DOCSLIB.ORG

Identification and Functional Characterisation of Non-Canonical DNA Methylation Readers in the Mammalian Brain

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identification and Functional Characterisation of Non-Canonical DNA Methylation Readers in the Mammalian Brain Identification and functional characterisation of non-canonical DNA methylation readers in the mammalian brain Sufyaan Mohamed School of Molecular Sciences ARC Centre of Excellence in Plant Energy Biology Harry Perkins Institute of Medical Research 2020 Supervisors: Professor Ryan Lister (60%) Associate Professor Ozren Bogdanovic (20%) Dr Yuliya Karpievitch (10%) Professor Ian Small (5%) Associate Professor Monika Murcha (5%) i i. Thesis Declaration: I, Sufyaan Mohamed, certify that: The work in this thesis has been substantially accomplished during enrolment in this degree. This thesis does not contain material which has been accepted for the reward of any other degree or diploma in my name, in any university or other tertiary institution. No part of this work will, in the future, be used in a submission in my name, for any other degree or diploma in any university or other tertiary institution without the prior approval of The University of Western Australia and where applicable, any partner institution responsible for the joint award of this degree. This thesis does not contain any material previously published or written by another person, except where due reference has been made in the text. The work(s) presented here are not in any way a violation or infringement of any copyright, trademark, patent, or other rights whatsoever of any person. Mass spectrometry samples were processed by Ino Karemaker. The ProteoMM code used for the analysis of the human and mouse datasets described in Chapter III was written by Dr. Yuliya Karpievitch This thesis contains published work and/or work prepared for publication, some of which has been co-authored. Signature: Date: 07/12/2020 ii ii. Abstract DNA methylation is a covalent modification found in all vertebrates and functions as an additional layer of information through which transcription may be controlled. Changes in transcription may be modulated by proteins that bind to DNA methylation termed methyl ‘readers’. DNA Methylation (mC) within mammals occurs predominantly in the CG dinucleotide context (mCG), but non-CG contexts (mCH, where H = A, C or T) exist within restricted cell types. In the brain, mCH accumulates to become the dominant form of DNA methylation in adult neurons, coinciding with synaptogenesis. Whilst many mCG reader proteins have been identified and characterised, the relatively recent discovery of mCA has meant that only one mCH reader, MECP2, has been discovered. This PhD focused on identifying many potential mCG and mCA reader candidate proteins in the human and mouse brain. A DNA pull-down utilising methylated probes and unmethylated controls were coupled with quantitative mass spectrometry (MS) to screen for potential mCG and mCA binders in human and mouse brain. Chapter 1 presents an introduction to DNA methylation in mammals, and the mechanisms by which this epigenetic mark is deposited, removed and read. Additionally, Chapter 1 discusses some well characterised mCG reader proteins, their effects on transcription and experimental challenges faced in characterising their binding. Chapter 2 contains relevant methods to experiments discussed in Chapters 3,4 and 5. A novel, multivariate Proteomics analysis tool, ProteoMM, was developed to analyse the DNA pull-down MS data. The rationale behind development of ProteoMM, its optimisation and efficacy are detailed in Chapter 3. The identification of novel mCG and mCA readers are discussed in Chapters 4 and 5 respectively. Results from the mCA screen established a list of candidate mCA readers. The top mCA reader, MBD2, was chosen for biochemical validation experiments to confirm a direct, specific interaction for mCA. Details regarding the recombinant expression, purification and DNA binding ability of this protein are also detailed in Chapter 5. This work constitutes the first comprehensive combined analysis of mCG readers in human and mouse brain. ProteoMM identified a significant overlap in the binding of proteins enriched in each species. Further, this study constitutes the first mCA reader screen, and confirms a direct, specific affinity of MBD2 for mCA providing a crucial repository of mCG and mCA binders future studies can build upon (Chapter 6). iii iii. Acknowledgements There are many names and faces of people that cross my mind when thinking about the completion of my PhD. First and foremost is my family, who have supported me through the ups and downs of my PhD and were there through the highs, lows and stressful situations. You were the backbone I needed, emotionally and financially, especially in the latter years of my PhD. Another individual I am eternally grateful to is my partner Nathan for his understanding, patience, support and confidence. I would like to thank my supervisor Prof. Ryan Lister for his feedback, support, and for inspiring a sense of drive and excellence within me, helping me become a better scientist. I would also like to thank my co-supervisors Prof. Ian Small, Assoc. Prof. Prof. Monika Murcha and Assoc. Prof. Ozren Bogdanovic for being good mentors and individuals I could go to for advice when needed. I am really grateful to Dr Yuliya Karpievitch for the numerous sessions spent in her office in which I learnt vital programming skills. I would also like to extend my gratification to Dr Ethan Ford, a master molecular biologist and great individual with sound advice in my early years, as well as Dr Marina Oliva for her advice, banter and comedic relief. Some other notable post-docs include Dr Daniel Poppe for his patience, and for sharing his knowledge and time in cell culture and microscopy, Christian Pflueger for his knowledge (in all matters) and Jahnvi Pflueger for her time in ensuring the laboratory functioned efficiently and for running the numerous NGS libraries I had prepared. Thanks to Tessa for helping revise parts of my thesis, and to the many other students in the lab. Extending out of the Lister lab, I would like to thank Prof. Charlie Bond for making time, having patience and allowing me to learn about recombinant protein expression in his lab. Special thanks to Dr Gavin Knott and Dr Amanda Blythe within this lab among the other, always friendly members for their invaluable advice and patience in teaching me how to operate the sensitive chromatography systems. I would also like to thank Dr Cathie Small, who has been a fond part of my memories since I was introduced to the PEB family as an undergraduate. Alongside, I would like to extend thanks to the admin team, most notably Deb for handling orders, errors and anything lab reagent related, and to Geetha for always being a friendly face, helpful and ever dependable in all matters related to admin. Thanks go out to the many individuals and PhD students that made my experience a more wholesome one. Some have, been and gone, but I am grateful to have known you all. Special mention to Katharina, Karina, Jakob, Jon, Dennis, Tim, Arnold and Max. Thank you for the memories and support, in so many instances, you were all instrumental to my wellbeing. This research was supported by an Australian Government Research Training Program (RTP) Scholarship. iv iv. Authorship declaration This thesis contains work that has been prepared for publication. Details of work: Identification of mCG and mCA readers in human and mouse brain Location in thesis: Chapters 3, 4 and 5 Contribution(s) to work: The processing of mass spectrometry samples was performed by Dr Ino Karemaker. The development of ProteoMM was performed by Dr Yuliya Karpievitch who was responsible for development of analysis code concerning the integration, imputation, and normalisation of these datasets. The totality of remaining experiments was performed by the student. These include isolation of protein extract from human and mouse brain, DNA pull-downs, Western blots, optimising and benchmarking ProteoMM, recombinant DNA cloning, recombinant protein expression and purification, electrophoretic mobility shift assays, and all other data analysis and plots within thesis. Student signature: Date:07/12/2020 I, Ryan Lister, certify that the student’s statements regarding their contribution to each of the works listed above are correct. Coordinating supervisor signature Date:07/12/2020 v Table of contents i. Thesis Declaration: ii ii. Abstract iii iii. Acknowledgements iv iv. Authorship declaration v Chapter I Introduction I-11 Epigenetics I-11 I.1.1 Definition of epigenetics I-11 Sculpting the epigenome landscape I-12 I.2.1 Layers of the epigenome I-13 Features of DNA methylation in mammals I-19 I.3.1 DNA methylation at CpG islands (CGIs) I-19 I.3.2 DNA methylation at enhancers and intergenic regions I-20 I.3.3 DNA methylation and alternative gene splicing I-22 I.3.4 CH methylation I-23 Writing, maintenance, and removal of DNA methylation in mammalian genomes I-24 I.4.1 Writers of DNA methylation I-24 I.4.2 Erasure of DNA methylation I-26 Readers of DNA methylation I-28 I.5.1 The MBD family I-28 I.5.2 Set and RING- associated (SRA) family I-35 I.5.3 Kaiso and the Broad complex, Tramtrack, Bric-á-brac or Poxvirus Zinc-finger (BTB/POZ) family I-36 I.5.4 Expansion of the mCG reader repertoire and the need for contextually relevant, multifaceted characterisation approaches I-38 I.5.5 A need for mCH reader characterisation I-40 Outline of thesis I-41 References I-42 Chapter II Materials and methods II-67 DNA pull-down coupled to Mass spectrometry II-67 II.1.1 Nuclei isolation and protein extraction from mammalian brain II-67 II.1.2 Preparation of biotinylated probes II-67 II.1.3
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Investigation of Candidate Genes and Mechanisms Underlying Obesity
    Prashanth et al. BMC Endocrine Disorders (2021) 21:80 https://doi.org/10.1186/s12902-021-00718-5 RESEARCH ARTICLE Open Access Investigation of candidate genes and mechanisms underlying obesity associated type 2 diabetes mellitus using bioinformatics analysis and screening of small drug molecules G. Prashanth1 , Basavaraj Vastrad2 , Anandkumar Tengli3 , Chanabasayya Vastrad4* and Iranna Kotturshetti5 Abstract Background: Obesity associated type 2 diabetes mellitus is a metabolic disorder ; however, the etiology of obesity associated type 2 diabetes mellitus remains largely unknown. There is an urgent need to further broaden the understanding of the molecular mechanism associated in obesity associated type 2 diabetes mellitus. Methods: To screen the differentially expressed genes (DEGs) that might play essential roles in obesity associated type 2 diabetes mellitus, the publicly available expression profiling by high throughput sequencing data (GSE143319) was downloaded and screened for DEGs. Then, Gene Ontology (GO) and REACTOME pathway enrichment analysis were performed. The protein - protein interaction network, miRNA - target genes regulatory network and TF-target gene regulatory network were constructed and analyzed for identification of hub and target genes. The hub genes were validated by receiver operating characteristic (ROC) curve analysis and RT- PCR analysis. Finally, a molecular docking study was performed on over expressed proteins to predict the target small drug molecules. Results: A total of 820 DEGs were identified between
    [Show full text]
  • Cell Reprogramming Technologies for Treatment And
    CELL REPROGRAMMING TECHNOLOGIES FOR TREATMENT AND UNDERSTANDING OF GENETIC DISORDERS OF MYELIN by ANGELA MARIE LAGER Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Thesis advisor: Paul J Tesar, PhD Department of Genetics and Genome Sciences CASE WESTERN RESERVE UNIVERSITY May 2015 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the thesis/dissertation of Angela Marie Lager Candidate for the Doctor of Philosophy degree*. (signed) Ronald A Conlon, PhD (Committee Chair) Paul J Tesar, PhD (Advisor) Craig A Hodges, PhD Warren J Alilain, PhD (date) 31 March 2015 *We also certify that written approval has been obtained from any proprietary material contained therein. TABLE OF CONTENTS Table of Contents……………………………………………………………………….1 List of Figures……………………………………………………………………………4 Acknowledgements……………………………………………………………………..7 Abstract…………………………………………………………………………………..8 Chapter 1: Introduction and Background………………………………………..11 1.1 Overview of mammalian oligodendrocyte development in the spinal cord and myelination of the central nervous system…………………..11 1.1.1 Introduction……………………………………………………..11 1.1.2 The establishment of the neuroectoderm and ventral formation of the neural tube…………………………………..12 1.1.3 Ventral patterning of the neural tube and specification of the pMN domain in the spinal cord……………………………….15 1.1.4 Oligodendrocyte progenitor cell production through the process of gliogenesis ………………………………………..16 1.1.5 Oligodendrocyte progenitor cell to oligodendrocyte differentiation…………………………………………………...22
    [Show full text]
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]
  • Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes.
    [Show full text]
  • WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization I International Bureau (10) International Publication Number (43) International Publication Date WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT (51) International Patent Classification: CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, C12Q 1/68 (2018.01) A61P 31/18 (2006.01) DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, C12Q 1/70 (2006.01) HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, (21) International Application Number: MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, PCT/US2018/056167 OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, (22) International Filing Date: SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, 16 October 2018 (16. 10.2018) TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (26) Publication Language: English GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, (30) Priority Data: UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, 62/573,025 16 October 2017 (16. 10.2017) US TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, ΓΕ , IS, IT, LT, LU, LV, (71) Applicant: MASSACHUSETTS INSTITUTE OF MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TECHNOLOGY [US/US]; 77 Massachusetts Avenue, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, Cambridge, Massachusetts 02139 (US).
    [Show full text]
  • Table SI. Primer List of Genes Used for Reverse Transcription‑Quantitative PCR Validation
    Table SI. Primer list of genes used for reverse transcription‑quantitative PCR validation. Genes Forward (5'‑3') Reverse (5'‑3') Length COL1A1 AGTGGTTTGGATGGTGCCAA GCACCATCATTTCCACGAGC 170 COL6A1 CCCCTCCCCACTCATCACTA CGAATCAGGTTGGTCGGGAA 65 COL2A1 GGTCCTGCAGGTGAACCC CTCTGTCTCCTTGCTTGCCA 181 DCT CTACGAAACCAGGATGACCGT ACCATCATTGGTTTGCCTTTCA 192 PDE4D ATTGCCCACGATAGCTGCTC GCAGATGTGCCATTGTCCAC 181 RP11‑428C19.4 ACGCTAGAAACAGTGGTGCG AATCCCCGGAAAGATCCAGC 179 GPC‑AS2 TCTCAACTCCCCTCCTTCGAG TTACATTTCCCGGCCCATCTC 151 XLOC_110310 AGTGGTAGGGCAAGTCCTCT CGTGGTGGGATTCAAAGGGA 187 COL1A1, collagen type I alpha 1; COL6A1, collagen type VI, alpha 1; COL2A1, collagen type II alpha 1; DCT, dopachrome tautomerase; PDE4D, phosphodiesterase 4D cAMP‑specific. Table SII. The differentially expressed mRNAs in the ParoAF_Control group. Gene ID logFC P‑Value Symbol Description ENSG00000165480 ‑6.4838 8.32E‑12 SKA3 Spindle and kinetochore associated complex subunit 3 ENSG00000165424 ‑6.43924 0.002056 ZCCHC24 Zinc finger, CCHC domain containing 24 ENSG00000182836 ‑6.20215 0.000817 PLCXD3 Phosphatidylinositol‑specific phospholipase C, X domain containing 3 ENSG00000174358 ‑5.79775 0.029093 SLC6A19 Solute carrier family 6 (neutral amino acid transporter), member 19 ENSG00000168916 ‑5.761 0.004046 ZNF608 Zinc finger protein 608 ENSG00000134343 ‑5.56371 0.01356 ANO3 Anoctamin 3 ENSG00000110400 ‑5.48194 0.004123 PVRL1 Poliovirus receptor‑related 1 (herpesvirus entry mediator C) ENSG00000124882 ‑5.45849 0.022164 EREG Epiregulin ENSG00000113448 ‑5.41752 0.000577 PDE4D Phosphodiesterase
    [Show full text]
  • Supporting Table S3 for PDF Maker
    Supplemental Table S3. Annotation of identified proteins. Number of Sequence Accession Number of Theoretical Subcellular Number Locus ID Gene Name Protein Name Identified Coverage Theoretical pI Protein Family NSAF Number Amino Acid MW (Da) Location of TMD Peptides (%) (O08539) Myc box-dependent-interacting protein 1 O08539 BIN1_MOUSE BIN1 (Bridging integrator 1) (Amphiphysin-like protein) 3 10.5 588 64470 5 Nucleus other NONE 5.73E-05 (Amphiphysin II) (SH3-domain-containing protein 9) (O08547) Vesicle-trafficking protein SEC22b (SEC22 O08547 SC22B_MOUSE SEC22B 5 30.4 214 24609 8.5 Cytoplasm other 2 0.000262 vesicle-trafficking protein-like 1) (O08553) Dihydropyrimidinase-related protein 2 (DRP-2) O08553 DPYL2_MOUSE DPYSL2 5 19.4 572 62278 6.4 Cytoplasm enzyme NONE 7.85E-05 (ULIP 2 protein) O08579 EMD_MOUSE EMD (O08579) Emerin 1 5.8 259 29436 5 Nucleus other 1 8.67E-05 (O08583) THO complex subunit 4 (Tho4) (RNA and transcription O08583 THOC4_MOUSE THOC4 export factor-binding protein 1) (REF1-I) (Ally of AML-1 1 9.8 254 26809 11.2 Nucleus NONE 2.21E-05 regulator and LEF-1) (Aly/REF) O08585 CLCA_MOUSE CLTA (O08585) Clathrin light chain A (Lca) 2 4.7 235 25557 4.5 Plasma Membrane other NONE 0.000287 (O08600) Endonuclease G, mitochondrial precursor (EC O08600 NUCG_MOUSE ENDOG 4 23.1 294 32191 9.5 Cytoplasm enzyme NONE 0.000134 3.1.30.-) (Endo G) (O08638) Myosin-11 (Myosin heavy chain, smooth O08638 MYH11_MOUSE MYH11 8 6.6 1972 227026 5.5 Cytoplasm other NONE 3.13E-05 muscle isoform) (SMMHC) (O08648) Mitogen-activated protein kinase kinase
    [Show full text]
  • Isolating the Role of Corticosterone in the Hypothalamic-Pituitary-Gonadal Genomic Stress Response
    bioRxiv preprint doi: https://doi.org/10.1101/2020.10.08.330209; this version posted October 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. 1 Isolating the role of corticosterone in the hypothalamic-pituitary-gonadal 2 genomic stress response 3 4 By: Suzanne H. Austin1, *, Rayna Harris1, April M. Booth1, Andrew S. Lang2, Victoria S. Farrar1, 5 Jesse S. Krause1, 3, Tyler A. Hallman4, Matthew MacManes2, and Rebecca M. Calisi1 6 7 1Department of Neurobiology, Physiology, and Behavior, University of California Davis, 1 8 Shields Avenue, Davis, CA, USA, 95616 9 2 Department of Molecular, Cellular and Biomedical Sciences, The University of New 10 Hampshire, 434 Gregg Hall, Durham, NH, USA, 03824 11 3 Department of Biology, University of Nevada, Reno, 1664 N. Virginia Street, Reno, NV, USA, 12 89557-0314 13 4 Department of Fisheries and Wildlife, Oregon State University, 104 Nash Hall, Corvallis, OR 14 97331 15 16 *Current address: 17 Department of Integrative Biology, Oregon State University, 3029 Cordley Hall, Corvallis, OR, 18 USA, 97331; Department of Fisheries and Wildlife, Oregon State University, 104 Nash Hall, 19 Corvallis, OR 97331 20 21 22 23 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.08.330209; this version posted October 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Figure S1. HAEC ROS Production and ML090 NOX5-Inhibition
    Figure S1. HAEC ROS production and ML090 NOX5-inhibition. (a) Extracellular H2O2 production in HAEC treated with ML090 at different concentrations and 24 h after being infected with GFP and NOX5-β adenoviruses (MOI 100). **p< 0.01, and ****p< 0.0001 vs control NOX5-β-infected cells (ML090, 0 nM). Results expressed as mean ± SEM. Fold increase vs GFP-infected cells with 0 nM of ML090. n= 6. (b) NOX5-β overexpression and DHE oxidation in HAEC. Representative images from three experiments are shown. Intracellular superoxide anion production of HAEC 24 h after infection with GFP and NOX5-β adenoviruses at different MOIs treated or not with ML090 (10 nM). MOI: Multiplicity of infection. Figure S2. Ontology analysis of HAEC infected with NOX5-β. Ontology analysis shows that the response to unfolded protein is the most relevant. Figure S3. UPR mRNA expression in heart of infarcted transgenic mice. n= 12-13. Results expressed as mean ± SEM. Table S1: Altered gene expression due to NOX5-β expression at 12 h (bold, highlighted in yellow). N12hvsG12h N18hvsG18h N24hvsG24h GeneName GeneDescription TranscriptID logFC p-value logFC p-value logFC p-value family with sequence similarity NM_052966 1.45 1.20E-17 2.44 3.27E-19 2.96 6.24E-21 FAM129A 129. member A DnaJ (Hsp40) homolog. NM_001130182 2.19 9.83E-20 2.94 2.90E-19 3.01 1.68E-19 DNAJA4 subfamily A. member 4 phorbol-12-myristate-13-acetate- NM_021127 0.93 1.84E-12 2.41 1.32E-17 2.69 1.43E-18 PMAIP1 induced protein 1 E2F7 E2F transcription factor 7 NM_203394 0.71 8.35E-11 2.20 2.21E-17 2.48 1.84E-18 DnaJ (Hsp40) homolog.
    [Show full text]
  • The NANOG Transcription Factor Induces Type 2 Deiodinase Expression and Regulates the Intracellular Activation of Thyroid Hormone in Keratinocyte Carcinomas
    Cancers 2020, 12 S1 of S18 Supplementary Materials: The NANOG Transcription Factor Induces Type 2 Deiodinase Expression and Regulates the Intracellular Activation of Thyroid Hormone in Keratinocyte Carcinomas Annarita Nappi, Emery Di Cicco, Caterina Miro, Annunziata Gaetana Cicatiello, Serena Sagliocchi, Giuseppina Mancino, Raffaele Ambrosio, Cristina Luongo, Daniela Di Girolamo, Maria Angela De Stefano, Tommaso Porcelli, Mariano Stornaiuolo and Monica Dentice Figure S1. Strategy for the mutagenesis of Dio2 promoter. (A) Schematic representation of NANOG Binding Site within the Dio2 promoter region. (B) Schematic diagram for site‐directed mutagenesis of NANOG Binding Site on Dio2 promoter region by Recombinant PCR. (C) Representation of the mutated NANOG Binding Site on Dio2 promoter region. (D) Electropherogram of the NANOG Binding Site mutation within the Dio2 promoter. Cancers 2020, 12 S2 of S18 Figure S2. Strategy for the silencing of NANOG expression. (A) Cloning strategies for the generation of NANOG shRNA expression vectors. (B) Electropherograms of the NANOG shRNA sequences cloned into pcDNA3.1 vector. (C) Validation of effective NANOG down-modulation by two different NANOG shRNA vectors was assessed by Western Blot analysis of NANOG expression in BCC cells. (D) Quantification of NANOG protein levels versus Tubulin levels in the same experiment as in C is represented by histograms. Cancers 2020, 12 S3 of S18 Figure S3. The CD34+ cells are characterized by the expression of typical epithelial stemness genes. The mRNA levels of a panel of indicated stemness markers of epidermis were measured by Real Time PCR in the same experiment indicated in figure 3F and G. Cancers 2020, 12 S4 of S18 Figure S4.
    [Show full text]
  • Application of Microrna Database Mining in Biomarker Discovery and Identification of Therapeutic Targets for Complex Disease
    Article Application of microRNA Database Mining in Biomarker Discovery and Identification of Therapeutic Targets for Complex Disease Jennifer L. Major, Rushita A. Bagchi * and Julie Pires da Silva * Department of Medicine, Division of Cardiology, University of Colorado Anschutz Medical Campus, Aurora, CO 80045, USA; [email protected] * Correspondence: [email protected] (R.A.B.); [email protected] (J.P.d.S.) Supplementary Tables Methods Protoc. 2021, 4, 5. https://doi.org/10.3390/mps4010005 www.mdpi.com/journal/mps Methods Protoc. 2021, 4, 5. https://doi.org/10.3390/mps4010005 2 of 25 Table 1. List of all hsa-miRs identified by Human microRNA Disease Database (HMDD; v3.2) analysis. hsa-miRs were identified using the term “genetics” and “circulating” as input in HMDD. Targets CAD hsa-miR-1 Targets IR injury hsa-miR-423 Targets Obesity hsa-miR-499 hsa-miR-146a Circulating Obesity Genetics CAD hsa-miR-423 hsa-miR-146a Circulating CAD hsa-miR-149 hsa-miR-499 Circulating IR Injury hsa-miR-146a Circulating Obesity hsa-miR-122 Genetics Stroke Circulating CAD hsa-miR-122 Circulating Stroke hsa-miR-122 Genetics Obesity Circulating Stroke hsa-miR-26b hsa-miR-17 hsa-miR-223 Targets CAD hsa-miR-340 hsa-miR-34a hsa-miR-92a hsa-miR-126 Circulating Obesity Targets IR injury hsa-miR-21 hsa-miR-423 hsa-miR-126 hsa-miR-143 Targets Obesity hsa-miR-21 hsa-miR-223 hsa-miR-34a hsa-miR-17 Targets CAD hsa-miR-223 hsa-miR-92a hsa-miR-126 Targets IR injury hsa-miR-155 hsa-miR-21 Circulating CAD hsa-miR-126 hsa-miR-145 hsa-miR-21 Targets Obesity hsa-mir-223 hsa-mir-499 hsa-mir-574 Targets IR injury hsa-mir-21 Circulating IR injury Targets Obesity hsa-mir-21 Targets CAD hsa-mir-22 hsa-mir-133a Targets IR injury hsa-mir-155 hsa-mir-21 Circulating Stroke hsa-mir-145 hsa-mir-146b Targets Obesity hsa-mir-21 hsa-mir-29b Methods Protoc.
    [Show full text]