Supporting Table S3 for PDF Maker
Total Page：16
File Type：pdf, Size：1020Kb
Load more
Recommended publications
-
SLC44A1 Transport of Choline and Ethanolamine in Disease
SLC44A1 Transport of Choline and Ethanolamine in Disease by Adrian Taylor A Thesis presented to The University of Guelph In partial fulfilment of requirements for the degree of Doctor of Philosophy in Human Health and Nutritional Sciences Guelph, Ontario, Canada © Adrian Taylor, April, 2019 ABSTRACT SLC44A1 TRANSPORT OF CHOLINE AND ETHANOLAMINE IN DISEASE Adrian Taylor Advisor(s): University of Guelph, 2019 Marica Bakovic Choline and ethanolamine are important molecules required for the de novo synthesis of phosphatidylcholine (PC) and phosphatidylethanolamine (PE) via the Kennedy pathway. Additionally, these two molecules are vital for maintaining both muscular and neurological function. The goal of this thesis was to gain insight into PC and PE metabolism with the use of unique metabolic disturbances ranging from obesity and genetic mutations in neurodegenerative disease. Firstly, the protective effects of choline supplementation on muscular function were investigated within the Pcyt2+/- mouse model. In Pcyt2+/- mice, substrate flow through the CDP-ethanolamine branch of the Kennedy pathway was diminished resulting in triacylglycerol (TAG) accumulation and obesity. Supplemental choline improved muscle function by altering the expression of genes devoted to reducing TAG synthesis and restoring energy homeostasis. With this new insight about the role of choline in regulating metabolism, the cellular uptake mechanism of choline was then analyzed. Skin fibroblasts from two patients with homozygous mutations in the SLC44A1 gene suffering from Neurodegeneration with Brain Iron Accumulation (NBIA) were utilized. In these fibroblasts, SLC44A1 expression and choline uptake were drastically diminished. Moreover, PC levels were unaffected while PE levels were diminished relative to control, an indication of perturbed phospholipid homeostasis. -
Bacillus Anthracis Edema Factor Substrate Specificity: Evidence for New Modes of Action
Toxins 2012, 4, 505-535; doi:10.3390/toxins4070505 OPEN ACCESS toxins ISSN 2072–6651 www.mdpi.com/journal/toxins Review Bacillus anthracis Edema Factor Substrate Specificity: Evidence for New Modes of Action Martin Göttle 1,*, Stefan Dove 2 and Roland Seifert 3 1 Department of Neurology, Emory University School of Medicine, 6302 Woodruff Memorial Research Building, 101 Woodruff Circle, Atlanta, GA 30322, USA 2 Department of Medicinal/Pharmaceutical Chemistry II, University of Regensburg, D-93040 Regensburg, Germany; E-Mail: [email protected] 3 Institute of Pharmacology, Medical School of Hannover, Carl-Neuberg-Str. 1, D-30625 Hannover, Germany; E-Mail: [email protected] * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +1-404-727-1678; Fax: +1-404-727-3157. Received: 23 April 2012; in revised form: 15 June 2012 / Accepted: 27 June 2012 / Published: 6 July 2012 Abstract: Since the isolation of Bacillus anthracis exotoxins in the 1960s, the detrimental activity of edema factor (EF) was considered as adenylyl cyclase activity only. Yet the catalytic site of EF was recently shown to accomplish cyclization of cytidine 5′-triphosphate, uridine 5′-triphosphate and inosine 5′-triphosphate, in addition to adenosine 5′-triphosphate. This review discusses the broad EF substrate specificity and possible implications of intracellular accumulation of cyclic cytidine 3′:5′-monophosphate, cyclic uridine 3′:5′-monophosphate and cyclic inosine 3′:5′-monophosphate on cellular functions vital for host defense. In particular, cAMP-independent mechanisms of action of EF on host cell signaling via protein kinase A, protein kinase G, phosphodiesterases and CNG channels are discussed. -
Upregulation of Peroxisome Proliferator-Activated Receptor-Α And
Upregulation of peroxisome proliferator-activated receptor-α and the lipid metabolism pathway promotes carcinogenesis of ampullary cancer Chih-Yang Wang, Ying-Jui Chao, Yi-Ling Chen, Tzu-Wen Wang, Nam Nhut Phan, Hui-Ping Hsu, Yan-Shen Shan, Ming-Derg Lai 1 Supplementary Table 1. Demographics and clinical outcomes of five patients with ampullary cancer Time of Tumor Time to Age Differentia survival/ Sex Staging size Morphology Recurrence recurrence Condition (years) tion expired (cm) (months) (months) T2N0, 51 F 211 Polypoid Unknown No -- Survived 193 stage Ib T2N0, 2.41.5 58 F Mixed Good Yes 14 Expired 17 stage Ib 0.6 T3N0, 4.53.5 68 M Polypoid Good No -- Survived 162 stage IIA 1.2 T3N0, 66 M 110.8 Ulcerative Good Yes 64 Expired 227 stage IIA T3N0, 60 M 21.81 Mixed Moderate Yes 5.6 Expired 16.7 stage IIA 2 Supplementary Table 2. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis of an ampullary cancer microarray using the Database for Annotation, Visualization and Integrated Discovery (DAVID). This table contains only pathways with p values that ranged 0.0001~0.05. KEGG Pathway p value Genes Pentose and 1.50E-04 UGT1A6, CRYL1, UGT1A8, AKR1B1, UGT2B11, UGT2A3, glucuronate UGT2B10, UGT2B7, XYLB interconversions Drug metabolism 1.63E-04 CYP3A4, XDH, UGT1A6, CYP3A5, CES2, CYP3A7, UGT1A8, NAT2, UGT2B11, DPYD, UGT2A3, UGT2B10, UGT2B7 Maturity-onset 2.43E-04 HNF1A, HNF4A, SLC2A2, PKLR, NEUROD1, HNF4G, diabetes of the PDX1, NR5A2, NKX2-2 young Starch and sucrose 6.03E-04 GBA3, UGT1A6, G6PC, UGT1A8, ENPP3, MGAM, SI, metabolism -
Diplomarbeit
DIPLOMARBEIT Titel der Diplomarbeit „The influence of free fatty acids on the development of liver inflammation“ Verfasser Mario Kuttke, B.Sc. angestrebter akademischer Grad Magister der Naturwissenschaften (Mag.rer.nat.) Wien, 2012 Studienkennzahl lt. Studienblatt: A 490 Studienrichtung lt. Studienblatt: Diplomstudium Molekulare Biologie Betreuerin / Betreuer: A.o.Univ.-Prof.Dipl.-Ing.Dr. Marcela Hermann Danksagung Zuerst möchte ich mich bei a.o.Univ.-Prof. Dipl.-Ing. Dr. Marcela Hermann für die Betreuung meiner Diplomarbeit bedanken. Besonderer Dank gilt a.o.Univ-Prof. Dr. Bettina Grasl-Kraupp für die fachliche Unterstützung und Betreuung während der praktischen Durchführung der Arbeit. Weiters bedanke ich mich bei Sandra Sagmeister, Therese Böhm, Nora Bintner, Waltraud Schrottmaier, Melanie Pichlbauer, Marzieh Nejabat, Teresa Riegler, Bettina Wingelhofer und Christiane Maier für die ausgezeichnete Zusammenarbeit im Labor und die Unterstützung in allen Lebenslagen. Birgit Mir-Karner, Helga Koudelka und Krystyna Bukowska danke ich für ihre Hilfsbereitschaft und für die kollegiale Zusammenarbeit. Mein größter Dank gilt meinen Eltern, Ursula und Heinz, und meiner Großmutter, Theresia, die mir mein Studium ermöglicht und mich immer unterstützt haben, sowie meinem Bruder, Alex, der in allen Lebenslagen für mich da ist. Table of Contents TABLE OF CONTENTS INTRODUCTION ............................................................................................................................................. 4 HEPATOCELLULAR CARCINOMA (HCC) -
Investigation of Candidate Genes and Mechanisms Underlying Obesity
Prashanth et al. BMC Endocrine Disorders (2021) 21:80 https://doi.org/10.1186/s12902-021-00718-5 RESEARCH ARTICLE Open Access Investigation of candidate genes and mechanisms underlying obesity associated type 2 diabetes mellitus using bioinformatics analysis and screening of small drug molecules G. Prashanth1 , Basavaraj Vastrad2 , Anandkumar Tengli3 , Chanabasayya Vastrad4* and Iranna Kotturshetti5 Abstract Background: Obesity associated type 2 diabetes mellitus is a metabolic disorder ; however, the etiology of obesity associated type 2 diabetes mellitus remains largely unknown. There is an urgent need to further broaden the understanding of the molecular mechanism associated in obesity associated type 2 diabetes mellitus. Methods: To screen the differentially expressed genes (DEGs) that might play essential roles in obesity associated type 2 diabetes mellitus, the publicly available expression profiling by high throughput sequencing data (GSE143319) was downloaded and screened for DEGs. Then, Gene Ontology (GO) and REACTOME pathway enrichment analysis were performed. The protein - protein interaction network, miRNA - target genes regulatory network and TF-target gene regulatory network were constructed and analyzed for identification of hub and target genes. The hub genes were validated by receiver operating characteristic (ROC) curve analysis and RT- PCR analysis. Finally, a molecular docking study was performed on over expressed proteins to predict the target small drug molecules. Results: A total of 820 DEGs were identified between -
Cell Reprogramming Technologies for Treatment And
CELL REPROGRAMMING TECHNOLOGIES FOR TREATMENT AND UNDERSTANDING OF GENETIC DISORDERS OF MYELIN by ANGELA MARIE LAGER Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Thesis advisor: Paul J Tesar, PhD Department of Genetics and Genome Sciences CASE WESTERN RESERVE UNIVERSITY May 2015 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the thesis/dissertation of Angela Marie Lager Candidate for the Doctor of Philosophy degree*. (signed) Ronald A Conlon, PhD (Committee Chair) Paul J Tesar, PhD (Advisor) Craig A Hodges, PhD Warren J Alilain, PhD (date) 31 March 2015 *We also certify that written approval has been obtained from any proprietary material contained therein. TABLE OF CONTENTS Table of Contents……………………………………………………………………….1 List of Figures……………………………………………………………………………4 Acknowledgements……………………………………………………………………..7 Abstract…………………………………………………………………………………..8 Chapter 1: Introduction and Background………………………………………..11 1.1 Overview of mammalian oligodendrocyte development in the spinal cord and myelination of the central nervous system…………………..11 1.1.1 Introduction……………………………………………………..11 1.1.2 The establishment of the neuroectoderm and ventral formation of the neural tube…………………………………..12 1.1.3 Ventral patterning of the neural tube and specification of the pMN domain in the spinal cord……………………………….15 1.1.4 Oligodendrocyte progenitor cell production through the process of gliogenesis ………………………………………..16 1.1.5 Oligodendrocyte progenitor cell to oligodendrocyte differentiation…………………………………………………...22 -
Cellular and Molecular Signatures in the Disease Tissue of Early
Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of -
Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses
bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes. -
Table SI. Primer List of Genes Used for Reverse Transcription‑Quantitative PCR Validation
Table SI. Primer list of genes used for reverse transcription‑quantitative PCR validation. Genes Forward (5'‑3') Reverse (5'‑3') Length COL1A1 AGTGGTTTGGATGGTGCCAA GCACCATCATTTCCACGAGC 170 COL6A1 CCCCTCCCCACTCATCACTA CGAATCAGGTTGGTCGGGAA 65 COL2A1 GGTCCTGCAGGTGAACCC CTCTGTCTCCTTGCTTGCCA 181 DCT CTACGAAACCAGGATGACCGT ACCATCATTGGTTTGCCTTTCA 192 PDE4D ATTGCCCACGATAGCTGCTC GCAGATGTGCCATTGTCCAC 181 RP11‑428C19.4 ACGCTAGAAACAGTGGTGCG AATCCCCGGAAAGATCCAGC 179 GPC‑AS2 TCTCAACTCCCCTCCTTCGAG TTACATTTCCCGGCCCATCTC 151 XLOC_110310 AGTGGTAGGGCAAGTCCTCT CGTGGTGGGATTCAAAGGGA 187 COL1A1, collagen type I alpha 1; COL6A1, collagen type VI, alpha 1; COL2A1, collagen type II alpha 1; DCT, dopachrome tautomerase; PDE4D, phosphodiesterase 4D cAMP‑specific. Table SII. The differentially expressed mRNAs in the ParoAF_Control group. Gene ID logFC P‑Value Symbol Description ENSG00000165480 ‑6.4838 8.32E‑12 SKA3 Spindle and kinetochore associated complex subunit 3 ENSG00000165424 ‑6.43924 0.002056 ZCCHC24 Zinc finger, CCHC domain containing 24 ENSG00000182836 ‑6.20215 0.000817 PLCXD3 Phosphatidylinositol‑specific phospholipase C, X domain containing 3 ENSG00000174358 ‑5.79775 0.029093 SLC6A19 Solute carrier family 6 (neutral amino acid transporter), member 19 ENSG00000168916 ‑5.761 0.004046 ZNF608 Zinc finger protein 608 ENSG00000134343 ‑5.56371 0.01356 ANO3 Anoctamin 3 ENSG00000110400 ‑5.48194 0.004123 PVRL1 Poliovirus receptor‑related 1 (herpesvirus entry mediator C) ENSG00000124882 ‑5.45849 0.022164 EREG Epiregulin ENSG00000113448 ‑5.41752 0.000577 PDE4D Phosphodiesterase -
KONSTRUKTION VON ESCHERICHIA COLI PRODUKTIONSSTÄMMEN ZUR FERMENTATIVEN HERSTELLUNG VON SUCCINAT AUS GLYCERIN Stefan Söllner
KONSTRUKTION VON ESCHERICHIA COLI PRODUKTIONSSTÄMMEN ZUR FERMENTATIVEN HERSTELLUNG VON SUCCINAT AUS GLYCERIN Von der Fakultät 4 (Energie-, Verfahrens- und Biotechnik) der Universität Stuttgart zur Erlangung der Würde eines Doktors der Naturwissenschaften (Dr. rer. nat.) genehmigte Abhandlung Vorgelegt von Stefan Söllner aus Schweinfurt Hauptberichter: Prof. Dr. rer. nat. Ralf Mattes Mitberichter: Prof. Dr.-Ing. Ralf Takors Tag der mündlichen Prüfung: 29.02.2012 Institut für Industrielle Genetik Universität Stuttgart 2012 Vielen Dank! … Herrn Prof. Dr. R. Mattes danke ich für die Überlassung des interessanten Themas, des Arbeitsplatzes, für gelegentliches Aufmuntern und für die Erstellung des Erstgutachtens dieser Arbeit. … Herrn Prof. Dr. R. Takors danke ich für die freundliche Übernahme des Zweitgutachtens und für spannende Diskussionen. … Herrn Dr. Josef Altenbuchner danke ich für die praktische Betreuung dieser Arbeit, für diverse Einladungen zu Grillfesten und ganz besonders für die intensive Durchsicht des Manuskriptes!!! … Herrn Dr. Martin Siemann-Herzberg danke ich für die motivierende, überschwängliche Begeisterung, die meine Ideen und Ergebnisse bei deren Besprechung jedesmal auslösten. … Herrn Prof. Dr. Reuss danke ich für die Initiierung des Projektes lange vor meiner Zeit. … Meinen Kollegen und Exkollegen danke ich für die gute Zusammenarbeit, das abwechslungsreiche Arbeitsklima sowie die vielen fachlichen und nichtfachlichen Gespräche, welche die Arbeit immer spannend gestalteten. Vor allem danke ich für das Verständnis für die von mir durchgeführten, absolut notwendigen, regelmäßigen Arbeitskontrollen. … Frau Dr. Anne Völker hat mir die Integration zu Beginn meines Aufenthaltes am IIG sehr erleichtert. Herzlichen Dank dafür! … Herrn Kambiz Morabbi Heravi danke ich recht herzlich für die Einladung ans National Institute of Genetic Engineering and Biotechnology in Teheran, Iran und für die internationale Freundschaft. -
Dependent Protein Kinase to Cyclic CMP Agarose
Binding of Regulatory Subunits of Cyclic AMP- Dependent Protein Kinase to Cyclic CMP Agarose Andreas Hammerschmidt1., Bijon Chatterji2., Johannes Zeiser2, Anke Schro¨ der2, Hans- Gottfried Genieser3, Andreas Pich2, Volkhard Kaever1, Frank Schwede3, Sabine Wolter1", Roland Seifert1*" 1 Institute of Pharmacology, Hannover Medical School, Hannover, Germany, 2 Institute of Toxicology, Hannover Medical School, Hannover, Germany, 3 Biolog Life Science Institute, Bremen, Germany Abstract The bacterial adenylyl cyclase toxins CyaA from Bordetella pertussis and edema factor from Bacillus anthracis as well as soluble guanylyl cyclase a1b1 synthesize the cyclic pyrimidine nucleotide cCMP. These data raise the question to which effector proteins cCMP binds. Recently, we reported that cCMP activates the regulatory subunits RIa and RIIa of cAMP- dependent protein kinase. In this study, we used two cCMP agarose matrices as novel tools in combination with immunoblotting and mass spectrometry to identify cCMP-binding proteins. In agreement with our functional data, RIa and RIIa were identified as cCMP-binding proteins. These data corroborate the notion that cAMP-dependent protein kinase may serve as a cCMP target. Citation: Hammerschmidt A, Chatterji B, Zeiser J, Schro¨der A, Genieser H-G, et al. (2012) Binding of Regulatory Subunits of Cyclic AMP-Dependent Protein Kinase to Cyclic CMP Agarose. PLoS ONE 7(7): e39848. doi:10.1371/journal.pone.0039848 Editor: Andreas Hofmann, Griffith University, Australia Received May 11, 2012; Accepted May 31, 2012; Published July 9, 2012 Copyright: ß 2012 Hammerschmidt et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. -
Mullergliaregnerationtranscriptome
gene.id fc1 fc2 fc3 fc4 p1 p2 p3 p4 FDR.pvalue-1 Gene Symbol Gene Title Pathway go biological process term go molecular function term go cellular component term Dr.10016.1.A1_at -2.33397 -3.86923 -4.38335 -2.39965 0.935201 0.320614 0.208 0.917227 0.208 zgc:77556 zgc:77556 --- proteolysis arylesterase activity /// metallopeptidase activity /// zinc ion --- binding Dr.10024.1.A1 at 1.483417 2.531269 2.089091 1.698761 1 0.613 0.998961 1 0.613 zgc:171808 zgc:171808--- cell-cell signaling --- --- Dr.10051.1.A1 at -1.78449 -2.22024 -1.70922 -1.99464 1 0.901663 1 0.999955 0.9017 ccng2 cyclin G2 --- --- --- --- Dr.10061.1.A1 at 2.065955 2.274632 2.248958 2.507754 0.992 0.718655 0.83 0.600609 0.6006 zgc:173506 zgc:173506--- --- --- --- Dr.10061.2.A1 at 2.131883 2.616483 2.49378 2.815337 0.983443 0.711513 0.805599 0.519115 0.5191 zgc:173506 Zgc:17350 --- --- --- --- Dr.10065.1.A1 at -1.02315 -2.01596 -2.29343 -1.88944 1 0.999955 0.957199 1 0.9572 zgc:114139 zgc:114139--- --- --- cytoplasm /// centrosome Dr.10070.1.A1_at -1.74365 -2.52206 -2.39093 -1.86817 1 0.741254 0.885401 1 0.7413 fbp1a fructose-1, --- carbohydrate metabolic process hydrolase activity /// phosphoric ester hydrolase activity --- Dr.10074.1.S1_at 6.035545 10.44051 7.880519 5.020371 0.1104 0.044 0.062491 0.144679 0.044 pdgfaa platelet-der--- multicellular organismal development /// cell proliferation growth factor activity membrane Dr.10095.1.A1 at -1.73408 -2.11615 -1.47234 -2.19919 1 0.997562 1 0.978177 0.9782 wu:fk95g04 wu:fk95g04--- --- --- --- Dr.10110.1.S1 a at 3.929761 5.798708