Myelin and Transcriptional Regulation of the Myelin Basic Protein Gene

Home , Myelin regulatory factor

Hooman Bagheri

Department of Human Genetics McGill University Montreal, Quebec, Canada

July 2017

A thesis submitted to McGill University In partial fulfillment of the requirements for the degree of masters

ABSTRACT

Myelin basic protein (MBP) is expressed in oligodendrocytes (OL) and Schwann cells

(SC), the myelin producing cells of central and peripheral nervous system respectively. Myelin

basic protein (MBP) is necessary for myelin compaction in the central nervous system and its

absence in mice leads to an amyelinated phenotype. The mbp gene is located within the

overlapping golli transcriptional unit that is expressed not only in oligodendrocytes but also elsewhere including in some neurons and the immune system.

Previously, reporter genes incorporating highly conserved non-coding mbp upstream

sequences (Named M1-5) were investigated in-vivo or in-vitro and shown to drive reporter

expression in oligodendrocytes and/or Schwann cells. In addition, M3KO mice showed 40%

reduction in mbp expression in OLs but not in SCs. Here, to evaluate the role of these enhancers

in the context of the endogenous golli/mbp locus, M4 and M5, individually or in combination

with M3, were deleted using the CRISPR-Cas9 technique. The subsequent expression of both

mbp and golli were then assayed in each knock-out (KO) mouse line at post-natal day 30.

Deletion of M4 led to ~80% reduction in mbp expression in SCs but had no effect in OLs.

Conversely in M5KO and M3M5KO mice mbp expression in OLs was reduced by ~40% and

~75% respectively while sparing SC expression. Ablation of M4 or M5 had no effect on golli

expression in OLs or thymus cells leaving the previously reported M3 as the sole golli enhancer

so far identified.

Preliminary light microscopy analysis of cervical spinal cord sections from 2-week old

M5KO mice suggests a modest reduction in myelin thickness while M3M5KO mice show

obviously thinner myelin sheaths; an observation correlating with their lower levels of mbp and

golli mRNA accumulation.

This investigation demonstrated that each of the three investigated enhancers contribute only partially to the expression of mbp and golli pointing to the existence of other yet to be

discovered enhancers that cooperate with the currently known ones to achieve the full expression

spectrum of these two genes. Ultimately, these findings provide new insights into the enhancer

scheme and transcriptional regulation of mbp and golli in OLs, SCs and thymus.

RÉSUMÉ

Le gène encodant pour la protéine MBP (Myelin Basic Protein) est exprimé au niveau des oligodendrocytes (OLs) et des cellules de Schwann (SCs), deux populations cellulaires qui produisent de la myéline au niveau du système nerveux central et périphérique. Les protéines

MBP sont impliquées dans la compaction de la myéline au niveau du système nerveux central et une absence de celles-ci chez la souris entraîne un phénotype du type amyéliné. Le gène mbp chevauche l’unité transcriptionnelle du gène golli qui est exprimé non seulement au niveau des

OLs, mais aussi au niveau de certains neurones et certaines cellules immunitaires.

Les capacités régulatrices de séquences non-codantes, hautement conservées et situées en amont du gène mbp (nommée M1-5) ont été précédemment investiguées in-vivo ou in-vitro. Ces

dernières ont démontré un potentiel régulateur au niveau des OLs et des SCs. Par ailleurs, les

souris M3KO démontrent 40% de réduction d’expression du gène mbp au niveau des OLs alors

que l’expression de ce dernier au niveau des SCs demeure inchangée. Dans ce travail, nous

avons évalué le rôle des séquences régulatrices M4 et M5 individuellement ou en combinaison

avec la séquence M3 au niveau du locus golli/mbp en délétant ces dernières avec la technologie

CRISPR-Cas9. Les niveaux d’expressions de mbp et golli furent évalués dans chaque lignées de

souris knockout générées à 30 jours après leur naissance. La délétion de la région régulatrice M4

a entraîné une réduction de 80% du niveau d’expression de mbp dans les SCs, sans affecter le

niveau d’expression de ce gène dans les OLs. Chez les souris M5KO et M3M5KO, le niveau

d’expression de mbp au niveau des OLs a été réduit d’environ 40% et 75% respectivement, alors

que le niveau d’expression au niveau des SCs est demeuré inchangé. La délétion des séquences

M4 ou M5 n’a eu aucun effet sur l’expression de golli au niveau des OLs ou des cellules du

thymus, suggérant que la séquence M3 est la seule impliquée dans la régulation de golli jusqu’à ce jour.

Des résultats préliminaires obtenus par microscopie à champ clair sur des sections de moelles épinières cervicales provenant de souris M5KO âgées de deux semaines suggèrent une modeste réduction de l’épaisseur de la gaine de myéline, alors que les souris M3M5KO démontrent une robuste réduction de celles-ci. Ces observations corrèlent avec le niveau d’expression plus faible de mbp et golli au niveau de l’ARN messager.

Cette enquête a démontré que chacun des trois séquences régulatrices étudiées ne

contribuent que partiellement à l'expression de mbp et golli. Cela suggère l'existence d'autres

séquences régulatrices non encore découvertes qui coopèrent avec ceux qui sont actuellement

connues pour atteindre le spectre d'expression de ces deux gènes. Finalement, ces résultats

démontrent de nouvelles perspectives au niveau de la distribution des séquences régulatrices

impliquées dans la régulation transcriptionnelle des gènes mbp et golli au niveau des cellules

OLs, SCs et du thymus.

TABLE OF CONTENTS

ABSTRACT………………………….………………………….………………………………..2

RÉSUMÉ…………….………………………….………………………………………………..4

ACKNOWLEDGMENTS……………..………….……………………………………………10

LIST OF FIGURES ……….………………………………….……………………………..…11

LIST OF ABBREVIATIONS………….………………………….…………………………...12

PREFACE AND CONTRIBUTIONS OF AUTHORS….……………………………………16

INTRODUCTION………………………….………………………….……………………….17

Myelin…………………………………………………………………………………....17

Golli/mbp locus/expression/function……………………………………………………18

Transcriptional regulation of mbp……………………………………………………...23

M1 and M2………………………………………………………………………………23

M3………………………………………………………………………………………..23

M5………………………………………………………………………………………..24

M4………………………………………………………………………………………..24

Enhancer and transcriptional regulation………………………………………...... 25

eRNA……………………………………………………………………………………..29

OL development and TF network…………………………………………………….…29

SC development and TF network……………………………………………………….34

Hypothesis and objectives……………………………………………………………….36

MATERIAL AND METHODS………………………………………………………….…….37

Animals…………………………………………………………………………………..37

M4 and M5 sequences…………………………………………………………………..37

CRISPR and gene editing……………………………………………………………….37

CRISPR design…………………………………………………………………………..38

sgRNA generation……………………………………………………………………….38

Zygote manipulation, delivery of CRISPR components and transplantation into

pseudopregnant mice……………………………………………………………………39

Genotyping and breeding scheme……………………………………………………….40

Tissue sample collection………………………………………………………………...40

RNA extraction and qRT-PCR………………………………………………………….41

Data analysis…………………………………………………………………………….42

Epon sample processing and light microscopy…………………………………………42

RESULTS………………………….………………………….……………………………..….43

KO mice generation…………………………………………………………………..…43

qPCR troubleshooting…………………………………………………………………...45

M4KO Consequence on mbp and golli accumulation in SN, cervical spinal cord and

Thymus…………………………………………………………………………………..49

M5KO Consequence on mbp and golli accumulation in SN, cervical spinal cord and

Thymus…………………………………………………………………………………..54

M3M5KO Consequence on mbp and golli accumulation in SN, cervical spinal cord

and Thymus……………………………………………………………………………...54

Myelin phenotype in cervical spinal cord……………………………………………….55

Enhancer KO consequence on myelin elaboration in the PNS………………………..59

Optic nerve cell count…………………………………………………………………...61

DISCUSSION……………………….………………………….…………………………….…63

mbp expression in the PNS……………………………………………………………...63

mbp expression in the CNS……………………………………………………………...64

Enhancer additivity in mbp expression…………………………………………………65

golli expression in the CNS and thymus………………………………………………..65

Enhancer-promoter interactions………………………………………………………..66

mRNA splicing…………………………………………………………………………..67

Behavioural and myelin phenotype……………………………………………….…….68

FUTURE DIRECTIONS………………….………………………….………………………...72

BIBLIOGRAPHY………………………….………………………….………………………..74

ACKNOWLEDGMENTS

I would like to first thank Dr. Alan C. Peterson for accepting me as a graduate student in his lab and for his supervision over the past few years. Thank you for allowing me to conduct my project with a great deal of freedom and always being open to listen, ready to provide advice and carry out insightful discussions. I also would like to thank you for allowing me to work on multiple projects and guiding me throughout my entire graduate program and preparation of my thesis. It has been a great learning experience working in this lab. I also would like to thank Dr.

Hana Friedman for her extensive assistance during the course of my graduate program. Thank you for providing me with new ideas and directions on every aspect of my project and thesis preparation. I also thank Dr. Harry Shao for his assistance in the experimental part of my investigation. I would also like to thank my supervisory committee members, Dr. Timothy

Kennedy, Dr. Xiang-Jiao Yang and Dr. Yojiro Yamanaka for accepting to be part of my supervisory committee and for providing insightful comments on my project along the way. I also would like to thank Jean-Francois Schmouth for his help in translating the abstract.

LIST OF FIGURES

Figure 1. golli/mbp locus……………………………………………………………………..…20

Figure 2. M5 Genomic region…………………………………………………………………...44

Figure 3. mbp measurement in serial dilutions of spinal cord cDNA……………………………46

Figure 4. golli primer test…………………………………………………………………...……48

Figure 5. Comparison of mbp accumulation in sciatic nerves of WT, M4KO, M3KO, M5KO and

M3M5KO P30 mice……………………………………………………………………..50

Figure 6. Comparison of mbp accumulation in cervical spinal cords of WT, M4KO, M3KO,

M5KO and M3M5KO P30 mice…………………………………………………………51

Figure 7. Comparison of golli accumulation in cervical spinal cords of WT, M4KO, M5KO,

M3KO and M3M5KO P30 mice…………………………………………………………52

Figure 8. Comparison of golli accumulation in thymi of WT, M4KO, M5KO, M3KO and

M3M5KO P30 mice……………………………………………………………………...53

Figure 9. Ventral-medial cervical spinal cord of WT P12 mice under light microscopy………..56

Figure 10. Ventral-medial cervical spinal cord of M5KO P13 mice under light microscopy…...57

Figure 11. Ventral-medial cervical spinal cord of M3M5KO P13 mice under light

microscopy……………………………………………………………………………….58

Figure 12. Ventral spinal root of (A) a P12 WT mouse, (B) a P13 M5KO and (C) a P13

M3M5KO mouse under light microscopy……………………………………………….60

Figure 13. Modular organization of the endogenous golli/mbp cis-regulatory elements………..71

LIST OF ABBREVIATIONS

˚C Degree Celsius

Bhlh Basic helix loop helix

BMP Bone morphogenic protein

bp Base pair

BRE TFIIB recognition element

cDNA Complementary DNA

ChIP-Seq Chromatin immuneprecipitation sequencing

CNS Central nervous system

CO2 Carbon dioxide

COF Cofactor

CRISPR Clustered regularly interspaced short palindromic repeats

ddH2O Double-distilled water

DNA Deoxyribonucleic acid

DPE Downstream promoter elements

DRE DNA replicating elements

EDTA Ethylenediaminetetraacetic acid eRNA Enhancer-derived RNA

Fig Figure

FGF-2 Fibroblast growth factor 2

Golli Gene of oligodendrocyte lineage

H3K4me1 Histone H3 lysine 4 monomethylation

H3K27Ac Histone H3 lysine 4 acetylation

HDAC Histone deacetylases

HMG High-mobility group hsp Heat shock promoter hprt Hypoxanthine-guanine phosphoribosyltransferase

Inr Initiator

I-Smad Inhibitory Smad kb Kilobase

KDa Kilodaltons

KO Knock-out

KSOM Potassium supplemented simplex optimized medium

MBP Myelin basic protein

MEM Minimal essential medium mRNA Messenger RNA miRNA MicroRNA

MPZ Myelin protein zero

MTE Motif 10 element

Myrf Myelin gene regulatory factor

NaCl Sodium chloride

NCC Neural crest cells ng Nanogram

NHEJ Non-homologous end joining

OL Oligodendrocyte

Olig1/2 Oligodendrocyte lineage gene 1/2

ON Optic nerve

OPC Oligodendrocyte progenitor cell

P Post-natal day

PIC preinitiation complex pMN Motorneuron precursor

PNS Peripheral nervous system

RNAP II RNA polymerase II

PDGF-α Platelet-derived growth factor alpha

PPE Promoter proximal element

PTE Promoter tethering element

PTS Promoter-targeting sequence q-RTPCR Quantitative reverse transcription polymerase chain reaction

RISC miRNA-induced silencing complexes

RNA Ribonucleic acid

SC Schwann cell

SDS Sodium dodecyl sulfate sgRNA Single guide RNA

SHH Sonic hedgehog

Sip-1 Smad-interacting protein-1

SN Sciatic nerve

SVZ Subventricular zone

TAD Topologically associated domain

TF Transcription factor

TSA Trichostatin A ug Microgram ul Microliter um Micrometer uM Micromolar

V Volts

WT Wild-type

ZEN2 Zygote Electroporation of Nuclease 2

PREFACE AND CONTRIBUTIONS OF AUTHORS

Manuscript:

Hooman Bagheri: wrote the manuscript

Alan C. Peterson: provided editorial support

Hana Friedman: provided editorial support

Jean-Francois Schmouth: translated abstract

Experimental procedures:

Hooman Bagheri: Mouse colony organization and breeding scheme

Sample collection

q-RTPCR troubleshooting

Gene expression experiments and Data analysis

Generated figures

Alan C. Peterson: Performed embryo manipulations related to CRISPR gene editing

Sample collection and processing for light microscopy

Hana Friedman: Molecular biology aspects of the experiment

Light microscopy

Harry Shao: Sample collection

INTRODUCTION

Myelin

Action potentials initiate at the neuronal axon hillock and propagate along the axon.

There are two major ways to increase the velocity of action potentials: either by increasing axonal diameter or by insulating the axonal membrane. The latter was achieved during evolution by the invention of myelin [1]. The existence of a thick sheath around some axons in the peripheral nervous system was first reported by Remak and later named myelin by Virchow [2].

Myelin is formed of multiple layers of plasma membrane extending from glial cells and is composed of 70% lipid and 30% protein [3]. Myelin has been shown to have multiple functions: one is to confer saltatory conduction of action potentials hence boosting their speed without an increase in axonal diameter. Saltatory conduction also allows a reduction in the energy cost of neuronal activity by limiting the necessity for re-establishing membrane potentials to the gaps between adjacent myelin sheaths, called nodes of Ranvier [4]. Myelin ensheathment also results in major changes to the axonal cytoskeleton that in turn, influence overall axon calibres [5,6].

Lastly, it was shown recently that myelin-producing cells support axon integrity by providing nutrients and metabolites [7-9].

It is believed that myelin evolved multiple times in different taxa of bilateria such as

Earthworms from Lophotrochozoa, Megacalanoid copepods and Decapod shrimps from

Ecdysozoa, and Gnathostome vertebrates from Deuterostomia [10-12]. In vertebrates, myelin first appeared in placoderms probably simultaneously in the central and peripheral nervous systems (CNS and PNS), concomitant with the appearance of a hinged jaw [13]. It is produced by two distinct cell types, oligodendrocytes in the CNS and Schwann cells in the PNS.

Even though the function of myelin is conserved in the CNS and PNS, myelin protein constituents and the cells that produce it demonstrate considerable differences. In mice, myelin formation in the PNS begins perinatally. In contrast, myelin initiation in the CNS is highly heterochronic initiating around birth in the ventral cervical spinal cord and extending dorsally and caudally over the next week. In the optic nerve (ON), myelin starts to appear around postnatal day 6 (P6) and in more rostral parts of the brain, myelination is further delayed [14].

Elaboration of myelin coincides with the rapid upregulation of several genes encoding myelin protein constituents (here referred to as “myelin genes”) suggesting a shared regulatory network

[15]. As the major period of myelin deposition ceases (around P14 in PNS and P18 in CNS), the expression of myelin genes drops to approximately half peak levels that are maintained throughout the life of the animal (myelin maintenance period) [14]. Occasionally myelin ensheathing the axons of central and peripheral nerves can be damaged. In response to myelin loss in the CNS, NG2+ precursor cells proliferate, migrate, differentiate and initiate production of new myelin sheaths [16,17]. Following myelin damage in the PNS, SCs undergo dedifferentiation, proliferate and reinitiate myelin synthesis [18,19]. These repair processes are referred to as remyelination and are of importance in numerous demyelinating diseases including

Multiple Sclerosis [20].

Golli/mbp locus/expression/function

One of the major protein constituents of myelin in both the CNS and PNS is myelin basic protein (MBP). MBP is an intrinsically unstructured protein with high positive net charge that regulates actin disassembly during myelin sheath wrapping and is essential for myelin compaction in the CNS [21,22]. Interestingly, the promoter of the mbp gene is located within the translated exon 4 of an overlapping transcriptional unit called gene of oligodendrocyte lineage

(golli) (Fig. 1). In rodents, the golli/mbp locus spans over 100 kb, contains 10 exons and produces two families of transcripts that initiate from two different transcriptional start sites

(https://www.ncbi.nlm.nih.gov/gene/17196).

Figure 1. golli/mbp locus with the transcripts initiating from their promoters in mice shown on

top taken from UCSC Genome Browser. Below is the magnified image of 5’ upstream sequence

of mbp promoter showing the position and phylogenetic conservation of each of the enhancers

(M1-5).

The mbp gene contains 7 exons that in mice produce six transcripts by alternative splicing: isoform 1 (contains all 7 exons and encodes a 21.5KDa protein), isoform 2 (lacks exon

5, 20.2KDa), isoform 3 (lacks exon 2, 18.5KDa), isoform 4 (lacks exons 2 and 5, 17.24KDa), isoform 5 (lacks exon 6, 17.22kDa), isoform 6 (lacks exons 2 and 6, 14KDa) [23]. All of the isoforms contain a 21 nucleotide RNA-trafficking signal at their 3’ UTR that is bound by hnRNP

A2 that mediates their transport and local translation at the distal processes of OLs [24]. Four major protein isoforms of mbp are shared between rodents (21.5KDa, 18.5KDa, 17.22KDa and

14KDa) and were shown to be expressed differentially during development with 21.5KDa and

18.5KDa isoforms being expressed during early myelination while the expression of the 14KDa

isoform increases during development and becomes the most dominant MBP isoform in mature

myelin where it localizes to the sub-membrane domain [23,25]. Interestingly, the molecular ratio

of 21.5KDa to 18.5KDa is similar to the ratio of 17.22KDa to 14KDa throughout development

suggesting the same regulatory factors are controlling their relative ratios [23]. In addition,

multiple experiments have shown that exon2-containing isoforms (21.5KDa and 17.22KDa) are

found in the cytoplasm and nucleus of developing OLs while exon2-lacking isoforms (18.5KDa

and 14KDa) are confined to the sub-plasma membrane domain [25-27].

A total lack of MBP leads to the absence of compact myelin in the CNS while the PNS is

largely spared. This is observed in “shiverer” mutant mice that bear a large deletion removing the

exons downstream of mbp intron 1 while sparing the 3 upstream exons unique to golli [28-32].

Shiverer mice show hindquarter tremors as early as 12 days after birth, convulsions after P60 and

have a lifespan of less than 5 months (Wolf 1985). In an elegant experiment, Hood and

colleagues produced transgenic mice with varying amounts of mbp and showed that having only

25% of the wild-type level is sufficient to correct the “shiverer” behavioural phenotype [33].

Moreover, 50% of wild type (WT) mbp levels supports development of myelin with normal thickness, as observed in heterozygous shiverer mice (shi/+) and expressing a single isoform of

MBP is sufficient to rescue the shivering phenotype [34-36]. Loss of mbp in the PNS leads to only minor morphological myelin abnormalities and modestly thinner myelin sheaths with an increased number of Schmidt-Lanterman incisures [30-32,37].

Golli, the other transcript family produced from this locus, has 3 additional exons located upstream of the mbp promoter which in mice are alternatively spliced into 3 major isoforms:

BG21 (21KDa), J37 (27.1KDa) and TP8 (7.5KDa) [38]. While mbp is expressed in both OLs and

SCs, golli, in addition to OLs, is expressed in multiple neuronal populations in both the CNS and

PNS and in the thymus [39]. Interestingly, the splicing of BG21 and J37 isoforms occurs in frame with mbp exons resulting in a protein with N-terminal golli sequence and C-terminal mbp sequences. However, the TP8 transcript is spliced with a frame shift at the transition between golli and mbp exons producing a distinct Golli protein [40].

In the CNS, the expression of golli is developmentally regulated and declines with age: the expression of BG21, the major golli isoform, initiates as early as embryonic day 11 and remains high throughout early postnatal development while J37 and TP8 initiate expression at slightly later ages and maintain it during the postnatal period [38,40,41]. Similarly, in the immune system, BG21 is the major golli transcript expressed in macrophages and thymocytes

[38,40-43]. Golli is thought to be an adapter protein and depending on its interacting partner, is involved in negative or positive modulation of Ca2+ influx that occurs through storage-operated and voltage-operated Ca2+ channels [42,44-48]. Mice lacking golli show delayed myelination, generalized hypomyelination and curiously, severely disrupted myelin formation limited to the

ON and visual cortex that persists into adulthood [45].

Transcriptional regulation of mbp

In order to map the cis-regulatory domains controlling the expression of mbp, Peterson and colleagues ran an inter-species non-coding sequence comparison. Within the 9.5kb upstream of the mbp promoter, they found four widely separated conserved modules named M1-4 based

on their relative distance from the mbp promoter that demonstrated regulatory function (Fig. 1).

When inserted in a single copy at the hprt locus, reporter constructs bearing all of these modules

were able to recapitulate the general expression program of the mbp gene in both the CNS and

PNS [49,50]. To understand the regulatory capacity of each of these modules and also potential

interactions amongst them, they were investigated in extensive developmental reporter

expression studies.

M1 and M2

Constructs containing different lengths of mbp proximal promoter sequence were

investigated; no OL or SC activity was observed when 300 bp or shorter sequences of proximal

promoter were used, however when the proximal promoter sequence was extended to -377 bp

(named M1) it drove reporter expression during primary myelination in OLs. A construct further

extended to -794 bp and thus including M2, increased the level and duration of reporter

expression in OLs; however, its activity was also restricted to early stages of myelination [50].

M3, a 471bp sequence located approximately 5kb upstream of the transcription start site,

was sufficient to drive reporter expression in OLs throughout development and maturity and also

during remyelination when attached to the proximal promoter of mbp (M1) or a minimal hsp

heterologous promoter [50,51]. Interestingly, M3 also showed robust albeit transient activity in

SCs during both primary myelination and remyelination. However this activity was cryptic as it

was observed only when M3 was appended to an hsp minimal promoter and not the endogenous proximal promoter of mbp. This observation is a particularly clear demonstration of a lineage restriction of enhancer activity imposed by a proximal promoter. Beyond observations made with reporter genes, analysis of mice in which M3 was knocked-out of the endogenous golli/mbp

locus showed a 40% reduction in mbp accumulation in OLs. However these mice were still able

to initiate remyelination in response to demyelination carried out by cuprizone treatment.

Moreover, the deletion of M3 had an even more profound effect on golli expression both in OLs

and in the thymus where mRNA levels were reduced by 80% or more [49]. Thus, in M3KO

mice, both the residual mbp expression and the ability to remyelinate define the existence of

additional OL enhancers acting on the mbp gene.

Recently, a further region demonstrating only moderate interspecies conservation, located

approximately 16kb upstream of the mbp promoter (hereafter referred to as M5), was reported to

show enhancer activity in transfected rat OLs in culture. Using ChIP-Seq analysis this upstream

module was also shown to contain a binding peak for Myelin Regulatory Factor (MYRF), a

transcription factor thought to be required for OL differentiation and myelination [52].

Therefore, M5 became a promising candidate to account for the residual expression of mbp in the

OLs of M3KO mice.

M4, another evolutionary conserved module located approximately 9kb upstream of the

mbp promoter robustly activated reporter expression in SCs during the full spectrum of

development while a construct terminating at -9.5kb but deleted of M4 (9.5kbΔM4) showed no

SC activity [49]. This observation suggests that M4 is the only functional SC enhancer in the

mbp 9.5kb upstream sequence. However, whether M4 functions in the same way in the context of the endogenous locus or is the only active mbp SC enhancer remained to be demonstrated.

Since the deletion of M3 greatly affected the expression of golli in OLs and thymus, it was of interest to determine if deletion of the other recognized mbp enhancers from the endogenous golli/mbp locus would have similar impacts on golli expression.

To address these questions, lines of mice bearing knock outs (KOs) of enhancers, either individually or in combination, were derived and the accumulation of mbp and golli mRNAs analysed.

Enhancer and transcriptional regulation

Gene transcription is an initial step in the control of protein production. There are cis sequences that recruit a combination of transcription factors (TFs) and cofactors (COFs) to modulate the temporal and spatial level of gene expression, either positively in the case of enhancers or negatively in the case of silencers [53]. Upon binding of TFs to their short motifs on enhancer DNA, they recruit COFs such as the Mediator complex or the acetyltransferase

CBP/P300 to mediate the recruitment of RNA polymerase II (RNAP II) to the promoter leading to gene activation [54-56].

Enhancers can also have binding sites for repressors to modulate the level and/or tissue specificity expression of the genes or even become a repressor in another tissue [53,57,58].

Examples of this were seen in the M3 module. A 225bp derivative of this enhancer, (removing bps 188-471) ligated to an hsp minimal promoter drove expression of LacZ reporter to levels 5 and 50 fold higher than the full length 471bp M3 in OLs and SC respectively [51]. Therefore, the removal of bps 188-471 from M3 to create the 225bp sub-sequence deleted repressive elements for both SCs and OLs. Moreover, in the same study, two 4bp mutant variants of M3 also had

increased SC activity but had no effect on OL expression of the reporter suggesting the SC repressive specificity of these two DNA-binding sites.

There are two general models for enhancer recognition. One model is based on the cooperative interaction between multiple TFs [54]. In this model the binding and interaction of multiple TFs are required to activate the enhancer and importantly, no single TF is essential. TFs generally bind to 4-10 nucleotide motifs and simply by chance such short sequences would be found with a high frequency throughout the genome. The cooperation between specific sets of

TFs, requiring the juxta positioning of multiple short binding sequences, would bring about more specificity to the regulation of each gene through its enhancers or silencers. This cooperation can be at the level of DNA binding or after [54]. Inactive enhancers are wrapped around histone nucleosomes in a compact form [59]. In this configuration, individual TFs might not be able to compete with histones in their DNA-binding affinity to cause nucleosome displacement thus increasing DNA accessibility [60,61]. One possible TF cooperating mechanism to overcome this barrier is their binding to closely spaced motifs to mediate the displacement of nucleosomes and consequent opening of chromatin [62]. Such a mechanism is passive and relies only on the DNA binding affinity of individual TFs [63,64].

The cooperating mechanism proposed above can be further enhanced when TFs interact with one another to bind as homo or hetero dimers. These interactions rely on specific protein- protein compatibility and motif spacing and lead to more DNA-binding specificity and affinity

[65]. Further, the dimerization of TFs can change their original binding preference thus contributing to the complexity of gene regulation [66]. Moreover, the interaction between TFs can be far more complex than just forming simple dimers and may include multiple TFs and

COFs to form a stable multi-protein complex (known as enhanceosomes), an example of which

can be seen at the interferon-beta gene locus [67]. These two passive and active cooperative mechanisms are not mutually exclusive and examples of each can be found in different enhancers or even within a single enhancer. One related example of TF cooperation is shown by the cooperative binding of two Sox10 proteins to two motifs on opposite DNA strands separated by 4-9 bp that was necessary to confer enhancer activity [68,69]. It has also been suggested that enhancers capable of forming an enhanceosome are more evolutionary conserved and less flexible to sequence changes as a specific arrangement of TF binding sites is required for their functionality [67,70].

The second model is based on the effect of pioneer TFs which bind to closed chromatin and allow local loosening of DNA and subsequent binding of additional TFs that ultimately recruit chromatin remodelling and histone and DNA modifying factors to mark and activate enhancers [71]. An example of this strategy was shown during cell reprogramming in which

Oct4, Sox2 or Klf4 facilitate nucleosomal targeting of cMyc [72]. While binding of co-activator

CBP/P300 marks functional enhancers, epigenetic marks such as monomethylation of lysine 4 histone H3 (H3K4me1) and acetylation of lysine 27 histone H3 (H3K27Ac), signal active enhancers [73-76].

The next step after activation of enhancers is cross-talk with distantly located promoters to initiate transcription. There are multiple models to explain this interaction. In one, loading of

TFs and COFs to the enhancer mediates recruitment of RNAP II and associated transcriptional machinery which then track through the intervening enhancer-promoter DNA sequence [77].

Another model suggests that this interaction is mediated by chromatin looping and recruitment of cohesin complex to put the enhancers and promoters into close physical proximity [77,78]. This model has been proposed to have two variants: in one, the TFs and COFs at the enhancer and the

preinitiation complex (PIC) at the promoter form stable protein complexes while in the other all the factors transiently interact in a more dynamic fashion [54].

There is a higher order of regulation at the level of 3D chromatin structure that modulates enhancer-promoter interactions. Chromatin is organized into many topologically associated domains (TADs) spanning several kb or Mb within which the interactions of enhancers and core- promoters are more frequent [79]. TAD boundaries are bound by insulating factors such as

CTCF and they dictate the extent of distant promoters that enhancers can regulate. [80].

There are other elements that specify the interaction of each enhancer to its rightful promoter. One named promoter-proximal tethering element (PTE) was shown in Drosophila to mediate specific long-distance enhancer-promoter interactions [81]. Another named the promoter-targeting sequence (PTS), also discovered in Drosophila, can be located within or adjacent to enhancers where it dictates the compatibility of enhancer and promoter interplay [82].

Alternatively, promoter proximal elements (PPEs) are also implicated in cell-type specific expression, possibly by regulating the accessibility of core-promoter DNA sequences and are likely to have a targeting role [83].

Within the same TAD there can be multiple neighbouring genes that are differentially expressed and influenced by specific enhancers. This circumstance cannot be explained merely by the accessibility of their promoter DNA thus suggesting that differences in core-promoter sequences may be important for enhancer targeting [84]. In fact, core-promoter sequences are generally divided into two types: housekeeping and developmentally regulated promoters. Core- promoter motifs such as TATA-Box, TFIIB recognition element (BRE), Initiator (Inr), motif 10 element (MTE) and downstream promoter elements (DPE) are enriched in developmentally regulated promoters while DNA replicating elements (DREs), polypyrimidine initiator motif

(TCT) and Ohler motifs 1, 6, 7, and 8 are common to housekeeping promoters. These core- promoter elements are bound by different factors that in turn might recruit other distinct COFs, functioning in a context-dependent manner, an indication of these elements’ interplay on core- promoter specificity [85-88]. eRNA

Recently, advances in sequencing technology led to the identification of enhancer- derived RNAs (eRNAs) made by RNA polymerase II recruited to enhancers. These eRNAs could be due to transcriptional noise and stochastic recruitment of RNAP II, a circumstance compatible with the above two models of enhancer-promoter interactions. However, based on numerous lines of evidence, it is proposed that eRNAs can be grouped into three non-mutually exclusive functional classes. In class I eRNAs, the loading of RNAP II to the enhancer would increase the concentration of RNAP II at the promoter consequently promoting transcription. In class II eRNA, the tracking of RNAP II from the enhancer to the promoter would mediate chromatin remodeling [77]. The movement of RNAP II from the enhancer toward the promoter in the same or opposite direction of gene transcription can facilitate the loading of RNAP II to the promoter or interfere with the movement of RNAP II along the gene [77,89]. Class III eRNAs are proposed to function as transcriptional activators through multiple mechanisms such as: by acting as a scaffold to trap the TFs thus increasing their concentrations at the enhancers, by interacting with chromatin looping factors to mediate enhancer-promoter looping or by binding to RNA binding proteins to exert a trans-effect on gene expression [77].

OL development and TF network

OLs, the myelin producing glial cells of the CNS, originate from OL precursor cells

(OPCs). During embryonic development, patterning of the neural tube is established by

morphogens such as sonic hedgehog (SHH) and bone morphogenic protein (BMP) from floor

(ventral) and roof (dorsal) plates respectively [90]. Together these morphogens establish a

gradient that specifies multiple domains in the neural tube with the first OPCs generated from the

motorneuron precursor domain (pMN) of the ventral neuroepithelium [91]. During fetal

development, a second wave of oligodendrogenesis arises from the dorsal spinal cord and a third

wave occurs postnatally with an unclear origin but possibly from progenitors residing in the

subependyma or NG2+ precursor cells throughout the parenchyma [90,92-95]. In brain also,

three waves of oligodendrogenesis are observed with the first wave arising from the embryonic

medial ganglionic eminence and anterior entopeduncular area. The second wave originates from

the lateral and caudal ganglionic eminences and the final wave arises from the cortex after birth

[94]. In the adult brain OPCs are generated from the subventricular zone (SVZ) [96].

Even though OPCs arise from distinct domains in the CNS, no functional differences

related to their sites of origin have been reported. After OPC generation, these proliferative cells

migrate along the vasculature to developing white matter regions of the brain where they

differentiate into immature OLs and ultimately to fully mature myelinating OLs [97-99]. OPC

proliferation, migration, differentiation, myelination and also remyelination are all affected by a wide range of cues such as growth factors (e.g. platelet-derived growth factor alpha (PDGF-α) and Fibroblast growth factor 2 FGF-2), chemokines, adhesion molecules of extracellular matrix, neurotransmitters and even electrical cues [100,101]. Although OLs appear to be functionally homogenous, they are heterogeneous in regard to gene expression profiles. Single cell gene expression analysis revealed that OPCs of the mouse brain can be categorized into thirteen groups defining their progress along the path to becoming myelin-forming OLs. Subsequently, they can be divided into six clusters of mature OLs [102]. Altogether, the complexity of

oligodendrogenesis and myelination would favour the use of in-vivo models to investigate their components.

One of many extrinsic influences on the differentiation of OPCs to myelinating OLs is

Notch signaling. One of the effectors of the Notch signaling pathway, the Hes5 transcription factor, functions as a negative regulator of OPC differentiation [103,104].

So far, multiple TFs have been characterized to regulate OLs differentiation [104].

Oligodendrocyte lineage genes 1 and 2 (Olig 1/2), basic helix loop helix (bhlh) TFs, are expressed in the pMN domain of the spinal cord that generates motor neurons and OPCs. In KO experiments, it was demonstrated that Olig2 is required for specification of both lineages while

Olig1 and Olig2 are both required for development and differentiation of OLs [105,106]. Olig1 was also shown to be necessary for remyelination following demyelination induced by cuprizone administration or ethidium bromide injection into the brain of mice [107]. These lines of evidence suggest that Olig1/2 are required for OL development, myelination and remyelination.

Myelin gene regulatory factor (Myrf) is a transcription factor with a transmembrane domain that is localized to the endoplasmic reticulum membrane and undergoes autocleavage to release its DNA-binding domain. It is expressed only in differentiating OLs, initiating prior to major myelin genes expression; in mice lacking Myrf, the expression of myelin genes is severely reduced and myelin is missing [108,109]. In a lysolecithin-induced demyelination study, targeted deletion of Myrf from OPCs, did not affect their differentiation into pre-myelinating OLs.

However, it severely perturbed the expression of myelin genes and remyelination [110]. These lines of evidence suggest Myrf is required for myelination and remyelination by OLs.

Sox proteins are TFs generally characterized by having different high-mobility group domains (HMG) that allow them to bind the minor groove of DNA and cause DNA bending. The

Sox E class of these proteins, Sox8/9/10, is involved in OL development. During spinal cord

development, Sox9 is expressed in the pMN domain during the specification of OPCs and its

ablation leads to a severe but transient loss of OLs in early development [111]. Sox9 continues to

be expressed until terminal differentiation of OLs even though its function is redundant. Sox8

and Sox10, other members of the Sox E class of TFs, start to be expressed in specified OPCs and

their expression continues throughout OL development. Inferred from KO analysis, Sox10 has an

essential role in OL terminal differentiation and expression of myelin genes [112]. ChIP-Seq

analysis showed that Sox10 directly activates Myrf after which they physically cooperate to

orchestrate the expression of several myelin genes including mbp [113]. This observation is similar to what happens in SCs and will be discussed later. In the same experiment, Wegner and colleagues also tested the ability of Sox10 and Myrf to induce the expression of multiple reporter constructs in-vitro. Among these were two constructs from the mbp locus: one bearing 3kb of

sequence immediately upstream of the mbp promoter and the other a further upstream sequence

(here referred to as M5) shown to be bound by Myrf TF [52,113]. Transfection of Sox10 alone

was able to activate both reporter constructs while Myrf alone only had a subtle effect.

Interestingly, co-transfection of both Sox10 and Myrf led to the synergistic activation of the M5

construct but not the other [113]. These lines of evidence suggest important roles for Sox10 and

Myrf as master regulators of OL differentiation and myelin gene induction.

Zfp488 is a zinc finger TF expressed only in differentiated OLs that plays a repressive

role. In the presence of Olig2, Zfp488 induced OL differentiation while its knock-down led to

reduced expression of myelin genes [114]. In a cuprizone mediated demyelination study,

retrovirus-mediated overexpression of Zfp488 improved the remyelination recovery by inducing

differentiation of progenitor cells residing in the subventricular zone [115]. These lines of evidence suggest Zfp488 promotes myelination and remyelination by OLs.

Smad-interacting protein-1 (Sip1) is expressed at low levels in OPCs but is upregulated in differentiated OLs. In Sip-1 KO mice, proliferation of OPCs is unaffected while myelin production is severely disrupted. Sip-1 plays a dual function; both repressing inhibitors and activating OL differentiation factors. It represses factors that inhibit OL differentiation by antagonizing BMP-Smad downstream signaling and this repressive effect is partly due to the ability of Sip-1 to form a co-repressor complex with NuRD, a multi-protein ATP-dependant chromatin remodelling deacetylase complex [116]. Sip-1 inhibits the expression of BMP-Smad downstream differentiation inhibitory genes such as Id2, Id4, Hes1, Hes5 and BMPR1 as shown by ChIP analysis [116,117]. Sip-1 also was shown to promote OL differentiation by activating pro-differentiating factor Smad7, an inhibitory Smad (I-Smad) protein [116]. These lines of evidence suggest Sip1 is required for differentiation of OPCs into OLs.

There is increasing evidence supporting a role for chromatin remodeling enzymes such as

SWI/SNF, histone modifying factors such as histone deacetylases (HDACS), and also microRNAs (miRNAs) in the regulation of OL development [104,118-120]. Chromatin remodelling enzymes like SWI/SNF are enzymes that are able to displace nucleosomes using

ATP to allow the opening of chromatin. In ChIP analysis, it was revealed that Olig2, Sox10 and

NF-κB are capable of interacting with Smarca4/Brg1, an ATPase subunit of the SWI-SNF chromatin remodeling complex, and this interaction is required for activation of downstream myelin genes [104,121,122].

HDACs are histone-modifying enzymes that remove acetyl groups from histone tails and are implicated in deactivation and dormancy of genes. One of the first lines of evidence

supporting such function in OLs came from the observation that blocking HDACs in OPCs using

the inhibitor trichostatin A (TSA) prevented these cells from differentiating into OLs in-vitro

[123]. Later, Lu and colleagues using targeted deletion of HDAC1/2 in OLs, provided the first in-vivo evidence that these two enzymes are necessary for OL differentiation. Mice lacking both

HDAC1/2 show a severe myelin deficit and die around the second postnatal week [124].

MicroRNAs (miRNAs) are small non-coding RNAs that are processed by Drosha and

Dicer enzymes. They incorporate into miRNA-induced silencing complexes (RISCs) that

generally mediate mRNA degradation or inhibition of translation. Targeted deletions of Dicer in

OLs led to a myelin deficient phenotype suggesting the necessity of miRNAs in OL

differentiation and myelination [125,126]. Many miRNAs are functionally characterized to be

involved in this process and are upregulated prior to OL differentiation. Among them, miR-219

was shown to be involved in the proliferation arrest of OPCs by repressing the expression of

PDGFRα, Sox6, Hes5, FoxJ3, Elovl7 and ZFP238 proteins [125-127]. miR-338, which was

shown to be activated by Sox10, also represses Sox6, Sox9 and Hes5 to inhibit OL

differentiation [127,128]. miR-138 functions similarly while miR-23 targets Lamin B1 that is

important for OL development and myelination [125,126].

SC development and TF network

During neural tube closure, multipotent neural crest cells (NCCs) arise from the

neuroectoderm border to migrate and differentiate into a variety of different cell types ranging

from neurons and glia of the peripheral nervous system to melanocytes and to most of the

cephalic cartilage and bone [129]. SCs, the myelin producing glial of the PNS, are derived from

NCCs. SC precursors undergo multiple stages of maturation; first they differentiate into

immature SCs that are in contact with bundles of peripheral axons. Subsequently, some establish

a one to one relationship with large calibre axons to become pre-myelinating SCs before finally becoming fully mature myelinating cells. Others become non-myelinating SCs and enclose the smaller caliber axons to form Remak fibres [19,130].

Each stage of SC development is affected by external stimuli and is tightly regulated by a network of TFs. Sox10, one of the master regulators of SC development, starts to be expressed in

NCCs and is thought to be induced by another member of its family, Sox9 [131,132]. Sox10 is required for the formation of SC progenitors as was revealed in mice lacking this TF [133]. In addition, stage specific deletion of Sox10 in SCs demonstrated its necessity throughout SC development [133-135].

Sox2, a member of the Sox D class of HMG TFs, is required to hold SCs at an immature stage [136]. c-Jun and Notch signalling also appears to inhibit further differentiation of immature

SCs [137,138]. ChIP assays showed that Sox10 activates the POU domain TF Oct6 by binding to the SC specific enhancer located 10 kb downstream of its coding sequence and recruiting Brg1- containing BAF chromatin remodelling complexes and HDACs [139-141]. HDAC1/2 are critical for the myelination program of SCs and their ablation leads to a myelin deficient phenotype

[119,142].

Synergistic binding of Sox10 and Oct6 leads to the activation of another master regulator of the SC gene network, Krox20 (a zinc finger TF also known as Egr2), through its SC enhancer located 35 kb downstream of the gene [143,144]. Then Sox10 and Krox20 together promote differentiation of SCs into myelinating cells partly by activating the expression of major genes of peripheral myelin such as myelin protein zero (mpz) and mbp. This was revealed by co- occupancy and synergistic activation of myelin genes by Sox10 and Krox20 [145,146].

Hypothesis and objectives

The primary aim of this investigation was to characterize the in-vivo activity conferred by previously recognized mbp associated enhancers. This was accomplished by measuring the accumulated levels of both mbp and golli mRNA in the CNS, PNS and thymus of mice bearing

KOs of enhancers both individually and in combination. Subsequently, the consequence of the observed diminished mbp and golli mRNA accumulation on the capacity of OLs and SCs to elaborate myelin sheaths were evaluated.

Material and methods

Animals

All of the animal care and experiments were carried out in accordance with the guidelines of the Canadian Council on Animal Care and the McGill University Animal Care Committee.

M4 and M5 sequences

The 422bp M4 enhancer targeted here was described previously [147]. M5 refers to the target of the MYRF ChIP carried out in rat [52]. Using the UCSC browser, this sequence was aligned with the mouse genome (chr18:82,536,728-82,539,249 GRCm38/mm10).

CRISPR and gene editing

At the initiation of this investigation, the remarkably efficient CRISPR (Clustered regularly interspaced short palindromic repeats) strategy of gene editing had been discovered and protocols for editing mouse zygotes were being refined [148-152]. Of most relevance, the efficiency of inducing double strand breaks at targeted sequences was frequently > 80% making it practical to attempt direct editing in mouse zygotes without any selection prior to embryo transplant. In the simultaneous presence of an overlapping template, such breaks greatly stimulate the homology directed DNA repair pathway achieving precise edits in approximately

5% of transfected cells although the actual repair frequencies are highly dependent upon the specific site targeted. In the absence of repair templates, double strand breaks typically resolve by the non-homologous end-joining pathway and are frequently associated with deletions and/or insertions. For the purpose of generating enhancer KOs, single guide RNAs (sgRNAs) were designed to target sequences flanking the conserved enhancer domain such that double strand breaks would be simultaneously introduced at both sides of the enhancer. When repaired by non- homologous end-joining (NHEJ), the sequences extending distal to the enhancer often ligate

resulting in deletion of the intervening enhancer sequence. Such events are initially detected by

PCR genotyping using primers flanking the enhancer but distal to the sgRNA target sites. The

precise deletions present are subsequently characterized by sequencing such diagnostic

amplicons.

CRISPR design

To delete M4 and M5 enhancer sequences of mbp, we targeted the ends of the sequence

to be deleted and relied upon NHEJ. sgRNAs were designed (using the CRISPR Design tool,

http://crispr.mit.edu/ (Zhang Lab, MIT 2015)) to identify locus specific targets. However, not all

targets are equally accessed by CRISPR and to minimize the impact of inefficient sgRNAs, we

designed 2 that bind in close proximity (for a total of 4 sgRNAs per enhancer deletion). The

sgRNA target sequences used to generate the KO mice are indicated in the table below. For the

M5 and M4 deletions, all sgRNAs were apparently effective.

5’ target M4 + strand CTCAGGCTGGCCAAGTATGT 5’ target M4 - strand TCCCAGCCTACCCACATACT 3’ target M4 - strand AACCACTTGACCTACTTGAG 3’ target M4 + strand TGCCTCTCAAGTAGGTCAAG 5’ target M5 + strand AGCATTCCACTAATTGTC 5’ target M5 + strand ATACCAACAGTCAAGAAC 3’ target M5 - strand CTTTGCAGGGTTCTCTAA 3’ target M5 + strand TGTCTGCTCTATACTCTC 5’ large M5' - strand CCGATCTCATGAGAAACGTC 5’ large M5' + strand CACGTAATCTAAAGTATGTT 3’ large M5' + strand GCATTCATTGTACATGGCTC 3’ large M5' + strand CCTCATTCCCTCCTGGGTTT

sgRNA generation

The plasmid DR274 was a gift from Keith Joung (Addgene plasmid # 42250) [87].

DR274 was digested with BsaI which cuts twice between the T7 promoter and the gRNA

scaffold, leaving sticky ends. For each of the targets listed above, two oligos, one for each strand,

were ordered from IDT. They were annealed at 40uM each in NEB3 buffer. Each has one of the

DR274 sticky ends so that they could be ligated into the plasmid using the NEB sticky end mix.

Each ligation mix was transformed into competent bacteria and kanamycin resistant clones

obtained. 3 clones of each were sequenced in the relevant region and used to generate the

sgRNA. The MEGA shortscript T7 kit from Life Technologies was used to synthesize the

sgRNA from the T7 promoter. The resulting sgRNA was tested on a Bioanlyzer at the McGill

Genome Center.

Zygote manipulation, delivery of CRISPR components and transplantation into pseudopregnant

mice

Zygotes were recovered mid-day from the oviduct of WT or M3KO C57Bl/6 mice [49]

naturally mated to wmN2 transgenic mice [153]. The cumulus cells were removed by a short

incubation in 1% hyaluronidase/M2 medium (Millipore) and moved into advanced KSOM media

(Millipore) at 37℃ with 5% CO2. Prior to electroporation the zygotes were moved to Opti-MEM

(Life Technologies) and thinning of the zona was achieved by treating the zygotes with Acid

Tyrode’s solution (Millipore) for 10 seconds and transferring them back into fresh Opti-MEM.

Zygotes were electroporated according to the ZEN2 protocol described by Wang et al., (2016) with a final concentration of 250ng/ul Cas9 mRNA (purchased from PNA Bio) and 300ng/ul sgRNA dissolved in TE pH7.5/Opti-MEM at a 1:1 ratio [154]. A 20ul drop of this mix containing the CRISPR reagents was prepared and the batch of 30-50 zygotes carried in less than

1ul of Opti-MEM were moved into this drop. The mix was transferred to a 1 mm electroporation cuvette purchased from BioRad and electroporation was carried out using a Bio-Rad Gene Pulser

Xcell electroporator. Embryos were subjected to 1-2 pulses of 25-30 V according to the ZEN2

protocol [154]. After transfection they were cultured overnight in advanced KSOM media at

37℃ with 5% CO2. All zygote manipulation was done at room temperature and the media was kept under mineral oil. After overnight incubation, embryos at the 2-cell stage were then transplanted (bilaterally, approximately 15/mouse) into the fallopian tubes of CD1 female recipients rendered pseudopregnant by mating with B6C3F1 vasectomized males (purchased from Charles River).

Genotyping and breeding scheme

Pups were tail-biopsied at weaning for genotyping. Tail samples were digested at 55C

overnight in lysis buffer (containing 100 mM Tris, pH 8.0, 5 mM EDTA, pH8.0, 200 mM NaCl,

0.2% sodium dodecyl sulfate (SDS) and 100ug/ul proteinase K) and genomic DNA was

extracted. Genotyping initially was done using PCR with primers surrounding the sequence to be

deleted. Upon detection of a desired, shorter-than-WT, band, the PCR product was sequenced at

the McGill University and Génome Québec Innovation Centre and the existence of M4 and M5

deletions confirmed. Founder mice were mated to WT C57Bl/6 and the consequent progeny were

genotyped by PCR for the deletion and LacZ (to detect the presence of a transgene at the HPRT

locus, that exists within our donor colony and select against it). Mice carrying the enhancer

deletion were mated to homozygosity while breeding out the transgene located on the X

chromosome. In total 2 lines of M4KO mice (identical sequencing results) and 3 lines of M5KO

(bearing different deletion lengths) and a line of M3M5KO, double KOs, were established.

Tissue sample collection

After the homozygous lines of mice were established, samples from males and females of

WT, M4KO, M3KO, M5KO and M3M5KO lines were taken at P30. The mice were anesthetized

with a lethal dosage of Avertin, and sciatic nerve (SN), cervical spinal cord and thymus samples

were collected into RNAlater solution (Ambion) according to the manufacturer’s instructions and stored at -20℃.

RNA extraction and qRT-PCR

Total RNA extraction was done using Trizol (Life Technologies) and a Qiagen RNeasy

MinElute Cleanup kit. RNA was eluted in nuclease free water and its concentration was measured using a spectrophotometer. The RT reaction was carried out using Superscript IV

VILO Mastermix (Life Technologies) using 1ug of total RNA according to the manufacturer’s instructions and the resulting cDNA was stored at -80℃. A QuantStudio™ 7 Flex Real-Time

PCR System (Life technologies) was used for qPCR in a 96-well plate. On the day of qPCR, the cDNA was diluted 20x and 40x for measuring golli and 100x and 400x for measuring mbp and gapdh. Each sample was measured twice at the low dilution and once at the high dilution.

Samples from WT, M4KO, M5KO, M3KO, M3M5KO mice were measured on a single 96-well plate to avoid inter-plate variability. To measure mbp and gapdh in SN and cervical spinal cord,

Taqman probes (mbp: Mm01266402_m1, gapdh: Mm99999915_g1, Life technologies) were used. For golli measurements in cervical spinal cord and thymus however, the SYBR green method was used (PowerUp SYBR green master mix, Life Technologies). Multiple primer sets were designed, tested and the optimal pair (2F: 5’ATTGGGTCGCCATGGGAAAC, 2B:

5’CCAGCCTCTCCTCGGTGAAT) was chosen. On each plate, 5 10-fold serial dilutions of a

DNA standard were run in triplicate to generate a standard curve. Standards were prepared by amplifying a sequence larger than the measured amplicon. After standard PCR, the single band was purified from a gel with a NucleoSpin Gel and PCR cleanup kit (Macherey-Nagel) and its concentration determined. The efficiencies of reactions for both Taqman and SYBR green methods inferred from standard curves were 95-105%.

Data analysis

After the generation of data, the measurements of each sample from both dilutions were averaged. Relative amounts of mbp and golli were calculated by dividing the average of each by the average of gapdh for the same sample. The relative mbp and golli measurements of all samples of each mouse line were averaged and the standard deviation was calculated and normalized to measured WT levels.

Epon sample processing and light microscopy

Mice lethally anesthetized with Avertin, were transcardially perfused with 2.5% glutaraldehyde + 0.5% paraformaldehyde in 0.1M sodium cacodylate buffer and cervical spinal cord and ON samples were collected. Samples were postfixed overnight at 4˚C followed by rinsing with 0.1M sodium cacodylate buffer. A second post fixation was done with 1% osmium tetroxide followed by rinsing with ddH2O. Samples were dehydrated by incubation in increasing concentrations of acetone: 30%, 50%, 70%, 80%. 90% and 3X100%. Infiltration was done with

1:1, 2:1, 3:1 (epon:acetone) followed by embedding in epon and overnight polymerization at

60˚C. 0.5 um sections were stained with Toluidine blue and cover slips were mounted with epon for imaging. Slides were imaged with 63X or 100X oil immersion objectives by light microscopy

(Zeiss Axio Imager M1).

RESULTS

KO mice generation

In previous reporter gene expression studies, M3 and M4 showed in-vivo enhancer activity [50,51,147]. M4 drove expression uniquely in Schwann cells at all ages. M3 drove expression in oligodendrocytes at all ages and transiently in Schwann cells when detached from the M1 proximal promoter. In addition, the deletion of M3 from the endogenous locus decreased the expression of mbp in OLs by 40% while it led to an over 80% reduction in golli expression in

OLs and thymus [49]. Evidence of M5 as a functional enhancer came from an in-vitro study

[49,52]. Here, to investigate the function of these regulatory modules in their endogenous context, we took advantage of CRISPR to generate KO lines of mice. To generate M4KO mice, we used four sgRNAs, two to target each end of the M4 enhancer sequence leading to its excision. For M5KO mice, since the initial reported sequence was in rats, we aligned rat and mouse sequences and designed 4 sets of sgRNAs to generate a short (829bp) and a long (3.27kb) deletion (Fig. 2). In order to simultaneously target both WT and M3KO alleles and generate short M5KO and M3M5KO mice we used heterozygous M3KO zygotes for the introduction of the short M5 deletion. Of 42 offspring derived from zygotes transfected with sgRNAs targeting either M4 or M5, 9 (21%) were either homozygous or heterozygous for the appropriate deletion.

Of these, 2 M4KO founders had the same identical sequence deleted and similarly the founders of M5KOshort and M3M5KO also had the same deletion of M5 sequence on both alleles as inferred by PCR genotyping and Sanger sequencing. To evaluate the contribution of M4 and M5 to the expression of both the mbp and golli, we analyzed the mRNA accumulation in sciatic nerve (mbp), cervical spinal cord (mbp and golli) and thymus (golli) samples from M4KO,

M5KOlong and M3M5KO mice (3 females and 3 males) at P30.

Figure 2. M5 Genomic region. The short (green) and long (red) M5 deletions are shown as well as the cut sites of the sgRNAs used in generating them. The MYRF ChIP peak, converted from the rat sequence (UCSC Genom Browser) and the sequence driving expression in vitro, again converted from rat, are shown.

qPCR troubleshooting

Our initial efforts at quantitation of mbp, golli, actin mRNAs in tissue samples using RT and qPCR were problematic. Measurement of dilutions of cDNA did not result in the expected reduction in qPCR values (Fig. 3). For concentrated samples this could have been due to inhibition coming from the cDNA sample. But for extensive serial dilutions of cDNA this was unlikely. It was more likely due to an inefficient PCR reaction. So, we had to optimize the PCR reactions.

Nonlinear mbp quantitation in serial cDNA dilutions 180

160

140

120

100

mbp cDNA 60

0 0.0000 0.2000 0.4000 0.6000 0.8000 1.0000 1.2000 cDNA amount

Figure 3. mbp measurement in serial dilutions of spinal cord cDNA. In this experiment, the cDNA was inhibitory in the samples with the highest concentrations but using greater dilutions, we were then able to obtain measurements in the linear range.

First, new primers were designed for each of the 3 genes. With new primers and new standards to encompass them, SYBR Green qPCR was still problematic. Testing serial dilutions of the cDNA indicated that there was inhibition because the PCR efficiency was 150-200% (Fig.

3). A PCR efficiency greater than 100% indicates that sample dilutions are giving higher measurements than their dilution would predict, thus suggesting inhibition in the more concentrated samples. Greater dilutions of cDNA proved to give more linear quantitation and we continued with these. In addition, adding carrier RNA to the standards and performing dilutions in Axygen “Maxymum recovery” nonstick tubes improved the efficiency of standards, bringing efficiencies closer to 100%.

In order to maximize our chances of resolving the problem, we also tried the Taqman probe approach. We moved to using gapdh as a standard because the actin probes amplified genomic DNA and seemed to be problematic. The use of Taqman probes increased sensitivity for mbp and gapdh and allowed us to dilute the cDNA samples thus minimizing inhibition coming from the cDNAs. There was no appropriate Taqman probe for golli transcripts but a new pair of primers and new standards were effective with the appropriate cDNA dilutions (Fig. 4).

golli Primer test 31.000

30.000

29.000 Pair 1

28.000 Pair 2a Ct Pair 2b

27.000 Pair 3 Pair 4

26.000

25.000 0.000 2.000 4.000 6.000 8.000 10.000 12.000 cDNA

Figure 4. golli Primer test: Spinal cord cDNA was serially diluted 4 times and tested in duplicate with 5 sets of golli primers. In this experiment, it was clear that pair 2b gave the lowest Ct scores for all dilutions. While none of these pairs gave linear values between the two highest cDNA concentrations, primer pair 2b enabled sufficient dilution of the cDNAs to gain high PCR efficiency and linear values.

For each tissue type and each gene, we assessed the cDNA dilution range that gave a

PCR efficiency near 100%. This was done by preparing many 4-fold serial dilutions of a cDNA, labeling them as standards so that the program would prepare a standard curve and determining which of the dilutions remain in the linear range. In this way, we were able to test all of the samples in their linear range. For golli, which is expressed at a much lower level than mbp or gapdh, cDNAs were diluted 20x and 40x while for mbp and gapdh, optimal dilutions were 100x

and 400x.

M4KO consequence on mbp and golli accumulation in SN, cervical spinal cord and Thymus

Previously in reporter expression studies, autonomous SC enhancer activity of the M4

module was confirmed when ligated to either hsp or the mbp promoter (M1) and a LacZ reporter

[147,155]. In addition, transgenic mice bearing 9.5kb of mbp upstream sequence including the

promoter express the reporter in SCs. However, when this sequence was deleted of M4, it was

unable to drive reporter expression in SCs [49]. To investigate the contribution of M4 to the

expression of mbp in the endogenous locus, we derived mice having an M4 deletion using the

CRISPR technique. To evaluate mbp gene expression in these mice, we analysed SN and SC

samples of homozygous M4KO P30 mice using qRT-PCR. The result showed that the deletion

of M4 led to ~80% reduction in accumulated mbp mRNA in SN while no significant effect was

detected in cervical spinal cord samples (Figs. 5 and 6). This is consistent with the M4

autonomous activity inferred from reporter expression studies [49,50,147,155]. In addition,

M4KO mice showed normal levels of golli in both cervical spinal cord and thymus (Figs. 7 and

8). Altogether, these results suggest that M4 activity is specific to mbp in SCs as its absence had

no effect on mbp or golli expression in the spinal cord or thymus. Also, M4 function is not

affected by gender as male and female mice gave indistinguishable results.

% of MBP/GAPDH in sciatic nerves of P30 mice 140%

120%

100%

80%

60%

40% 21% 20%

0% WT M4KO M3KO M5KO M3M5KO

Figure 5. Comparison of mbp accumulation in sciatic nerves of WT, M4KO, M3KO, M5KO and

M3M5KO P30 mice. Deletion of the M4 enhancer reduced the accumulation of mbp by ~80% while deletion of M3 and/or M5 had no effect on mbp accumulation in SCs. (P<0.0001).

% of MBP/GAPDH in cervical spinal cords of P30 mice 120%

100%

80% 56% 58% 60%

40% 26%

20%

0% WT M4KO M3KO M5KO M3M5KO

Figure 6. Comparison of mbp accumulation in cervical spinal cords of WT, M4KO, M3KO,

M5KO and M3M5KO P30 mice. The deletion of either M3 or M5 reduced the mbp accumulation in OLs by ~40% while the double KO reduced it by ~75%. Deletion of M4 showed no effect on mbp accumulation in OLs. (P<0.0001).

% of Golli/GAPDH in cervical spinal cords of P30 mice 120%

100%

80%

60%

40%

20% 11% 8%

0% WT M4KO M5KO M3KO M3M5KO

Figure 7. Comparison of golli accumulation in cervical spinal cords of WT, M4KO, M5KO,

M3KO and M3M5KO P30 mice. The deletion of either M4 or M5 had no effect on the accumulation of golli in OLs while the ablation of M3 alone or with M5 reduced it by ~90%.

(P<0.0001).

% of Golli/GAPDH in thymi of P30 mice 120%

100%

80%

60%

40%

10% 10% 20%

0% WT M5KO M4KO M3KO M3M5KO

Figure 8. Comparison of golli accumulation in thymi of WT, M4KO, M5KO, M3KO and

M3M5KO P30 mice. The deletion of either M4 or M5 had no effect on the accumulation of golli in thymus while the ablation of M3 alone or with M5 reduced it by ~90%. (P<0.0001).

M5KO consequence on mbp and golli accumulation in SN, cervical spinal cord and Thymus

M3KO mice have a residual 60% expression of mbp in the CNS and their ability to initiate remyelination following cuprizone demyelination appears to be unimpaired [49,51].

Thus, one would predict the existence of another CNS enhancer. The further upstream module,

(we designated as M5) capable of enhancing activity in-vitro and bound by the MYRF TF in

ChIP-seq, was a good candidate to be investigated in-vivo. We have generated multiple M5 deletions varying in their length. In this study, however, we have used the longest deletion

(3.27kb, M5KOlong) to ensure that we have encompassed the whole sequence capable of enhancing activity. Analysis of mbp expression in the cervical spinal cord of these mice showed a 40% reduction while SC expression was unaffected (Figs. 5 and 6). This exactly mimics the results obtained from mbp expression in cervical spinal cord of M3KO mice [49]. However, deletion of M5 had no effect on golli expression in either the cervical spinal cord or the thymus

(Figs. 7 and 8). This contrasts with the effect of M3 on golli in both cervical spinal cord and thymus [49]. Altogether these results confirm the enhancer activity of M5 in-vivo in which M5 only enhances the expression of mbp in OLs but fails to regulate golli expression in OLs and also in thymus. As we saw above for M4, M5 also demonstrates no inter-gender differences.

M3M5KO consequence on mbp and golli accumulation in SN, cervical spinal cord and Thymus

Since the individual deletions of each of the M3 and M5 modules led to ~40% decrease in mbp expression, it was interesting to see the consequence of simultaneous deletion of both enhancers on mbp expression and if the resultant mutant mice would be able to elicit remyelination; In my investigation, I have only focused on the mbp and golli expression. Along this path we have used the already existing M3KO mice to generate a double KO line (M3M5KO with short M5 deletion) (Fig. 2). Analysis of cervical spinal cord showed ~75% reduction in mbp

expression regardless of gender which is very close to the predicted additive loss of 80%.

However, the expression of golli in OLs and thymus samples was similar to M3KO mice and

also the expression of mbp in SN was not affected by the deletion of both M3 and M5. These

results are consistent with the observation in M5KO mice that M5 had no effect on golli expression in both OLs and thymus and also mbp expression in SCs.

Myelin phenotype in cervical spinal cord

We observed a major reduction in the amount of mbp produced by OLs especially in

M3M5KO mice. To determine if this reduction is translated into a myelin deficient phenotype

we collected cervical spinal cord and ON samples from M5KO, M3M5KO and WT mice at

P12/13. The 0.5 um cross-sections of tissues embedded in Epon were stained with Toluidine

blue, photographed with 63X or 100X oil immersion objectives under the light microscope and

high magnification montages were prepared. Preliminary comparison of M5KO and WT myelin

in cervical spinal cord sections indicates a modest reduction in myelin thickness while M3M5KO

mice show markedly thinner myelin sheaths (Figs. 9, 10 and 11). Even though M3M5KO mice

did not show a shivering phenotype, the myelin deficit was evident, demonstrating a direct

relationship between the level of mbp transcription and myelin thickness.

Figure 9. Ventral-medial cervical spinal cord of WT P12 mice under light microscopy. Myelin sheaths stain intensely. (Axons of similar calibres are marked with an asterisk (*) in Figs 9, 10 and 11 to assist in comparing relative myelin thicknesses). Calibration bar = 8 um.

Figure 10. Ventral-medial cervical spinal cord of M5KO P13 mice under light microscopy. A modest decrease in myelin thickness is observed when the myelin of similar calibre axons is compared between M5KO and WT mice. Calibration bar = 8 um.

Figure 11. Ventral-medial cervical spinal cord of M3M5KO P13 mice under light microscopy.

There is an apparent myelin deficiency and most of the axons are ensheathed by thin myelin as compared to the WT axons of the same calibre. Calibration bar = 8 um.

Enhancer KO consequences on myelin elaboration in the PNS.

A detailed evaluation of myelin elaborated by Schwann cells in the enhancer KO lines has not been undertaken. While the M4KO was shown here to reduce mbp mRNA accumulation in Schwann cells, it is notable that a complete lack of mbp mRNA in myelinating Schwann cells, as observed in shiverer mice, leads to a very modest and difficult to detect reduction in PNS myelin thickness [32]. Consistent with the observations in shiverer mice and the normal levels of mbp mRNA observed in the SN samples of M3, M5 and M3M5 KO mice, no myelin deficiency was apparent in the spinal roots (PNS) attached to the spinal cord samples imaged above (Fig.

12).

Figure 12. Ventral spinal root of (A) a P12 WT mouse, (B) a P13 M5KO and (C) a P13

M3M5KO mouse under light microscopy. Note the thickness of myelin, elaborated by SCs, is similar; consistent with the lack of mbp mRNA reduction. Calibration bar = 20 um.

Optic nerve cell count

The accumulated mbp and golli mRNA levels in spinal cord samples from the M5, M3 and M3M5KO lines were reduced relative to that observed in WT mice. However, in the CNS of

shiverer mice, the absence of mbp and myelin results in a relative increase in the size of the

maintained oligodendrocyte population [156]. As a consequence, the relationship between the

observed results and the amount of mRNA accumulated per cell may differ. To determine if the

mRNA levels I observed accurately reflect concentration per cell, it would be necessary to

establish that the samples analyzed contained equivalent numbers of oligodendrocytes. It has

been estimated that 5% of the cells in the human brain are oligodendrocytes suggesting that a

truly vast number of oligodendrocytes will exist in the white and grey matter of the spinal cord.

Moreover, that number will vary dramatically depending upon the specific level of the cord

examined. Consequently, without an independent and perhaps automated means of directly

determining the size of the oligodendrocyte population in the spinal cord samples analyzed, the

results reported here must be interpreted in light of this unknown. Despite the above caveat,

observations on total cell number in the ON of the KO mice are consistent with little or no

change in oligodendrocyte density. As oligodendrocytes comprise a significant proportion of the

total cell number in ON, any major disruption in the size of the oligodendrocyte population was

expected to have a noticeable effect on the total cell number.

A preliminary evaluation of cell numbers in ONs was obtained only from 2 week old

mice when myelin elaboration is nearing peak levels in the mouse ON. All nuclei within the ON

proper recognized by their size, staining density, presence of prominent nuclear membranes

and/or nucleoli were counted. Although the nuclei could be in oligodendrocytes, astrocytes or

microglia, at the level of the light microscope, it is not possible to make that assignment on

histological features alone. However, because oligodendrocytes make up approximately 50% of the cells in the mouse ON, an obvious change in total glial number was expected if the oligodendrocyte population was markedly different. Consistent with an equivalent oligodendrocyte density in all samples, no striking difference in total cell number per ON cross section was noted amongst the mice examined (WT = 136, M5KO = 143 and M3M5KO = 132).

DISCUSSION mbp expression in the PNS

In mice, myelin starts to be elaborated around birth by OLs and SCs in the CNS and PNS respectively. The production of myelin is accompanied by upregulation of numerous myelin genes (e.g. mbp) that reach their peak levels around P14 in both OLs and SCs. By P21, myelin has been built in most areas and many myelin genes including mbp are downregulated and by

P30 myelin production stabilizes and enters myelin maintenance period in which myelin genes such as mbp are expressed stably at half peak levels throughout the life of the animal.

In this study, we evaluated the contribution of three regulatory modules, M3, M4 and M5, to mbp and golli expression. While establishing the full developmental expression profile of the different enhancer deleted alleles is ongoing, I chose P30 as the initial age to investigate expecting inter-litter and inter-individual developmental variability to be minimal at this post- weaning age. In addition, I investigated the consequence of the M5 deletion alone and in combination with M3 on myelin phenotypes at P12/13.

Previously, it was shown that in the 9.5kb 5’ upstream of the mbp promoter, only M4 is able to activate reporter expression in SCs and it does so during all stages of development in the presence of proximal promoter elements [49,50,147,155]. However, in the exceptional circumstance where M3 was ligated to the minimal hsp promoter, it was also able to activate reporter constructs albeit only transiently in myelinating SC. Notably, this activity was silenced entirely when ligated to M1 [49]. Here we deleted M4 from the endogenous locus and demonstrated an ~80% reduction in the accumulated mbp mRNA in SCs while the amount of mbp in OLs remains unaltered. Based on previous and current enhancer KO or reporter expression results, it is not anticipated that other known modules, M1-5, account for the residual

20% activity. Therefore, I conclude that one or more regulatory modules upregulating mbp expression in SCs remain to be identified. One possible candidate is a so far uninvestigated sequence located in intron 1 of mbp that shows high phylogenetic conservation and Sox10-Egr2 binding in ChiP-Seq studies [146]. mbp expression in the CNS

In contrast to M4KO mice, deletion of M5 produced ~40% less mbp in OLs compared to

WT level but displayed no effect on the level of mbp in SCs; this observation is similar in the case of M3KO mice. Furthermore, simultaneous ablation of M3 and M5 (M3M5KO) led to the further reduction of mbp in OLs, resulting in ~75% less mbp than WT. In reporter expression studies, a LacZ reporter construct driven by 300 bp of 5’ proximal promoter sequence of mbp was not expressed in OLs. Extending this sequence by 77 bp (to -377 bp), and thus including

M1, led to targeting of the reporter expression to myelinating OLs but its activity was limited to the primary myelination period [50]. Addition of the M2 module to this construct increased the level of reporter expression but its activity still silenced as the mice matured. However, when M3 was deleted from the reporter construct bearing mbp 9.5kb upstream sequence, the reporter activity was observed in both young and adult mice although at reduced levels [49]. In addition, random insertion of two copies of the mbp gene along with 4kb of 5’ upstream sequence, hence including the sequence downstream of M3, into “shiverer” mice showed mbp mRNA accumulation to 25% of the WT level at P18 and similarly, this activity also downregulated as the mice entered the myelin maintenance period [157]. Therefore, the residual activity in OLs of

M3M5KO mice at P30 could possibly be achieved by the sequence located between M3 and mbp promoter. Further analysis of mbp expression at other developmental stages or during

remyelination and alternatively, deletion analysis of sequences flanked by M3 and mbp promoter would further increase our knowledge of the complex multi-module regulation of mbp in OLs.

Enhancer additivity in mbp expression

Multiple regulatory modules can converge on a single promoter to modulate the level and pattern of gene transcription. These modules can interact with one another to exert additive, sub- additive or a super-additive effect on gene expression [158]. Here we observed an ~40% reduction in mbp mRNA accumulation when either M3 or M5 were deleted. If these two enhancers were to contribute in an additive fashion to the expression of mbp, the simultaneous

deletion of both would be equal to the sum of the reduction caused by each which is ~80%. The

mbp mRNA level actually measured in the cervical spinal cords of M3M5KO mice is 75% which

is not far from the predicted value for additivity. The minor deviation (75% vs 80%) might arise

from the concurrent lack of these 2 strong modules relieving enhancer competition such that

unknown enhancers might interact more frequently with the promoter. Alternatively, it might be

due to the difference in the length of the M5 deletion in M5KO (long) and M3M5KO (short)

mice and this issue can be addressed by direct analysis of mice bearing the short M5KO alone.

Regardless, we conclude that M3 and M5 contribute to mbp expression in a largely if not

exclusively additive manner.

golli expression in the CNS and thymus

Golli, the upstream transcript produced from the golli/mbp locus, is expressed in OLs,

neurons and thymus cells [38,39]. Earlier, it was observed that deletion of M3 showed a dramatic

reduction in the expression of golli in spinal cord, ON and thymus (Dib. Ph.D. thesis 2011) [49].

Since M3 and M5 had similar effects on mbp expression, one might expect to see a similar effect

on golli expression. In contrast to this hypothesis, ablation of either M5 or M4 had no effect on

golli accumulation in the spinal cord or thymus. Thus, two enhancers equally capable of driving

the expression of mbp in OLs do not behave similarly in activating another transcriptional unit in a different lineage. This suggests that M5 might lack the specific TF binding sites required for thymus specific activity. Notably in OLs, M3 and M5 bind different important TFs involved in the myelin gene regulatory network [52,116,122,146,159-161]. To the present, M3 remains the sole enhancer capable of activating two promoters in OLs, golli and mbp, as well as the golli promoter in thymus cells. This circumstance may help define the TF binding sites that confer such lineage specific activities and contribute to new insights into how one enhancer interacts with two promoters within the same cell.

Enhancer-promoter interactions

There are many models that describe the interaction of enhancers with promoters

[53,162,163]. I believe the following model best describes our observations in enhancer deletion

studies of mbp and golli. The enhancer-promoter interaction mediated by chromatin looping in

which the TFs, COF and PIC are highly dynamic might explain how RNAP II is able to bind to

enhancers that are already occupied by TFs and probably displacing them to produce eRNAs.

This model can also support the simultaneous interaction of a single enhancer with multiple

promoters in a single TAD to induce transcription [162]. Levin and colleagues designed an

elegant experiment to show the importance of TADs in activation of two reporter genes by a

single enhancer in Drosophila. Previous quantitative methods showed that transcription of genes

occurs as short variable bursts. The level of gene expression is affected by duration, amplitude

and frequency of individual bursts [162]. During each burst, multiple RNAP II complexes are

released from the active promoter to produce several transcripts. This period is followed by a

refractory period of little or no activity [164-166]. When Levin and colleagues used quantitative

methods to look at the transcript production of each reporter, they observed simultaneous burst- like activity emanating from each of the promoters suggesting concurrent activation of both promoters by the same enhancer. Interestingly, inserting a gypsy insulator sequence between an enhancer and promoter pair greatly reduced the activation of one promoter without affecting the other [162]. In their experiment they noticed that the major variable was burst frequency while the amplitude of bursts remained similar. The frequency was also affected when the reporters were placed in an asymmetric fashion with the highest frequency attributed to the closer promoter [162]. This difference can be due to the competition between same-strength promoters over an enhancer in which the proximal promoter over-competes the distal one; An example of this effect has been reported for the β-globin gene [167,168]. mRNA splicing

Multiple factors modulate alternative splicing of pre-mRNA transcripts including cis- regulatory sequences such as exonic/intronic splicing enhancers/silencers or trans-acting factors that bind to those sequences. mRNA splicing has also been coupled to transcription activity such that it is modified by the rate which RNAP II moves along the gene [169]. This is particularly important when the splicing signals are weak; the slow movement of RNAP II along the chromatin would provide more time for the splicing machinery to recognize the weak enhancing signals and minimizes exon skipping [170,171]. On the other hand, it can also create an opportunity for negative regulators of splicing to bind to their weak signals thus minimizing exon inclusion [172-174]. Here, in our KO lines of mice, the reduction in the amount of mbp and/or golli mRNAs as a consequence of enhancer deletions could in part reflect a reduced elongation rate that in turn might change the normal splicing pattern. However, when Hood and colleagues randomly inserted a genomic copy of mbp along with 4kb of 5’ and 1kb of 3’ flanking sequence,

they observed the normal developmental expression program of mbp with comparable relative isoform ratios, although at low levels similar to our M3M5KO mice. Thus, they concluded that the required splicing signals were within this construct and were not affected by removal of the remaining mbp locus [157]; this is probably the case for our mice where the lower expression levels reflect RNAPolII recruitment to the promoter. Ultimately, targeted mRNA sequencing can provide more concrete evidence on this matter.

Behavioural and myelin phenotype

Previous work investigating the effect of the mbp expression level on myelin and mouse phenotypes, demonstrated that mice expressing 12.5% and 13.5% of normal mbp mRNA show low levels of myelination only around a few of the larger axons and are ultrastructurally indistinguishable from one another although they differ phenotypically. Mice with 12.5% of normal mbp expression level retain the shiverer phenotype but live longer. Addition of 1% to make up 13.5% reduces the shivering phenotype and abolishes convulsions [33].

Mice expressing approximately 25% of WT mbp mRNA levels showed significantly improved phenotype with only sight transient tremors while initiating walking and they appeared normal and healthy at 6 months of age [36,157]. Ultra-structural analysis of myelin in these mice revealed that the CNS axons have well compacted myelin even though the smallest axons were wrapped by loosely-compacted myelin. However, the myelin sheath appears thinner compared to

WT mice [33,157]. P30 mice bearing the double deletion of M3 and M5 express mbp mRNA at approximately 25% WT levels. This amount seems to be enough to make these mice indistinguishable from their WT counterparts. The phenotype difference between our M3M5KO mice and the previously produced transgenic mice by Hood and colleagues with the same amount of mbp mRNA could arise from a slight deviation between our reported mbp mRNA

levels and theirs suggesting the amount of mbp in our mice could be at the border below which transient tremors result [157]. Alternatively, this inconsistency might arise from differences in mouse strain, the random integration of their mbp construct or other unknown factors.

Ultimately, quantification analysis of a larger sample of M3M5KO mice would result in a more accurate measurement of mbp accumulated mRNA and might resolve this minor discrepancy.

G-ratio is a widely accepted and reliable strategy for assessing axonal myelination as it simultaneously considers the thickness of the myelin sheath and the co-varying axonal calibre. It is calculated as the ratio of the axonal diameter to the total outer diameter of the fibre [175].

Readhead and colleagues reported that expressing mbp at 50% of WT level is sufficient to allow normal myelin sheath formation [36]. However, in a previously generated mouse model, oligodendrocytes expressing half WT levels of both golli and mbp showed a reduction in myelin thickness around axons of the cervical spinal cord (Bachnou et al., unpublished). Similarly, g- ratio analysis in the CNS of M3KO mice that accumulate 60% of WT mbp mRNA demonstrated mild hypomyelination throughout the CNS, examined up to P60 (Dib. Ph.D. thesis 2011).

Consistent with this, initial qualitative light microscopy analysis of the myelin phenotype in cervical spinal cord samples from P30 M5KO mice, exhibiting 60% WT levels of mbp accumulation, also showed a modest reduction in myelin thickness. This suggests that the hypomyelination observed in the CNS of M3 and M5 KO mice is the result of 40% reduction in mbp expression. To confirm this, direct comparison of age matched M5 and M3 samples processed in an identical fashion and analysed at the ultrastructural level will need to be performed. However if such high resolution analysis of M5KO mice revealed no reduction in myelin thickness, the hypomyelination observed in M3KO mice and in mice with 50% mbp and golli levels could arise from the decreased levels of golli or a combination of golli and mbp

mRNAs. In support of this possibility, golli KO mice showed delayed myelination, hypomyelination and morphologically abnormal myelin in the visual cortex and ON; however in

that study, the ultra-structural analysis was limited to these two regions because they initially

observed a noticeable difference between golli KO and WT mice by light microscopy [45].

Moreover, the proliferation of OPCs was shown to be decreased in golli KO mice and since OPC

proliferation directly related to the density of OL population and thus myelination, golli might

exert an effect on myelination through this process [46].

The preliminary total cell count in the ONs of M3M5KO, M5KO, M3KO and WT mice

was similar, and since OLs constitute approximately 50% of the cells in ON, a large change in

their number would be expected to lead to detectable changes in total cell number [176]. This

suggests that, in contrast to golli null mice, the residual 15% golli mRNA in the ON of the

M3M5KO mice is sufficient for the development of normal OL population, although these mice

exhibited hypomyelination [49].

In summary we have characterized the in-vivo cell-specific activity of the M3, M4 and

M5 enhancers (Fig. 13). These observations also suggest the existence of other, yet to be

discovered, regulatory sequences acting on the mbp and golli genes in OLs, SCs and thymus

cells. This investigation leads to a highly dynamic model of enhancer-promoter interaction

consistent with bursting of transcription from both mbp and golli genes and lays the foundation

for future studies in which those interactions might be further characterized.

M5 M4 M3 M2 M1 mbp

OL and Thymus

golli M5 M4 M3 M2 M1

Figure 13. Modular organization of the endogenous golli/mbp cis-regulatory elements.

Schematic representation of recognized regulatory program conferred by the investigated modules (M3, M4 and M5). Targeting activity is represented by the solid arrows in OLs, SCs and thymus for both mbp (top) and golli (bottom).

FUTURE DIRECTIONS

While the full significance of myelinating cell plasticity is yet to be determined, the regulatory system controlling mbp expression is known to differ at different stages of myelin elaboration in both the CNS and PNS. A notable demonstration of this phenomenon is a reporter construct that initiates robust expression in Schwann cells only when myelin elaboration is declining in post-weaning mice [147]. Conversely, numerous mbp regulated reporter constructs showed diminishing or no expression in oligodendrocytes in post-weaning mice after expressing robustly during the earlier period of primary myelin elaboration [49,50]. Thus, it will be of interest to determine if the M3, M4 and M5 enhancers play similar roles at all stages of myelin production and also remyelination. This will be revealed by analyzing mbp and golli mRNA accumulation in KO mice at different ages. To support this future analysis, I have prepared samples from mice at P7 when myelination is initiating, P14 when near peak levels of myelin synthesis are achieved, P21 when the myelin maintenance period is beginning and in sexually mature P90 mice when the mature myelin phenotype is fully established throughout the CNS and

PNS.

Based on the apparent hypomyelinated phenotypes observed in the spinal cord samples of the P12 mice so far examined, it will be of interest to determine if this deficit is realized at all stages of maturation or rather, if it reflects only a delay in myelin acquisition that eventually resolves in more mature mice. Resolving this issue and investigating the role of these enhancers during remyelination also may provide new insight into the organization of the mbp regulatory mechanism operating in oligodendrocytes repairing the mature nervous system. Similarly, the curious restriction of major myelin disruption seen only in the optic system of golli KO mice points to an interesting level of oligodendrocyte heterogeneity [45]. Thus, it will be of interest to

investigate myelin acquisition in different CNS domains in the KO mice. This investigation can be augmented by crossing the KO lines with their specific levels of mbp and golli downregulation to mbp null shiverer mice expressing a major golli transcript (BG21) or MBP-

LacZ mice lacking both mbp and golli transcripts to generate mice with variable levels of golli and mbp [14]. This will also allow the investigation of possible combinatorial effects of golli and mbp on myelination by OLs.

The apparently unique capacity of the M3 enhancer to drive expression in both myelinating oligodendrocytes and the thymus may open a door to identifying those transcription factors that make either positive or negative contributions to such lineage specificity. Finally, the functional characterization achieved here for intact enhancers should provide critical insights upon which deletion and substitution experiments can lead to effective characterization of relevant TF binding sites and their patterns of TF engagement during primary myelination, myelin maintenance and adult remyelination. Such insights may further contribute to refinement of the emerging models of enhancer-promoter interaction and the regulation of gene transcription.

BIBLIOGRAPHY

1. Rushton WAH: A theory of the Effects of fibre size in medullated nerve. J. Physiol 1951, 115:101-122. 2. Virchow R: Über das ausgebreitete Vorkommen einer dem Nervenmark analogen Substanz in den tierischen Geweben. Virchows Arch. (Eur. J. Pathol.) 1854, 6:562- 572. 3. Cuzner ML, Davison AN, Gregson NA: The chemical composition of vertebrate myelin and microsomes. Journal of Neurochemistry 1965, 12:469-481. 4. Huxley A. F. SR: Evidence for saltatory conduction in peripheral myelinated nerve fibers. J. Physiol 1949, 108:315-339. 5. Brady S, Witt A, Kirkpatrick L, de Waegh S, Readhead C, Tu P, Lee V: Formation of compact myelin is required for maturation of the axonal cytoskeleton. J Neurosci 1999, 19:7278-7288. 6. Kirkpatrick L, Witt A, Payne H, Shine H, Brady S: Changes in microtubule stability and density in myelin-deficient shiverer mouse CNS axons. J Neurosci 2001, 21:2288- 2297. 7. Lee S, Leach MK, Redmond SA, Chong SY, Mellon SH, Tuck SJ, Feng ZQ, Corey JM, Chan JR: A culture system to study oligodendrocyte myelination processes using engineered nanofibers. Nat Methods 2012, 9:917-922. 8. Funfschilling U, Supplie LM, Mahad D, Boretius S, Saab AS, Edgar J, Brinkmann BG, Kassmann CM, Tzvetanova ID, Mobius W, et al.: Glycolytic oligodendrocytes maintain myelin and long-term axonal integrity. Nature 2012, 485:517-521. 9. Lee Y, Morrison BM, Li Y, Lengacher S, Farah MH, Hoffman PN, Liu Y, Tsingalia A, Jin L, Zhang PW, et al.: Oligodendroglia metabolically support axons and contribute to neurodegeneration. Nature 2012, 487:443-448. 10. Zalc B: The acquisition of myelin: An evolutionary perspective. Brain Res 2015. 11. Hartline DK, Colman DR: Rapid conduction and the evolution of giant axons and myelinated fibers. Curr Biol 2007, 17:R29-35. 12. Castelfranco AM, Hartline DK: Evolution of rapid nerve conduction. Brain Res 2016, 1641:11-33. 13. Zalc B, Goujet D, Colman D: The origin of the myelination program in vertebrates. Curr Biol 2008, 18:R511-512. 14. Foran DR, Peterson A: Myelin Acquisition in the Central Nervous System of the Mouse Revealed by an MBP-Lac Z Transgene. The Journal of Neuroscience 1992, 12:4890- 4897. 15. Fulton DL, Denarier E, Friedman HC, Wasserman WW, Peterson AC: Towards resolving the transcription factor network controlling myelin gene expression. Nucleic Acids Res 2011, 39:7974-7991. 16. Franklin RJ, Ffrench-Constant C: Remyelination in the CNS: from biology to therapy. Nat Rev Neurosci 2008, 9:839-855. 17. Peters A, Sethares C: Oligodendrocytes, their progenitors and other neuroglial cells in the aging primate cerebral cortex. Cereb Cortex 2004, 14:995-1007. 18. Chen ZL, Yu WM, Strickland S: Peripheral regeneration. Annu Rev Neurosci 2007, 30:209-233. 19. Jessen KR, Mirsky R, Lloyd AC: Schwann Cells: Development and Role in Nerve Repair. Cold Spring Harb Perspect Biol 2015, 7:a020487. 20. Dubois-Dalcq M, Ffrench-Constant C, Franklin RJ: Enhancing central nervous system remyelination in multiple sclerosis. Neuron 2005, 48:9-12.

21. Harauz G, Ishiyama N, Hill CM, Bates IR, Libich DS, Fares C: Myelin basic protein- diverse conformational states of an intrinsically unstructured protein and its roles in myelin assembly and multiple sclerosis. Micron 2004, 35:503-542. 22. Zuchero JB, Fu MM, Sloan SA, Ibrahim A, Olson A, Zaremba A, Dugas JC, Wienbar S, Caprariello AV, Kantor C, et al.: CNS myelin wrapping is driven by actin disassembly. Dev Cell 2015, 34:152-167. 23. E. Barbarese JC, P. E. Braun: ACCUMULATION OF THE FOUR MYELIN BASIC PROTEINS IN MOUSE BRAIN DURING DEVELOPMENT Neurochemistry 1978, 31:779-782. 24. Barbarese E, Brumwell C, Kwon S, Cui H, Carson J: RNA on the road to myelin. Journal of Neurocytology 1999, 28:263-270. 25. Akiyama K, Ichinose S, Omori A, Sakurai Y, Asou H: Study of expression of myelin basic proteins (MBPs) in developing rat brain using a novel antibody reacting with four major isoforms of MBP. J Neurosci Res 2002, 68:19-28. 26. Barbarese E, Braun PE, Carson JH: Identification of prelarge and presmall basic proteins in mouse myelin and their structural relationship to large and small basic proteins Proc Natl Acad Sci U S A 1977, 74:3360-3364. 27. Allinquant B, Staugaitis SM, D'Urso D, Colman DR: The ectopic expression of myelin basic protein isoforms in Shiverer oligodendrocytes: implications for myelinogenesis. The Journal of Cell Biology 1991, 113:393-403. 28. Roach A, Takahashi N, Pravtcheva D, Ruddle F, Hood L: Chromosomal mapping of mouse myelin basic protein gene and structure and transcription of the partially deleted gene in shiverer mutant mice. Cell 1985, 42:149-155. 29. Chernoff G: Shiverer: an autosomal recessive mutant mouse with myelin deficiency. The journal of Heredity 1981, 72:128. 30. Rosenbluth J: Peripheral myelin in the mouse mutant Shiverer. The Journal of Comparative Neurology 1980, 193:729-739. 31. Rosenbluth J: Central myelin in the mouse mutant Shiverer. The Journal of Comparative Neurology 1980, 194:639-648. 32. Peterson AC, Bray GM: Hypomyelination in the peripheral nervous system of shiverer mice and in shiverer in equilibrium normal chimaera. The Journal of Comparative Neurology 1984, 227:348-356. 33. Popko B, Puckett C, Lai E, Shine H, Readhead C, Takahashi N, Hunt S, Sidman R, Hood L: Myelin deficient mice: expression of myelin basic protein and generation of mice with varying levels of myelin. Cell 1987, 48:713-721. 34. Kimura M, Sato M, Akatsuka A, Saito S, Ando K, Yokoyama M, Katsuki M: Overexpression of a minor component of myelin basic protein isoform 17.2kDa. can restore myelinogenesis in transgenic shiverer mice. Brain Res 1989, 1998:245-252. 35. Kimura M, Sato M, Akatsuka A, Nozawa-Kimura S, Takahashi R, Yokoyama M, Nomura T, Katsuki M: Restoration of myelin formation by a single type of myelin basic protein in transgenic shiverer mice. Proc Natl Acad Sci U S A 1989, 86:5661-5665. 36. Readhead C, Takasashi N, Shine H, Saavedra R, Sidman R, Hood L: Role of myelin basic protein in the formation of central nervous system myelin. Annals of the New York Academy of Sciences 1990, 605:280-285. 37. Gould RM, Byrd AL, Barbarese E: The number of Schmidt-Lanterman incisures is more than doubled in shiverer PNS myelin sheaths. Journal of Neurocytology 1995, 24:85- 98. 38. Campagnoni A, Pribyl T, Campagnoni C, Kampf K, Amur-Umarjee S, Landry C, Handley V, Newman S, Garbay B, Kitamura K: Structure and developmental regulation of Golli- mbp, a 105-kilobase gene that encompasses the myelin basic protein gene and is

expressed in cells in the oligodendrocyte lineage in the brain. Biol Chem 1993, 268:4930-4938. 39. Landry FC, Pribyl MT, Ellison AJ, Givogri MI, Kampf K, Campagnoni WC, Campagnoni TA: Embryonic Expression of the Myelin Basic Protein Gene, Identification of a Promoter Region That Targets Transgee Expression to Pioneer Neurons. The Journal of Neuroscience 1998, 18. 40. Givogri MI, Bongarzone ER, Campagnoni AT: New insights on the biology of myelin basic protein gene: the neural-immune connection. Journal of Neuroscience Research 2000, 59:153-159. 41. Feng JM: Minireview: expression and function of golli protein in immune system. Neurochem Res 2007, 32:273-278. 42. Feng JM, Fernandes AO, Campagnoni CW, Hu YH, Campagnoni AT: The golli-myelin basic protein negatively regulates signal transduction in T lymphocytes. J Neuroimmunol 2004, 152:57-66. 43. Feng JM, Givogri IM, Bongarzone ER, Campagnoni C, Jacobs E, Handley VW, Schonmann V, Campagnoni AT: Thymocytes Express the golli Products of the Myelin Basic Protein Gene and Levels of Expression Are Stage Dependent. The Journal of Immunology 2000, 165:5443-5450. 44. Feng JM, Hu YK, Xie LH, Colwell CS, Shao XM, Sun XP, Chen B, Tang H, Campagnoni AT: Golli protein negatively regulates store depletion-induced calcium influx in T cells. Immunity 2006, 24:717-727. 45. Jacobs EC, Pribyl TM, Feng JM, Kampf K, Spreur V, Campagnoni C, Colwell CS, Reyes SD, Martin M, Handley V, et al.: Region-specific myelin pathology in mice lacking the golli products of the myelin basic protein gene. J Neurosci 2005, 25:7004-7013. 46. Paez PM, Fulton DJ, Spreuer V, Handley V, Campagnoni CW, Campagnoni AT: Regulation of store-operated and voltage-operated Ca2+ channels in the proliferation and death of oligodendrocyte precursor cells by golli proteins. ASN Neuro 2009, 1. 47. Jacobs EC, Reyes SD, Campagnoni CW, Irene Givogri M, Kampf K, Handley V, Spreuer V, Fisher R, Macklin W, Campagnoni AT: Targeted overexpression of a golli-myelin basic protein isoform to oligodendrocytes results in aberrant oligodendrocyte maturation and myelination. ASN Neuro 2009, 1. 48. Vt C, Da SG, V S, V H, At C, Pm P: Golli Myelin Basic Proteins Modulate Voltage- Operated Ca(++) Influx and Development in Cortical and Hippocampal Neurons. Mol Neurobiol 2016, 53:5749-5771. 49. Dib S, Denarier E, Dionne N, Beaudoin M, Friedman HH, Peterson AC: Regulatory modules function in a non-autonomous manner to control transcription of the mbp gene. Nucleic Acids Res 2011, 39:2548-2558. 50. Hooman F. Farhadi PL, Reza Forghani, Hana C. H. Friedman, Wayel Orfali, Luc Jasmin, Webb Miller, Thomas J. Hudson, Alan C. Peterson: A Combinatorial Network of Evolutionarily Conserved Myelin Basic Protein Regulatory Sequence Confers Distinct Gial-Specific Phenotypes. Neurosciene 2003, 23:10214-10223. 51. Dionne N, Dib S, Finsen B, Denarier E, Kuhlmann T, Drouin R, Kokoeva M, Hudson TJ, Siminovitch K, Friedman HC, et al.: Functional organization of an Mbp enhancer exposes striking transcriptional regulatory diversity within myelinating glia. Glia 2016, 64:175-194. 52. Bujalka H, Koenning M, Jackson S, Perreau VM, Pope B, Hay CM, Mitew S, Hill AF, Lu QR, Wegner M, et al.: MYRF is a membrane-associated transcription factor that autoproteolytically cleaves to directly activate myelin genes. PLoS Biol 2013, 11:e1001625. 53. Levine M: Transcriptional enhancers in animal development and evolution. Curr Biol 2010, 20:R754-763.

54. Reiter F, Wienerroither S, Stark A: Combinatorial function of transcription factors and cofactors. Curr Opin Genet Dev 2017, 43:73-81. 55. Spitz F, Furlong EE: Transcription factors: from enhancer binding to developmental control. Nat Rev Genet 2012, 13:613-626. 56. Shlyueva D, Stampfel G, Stark A: Transcriptional enhancers: from properties to genome-wide predictions. Nat Rev Genet 2014, 15:272-286. 57. Mellerick DM, Nirenberg M: Dorsal-ventral patterning genes restrict NK-2 homeobox gene expression to the ventral half of the central nervous system of Drosophila embryos. Dev Biol 1995, 171:306-316. 58. Ip YT, Park RE, Kosman D, Bier E, Levine M: The dorsal gradient morphogen regulates stripes of rhomboid expression in the presumptive neuroectoderm of the Drosophila embryo. Genes & Development 1992, 6:1728-1739. 59. Barozzi I, Simonatto M, Bonifacio S, Yang L, Rohs R, Ghisletti S, Natoli G: Coregulation of transcription factor binding and nucleosome occupancy through DNA features of mammalian enhancers. Mol Cell 2014, 54:844-857. 60. Moyle-Heyrman G, Tims HS, Widom J: Structural constraints in collaborative competition of transcription factors against the nucleosome. J Mol Biol 2011, 412:634-646. 61. Lickwar CR, Mueller F, Hanlon SE, McNally JG, Lieb JD: Genome-wide protein-DNA binding dynamics suggest a molecular clutch for transcription factor function. Nature 2012, 484:251-255. 62. Deplancke B, Alpern D, Gardeux V: The Genetics of Transcription Factor DNA Binding Variation. Cell 2016, 166:538-554. 63. Miller JA, Widom J: Collaborative Competition Mechanism for Gene Activation In Vivo. Molecular and Cellular Biology 2003, 23:1623-1632. 64. Mirny LA: Nucleosome-mediated cooperativity between transcription factors. Proc Natl Acad Sci U S A 2010, 107:22534-22539. 65. Kerppola TK, Curran T: Fos-Jun heterodimers and jun homodimers bend DNA in opposite orientations: Implications for transcription factor cooperativity. Cell 1991, 66:317-326. 66. Jolma A, Yin Y, Nitta KR, Dave K, Popov A, Taipale M, Enge M, Kivioja T, Morgunova E, Taipale J: DNA-dependent formation of transcription factor pairs alters their binding specificity. Nature 2015, 527:384-388. 67. Panne D: The enhanceosome. Curr Opin Struct Biol 2008, 18:236-242. 68. Schlierf B, Ludwig A, Klenovsek K, Wegner M: Cooperative binding of Sox10 to DNA, requirements and consequences. Nucleic Acids Res 2002, 30:5509-5516. 69. Peirano R, Wegner M: The glial transcription factor Sox10 binds to DNA both as monomer and dimer with different functional consequences. Nucleic Acids Res 2000, 28:3047-3055. 70. Meireles-Filho AC, Stark A: Comparative genomics of gene regulation-conservation and divergence of cis-regulatory information. Curr Opin Genet Dev 2009, 19:565- 570. 71. Zaret KS, Carroll JS: Pioneer transcription factors: establishing competence for gene expression. Genes Dev 2011, 25:2227-2241. 72. Soufi A, Garcia MF, Jaroszewicz A, Osman N, Pellegrini M, Zaret KS: Pioneer transcription factors target partial DNA motifs on nucleosomes to initiate reprogramming. Cell 2015, 161:555-568. 73. Visel A, Blow MJ, Li Z, Zhang T, Akiyama JA, Holt A, Plajzer-Frick I, Shoukry M, Wright C, Chen F, et al.: ChIP-seq accurately predicts tissue-specific activity of enhancers. Nature 2009, 457:854-858.

74. Calo E, Wysocka J: Modification of enhancer chromatin: what, how, and why? Mol Cell 2013, 49:825-837. 75. Mikkelsen TS, Ku M, Jaffe DB, Issac B, Lieberman E, Giannoukos G, Alvarez P, Brockman W, Kim TK, Koche RP, et al.: Genome-wide maps of chromatin state in pluripotent and lineage-committed cells. Nature 2007, 448:553-560. 76. Heintzman ND, Stuart RK, Hon G, Fu Y, Ching CW, Hawkins RD, Barrera LO, Van Calcar S, Qu C, Ching KA, et al.: Distinct and predictive chromatin signatures of transcriptional promoters and enhancers in the human genome. Nat Genet 2007, 39:311-318. 77. Li W, Notani D, Rosenfeld MG: Enhancers as non-coding RNA transcription units: recent insights and future perspectives. Nat Rev Genet 2016, 17:207-223. 78. Deng W, Lee J, Wang H, Miller J, Reik A, Gregory PD, Dean A, Blobel GA: Controlling long-range genomic interactions at a native locus by targeted tethering of a looping factor. Cell 2012, 149:1233-1244. 79. Dixon JR, Selvaraj S, Yue F, Kim A, Li Y, Shen Y, Hu M, Liu JS, Ren B: Topological domains in mammalian genomes identified by analysis of chromatin interactions. Nature 2012, 485:376-380. 80. Vietri Rudan M, Hadjur S: Genetic Tailors: CTCF and Cohesin Shape the Genome During Evolution. Trends Genet 2015, 31:651-660. 81. Calhoun VC, Stathopoulos A, Levine M: Promoter-proximal tethering elements regulate enhancer-promoter specificity in the Drosophila Antennapedia complex. Proc Natl Acad Sci U S A 2002, 99:9243-9247. 82. Zhou J, Levine M: A novel cis-regulatory element, the PTS, mediates an anti-insulator activity in the Drosophila embryo. Cell 1999, 99:567-575. 83. Li X, Noll M: Compatibility between enhancers and promoters determines the transcriptional specificity of gooseberry and gooseberry neuro in the Drosophila embryo. EMBO J 1994, 13:400-406. 84. Merli C, Bergstrom DE, Cygan JA, Blackman RK: Promoter specificity mediates the independent regulation of neighboring genes. Genes Dev 1996, 10:1260-1270. 85. Kadonaga JT: Perspectives on the RNA polymerase II core promoter. Wiley Interdiscip Rev Dev Biol 2012, 1:40-51. 86. Sandelin A, Carninci P, Lenhard B, Ponjavic J, Hayashizaki Y, Hume DA: Mammalian RNA polymerase II core promoters: insights from genome-wide studies. Nat Rev Genet 2007, 8:424-436. 87. Zabidi MA, Arnold CD, Schernhuber K, Pagani M, Rath M, Frank O, Stark A: Enhancer- core-promoter specificity separates developmental and housekeeping gene regulation. Nature 2015, 518:556-559. 88. Zabidi MA, Stark A: Regulatory Enhancer-Core-Promoter Communication via Transcription Factors and Cofactors. Trends Genet 2016, 32:801-814. 89. Hao N, Palmer AC, Ahlgren-Berg A, Shearwin KE, Dodd IB: The role of repressor kinetics in relief of transcriptional interference between convergent promoters. Nucleic Acids Res 2016, 44:6625-6638. 90. Rowitch DH, Kriegstein AR: Developmental genetics of vertebrate glial-cell specification. Nature 2010, 468:214-222. 91. Noll E, Miller RH: Oligodendrocyte precursors originate at the ventral ventricular zone dorsal to the ventral midline region in the embryonic rat spinal cord. Development 1993, 118:563-573. 92. Cai J, Qi Y, Hu X, Tan M, Liu Z, Zhang J, Li Q, Sander M, Qiu M: Generation of oligodendrocyte precursor cells from mouse dorsal spinal cord independent of Nkx6 regulation and Shh signaling. Neuron 2005, 45:41-53.

93. Vallstedt A, Klos JM, Ericson J: Multiple dorsoventral origins of oligodendrocyte generation in the spinal cord and hindbrain. Neuron 2005, 45:55-67. 94. Kessaris N, Fogarty M, Iannarelli P, Grist M, Wegner M, Richardson WD: Competing waves of oligodendrocytes in the forebrain and postnatal elimination of an embryonic lineage. Nat Neurosci 2006, 9:173-179. 95. Fu H, Qi Y, Tan M, Cai J, Takebayashi H, Nakafuku M, Richardson W, Qiu M: Dual origin of spinal oligodendrocyte progenitors and evidence for the cooperative role of Olig2 and Nkx2.2 in the control of oligodendrocyte differentiation. Development 2002, 129:681-693. 96. Gonzalez-Perez O, Alvarez-Buylla A: Oligodendrogenesis in the subventricular zone and the role of epidermal growth factor. Brain Res Rev 2011, 67:147-156. 97. Tsai HH, Niu J, Munji R, Davalos D, Chang J, Zhang H, Tien AC, Kuo CJ, Chan JR, Daneman R, et al.: Oligodendrocyte precursors migrate along vasculature in the developing nervous system. Science 2016, 351:379-384. 98. Goldman SA, Kuypers NJ: How to make an oligodendrocyte. Development 2015, 142:3983-3995. 99. Bergles DE, Richardson WD: Oligodendrocyte Development and Plasticity. Cold Spring Harb Perspect Biol 2015, 8. 100. de Castro F, Bribian A, Ortega MC: Regulation of oligodendrocyte precursor migration during development, in adulthood and in pathology. Cell Mol Life Sci 2013, 70:4355- 4368. 101. Miron VE, Kuhlmann T, Antel JP: Cells of the oligodendroglial lineage, myelination, and remyelination. Biochim Biophys Acta 2011, 1812:184-193. 102. Marques S, Zeisel A, Codeluppi S, van Bruggen D, Mendanha Falcão A, Xiao L, Li H, Häring M, Hochgerner H, Romanov RA, et al.: Oligodendrocyte heterogeneity in the mouse juvenile and adult central nervous system. Science 2016, 352:1326-1329. 103. Liu A, Li J, Marin-Husstege M, Kageyama R, Fan Y, Gelinas C, Casaccia-Bonnefil P: A molecular insight of Hes5-dependent inhibition of myelin gene expression: old partners and new players. EMBO J 2006, 25:4833-4842. 104. He L, Lu QR: Coordinated control of oligodendrocyte development by extrinsic and intrinsic signaling cues. Neurosci Bull 2013, 29:129-143. 105. Zhou Q, Anderson DJ: The bHLH Transcription Factors OLIG2 and OLIG1 Couple Neuronal and Glial Subtype Specification. Cell 2002, 109:61-73. 106. Lu QR, Sun T, Zhu Z, Ma N, Garcia M, Stiles CD, Rowitch DH: Common Developmental Requirement for Olig Function Indicates a Motor Neuron/Oligodendrocyte Connection. Cell 2002, 109:75-86. 107. Arnett HA, Fancy SPJ, Alberta JA, Zhao C, Plant SR, Kaing S, Raine CS, Rowitch DH, Franklin RJM, Stiles CD: bHLH Transcription Factor Olig1 Is Required to Repair Demyelinated Lesions in the CNS. Science 2004, 306:2111-2115. 108. Emery B, Agalliu D, Cahoy JD, Watkins TA, Dugas JC, Mulinyawe SB, Ibrahim A, Ligon KL, Rowitch DH, Barres BA: Myelin gene regulatory factor is a critical transcriptional regulator required for CNS myelination. Cell 2009, 138:172-185. 109. Koenning M, Jackson S, Hay CM, Faux C, Kilpatrick TJ, Willingham M, Emery B: Myelin gene regulatory factor is required for maintenance of myelin and mature oligodendrocyte identity in the adult CNS. J Neurosci 2012, 32:12528-12542. 110. Duncan GJ, Plemel JR, Assinck P, Manesh SB, Muir FGW, Hirata R, Berson M, Liu J, Wegner M, Emery B, et al.: Myelin regulatory factor drives remyelination in multiple sclerosis. Acta Neuropathol 2017. 111. Stolt CC, Lommes P, Sock E, Chaboissier MC, Schedl A, Wegner M: The Sox9 transcription factor determines glial fate choice in the developing spinal cord. Genes & Development 2003, 17:1677-1689.

112. Stolt CC, Rehberg S, Ader M, Lommes P, Riethmacher D, Schachner M, Bartsch U, Wegner M: Terminal differentiation of myelin-forming oligodendrocytes depends on the transcription factor Sox10. Genes & Development 2002, 16:165-170. 113. Hornig J, Frob F, Vogl MR, Hermans-Borgmeyer I, Tamm ER, Wegner M: The transcription factors Sox10 and Myrf define an essential regulatory network module in differentiating oligodendrocytes. PLoS Genet 2013, 9:e1003907. 114. Wang SZ, Dulin J, Wu H, Hurlock E, Lee SE, Jansson K, Lu QR: An oligodendrocyte- specific zinc-finger transcription regulator cooperates with Olig2 to promote oligodendrocyte differentiation. Development 2006, 133:3389-3398. 115. Soundarapandian MM, Selvaraj V, Lo UG, Golub MS, Feldman DH, Pleasure DE, Deng W: Zfp488 promotes oligodendrocyte differentiation of neural progenitor cells in adult mice after demyelination. Sci Rep 2011, 1:2. 116. Weng Q, Chen Y, Wang H, Xu X, Yang B, He Q, Shou W, Chen Y, Higashi Y, van den Berghe V, et al.: Dual-mode modulation of Smad signaling by Smad-interacting protein Sip1 is required for myelination in the central nervous system. Neuron 2012, 73:713-728. 117. Verstappen G, van Grunsven LA, Michiels C, Van de Putte T, Souopgui J, Van Damme J, Bellefroid E, Vandekerckhove J, Huylebroeck D: Atypical Mowat-Wilson patient confirms the importance of the novel association between ZFHX1B/SIP1 and NuRD corepressor complex. Hum Mol Genet 2008, 17:1175-1183. 118. Zuchero JB, Barres BA: Intrinsic and extrinsic control of oligodendrocyte development. Curr Opin Neurobiol 2013, 23:914-920. 119. Jacob C, Lebrun-Julien F, Suter U: How histone deacetylases control myelination. Mol Neurobiol 2011, 44:303-312. 120. Emery B: Transcriptional and post-transcriptional control of CNS myelination. Curr Opin Neurobiol 2010, 20:601-607. 121. Marathe HG, Mehta G, Zhang X, Datar I, Mehrotra A, Yeung KC, de la Serna IL: SWI/SNF enzymes promote SOX10- mediated activation of myelin gene expression. PLoS One 2013, 8:e69037. 122. Yu Y, Chen Y, Kim B, Wang H, Zhao C, He X, Liu L, Liu W, Wu LM, Mao M, et al.: Olig2 targets chromatin remodelers to enhancers to initiate oligodendrocyte differentiation. Cell 2013, 152:248-261. 123. Marin-Husstege M, Muggironi M, Liu A, Casaccia-Bonnefil P: Histone deacetylase activity is necessary for oligodendrocyte lineage progression. The Journal of Neuroscience 2002, 22:10333-10345. 124. Ye F, Chen Y, Hoang T, Montgomery RL, Zhao XH, Bu H, Hu T, Taketo MM, van Es JH, Clevers H, et al.: HDAC1 and HDAC2 regulate oligodendrocyte differentiation by disrupting the beta-catenin-TCF interaction. Nat Neurosci 2009, 12:829-838. 125. Shin D, Shin JY, McManus MT, Ptacek LJ, Fu YH: Dicer ablation in oligodendrocytes provokes neuronal impairment in mice. Ann Neurol 2009, 66:843-857. 126. Dugas JC, Cuellar TL, Scholze A, Ason B, Ibrahim A, Emery B, Zamanian JL, Foo LC, McManus MT, Barres BA: Dicer1 and miR-219 Are required for normal oligodendrocyte differentiation and myelination. Neuron 2010, 65:597-611. 127. Zhao X, He X, Han X, Yu Y, Ye F, Chen Y, Hoang T, Xu X, Mi QS, Xin M, et al.: MicroRNA-mediated control of oligodendrocyte differentiation. Neuron 2010, 65:612-626. 128. Reiprich S, Cantone M, Weider M, Baroti T, Wittstatt J, Schmitt C, Kuspert M, Vera J, Wegner M: Transcription factor Sox10 regulates oligodendroglial Sox9 levels via microRNAs. Glia 2017, 65:1089-1102. 129. Hall BK: The neural crest as a fourth germ layer and vertebrates as quadroblastic not triploblastic. Evolution & Development 2000, 2:1, 3-5.

130. Mirsky R, Woodhoo A, Parkinson D, Arthur-Farraj P, Bhaskaran A, Jessen K: Novel signals controlling embryonic Schwann cell development, myelination and dedifferentiation. Journal of peripheral nervous system 2008, 13:122-135. 131. Mayanil CS: Transcriptional and epigenetic regulation of neural crest induction during neurulation. Dev Neurosci 2013, 35:361-372. 132. Kuhlbrodt K, Herbarth B, Sock E, Hermans-Borgmeyer I, Wegner M: Sox10, a Novel Transcriptional Modulator in Glial Cells. The Journal of Neuroscience 1998, 18:237- 250. 133. Finzsch M, Schreiner S, Kichko T, Reeh P, Tamm ER, Bosl MR, Meijer D, Wegner M: Sox10 is required for Schwann cell identity and progression beyond the immature Schwann cell stage. J Cell Biol 2010, 189:701-712. 134. Bremer M, Frob F, Kichko T, Reeh P, Tamm ER, Suter U, Wegner M: Sox10 is required for Schwann-cell homeostasis and myelin maintenance in the adult peripheral nerve. Glia 2011, 59:1022-1032. 135. Frob F, Bremer M, Finzsch M, Kichko T, Reeh P, Tamm ER, Charnay P, Wegner M: Establishment of myelinating Schwann cells and barrier integrity between central and peripheral nervous systems depend on Sox10. Glia 2012, 60:806-819. 136. Le N, Nagarajan R, Wang JY, Araki T, Schmidt RE, Milbrandt J: Analysis of congenital hypomyelinating Egr2Lo/Lo nerves identifies Sox2 as an inhibitor of Schwann cell differentiation and myelination. Proc Natl Acad Sci U S A 2005, 102:2596-2601. 137. Parkinson DB, Bhaskaran A, Arthur-Farraj P, Noon LA, Woodhoo A, Lloyd AC, Feltri ML, Wrabetz L, Behrens A, Mirsky R, et al.: c-Jun is a negative regulator of myelination. J Cell Biol 2008, 181:625-637. 138. Woodhoo A, Alonso MB, Droggiti A, Turmaine M, D'Antonio M, Parkinson DB, Wilton DK, Al-Shawi R, Simons P, Shen J, et al.: Notch controls embryonic Schwann cell differentiation, postnatal myelination and adult plasticity. Nat Neurosci 2009, 12:839-847. 139. Ghazvini M, Mandemakers W, Jaegle M, Piirsoo M, Driegen S, Koutsourakis M, Smit X, Grosveld F, Meijer D: A cell type-specific allele of the POU gene Oct-6 reveals Schwann cell autonomous function in nerve development and regeneration. EMBO J 2002, 21:4612-4620. 140. Jagalur NB, Ghazvini M, Mandemakers W, Driegen S, Maas A, Jones EA, Jaegle M, Grosveld F, Svaren J, Meijer D: Functional dissection of the Oct6 Schwann cell enhancer reveals an essential role for dimeric Sox10 binding. J Neurosci 2011, 31:8585-8594. 141. Mandemakers W, Zwart R, Jaegle M, Walbeehm E, Visser P, Grosveld F, Meijer D: A distal Schwann cell-specific enhancer mediates axonal regulation of the Oct-6 transcription factor during peripheral nerve development and regeneration. EMBO J 2000, 19:2992-3002. 142. Chen Y, Wang H, Yoon SO, Xu X, Hottiger MO, Svaren J, Nave KA, Kim HA, Olson EN, Lu QR: HDAC-mediated deacetylation of NF-kappaB is critical for Schwann cell myelination. Nat Neurosci 2011, 14:437-441. 143. Ghislain J, Charnay P: Control of myelination in Schwann cells: a Krox20 cis- regulatory element integrates Oct6, Brn2 and Sox10 activities. EMBO Rep 2006, 7:52-58. 144. Reiprich S, Kriesch J, Schreiner S, Wegner M: Activation of Krox20 gene expression by Sox10 in myelinating Schwann cells. J Neurochem 2010, 112:744-754. 145. Jang SW, Srinivasan R, Jones EA, Sun G, Keles S, Krueger C, Chang LW, Nagarajan R, Svaren J: Locus-wide identification of Egr2/Krox20 regulatory targets in myelin genes. J Neurochem 2010, 115:1409-1420.

146. Srinivasan R, Sun G, Keles S, Jones EA, Jang SW, Krueger C, Moran JJ, Svaren J: Genome-wide analysis of EGR2/SOX10 binding in myelinating peripheral nerve. Nucleic Acids Res 2012, 40:6449-6460. 147. Denarier E, Forghani R, Farhadi HF, Dib S, Dionne N, Friedman HC, Lepage P, Hudson TJ, Drouin R, Peterson A: Functional organization of a Schwann cell enhancer. J Neurosci 2005, 25:11210-11217. 148. Barrangou R, Doudna JA: Applications of CRISPR technologies in research and beyond. Nat Biotechnol 2016, 34:933-941. 149. Mali P, Esvelt KM, Church GM: Cas9 as a versatile tool for engineering biology. Nat Methods 2013, 10:957-963. 150. Waddington SN, Privolizzi R, Karda R, O'Neill HC: A Broad Overview and Review of CRISPR-Cas Technology and Stem Cells. Curr Stem Cell Rep 2016, 2:9-20. 151. Vora S, Tuttle M, Cheng J, Church G: Next stop for the CRISPR revolution: RNA- guided epigenetic regulators. FEBS J 2016, 283:3181-3193. 152. Wang H, La Russa M, Qi LS: CRISPR/Cas9 in Genome Editing and Beyond. Annu Rev Biochem 2016, 85:227-264. 153. Tuason MC, Rastikerdar A, Kuhlmann T, Goujet-Zalc C, Zalc B, Dib S, Friedman H, Peterson A: Separate proteolipid protein/DM20 enhancers serve different lineages and stages of development. J Neurosci 2008, 28:6895-6903. 154. Wang W, Kutny PM, Byers SL, Longstaff CJ, DaCosta MJ, Pang C, Zhang Y, Taft RA, Buaas FW, Wang H: Delivery of Cas9 Protein into Mouse Zygotes through a Series of Electroporation Dramatically Increases the Efficiency of Model Creation. J Genet Genomics 2016, 43:319-327. 155. Reza Forghani LG, David R. Foran, Hooman F. Farhadi, Pierre Lepage, Thomas J. Hudson, Irene Tretjakoff, Priscila Valera, and Alan Peterson: A Distal Upstream Enhancer from the Myelin Basic Protein Gene Regulated Expression in Myelin- Forming Schwann Cells. The Journal of Neuroscience 2001, 21:3780-3787. 156. Bu J, Banki A, Wu Q, Nishiyama A: Increased NG2(+) glial cell proliferation and oligodendrocyte generation in the hypomyelinating mutant shiverer. Glia 2004, 48:51-63. 157. Readhead C, Popko B, Takahashi N, Shine H, Saavedra R, Sidman R, Hood L: Expression of a myelin basic protein gene in transgenic shiverer mice: correction of the dysmyelinating phenotype. Cell Press 1987, 48:713-721. 158. Bothma JP, Garcia HG, Ng S, Perry MW, Gregor T, Levine M: Enhancer additivity and non-additivity are determined by enhancer strength in the Drosophila embryo. Elife 2015, 4. 159. Cai J, Zhu Q, Zheng K, Li H, Qi Y, Cao Q, Qiu M: Co-localization of Nkx6.2 and Nkx2.2 homeodomain proteins in differentiated myelinating oligodendrocytes. Glia 2010, 58:458-468. 160. Lopez-Anido C, Sun G, Koenning M, Srinivasan R, Hung HA, Emery B, Keles S, Svaren J: Differential Sox10 genomic occupancy in myelinating glia. Glia 2015. 161. Meijer DH, Kane MF, Mehta S, Liu H, Harrington E, Taylor CM, Stiles CD, Rowitch DH: Separated at birth? The functional and molecular divergence of OLIG1 and OLIG2. Nat Rev Neurosci 2012, 13:819-831. 162. Fukaya T, Lim B, Levine M: Enhancer Control of Transcriptional Bursting. Cell 2016, 166:358-368. 163. Levine M, Cattoglio C, Tjian R: Looping back to leap forward: transcription enters a new era. Cell 2014, 157:13-25. 164. Chong S, Chen C, Ge H, Xie XS: Mechanism of transcriptional bursting in bacteria. Cell 2014, 158:314-326.

165. Coulon A, Chow CC, Singer RH, Larson DR: Eukaryotic transcriptional dynamics: from single molecules to cell populations. Nat Rev Genet 2013, 14:572-584. 166. Sanchez A, Golding I: Genetic Determinants and Cellular Constraints in Noisy Gene Expression. Science 2013, 342:1188-1193. 167. Foley K, Engel J: Individual stage selector element mutations lead to reciprocal changes in beta- vs. epsilon-globin gene transcription: genetic confirmation of promoter competition during globin gene switching. Genes & Development 1992, 6:730-744. 168. Choi OB, Engel JD: Developmental regulation of beta-globin gene switching. Cell Press 1998, 55:17-26. 169. Kornblihtt AR, Schor IE, Allo M, Dujardin G, Petrillo E, Munoz MJ: Alternative splicing: a pivotal step between eukaryotic transcription and translation. Nat Rev Mol Cell Biol 2013, 14:153-165. 170. Pandya-Jones A, Black DL: Co-transcriptional splicing of constitutive and alternative exons. RNA 2009, 15:1896-1908. 171. de la Mata M, Lafaille C, Kornblihtt AR: First come, first served revisited: factors affecting the same alternative splicing event have different effects on the relative rates of intron removal. RNA 2010, 16:904-912. 172. Ip JY, Schmidt D, Pan Q, Ramani AK, Fraser AG, Odom DT, Blencowe BJ: Global impact of RNA polymerase II elongation inhibition on alternative splicing regulation. Genome Res 2011, 21:390-401. 173. Dutertre M, Sanchez G, De Cian MC, Barbier J, Dardenne E, Gratadou L, Dujardin G, Le Jossic-Corcos C, Corcos L, Auboeuf D: Cotranscriptional exon skipping in the genotoxic stress response. Nat Struct Mol Biol 2010, 17:1358-1366. 174. Solier S, Barb J, Zeeberg BR, Varma S, Ryan MC, Kohn KW, Weinstein JN, Munson PJ, Pommier Y: Genome-wide analysis of novel splice variants induced by topoisomerase I poisoning shows preferential occurrence in genes encoding splicing factors. Cancer Res 2010, 70:8055-8065. 175. Chomiak T, Hu B: What is the optimal value of the g-ratio for myelinated fibers in the rat CNS? A theoretical approach. PLoS One 2009, 4:e7754. 176. Dawson M: NG2-expressing glial progenitor cells: an abundant and widespread population of cycling cells in the adult rat CNS. Molecular and Cellular Neuroscience 2003, 24:476-488.