Cell Reprogramming Technologies for Treatment And

CELL REPROGRAMMING TECHNOLOGIES FOR TREATMENT AND

UNDERSTANDING OF GENETIC DISORDERS OF MYELIN

ANGELA MARIE LAGER

Submitted in partial fulfillment of the requirements for the degree of

Doctor of Philosophy

Thesis advisor: Paul J Tesar, PhD

Department of Genetics and Genome Sciences

CASE WESTERN RESERVE UNIVERSITY

May 2015

CASE WESTERN RESERVE UNIVERSITY

SCHOOL OF GRADUATE STUDIES

We hereby approve the thesis/dissertation of

Angela Marie Lager

Candidate for the Doctor of Philosophy degree*.

(signed) Ronald A Conlon, PhD (Committee Chair)

Paul J Tesar, PhD (Advisor)

Craig A Hodges, PhD

Warren J Alilain, PhD

(date) 31 March 2015

*We also certify that written approval has been obtained from any proprietary material contained therein. TABLE OF CONTENTS

Table of Contents……………………………………………………………………….1

List of Figures……………………………………………………………………………4

Acknowledgements……………………………………………………………………..7

Abstract…………………………………………………………………………………..8

Chapter 1: Introduction and Background………………………………………..11

1.1 Overview of mammalian oligodendrocyte development in the spinal

cord and myelination of the central nervous system…………………..11

1.1.1 Introduction……………………………………………………..11

1.1.2 The establishment of the neuroectoderm and ventral

formation of the neural tube…………………………………..12

1.1.3 Ventral patterning of the neural tube and specification of the

pMN domain in the spinal cord……………………………….15

1.1.4 Oligodendrocyte progenitor cell production through the

process of gliogenesis ………………………………………..16

1.1.5 Oligodendrocyte progenitor cell to oligodendrocyte

differentiation…………………………………………………...22

1.1.6 Oligodendrocytes and their role in myelinating the central

nervous system………………………………………………...24

1.1.7 Summary………………………………………………………..29

1.2 Leukodystrophies: progressive, heritable disorders of myelin………..31

1.2.1 Introduction……………………………………………………..31

1.2.2 Pelizaeus-Merzbacher disease………………………………33

1.2.3 Krabbe disease………………………………………………...33

1.2.4 Summary………………………………………………………..39

1.3 Mouse models of human myelin-related diseases…………………….40

1.3.1 Introduction……………………………………………………..40

1.3.2 Shiverer: mouse model of hypomyelination………………...41

1.3.3 Twitcher: mouse model of Krabbe disease…………………43

1.3.4 Jimpy: mouse model of Pelizaeus-Merzbacher disease…..46

1.3.5 Summary………………………………………………………..48

1.4 Current cell reprograming and differentiation technologies…………..49

1.5 Summary and research aims…………………………………………….56

Chapter 2: Transcription factor-mediated reprogramming of fibroblasts to expandable, myelinogenic oligodendrocyte progenitor cells………………..58

2.1 Abstract…………………………………………………………………….59

2.2 Introduction………………………………………………………………...59

2.3 Methods…………………………………………………………………….61

2.4 Results……………………………………………………………………...72

2.5 Discussion………………………………………………………………….94

Chapter 3: Rapid screening platform for elucidating the role of candidate genes in the oligodendrocyte lineage……………………………………………96

3.1 Introduction………………………………………………………………...96

3.2 Methods…………………………………………………………………….98

3.3 Results…………………………………………………………………….108

3.4 Discussion………………………………………………………………..129

Chapter 4: Discussion of future directions…………………………………….131

4.1 Summary………………………………………………………………….131

4.2 Generation of autologous gene-corrected cell based therapies for

human disorders of myelin……………………………………………...134

4.3 Oligodendrocyte in vitro differentiation method as a first tier platform

for mouse model generation……………………………………………137

4.4 Identifying the genetic basis of oligodendrocyte identity by high-

throughput in vitro screening……………………………………………140

4.5 Elucidating gene-regulatory networks of the oligodendrocyte

lineage…………………………………………………………………….145

4.5.1 Understanding the role of oligodendrocyte enhancers in the

diagnosis of rare myelin diseases………………………….145

4.5.2 Delineating enhancers that contribute to oligodendrocyte

development………………………………………………….148

References…………………………………………………………………………....150

LIST OF FIGURES

Chapter 1

Figure 1.1 - TGFβ and BMP signaling pathway……………………………………14

Figure 1.2 - Patterning of the ventral neural tube………………………………….17

Figure 1.3 - Gliogenesis in the ventral spinal cord………………………………...20

Figure 1.4 - Oligodendrocyte progenitor cell proliferation and oligodendrocyte differentiation and maturation………………………………………………………...27

Figure 1.5 - Myelin of the central nervous system…………………………………30

Chapter 2

Figure 2.1 - Eight transcription factors can reprogram mouse embryonic fibroblasts to induced oligodendrocyte progenitor cells……………………………82

Figure 2.2 - Characterization of the selected eight transcription factor pool……83

Figure 2.3 - Characterization of MEFs utilized for reprogramming………………84

Figure 2.4 - Eight transcription factor induced MEFs exhibit properties of bona fide OPCs……………………………………………………………………………….85

Figure 2.5 - Properties of 8TF-induced MEFs……………………………………..86

Figure 2.6 - Eight transcription factor induced MEFs function to generate compact myelin………………………………………………………………………...87

Figure 2.7 - A2B5 immunosorting allows for the prospective enrichment of iOPCs…………………………………………………………………………………...88

Figure 2.8 - Narrowing down the 8TF pool…………………………………………89

Figure 2.9 - Sox10, Olig2, and Nkx6.2 are sufficient to reprogram fibroblasts to iOPCs…………………………………………………………………………………...90

Figure 2.10 - Properties of 3TF-induced MEFs……………………………………92

Figure 2.11 - Three transcription factors are able to induce iOPCs from an additional somatic cell source………………………………………………………..93

Chapter 3

Figure 3.1 - Mouse embryonic stem cells express canonical markers of pluripotency…………………………………………………………………………...117

Figure 3.2 - Generation of a robust population of OPCs from patterned mESCs………………………………………………………………………………...118

Figure 3.3 - mESC patterned cells express markers of the neuroectoderm…..119

Figure 3.4 - mESC patterned cells give rise to neurons…………………………120

Figure 3.5 - mESC derived OPCs robustly express cell surface markers NG2 and PDGFRa………………………………………………………………………….121

Figure 3.6 - mESC derived OPCs differentiate into myelin protein expressing oligodendrocytes……………………………………………………………………..122

Figure 3.7 - Shiverer induced pluripotent stem cells express canonical markers of pluripotency………………………………………………………………………..123

Figure 3.8 - Shiverer iPSC derived OPCs generate MBP negative oligodendrocytes……………………………………………………………………..124

Figure 3.9 - Shiverer iPSC derived OPCs robustly express cell surface markers

NG2 and PDGFRa…………………………………………………………………...125

Figure 3.10 - Gene correction of shiverer MBP deletion………………………...126

Figure 3.11 - CRISPR-Cas9 mediated gene perturbation………………………127

Figure 3.12 - Perturbations of known oligodendrocyte lineage genes cause oligodendrocytes to display deficits in myelin protein expression………………128

ACKNOWLEDGEMENTS

I would like to thank Jared M Cregg for his critical comments and edits of this document.

Cell Reprogramming Technologies for Treatment and Understanding of

Genetic Disorders of Myelin

Abstract

ANGELA MARIE LAGER

The oligodendrocyte lineage is essential for high-fidelity information transfer in neural circuits of the central nervous system. Oligodendrocytes arise from a pool of migratory progenitor cells that populate the brain and spinal cord shortly before birth. These oligodendrocyte progenitor cells undergo subsequent differentiation into mature oligodendrocytes, a cell whose primary function is to generate a multilayer protein-lipid membrane around axons termed myelin. Myelin segments allow saltatory conduction of action potentials down the axon, increasing impulse velocity by as much as 100-fold. Therefore, oligodendrocytes are thought to contribute to efficient signal processing in local microcircuits and are required for long-distance propagation of action potentials by projection neurons.

The importance of oligodendrocytes in central nervous system function is underscored by the prevalence of neurological diseases characterized by abnormal myelination. These diseases, collectively termed leukodystrophies, encompass a spectrum of disorders associated with mutations in over 40 different

8 oligodendrocyte lineage-specific genes. Although the genetic etiology for a majority of these disorders is well understood, less is known about how genetic abnormalities underlie cellular dysfunction and overt disease pathology. As there are currently no standard treatments for patients suffering from leukodystrophies, addressing this gap is of fundamental importance.

Recent use of mouse genetic models and cell reprogramming technologies has dramatically improved our ability to understand how genetic mutations underlie disease at the molecular, cellular, and systems level. We sought to adapt these technologies to develop a method for obtaining oligodendrocyte progenitor cells— a previously inaccessible cell type. Herein, I describe our identification of oligodendrocyte lineage-specific transcription factors and their subsequent use in direct reprogramming of mouse fibroblasts to induced oligodendrocyte progenitor cells (iOPCs). iOPCs exhibit morphology and gene expression profiles similar to bona fide oligodendrocyte progenitors, can be expanded in vitro in a progenitor state capable of differentiating into mature multiprocessed oligodendrocytes, and form compact myelin when grafted into the mouse central nervous system. We have also developed a second method that allows us to direct the differentiation of oligodendrocyte progenitor cells from wild type and mutant mouse pluripotent stem cell populations. By systematically treating mouse pluripotent stem cells with small molecules and growth factors that mimic growth factor conditions observed during development, we developed a robust and rapid method for obtaining a pure population of oligodendrocyte progenitor cells. Thus, through these methods, we gain new experimental access to oligodendrocyte lineage cells for the first time.

With the development of new protocols for obtaining pure populations of oligodendrocyte progenitor cells and mature oligodendrocytes, we can begin to address gaps in our basic knowledge and make technological advances in several areas: First, access to oligodendrocyte lineage cells may allow us to study regulatory programs that underlie oligodendrocyte development and acquisition of terminal identity features. Second, we may now model genetic determinants of leukodystrophies in culture to gain insight into how genetic mutations give rise to cellular dysfunction. These studies might provide a platform for drug-discovery, allowing the identification of candidate compounds that successfully modulate disease progression. Third, cell reprogramming technologies have opened the door for cell based therapies in disease management. As we can now generate oligodendrocyte progenitor cells from autologous sources, we may be able to develop personalized cell based therapies for those suffering from leukodystrophies; however, these strategies will require correction of genetic abnormalities that underlie disease. Together, our methods of obtaining oligodendrocyte progenitor cells act as a basis for future studies into treatments for patients suffering from leukodystrophies and disease understanding.

Chapter 1: Introduction and Background

1.1 Overview of mammalian oligodendrocyte development in the spinal cord and myelination of the central nervous system

1.1.1 Introduction

Oligodendrocytes are responsible for myelination of central nervous system

(CNS) axons. Oligodendrocytes exhibit highly ramified processes that ensheath several neighboring axons with a multilaminar protein-lipid myelin membrane.

Segments of myelin act to prevent leakage of Na+ ions from the axolemma, allowing rapid conduction of Na+ currents (i.e. action potentials) down the axon.

Myelin segments also direct the specialization of nodal structures in the axolemma, termed Nodes of Ranvier, which exhibit a high density of voltage-gated Na+ channels. These specializations, situated between segments of myelin, allow the regeneration of Na+ currents during action potential propagation. Therefore, oligodendrocyte derived myelin is critical for preventing degeneration of Na+ currents, and thus, required for action potential propagation in large diameter axons of the mammalian CNS. The development of oligodendrocytes and the process by which they myelinate axons is complex and incompletely understood.

Here we review current knowledge regarding oligodendrocyte development and myelination with the idea that these principles will yield mechanistic insight into the basis of dysmyelinating diseases.

1.1.2 The establishment of the neuroectoderm and the formation of the neural tube

During early embryonic gastrulation, the embryo organizes itself into a laminar structure composed of three germ layers: the endoderm, mesoderm, and ectoderm. The specification of each of these distinct germ layers is directed by growth factors that act through specific signaling pathways to regulate cellular fate.

The mesoderm and endoderm are specified by transforming growth factor-β

(TGFβ) family ligands. The TGFβ family is comprised of more than 30 individual

TGFβ ligands that are categorized into two functional groups: (1) the transforming growth factor beta-like group, which includes TGFβs, activins, and nodals, and (2) the bone morphogenetic protein-like group, which includes bone morphogenetic proteins (BMPs) and anti-Mullerian hormone (AMH). These proteins work through their cognate receptors to phosphorylate intracellular Smads (Figure 1.1). BMPs bind to type I/II BMP receptors leading to the phosphorylation of type I ALK receptors, which in turn, allow the phosphorylation and activation of Smads 1/5/8.

Activin, nodal, and TGFβs work similarly through type I/II TGFβ receptors, but cause the phosphorylation of Smads 2/3. Phosphorylated Smads 1/2/3/5/8 bind

Smad4 (also referred to as co-Smad) to form an activated Smad complex that translocates to the nucleus. This Smad transcription factor complex recruits co- activators or co-repressors to facilitate or inhibit gene expression at target loci. In this manner, TGFβ ligands act in the specification of the mesoderm and endoderm.

The formation of the neuroectoderm is specified by TGFβ ligand antagonists that bind and sequester TGFβ ligands, preventing their engagement

12 of type II receptors. During gastrulation, the primitive node, located on the dorsal side of the developing embryo, secretes the BMP-2/4/7 antagonists noggin, chordin, and follistatin (Figure 1.1). Additionally, the anterior visceral endoderm secretes Lefty1, which acts to inhibit type II receptor engagement by activin, nodal, and TGFβ ligands (Figure 1.1). TGFβ ligand antagonists therefore prevent the activation of Smads 1/2/3/5/8 and Smad-dependent transcriptional programs (Belo

JA et al. 1997, Meno C et al. 1999, Perea-Gomez et al. 2002; Reissmann et al.

2001; Schier et al. 2003; Smith et al. 2008). Inhibition of TGFβ signaling by ligand antagonists ultimately acts to anteriorize the developing embryo, allowing the formation of the neuroectoderm (Camus et al. 2006; Chambers et al. 2009;

Hemmati-Brivanlou et al. 1994). Although transcriptional programs underlying neuroectoderm formation are incompletely understood, expression of the transcription factors Sox1 and Pax6 coincides with neuroectoderm appearance, and is thought to be important for the induction and specification of neuroectoderm

(Pevny et al. 1998; Zhang et al. 2010).

After the primitive neuroectoderm thickens to form the neural plate, it begins morphogenesis to from the neural tube. As the neural tube closes, secretion of sonic hedgehog (SHH) from the ventral notochord acts in the induction of the medial floorplate (Chiang et al. 1996). Neural tube closure occurs when the neural plate bends at the centrally located floorplate and lateral hinge points. The furrowing of the lateral hinge points come together dorsally forming the neural tube.

Figure 1.1 – TGFβ and BMP signaling pathway. Sequestering of TGFβ and BMP signaling is essential for the formation of the neuroectoderm during gastrulation. TGFβs, nodals, and activins bind to type II TGFβ receptors leading to the recruitment and phosphorylation of type I receptors, which in turn, allow for the phosphorylation and activation of Smad 2 and Smad 3. Similarly, BMPs and anti-Mullerian homrome (AHM) bind to type II BMP receptors leading to the recruitment and phosphorylation of type I receptors leading to downstream phosphorylation of Smad 1, Smad 5, and Smad 8. Upon phosphorylation and activation, Smad 1/2/3/5/8 bind Smad 4 (co-smad) to from an activated Smad complex that translocates to the nucleus to facilitate or inhibit gene expression. The formation of the neuroectoderm is specificed by TGFβ and MBP signaling inhibitors. Lefty1 inhibits receptor engagement of the TGFβ pathway whereas BMP antagonists follistatin, noggin, and chordin work to inhibit the downstream processes of the BMP signaling pathway.

Ventral secretion of SHH is opposed by dorsally secreted BMP ligands (Ulloa and

Marti 2010). Furthermore, noggin (a BMP ligand antagonist) is secreted ventrally.

Noggin null embryos fail to form dorsolateral neural folds, resulting largely from increased activity of BMP4 in the dorsal neural folds (Stottmann et al. 2006). Thus, ventral secretion of noggin is important for inhibiting ventral action of BMP ligands

(Liem et al. 2000). Together, antagonistic gradients of SHH (high ventral/low dorsal) and BMPs (high dorsal/low ventral) establish distinct dorsal-ventral domains within the embryonic spinal cord.

1.1.3 Ventral patterning of the neural tube and specification of the pMN domain in the spinal cord

During development, notochord secreted SHH establishes five spatially and molecularly distinct progenitor domains in the ventral half of the neural tube (Figure

1.2). Neural progenitors from these domains express homeodomain proteins that act as intermediary factors for interpretation and sharpening of boundaries resulting from graded SHH signaling (Briscoe et al. 1999; Briscoe et al. 2000;

Pierani et al. 1999). Whereas SHH promotes the expression of class II homeodomain proteins (Nkx6.1 and Nxk2.2), SHH represses the expression of class I homeodomain proteins (Pax7, Dbx1, Dbx2, Irx3, and Pax6) in a concentration-dependent manner (Briscoe et al. 2000) (Figure 1.2). Combinatorial expression of these homeodomain proteins demarcates boundaries for each of five progenitor domains within the ventral neural tube, with p0 most dorsal, followed by p1, p2, pMN, and p3 most ventral (Figure 1.2). Interestingly,

15 complementary pairs of class I and class II homeodomain proteins in adjacent domains act in reciprocal repression, ensuring the establishment of sharp boundaries between each progenitor domain. Nkx6.1, Nkx2.2, and Irx3 govern the induction of the pMN domain in the ventral spinal cord, which is characterized by expression of Olig2 and Nkx6.1 (Lu et al. 2002).

Genetic studies in the mouse have demonstrated that Olig2 null mice exhibit arrested motor neuron and oligodendrocyte progenitor cell development

(Takebayashi et al. 2002) (Figure 1.2). Additionally, in the absence of the p3 domain transcription factor Nkx2.2, Olig1/Olig2 positive neuroepithelial cells exhibit ventral expansion into the p3 domain which results in an increased number of oligodendrocyte progenitors (Qi et al. 2001) (Figure 1.2). Together these studies demonstrate that oligodendrocyte progenitor cells arise from the pMN domain in the ventral neural tube following a period of neurogenesis (Lu et al. 2002).

1.1.4 Oligodendrocyte progenitor cell production through the process of gliogenesis

As motor neurons and oligodendrocytes both arise from the pMN domain of the ventral spinal cord, intricate transcriptional programs regulate neural versus glial specification of pMN domain progenitors. Proneural transcription factors act to repress gliogenesis and inhibit the development of oligodendrocyte progenitor cells. In the pMN domain, the proneural transcription factor Ngn2 is expressed in a subset of Olig2 expressing neuroepithelial cells at the time of motor neuron production (Mizuguchi et al. 2001; Novitch et al. 2001; Zhou et al. 2002) (Figure

Figure 1.2 – Patterning of the ventral neural tube. (a) During development the ventral neural tube organizes itself into five spatially distinct domains based on dorsal-ventral BMP/SHH graded signaling. Ventrally secreted SHH establishes the five domains of the ventral spinal cord by promoting the expression of class II homeodomain proteins (Nkx6.1 and Nkx2.2) while repressing the expression of class I homeodomain proteins (Dbx2, Pax6, Irx3, Dbx1, and Pax7). Combinatorial expression of these homeodomain proteins demarcate sharp boundaries for each of the five progenitor domains within the ventral neural tube with p0 most dorsal, followed by p1, p2, pMN, and p3 most ventral. (b) Elegant genetic studies in the mouse have demonstrated that Olig2 null mice exhibit arrested motor neuron and oligodendrocyte progenitor cell development where as the absence of Nkx2.2 leads to an increase in the number of oligodendrocyte progenitor cells. Together these studies have identified the location and domain in which oligodendrocyte progenitor cells arise from in the developing neural tube.

1.3). Zhou et al demonstrated that oligodendrocyte progenitor cell specification is preceded by downregulation of Ngn2, and furthermore, that ectopic expression of

Olig2 in the absence of Ngn2 leads to generation of oligodendrocyte progenitor cells (Zhou et al. 2001). These results indicate that Ngn2 is a key proneural determinant of neural versus glial specification of pMN domain progenitors. Delta-

Notch signaling also plays an important role in the specification of oligodendrocyte progenitor cells from pMN domain progenitors. Analysis in the mouse demonstrates that oligodendrocyte progenitor cells fail to develop in the absence of notch signaling, and pMN domain progenitors give rise solely to motor neurons

(Itoh et al. 2003; Yang et al. 2006) (Figure 1.3). Conversely, if Notch1 is overexpressed, neurogenesis is suppressed and the generation of oligodendrocyte progenitor cells is enhanced (Figure 1.3).

Historically it was believed that vertebrate glial cell development was a default developmental state arising consequently from the downregulation of proneural factors (Tropepe et al. 2001). In direct opposition to this view, however,

Stolt et al identified Sox9 as a major proglial transcription factor in the developing spinal cord. Stolt et al demonstrated that mice with conditional deletion of Sox9 in neural progenitor cells exhibit defects in the specification of oligodendrocyte progenitor cells from pMN domain progenitors, and exhibit concordant increases in the number of motor neurons (Stolt et al. 2003) (Figure 1.3). Thus, progenitors failed to switch from developmental programs defining neurogenesis to those defining gliogenesis. The implication of these findings is that specific transcriptional

18 programs underlie the commitment of neural progenitors to the oligodendrocyte lineage.

Several recent studies have proposed that generation of oligodendrocyte progenitors within the spinal cord can occur independently of pMN domain specification (Cai et al. 2005; Chandran et al. 2003; Vallstedt et al. 2005). Vallstedt et al. found that ventral pMN-derived oligodendrocytes require Nkx6.1 and Nkx6.2 for their specification, whereas a second more dorsal wave of oligodendrocytes is generated in an SHH-independent manner (Vallstedt et al. 2005). Fate-mapping studies by Fogarty et al have corroborated these findings by demonstrating a more dorsal, Dbx1-derived source of oligodendrocyte progenitor cells in the spinal cord

(Fogarty et al. 2005). In mouse, this second wave of oligodendrogenesis occurs at

E16.5, 4 days after pMN domain-directed oligodendrogenesis (Fogarty et al.

2005). Interestingly, this ventral to dorsal induction of oligodendrogenesis parallels the temporal development of the spinal cord as a whole (Cai et al. 2005; Fogarty et al. 2005; Vallstedt et al. 2005). At the population level, the contribution of ventrally derived oligodendrocyte progenitors relative those derived from more dorsal Dbx1 progenitors is about 4:1. Whether these two populations of oligodendrocyte progenitor cells exhibit functional heterogeneity, however, remains unknown.

During maturation, Olig2+ oligodendrocyte progenitors acquire several molecular features of identity, including the expression of Nkx2.2, Sox10, NG2, and PDGFRa (Figure 1.3). Interestingly, in early stages of development prior to specification of pMN domain progenitors, Nkx2.2 acts as a potent transcriptional

Figure 1.3 – Gliogenesis in the ventral spinal cord. Neurons and oligodendrocyte progenitor cells both arise for the pMN domain of the ventral spinal cord. In the pMN domain, the proneural transcription factor Ngn2 is expressed in a subset of pMN domain derived Olig2 expressing progenitors at the time of motor neuron production. During development a neuroglial switch occurs in which Ngn2 downregulation is proceeded by upregulation of Sox9, a major proglial transcription factor leading to the production of oligodendrocyte progenitor cells characterized by distinct gene expression profiles. In addition, notch signaling plays an important role in the specification of oligodendrocyte progenitor cells from pMN domain progenitors. Mouse studies demonstrate that in the absence of notch signaling, pMN domain progenitors solely give rise to motor neurons whereas notch overexpression leads to the suppression of neurogenesis and the enhancement of oligodendrocyte progenitor cells.

20 repressor of pMN domain transcription factors, including Olig2. In contrast, Olig2 and Nkx2.2 collaborate in post-induction, migratory oligodendrocyte progenitors to establish features of oligodendrocyte progenitor identity. Once specified, oligodendrocyte progenitor cells utilize a rich complement of attractive/repulsive guidance receptors to migrate throughout the parenchyma and populate the spinal cord (Simpson and Armstrong 1999; Tsai et al. 2002; Tsai et al. 2003).

Oligodendrocyte progenitor cells rely on extracellular signals to regulate their survival and proliferation. Signals that promote oligodendrocyte progenitor proliferation work by inhibiting differentiation of oligodendrocyte progenitors into mature oligodendrocytes. Proliferative signals may also act to promote oligodendrocyte progenitor survival. During nervous system development, it is estimated that a large majority of oligodendrocyte progenitor cells undergo apoptosis during terminal differentiation of progenitors into mature oligodendrocytes (Barres et al. 1992; Trapp et al. 1997). An intricate signaling network thus ensures proper timing of terminal differentiation and myelination, the proper distribution of myelinated white matter, and maintenance of oligodendrocyte progenitor pools into adulthood (Cui et al. 2010; Wang et al.

2007).

Two key oligodendrocyte progenitor mitogens are platelet derived growth factor A (PDGF-AA) and fibroblast growth factor 2 (FGF2) (Figure 1.4). PDGF-AA signals though PDGFRa, which is expressed by oligodendrocyte progenitor cells

(Noble et al. 1988). Interestingly, levels of PDGF-AA tightly correlate with the rate of oligodendrocyte progenitor proliferation and total number of oligodendrocyte

21 progenitor cells (Calver et al. 1998). FGF-2 works to promote the expression of

PDGFRa, and likewise, induces oligodendrocyte progenitor cell proliferation while inhibiting progenitor differentiation into mature oligodendrocytes (McKinnon et al.

1990). Additionally, several transcription factors, including Id2, Id4, and Hes5, are thought to act in the maintenance of progenitor state by repressing transcription of myelin-associated genes (Kondo and Raff 2000a; Kondo and Raff 2000b) (Figure

1.4).

1.1.5 Oligodendrocyte progenitor cell to oligodendrocyte differentiation

During early postnatal development, oligodendrocyte progenitors must disengage proliferative networks, exit the cell cycle, and differentiate into mature myelinating oligodendrocytes. Although the mechanisms underlying this transition are not fully understood, genetic manipulations in the mouse have uncovered a number of key transcription factors and signaling molecules that are required for oligodendrocyte differentiation; genetic deletion of Ascl1/Mash1, Nkx2.2, or Erk2 each results in impaired generation of post-mitotic oligodendrocytes from oligodendrocyte progenitors (Nakatani et al. 2013; Parras et al. 2007; Qi et al.

2001; Sugimori et al. 2008). Posttranscriptional control of gene expression by microRNAs also plays an important role in allowing the differentiation of oligodendrocyte progenitor cells to oligodendrocytes. By comparing microRNA expression profiles for oligodendrocyte progenitor cells and oligodendrocytes,

Dugas et al identified microRNA-219 as a highly expressed, oligodendrocyte-

22 specific mircoRNA (Dugas et al. 2010). Dugas et al found that the expression of microRNA-219 is specifically induced in oligodendrocyte progenitors by mitogen withdrawal, and that microRNA-219 is both sufficient and necessary for terminal differentiation of mature oligodendrocytes. Dugas et al further found that microRNA-219 works specifically to repress expression of PDGFRa, Sox6, FoxJ3, and zinc finger protein 238, proteins that promote oligodendrocyte progenitor cell proliferation and inhibit the differentiation of oligodendrocyte progenitors into mature oligodendrocytes (Barres et al. 1994; Stolt et al. 2006) (Figure 1.4). Thus, signaling networks regulate the terminal differentiation of oligodendrocytes at both the transcriptional and post-transcriptional levels.

In addition to microRNA-219, transcription factor Yin Yang 1 (YY1) has also been identified as a key modulator in the maturation of oligodendrocyte progenitor cells. He et al. demonstrated that mice in which YY1 was conditionally ablated in the oligodendrocyte lineage exhibited a reduction in the number of myelin axons present in the CNS (He et al. 2007). He et al. further determined that impaired myelination in YY1 conditional knockout mice was due to an arrest in the maturation of oligodendrocyte progenitor cells. Furthermore, using gene expression profiles and overexpression studies He et al. found that YY1 works to repress transcription factors Id4 and Tcf2, which are well characterized inhibitors of oligodendrocyte progenitor cell differentiation and myelin gene expression

(Figure 1.4).

The complex orchestration of oligodendrogenesis is likely regulated at a global level through chromatin modification. In support of this, Marin-Husstege et

23 al found that treatment of oligodendrocyte progenitor cells with trichostatin A, a global histone deacetylase inhibitor, causes oligodendrocyte progenitors to exit the cell cycle but results in a failure of these progenitors to differentiate into mature oligodendrocytes expressing a battery of genes associated with myelin biogenesis

(Marin-Husstege et al. 2002). Further understanding of differential chromatin landscapes in oligodendrocyte progenitors and mature oligodendrocytes may yield insight into the transcriptional programs that allow for this transition.

As pure populations of oligodendrocyte progenitors can readily differentiate into oligodendrocytes in vitro in the absence of neurons, this transition does not require neuronal membrane bound inductive cues (Lee et al. 2012). Because oligodendrocyte-promoting culture conditions use thyroid hormone (in the absence of growth factors) to induce oligodendrogenesis, it is possible that some of these diffusible factors are derived in vivo in non-cell autonomous manner (Barres et al

1994; Noble et al 1988). Therefore, it remains unknown whether neuronal-derived diffusible factors contribute to oligodendrogenesis in vivo.

1.1.6 Oligodendrocytes and their role in myelinating the central nervous system

CNS myelination is the process by which oligodendrocytes ensheath axons with multiple layers of myelin. In contrast to peripherally-located Schwann cells that each myelinate only one axon, single oligodendrocytes can myelinate up to 50 axons at a time. Dynamic signaling networks govern oligodendrocyte myelination of CNS axons at several discrete stages.

First, oligodendrocyte processes make contact with axons to initiate myelination. Oligodendrocytes extend large lamellae that recognize unmyelinated axons by use of membrane-bound receptors that bind axonal ligands in trans.

Premyelinated axons synthesize laminin-α2, which binds to β1 integrin receptors on oligodendrocytes (Hu et al. 2009). This interaction regulates downstream activity of RhoA to promote oligodendrocyte process extension (Liang et al. 2004).

Interestingly, laminin-α2 deficient mice exhibit hypomyelination (Chun et al. 2003) whereas interfering with β1 integrin signaling has yielded divergent results

(Benninger et al. 2006; Camara et al. 2009; Lee et al. 2006). In addition, phosphorylation-dependent cytosolic translocation of Olig1 is thought to contribute to lamellae expansion that precedes ensheathment of axons (Niu et al. 2012).

Upon axonal contact, premyelinating oligodendrocytes (marked by their expression of O4 and galactocerebroside) undergo functional maturation and begin to synthesize proteins that function in myelin biogenesis, including myelin basic protein (MBP) and proteolipid protein (PLP). Myelin regulatory factor (MRF) plays a critical role in the functional maturation of premyelinating oligodendrocytes by promoting the expression of myelin proteins. MRF is specifically expressed in postmitotic oligodendrocytes where it preferentially enhances transcription of genes expressed by functionally mature oligodendrocytes (Bujalka et al. 2013;

Cahoy et al. 2008) (Figure 1.4). RNAi-mediated knockdown of MRF in cultured oligodendrocyte progenitor cells does not affect cell cycle arrest or the downregulation of oligodendrocyte progenitor cell markers, but rather, greatly reduces the expression of genes associated with myelin biogenesis (Emery et al. 2009). In

25 addition, when MRF is selectively ablated in Olig2+ oligodendrocyte lineage cells in vivo, premyelinating oligodendrocytes fail to express myelin genes (e.g. MBP,

MOG) and fail to ensheath axons. This genetic perturbation leads to severe dysmyelination and a lifespan limited to the third postnatal week (Emery et al.

2009). Zinc finger protein 191 (Zfp191) also appears to play a key role in the functional maturation of premyelinating oligodendrocytes (Figure 1.4). Using a forward genetics approach, Howng et al identified a mutant mouse that exhibits hypomyelination and reduced expression of several myelin-associated genes including MBP, MAG, and MOG. Through linkage mapping and complementation testing, Hwong et al found that this mutant harbors a single nucleotide insertion in

Zfp191. Interestingly, myelination in these mutants failed despite an abundant number of process-extended oligodendrocytes, thus indicating a specific defect in the functional maturation of premyelinating oligodendrocytes (Howng et al. 2010).

Electrical activity in axons is thought to act as an important signal for myelination. The first evidence for activity-dependent myelination of premyelinated axons was obtained from studies of dark-reared mice, which exhibit diminished activity in centrally-projecting retinal ganglion sensory neurons. In contrast to control animals reared under a normal light-dark cycle, dark-reared mice exhibited a significant reduction in the number of myelinated axons in the optic nerve

(Gyllensten and Malmfors 1963). In addition, Tauber et al. found that rabbits with artificially-induced premature eye opening exhibited accelerated myelination of axons within the optic nerve (Tauber et al. 1980). These studies were subsequently corroborated using modern pharmacology; when action potentials were blocked

Figure 1.4 – Oligodendrocyte progenitor cell proliferation and oligodendrocyte differentiation and maturation. Oligodendrocyte progenitor cells rely on mitogens for continued proliferation and renewal. FGF2 and PDGF-AA work to promote oligodendrocyte progenitor cell proliferation while several transcription factors, including Id4, Id2, Tcf2, and Hes5 are thought to act in the maintenance of the progenitor state by repressing oligodendrocyte differentiation. During postnatal development, oligodendrocyte progenitor cells exit the cell cycle and differentiate into premyelinating oligodendrocytes. MicroRNA-219 has been identified to play an important role in the differentiation of oligodendrocytes by acting to repress the expression of proteins that promote oligodendrocyte progenitor cell proliferation including Zfp238, Sox6, and FoxJ3. In addition, transcription factor YY1 plays a role in oligodendrocyte development by repressing Id4 and Tcf2, well characterized inhibitors of oligodendrocyte differentiation and myelin gene expression. MRF and Zfp191 appear to play essential roles in the functional maturation and premyelinating oligodendrocytes.

27 using the sodium channel blocker tetrodotoxin, myelination in the developing optic nerve was reduced. Conversely, myelination was enhanced by promoting the activity of retinal ganglion cells using a selective sodium channel activator

(Demerens et al. 1996). Furthermore, Stevens et al. found that action potentials cause the activation of adenosine receptors in oligodendrocyte progenitor cells, providing a molecular link between electrical activity in premyelinated axons and the induction of myelination (Stevens et al. 2002). Although oligodendrocytes myelinate in response to electrical activity in premyelinated axons, neuronal activity is not required for myelination as oligodendrocytes are able to myelinate engineered nanofibers in vitro (Lee et al. 2012).

Upon axonal contact, oligodendrocyte lamellae begin to wrap axons to form layers of myelin. Historically, intrinsic lamellae wrapping was largely inferred on the basis of terminal morphology—yet modern imaging studies have only recently confirmed this hypothesis. Snaidero et al demonstrated though extensive imaging that myelination occurs when the leading edge of the oligodendrocyte lamellae wraps around the axon, where the leading edge continues to extend by axonal contact and wrap concentrically underneath previous passes (Snaidero et al.

2014). The leading edge of the oligodendrocyte also lateralizes from the point of initial contact, explaining why myelin segments are denser at the central core region (Snaidero et al. 2014). The compaction of myelin occurs simultaneously with wrapping, but first appears in the outermost layers of myelin (Snaidero et al.

2014). Under transmission electron microscopy, compact myelin can be identified as concentric layers of electron-dense and electron-light material, corresponding

28 to alternating layers of myelin lipids and myelin proteins. Interestingly, myelin basic protein (MBP) is required for the formation of the major dense line observed in compact myelin.

Myelin segmentation along axons directs the appropriate distribution of voltage-gated ion channels within the axolemma (Joe and Angelides 1993) (Figure

1.5). Nodes of Ranvier are specialized, unmyelinated regions of the axon that exhibit a high density of voltage-gated Na+ channels. These nodal structures are situated between adjacent myelin paranodes, where a variety of adhesion molecules act to tether the myelin sheath to the axon. Juxtaparanodes flank the paranodes more proximal to myelin internodes, which form the core segment of compact myelin. Juxtaparanodal axolemma exhibits a high density of voltage- gated potassium channels. Together, myelination directs the proper distribution of voltage-gated ion channels within the axolemma at these nodal specializations, and is therefore essential for saltatory impulse conduction in axons of the CNS.

1.1.7 Summary

Smooth motor sequences and other higher-order functional attributes of the adult mammalian nervous system arise at least in part via efficient development of oligodendrocyte lineage cells. The generation of oligodendrocytes is therefore tightly controlled by environmental cues presented with temporal precision at discrete stages of nervous system development. A number of congenital

Figure 1.5 – Myelin of the central nervous system. Myelination is essential for saltatory conduction in axons of the central nervous system. The precise composition and organization of myelin directs the appropriate distribution of voltage-gated ion channels within the axolemma. The Nodes of Ranvier are unmyelinated regions of the axon that exhibit high density of voltage- + gates Na channels. These nodal structures are situated between adjacent myelin paranodes, where a variety of adhesion molecules act to tether the myelin sheath to the axon. The Juxtaparanode region us flanked by paranode and internode regions and exhibit high density of + voltage-gates K channels.

30 neurological disorders are caused by disruptions in various stages of oligodendrocyte development, terminal differentiation, or generation of compact myelin. These diseases are collectively categorized as leukodystrophies, a broad spectrum of neurological disorders characterized by dysmyelination of the CNS.

Through our understanding of oligodendrocyte development and myelination, we can begin to understand the cellular and molecular mechanisms underlying dysmyelinating diseases with an ultimate goal of identifying therapeutic interventions for patients suffering from leukodystrophies.

1.2 Leukodystrophies: progressive, heritable disorders of myelin

1.2.1 Introduction

Leukodystrophies comprise a rare and heterogeneous group of congenital disorders that affect the generation and maintenance of myelin. Although leukodystrophies are typically associated with aberrant myelination, axonal injury has also been identified in patients diagnosed with some forms of leukodystrophy

(Mar and Noetzel 2010). It’s important to note that leukodystrophies are distinguishable from acquired disorders of myelin in that they are heritable.

Acquired myelin disorders are typically associated with strong environmental risk components, such being the case with multiple sclerosis (an autoimmune disorder), progressive multifocal leukoencephalopathy (caused by viral infection), and chronic hypertensive encephalopathy (caused by tissue ischemia).

At least 40 different leukodystrophies have been identified, each with distinct genetic etiology. Leukodystrophies can be further categorized into two subclasses: Dysmyelinating diseases (including Pelizaeus-Merzbacher disease) are characterized by the absence of myelin formation, whereas demyelinating diseases (e.g. Krabbe disease) are characterized by the destruction of myelin.

Clinically, leukodystrophies manifest with a broad spectrum of neurological symptoms and disease characteristics, which leads to a range of diagnoses, prognoses, and strategies for management. Leukodystrophies typically arise postnatally after an initial period of normal development, though the age of onset varies greatly depending on the specific diagnosis. Initial neurological indications for leukodystrophies include behavioral changes and cognitive decline, symptoms which are typically followed by progressive motor ataxia and weakness (Costello et al. 2009; Lyon et al. 2006). Furthermore, most patients diagnosed with a leukodystrophy do not survive beyond the first decade of life.

Several leukodystrophies have well-defined characteristics at genomic, neurological, biochemical, radiological, and histological levels of analysis.

Nevertheless, a number of leukodystrophies still remain poorly understood and many patients suffering from leukodystrophies remain undiagnosed. In addition, there are currently no treatment options for patients diagnosed with a leukodystrophy, and most clinical interventions focus on managing symptoms of disease through physical therapy. This section highlights what is currently known about two leukodystrophies—Pelizaeus-Merzbacher disease and Krabbe disease—which have been characterized through extensive clinical observations

32 and mouse modeling. These diseases exhibit some general features that are applicable to all leukodystrophies, as well as features that are disease-specific. We further highlight the clinical need for derivation of autologous oligodendrocyte progenitor cells, which holds great potential for treatment of leukodystrophies and other myelin related disorders.

1.2.2 Pelizaeus-Merzbacher disease

In 1885, the German neurologist Friedrich Pelizaeus described a family with several members exhibiting severe neurological impairment. Infants of this family presented with involuntary eye movements, poor head control, limited motor control, and tremors of the head and neck. Pelizaeus noted that the disease was passed though the mother without her being affected, an inheritance pattern known today as X-linked recessive (Pelizaeus 1885). It wasn’t until later that the German neuropathologist and psychiatrist Ludwig Merzbacher re-evaluated post-mortem tissue samples from the same family and observed a widespread deficiency in myelin staining within the cerebral white matter of an affected male (Merzbacher

1910). Thus, Merzbacher provided the first pathological description of what we refer to today as Pelizaeus-Merzbacher disease, or PMD. In 1954, a more severe form of PMD was identified, and further histological characterization of post- mortem tissue demonstrated a near-complete absence of myelin and oligodendrocytes in the CNS (Seitelberger 1954). To distinguish these clinical and

33 pathological findings from those described by Pelizaeus and Merzbacher,

Seitelberger introduced the terms classical PMD and connatal (more severe) PMD.

Patients diagnosed with PMD exhibit neurological symptoms that span a continuum of severity and progression, ranging at the individual level from slow with progressive severity to rapid-onset and acute severity. The most prevalent form of PMD is classical PMD. These patients usually present in the first year of life with irregular eye movements, hypotonia, delayed development, and abnormal patches of myelination in CNS white matter. Patients with classical PMD exhibit very slow neurological deterioration, typically reaching severe impairment after the first decade of life. In contrast, connatal PMD is rarer and is associated with rapid progression to the stage of severe neurological impairment. Patients with connatal

PMD exhibit early feeding impairment and severe hypotonia/muscle weakness, and histologically, exhibit complete lack of myelin and a severe reduction in the number of CNS oligodendrocytes. Patients with connatal PMD have a particularly grim prognosis as most do not survive beyond the first decade of life.

As patients with PMD exhibit abnormal myelination, it was hypothesized in

1964 that PMD might be caused by defective proteolipid, which was known at the time to be a major constituent of compact myelin (Zeman et al. 1964). Indeed, over

20 years later, proteolipid protein 1 (PLP) was mapped to the X chromosome and was found to be mutated in several families with heritable PMD (Gencic et al. 1989;

Hudson et al. 1989; Trofatter et al. 1989; Willard and Riordan 1985). PLP is a 17kb gene that contains 7 exons encoding two major proteins, PLP and its splice variant

DM20, which are specifically expressed in CNS oligodendrocytes (Nave et al.

1987).

Oligodendrocyte-expressed PLP and DM20 function in the formation of compact myelin. A variety of mutations—including PLP deletions/truncations, missense mutations, and chromosomal duplications—have been implicated in

PMD. The most severe forms of PMD are generally associated with various missense mutations of the PLP gene, yet PLP missense mutations can result in a broad range of clinical phenotypes (Cailloux et al. 2000). X chromosome duplications (of variable length) containing the PLP locus are the most prevalent mutations observed among PMD patients (Inoue et al. 1999; Mimault et al. 1999;

Sistermans et al. 1998). Interestingly, the extent of chromosomal duplications does not correlate with clinical severity, highlighting the potential impact of accompanying modifiers and non-coding regions of the genome in divergent clinical phenotypes (Regis et al. 2008). Patients that harbor PLP deletions or mutations that lead to premature truncation usually exhibit a less-severe clinical phenotype (Inoue et al. 2002; Raskind et al. 1991; Sistermans et al. 1996).

Genetic studies in the mouse have suggested that dysmyelination resulting from PLP point mutations arises not from the absence of functional PLP protein, but rather from a cytotoxic effect of the mutant protein (Schneider et al. 1995). On a cellular level, mutant PLP protein has been observed to accumulate in the endoplasmic reticulum, thus mutant PLP protein exhibits trafficking defects that preclude its insertion into the cytoplasmic membrane of oligodendrocytes (Gow et al. 1997; Gow et al. 1996). Interestingly, this trafficking defect correlates with

35 clinical severity. Mutations of PLP that lead to a more severe phenotype exhibit trafficking abnormalities of both PLP and DM20, whereas mutations of PLP that lead to a less severe phenotype cause a trafficking defect of only PLP (Gow et al.

1997; Gow et al. 1996). In the mouse, accumulation of PLP and DM20 in the endoplasmic reticulum leads to premature oligodendrocyte death, ultimately leading to CNS hypomyelination (Knapp et al. 1986; Rosenfeld and Freidrich et al.

1983; Sidman et al. 1964; Thomson et al. 1999).

As PMD patients exhibit a wide variety of genetic abnormalities at the PLP locus and have a range of associated pathological defects, there are currently no standard clinical treatments available for this patient population as a whole due to genetic and phenotypic variability. Because PLP/DM20 expression is restricted to the oligodendrocyte lineage, PMD is characterized as a cell type-specific disorder.

Therefore, oligodendrocyte transplantation has been proposed as a promising therapy for PMD patients (Gupta et al. 2012).

1.2.3 Krabbe disease

Krabbe disease, or globoid cell leukodystrophy, is an autosomal recessive disorder that affects myelin of the central and peripheral nervous systems.

Genetically, Krabbe disease is caused by various homozygous or compound heterozygous mutations in galactosylceramidase (GALC), an enzyme that breaks down fatty lipid byproducts of myelin generation in central oligodendrocytes and peripheral Schwann cells (Kobayashi et al. 1980; Shinoda et al. 1987). Myelin is

36 composed of 70-80% lipid and 15-30% protein (Deber and Reynolds 1991).

Galactosylceramides are the most prevalent myelin lipid, accounting for approximately 20% of total lipid by dry weight (Baumann and Pham-Dinh 2001;

Deber and Reynolds 1991). GALC functions as a lysosomal enzyme, breaking down galactosylceramide and psychosine lipids that accumulate in excess during myelination. GALC is highly expressed in central oligodendrocytes and peripheral

Schwann cells, and exhibits peak enzymatic activity during periods of active myelination (Santambrogio et al. 2012).

Krabbe patients that harbor either homozygous mutations or compound heterozygous mutations exhibit reduced enzymatic activity of GALC, which leads to accumulation of galactosylceramide and psychosine in the brain (Svennerholm et al 1980; Vanier and Svennerholm 1976), and more specifically, in oligodendrocyte cell bodies (Borda et al. 2008; LeVine et al. 1994; Suzuki 2003a).

The accumulation of psychosine in oligodendrocytes leads to demyelination and oligodendrocyte apoptosis (Won et al. 2013). A majority of Krabbe patients present within the first 6 months of life with limb stiffness, hypersensitivity, irritability, psychomotor regression, muscular hypertonia, and spasticity (Fiumara et al. 2011;

Tappino et al. 2010). In addition, brain MRI scans from these patients indicate cerebral and cerebellar hypomyelination and generalized brain atrophy. These neurological and radiological abnormalities correlate with reduced GALC enzymatic activity, ranging from 0 to 22% of normal levels (Fiumara et al. 2011;

Tappino et al. 2010). Nerve conduction velocity studies have demonstrated that axons in Krabbe patients exhibit uniform (rather than focal) demyelination, and

37 interestingly, defects in generation of compound action potentials manifest very early in Krabbe disease—before the onset of myelination (Siddiqi et al. 2006).

Although the infantile form of Krabbe disease is most prevalent, cases of late-onset

Krabbe disease have also been described (Crome et al. 1973).

Over 40 mutations have been identified in Krabbe patients presenting with a wide range of disease phenotypes, making it difficult to establish relationships between GALC genotype and clinical phenotype (Wenger DA et al. 1997).

Interestingly, mutations concentrated in the central domain of the protein occur with greater frequency in the infantile form of Krabbe disease, whereas mutations in the N- or C-terminus seem to be associated with adult-onset Krabbe populations

(Furuya et al. 1997). In addition, some mutations clearly result in the infantile form of Krabbe disease if found in the homozygous state or in a compound heterozygous state with another severe mutation. In other cases, predicting causative allelic variants has proven difficult due to a high degree of polymorphic changes at the human GALC locus (Wenger et al. 1997), but with advances is sequencing technologies genetic variations and phenotype relationships can be more easily explored. ClinVar, an archive of phenotype-genotype relationships has been a tremendous resource for ascertaining new and novel genetic mutations and how they contribute to disease pathogenesis (Landrum et al. 2014).

Like other forms of leukodystrophies, including PMD, the pathobiology of

Krabbe disease is restricted to myelinogenic cells of the nervous system. Although

Escolar et al reported modest abatement of Krabbe progression by treating pre- symptomatic infantile Krabbe patients with transfusion of umbilical cord blood.

Escolar and colleagues hypothesized that donor leukocytes could proved the deficient enzyme to cells in both the peripheral and central nervous systems, but treatment of those patients diagnosed postnatally had no effect on progression of the disease (Escolar et al. 2005). Therefore, cell transplantation therapies that target replacement of myelinogenic cells of the nervous system may be critical for clinical treatment of Krabbe disease.

1.2.4 Summary

Leukodystrophies are congenital disorders that affect the generation and maintenance of CNS myelin. There are currently over 40 recognized leukodystrophies, and considerable allelic heterogeneity is exhibited amongst patient populations diagnosed with a specific leukodystrophy (such being the case with both PMD and Krabbe disease). Thus, the genetic diversity within leukodystrophies as a group of disorders results in a broad range of clinical neurological symptoms. Furthermore, due to a variety of underlying molecular pathologies, there are no medications or treatments used clinically for management of disease. Despite these differences, leukodystrophies have one important defining feature, that is, leukodystrophies are associated with dysfunction of CNS oligodendrocytes. This commonality has important implications for potential treatment strategies for leukodystrophies. Specifically, cell transplantation therapies that target replacement of oligodendrocytes or their progenitor cells may allow myelination in otherwise hypomyelinated humans.

While this may seem farfetched, several studies have demonstrated the efficacy of progenitor transplantation in replenishing myelin, improving motor deficits, and increasing lifespan in preclinical models (Gupta et al. 2012; Wang et al. 2013; Windrem et al. 2008). Although the transplantation of allogeneic oligodendrocyte progenitors may prove efficacious for treatment of leukodystrophies in preclinical models, safety concerns arise (e.g. graft rejection, graft-verus-host disease) when considering their translation clinically. For these reasons, there exists a clinical need for derivation of autologous oligodendrocyte progenitor cells. Mouse models of leukodystrophies may serve as important preclinical models for assessing the efficacy of autologously derived myelinogenic oligodendrocytes in treatment of genetic orders of myelin.

1.3 Mouse models of human myelin-related diseases

1.3.1 Introduction

Model systems serve as excellent resources for understanding human development and disease. Mammalian vertebrate model systems are especially advantageous due to their genomic similarity to humans. Amongst mammalian model systems, the mouse has become the major animal model for research purposes due to its tractability, ease of genetic manipulation, and physiological similarity to humans.

While significant barriers have largely limited the procurement of human brain and spinal cord tissues for research, mouse models of leukodystrophies have allowed unequivocal experimental study of the molecular, cellular, and systems- level basis of myelin diseases. In addition to their role in elucidating mechanisms underlying disease, mouse models of leukodystrophies have acted as important preclinical models for studying the efficacy of potential therapeutics in modulating disease phenotypes. Here we review three mouse models of myelin disease by describing their pathology and comparing it with human disease counterparts. We further highlight the use of these models in preclinical testing, with a specific end goal of using these models to test the efficacy of autologously derived oligodendrocyte progenitor cells in transplantation therapies (see Chapter 2).

1.3.2 Shiverer: mouse model of hypomyelination

The shiverer mouse was first discovered as a spontaneous mutant characterized phenotypically by generalized tremor and a complete lack of CNS myelin. By using classical linkage mapping, the shiverer mutation was located to the distal end of chromosome 18 and further characterized as a 19.5 kb deletion of myelin basic protein (MBP) exons 3 through 7 (Molineaux et al. 1986; Roach et al. 1983; Roach et al. 1985; Sidman et al. 1985). Radioimmunoassay and immunofluorescence studies performed in the late 1970s and early 1980s have demonstrated that homozygous shiverer mice contain less than 3% of normal MBP content in the CNS, while shiverer heterozygotes exhibit a 50% reduction in MBP

(Barbarese et al. 1983; Dupouey et al. 1979; Jacque et al. 1983). Through alternative exon splicing, MBP produces 4 distinct isoforms present in both the human and mouse, but absent in shiverer (Barbarese et al. 1978; de Ferra et al.

1985). Myelin segmentation along axons functions to facilitate saltatory conduction of action potentials (Huxley and Stampfli 1949). Therefore, due to a lack of MBP expression and overt hypomyelination, shiverer mice exhibit generalized tremor by

~12 days of age and experience a reduced life span when compared with wild type littermates.

Although humans that exhibit dysmyelination have not been observed to harbor the same shiverer MBP deletion of exons 2 through 7, dysmyelination of the central nervous system have been observed in patients that harbor a 1.62 Mb deletion mapping between 18q22.3 and 18q23 on the distal arm of chromosome

18. The deletion of this critical region has been observed to be 100% penetrant with the dysmyelinating phenotype which is not surprising given that one of the five genes located within this deleted region is MBP (Cody et al. 2009).

Interestingly, the shiverer mouse has revealed an essential role for MBP in regulating compaction of the myelin sheath. While shiverer oligodendrocytes extend processes that ensheath axons, wrappings remain loose in appearance and fail to undergo compaction. By electron microscopy, shiverer myelin sheaths lack the major dense line, a canonical feature of compact myelin (Dupouey et al.

1979; Jacque et al. 1983; Privat et al. 1979; Rosenbluth 1981; Rosenbluth 1980).

In addition, oligodendrocyte processes exhibit aberrant size, shape, and distribution, which suggests that MBP may also act to regulate the morphological

42 complexity of oligodendrocytes (Inoue et al. 1981; Noebels et al. 1991; Wang et al. 1995).

With the hypothesis that the shiverer allele is functionally hypomorphic,

Readhead et al. and Kimura et al. introduced a MBP transgene into the germ line of shiverer mice. Shiverer MBP transgenic mice exhibited expression of MBP

(albeit at reduced levels compared with wild type mice), compact myelin in CNS tissues, and lacked the characteristic shiverer tremor (Kimura et al. 1989;

Readhead et al. 1987). Thus, these authors rescued phenotypic traits of the shiverer mouse by transgenic expression of MBP. This work was groundbreaking in that it provided one of the first demonstrations of genetic rescue for a CNS disorder.

In addition to its role in providing mechanistic insight into the process of myelination, development of the shiverer mutant as a model of CNS hypomyelination has provided a platform for studying therapies directed at restoring myelin. Specifically, several groups have used this model of hypomyelination to examine the potential of cell transplantation therapies to rescue pathological and behavioral abnormalities associated with the shiverer phenotype

(Bin et al. 2012; Goldman et al. 2012; Windrem et al. 2008; Yandava et al. 1999).

1.3.3 Twitcher: mouse model of Krabbe disease

The twitcher mutant was first discovered in 1976 by researchers from

Jackson Laboratories (Bar Harbor, Maine), and was characterized as an

43 autosomal recessive trait that mimicked human globoid cell leukodystrophy, or

Krabbe disease (Kobayashi et al. 1980). Sequencing of cDNA from the liver of twitcher mice revealed a nonsense mutation in the GALC gene, which maps to mouse chromosome 12 and human chromosome 14 (Oehlmann et al. 1993; Sakai et al. 1996; Zlotogora et al. 1990). The twitcher allele is associated with deficient activity of GALC, a lysosomal enzyme important for the degradation of specific galactolipids, including galactosylceramides and psychosines (Kobayashi et al.

1980; Shinoda et al. 1987). Kobayashi et al. demonstrated that phenotypically normal twitcher heterozygotes exhibited intermediate levels of GALC enzymatic activity (Kobayashi et al. 1980), suggesting that the twitcher allele is functionally hypomorphic.

Reduction of GALC enzymatic activity in twitcher mice is associated with elevated levels of psychosine in the brain. Accumulation of psychosine and other galactolipids is thought to contribute to widespread oligodendrocyte apoptosis, ultimately resulting in severe demyelination by the fourth postnatal week (Ichioka et al. 1987; Nagara et al. 1982). Interestingly, loss of MBP in twitcher mice is observed as early as postnatal day 10 and is associated with changes in axonal conduction velocity in the spinal cord (Smith et al. 2011). Thus, oligodendrocytes exhibit pathological symptoms prior to cell death that underlie phenotypic abnormalities observed in early postnatal life. In addition to central deficits, twitcher mice exhibit peripheral neuropathies that contribute to impaired motor function

(Olmstead 1987). These neuropathies have been attributed to structural defects in axons of the peripheral nervous system, which are thought to occur as

44 pathologies secondary to the dysfunction of myelin (Castelvetri et al. 2011; Duchen et al. 1980; Jacobs et al. 1982; Kobayashi et al. 1988).

As twitcher mice bear strikingly similar pathological characteristics to human patients with Krabbe disease, the twitcher mouse has become a useful preclinical model for testing potential Krabbe therapies. Using this model, Ichioka et al. and

Yeager et al. explored the transplantation of allogeneic hematopoietic cells as a potential enzyme replacement therapy for Krabbe disease (Ichioka et al. 1987;

Yeager et al. 1984). After transfusion of hematopoietic cells from wild type mice, twitcher mice exhibited normal GALC activity in the brain and spleen, and reduced levels of psychosine compared with control animals, however, psychosine levels gradually returned to those observed in untreated twitcher mice by 100 days post transplantation (Ichioka et al. 1987). Interestingly, twitcher mice exhibited peripheral remyelination and prolonged survival, but transfusion had no effect on

CNS pathologies (Yeager et al. 1984). Similar effects were observed in twitcher mice following bone marrow transplantation (Hoogerbrugge et al. 1988;

Hoogerbrugge et al. 1989); twitcher mice exhibited increased GALC activity in the peripheral and central nervous systems, and concordant improvements in neurological function by 100 days post transplantation. Although bone marrow grafts allowed improved clearance of brain galactolipids, oligodendrocyte pathology still persisted (Suzuki K et al. 1988). These results underscore the complexity of lipid metabolism in the nervous system, where clearance of CNS galactolipids can occur in a cell nonautonomous manner. Nevertheless, oligodendrocytes appear to be particularly sensitive to the accumulation of

45 galactolipids as their marked pathology is the most significant feature of Krabbe clinically.

Because improved galactolipid clearance from the brain after hematopoietic transfusion or bone marrow transplantation has been correlated with improvements in neurological outcome, several groups have explored gene therapy approaches for targeted reintroduction of functional GALC to twitcher nervous tissues. Rescue of galactocerebrosidase activity has been demonstrated in various mutant cells (from twitcher mice or Krabbe patients) in vitro by retroviral transduction of wild type GALC (Costantino-Ceccarina et al. 1999; Gama Sosa et al. 1996; Rafi et al. 1996; Torchiana et al. 1998). Additionally, several groups have used viral approaches for in vivo gene therapy with varying degrees of success

(Dolcetta et al. 2006; Lin et al. 2005; Lin et al. 2007; Lin et al. 2011; Luzi et al.

2001; Meng et al. 2005; Qin et al. 2012; Reddy et al. 2011; Shen et al. 2001). Thus, since its characterization, the twitcher mouse has served as an invaluable model for studying Krabbe pathologies and for preclinical testing of potential Krabbe therapeutics.

1.3.4 Jimpy: mouse model of Pelizaeus-Merzbacher disease

The jimpy mouse harbors a point mutation in PLP, a protein which accounts for up to 50% of total myelin protein. PLP function is vital for several aspects of oligodendrocyte development and myelination (Schneider et al. 1992), and thus, the jimpy mouse exhibits tremor and ataxia of the limbs, expanding to convulsions

46 and premature death by 4 weeks of age (Dautigny et al. 1986; Nave et al. 1986;

Phillips 1954; Sidman et al. 1964).

The jimpy mutation disrupts a splice acceptor signal upstream of PLP exon

5, causing exon 5 to be skipped during mRNA processing. This leads to an mRNA transcript truncation of 74 bases as well as a frameshift mutation that alters the carboxy-terminus of jimpy PLP protein (Dautigny et al. 1986; Hudson et al. 1987;

Macklin et al. 1987; Nave et al. 1986; Nave et al. 1987; Roussel et al. 1987).

Ultimately, trafficking of mutant jimpy protein is arrested in the golgi apparatus

(Roussel et al. 1987).

Jimpy mice exhibit an X-linked recessive inheritance pattern, and therefore heterozygous females are unaffected. While the jimpy inheritance pattern and the failure of jimpy PLP to appropriately traffic to the plasmid membrane might suggest that jimpy PLP is functionally hypomorphic, transgenic studies in the mouse have demonstrated otherwise. Interestingly, jimpy mice carrying an autosomal transgenic copy of wild type PLP are phenotypically indistinguishable from non- transgenic jimpy mice despite subtle improvements in myelination (Schneider et al. 1995). In this artificially heterozygous situation, the dominant-negative action of jimpy PLP leads to oligodendrocyte pathology, and therefore, the jimpy allele functions as a neomorphic mutation. In this case of X-linked recessive inheritance, heterozygous females appear to be phenotypically normal because of mosaicism caused by X-inactivation (Dautigny et al. 1986).

In support of the view that jimpy functions as a neomorphic allele, several groups have demonstrated that oligodendrocytes exhibit premature death during

47 the initial stages of maturation and axonal myelination, suggesting that jimpy PLP is toxic to oligodendrocytes (Knapp et al. 1986; Hudson et al. 1987; Schneider et al. 1995; Thomson et al. 1999). Due to oligodendrocyte death, jimpy mice exhibit

CNS hypomyelination as well as axonal swelling (Knapp et al. 1986; Rosenfeld and Freidrich et al. 1983; Sidman et al. 1964; Thomson et al. 1999).

Oligodendrocytes that do survive in jimpy mice fail to make appropriate ensheathments and form abnormal compact myelin. Jimpy myelin is characterized by an aberrant intraperiod line, a feature associated with PLP localization in compact myelin (Duncan et al. 1989; Thomson et al. 1999). Although PLP expression is decreased in the sciatic nerve of jimpy mice, Schwann cell abnormalities and demyelination of the peripheral nervous system have not been observed (Anderson et al. 1997; Sidman et al. 1964; Wight et al. 2007).

Several other mice exhibiting mutations in PLP have been identified, including the mutants rumpshaker (Schneider et al. 1992) and jimpy-4j (Billings-

Gagliardi et al. 1995). These mutants exhibit a range of pathologies, sometimes associated with PLP hypomorphism. Thus, these mice may be useful for understanding the pathologies underlying a spectrum of clinical Pelizaeus-

Merzbacher phenotypes.

1.3.5 Summary

The mouse model system serves as an invaluable resource for understanding molecular, cellular, and systems level pathologies underlying a

48 variety of human leukodystrophies. Furthermore, mouse models serve as an important experimental system for understanding various genetic mutations underlying disease, mutations which can be associated with complete or partial loss of gene function, gain of function, dominant negative function, or neomorphic function. Finally, mouse models act as an important preclinical model for discovery of molecular, cellular, and genetic therapies for human diseases of myelin.

1.4 Current cell reprogramming and differentiation technologies

Higher mammalian species exhibit extraordinary cellular diversity.

The multitude of mature cell types in adult mammals is essential for the complex function of differentially specialized organs (brain, heart, liver, etc.). Therefore, understanding how embryonic stem cells give rise to such a rich complement of terminally differentiated cell types, and how cellular identity is established and maintained, remains of fundamental importance. Historically it was thought that as cells differentiate or become more specialized, cells cast off or permanently inactivate genes that are not related to their cell type-specific function (Weismann

1893). Alternatively, others proposed that all cells retain the entire genome throughout development, but selectively turn on genes related (or turn off genes that are unrelated) to their identity.

In order to understand cellular identity and early embryonic development,

Briggs and King set out to perfect the method of somatic cell nuclear transfer

(SCNT) (Comandon and de Fonbruene 1939; Hammerling 1934). By isolating

49 nuclei from undifferentiated frog blastula cells and inserting them into enucleated frog eggs, Briggs and King demonstrated that SCNT allows for normal embryo development and the generation of tadpoles with a success rate of 40% (Briggs and King 1952). This seminal experiment demonstrated that even a nucleus of the more mature blastula contains all of the genetic material necessary for directing organismal development. Nevertheless, because donor nuclei were isolated from an early embryonic developmental state (e.g. the blastula), questions concerning the developmental plasticity of a more mature nucleus still remained.

In 1962, Gurdon addressed these concerns by performing transfer of fully differentiated tadpole intestinal cell nuclei into enucleated frog eggs, which resulted in the successful generation of tadpoles (Gurdon 1962). After unsuccessful attempts by Briggs and King (Briggs and King 1957), this seminal work by Gurdon demonstrated, for the first time, that cell identity depends on changes in gene expression rather than genomic content.

Following these seminal experiments, others turned their efforts toward the use of SCNT in studies of mammalian development. The first documented attempt of mammalian SCNT came when Bromhall transferred the nucleus of a rabbit embryo into an enucleated rabbit egg through the use of both microinjection and

Sendai virus. What followed was the generation of embryos that arrested during cleavage, with a small percentage reaching the morula stage (Bromhall 1975).

Other groups followed with much greater success, demonstrating successful

SCNT in a variety of mammals, including sheep (Campbell et al 1996; Willadsen

1986), rabbits (Stice and Robl 1988), pigs (Prather et al 1989), mice (Cheong et al

1993), and cows (Sims and First 1994). These studies in mammalian cloning, however, were limited to the use of embryonic cells as nuclear donors.

In 1997, Wilmut et al succeeded in producing a single cloned sheep by

SCNT using an adult mammary gland cell as a nuclear donor (Wilmut et al 1997).

This success in cloning an adult mammal was soon replicated by several other groups in a variety of mammalian species (Baguisi et al 1999; Chesne et al 2002;

Kato et al 1998; Polejaeva et al 2000; Shin et al 2002; Wakayama et al 1998).

From this ground breaking work, the field began to consider the application of

SCNT for generating human embryonic stem cells genetically identical to adult patients, potentially allowing autologous stem-cell based therapies for treatment of human disease. Yet the ability to generate human embryonic stem cells by SCNT raised a variety of ethical concerns, even while technical limitations precluded the implementation of human SCNT practically.

Despite this, the laboratory of Mitalipov set out to accomplish primate

SCNT. In 2007, Byrne et al were able to isolate, culture, and maintain two embryonic stem cell lines isolated from embryos generated from SCNT from starting rhesus macaque adult skin fibroblasts (Byrne et al 2007) which were individually validated from an independent laboratory confirming that the chromosome complement of the two lines were genetically identical to the cell donor nucleus and that the mitochondrial DNA originated from the recipient oocytes (Cram et al 2007). This exciting work primed the field for Mitalipova’s second successful primate SCNT experiment which resulted in the derivation of nuclear transfer derived embryonic stem cells from starting human fibroblasts

(Tachibana et al 2013). Excitingly, these human nuclear transfer derived embryonic stem cells were able to differentiate in culture to more specialized cell types including cardiomyocytes, hepatocytes, and neurons (Tachibana et al 2013).

In the late 1990s and early 2000s, various groups suggested that somatic cells could be reprogrammed by lineage conversion, in which one cell type

“transdifferentiates” or is reprogrammed into another mature somatic cell type without undergoing an intermediate or pluripotent state. This was purportedly achieved through various co-culturing techniques. Although these experiments provided optimism that somatic cells might be capable of lineage conversion, this approach was met with a considerable amount of criticism. Indeed, two independent laboratories confirmed that “transdifferentiation” is not a result of culture conditions, but rather a result of spontaneous cell fusion (Terada et al 2002;

Ying et al 2002). These experiments highlighted the importance of understanding fundamental mechanisms that allow for acquisition of cellular fate.

Transcription factor profiles are key determinants of cellular identity. With this knowledge, Takahashi and Yamanaka in 2006 performed a rather ingenious experiment demonstrating the unexpected plasticity of cell fate. By inducing the expression of a defined set of transcription factors in embryonic or adult somatic cells, Takahashi and Yamanaka were able to convert these somatic cells into pluripotent stem cells, termed induced pluripotent stem (iPS) cells. iPS cells exhibit several characteristics normally definitive of embryonic stem cells, including the ability to contribute to mouse embryonic development when injected into mouse blastocyst (Takahashi and Yamanaka 2006). Furthermore, iPS cells exhibit the

52 ability to differentiate into virtually any cell type of the body. What is remarkable about this work is that ectopic expression of only 4 key transcription factors—Oct4,

Klf4, c-Myc, and Sox2—is sufficient to revert somatic cells to a pluripotent state.

Today this method acts as a powerful tool for studying mammalian development, understanding the pathology and progression of human diseases, discovery of new pharmaceutics, and development of cellular therapies.

In a proof-of-principle demonstration supporting the use of iPS cells for studying human disease, Moretti and colleagues generated iPS cells from fibroblasts derived from human patients diagnosed with type 1 long-QT syndrome, which is caused by mutations in KCNQ1 (Moretti et al. 2010). Moretti et al were able to directly differentiate patient-specific iPS cells into cardiomyocytes, and by electrophysiological analysis of these cells, the authors observed prolonged action potentials characteristic of long-QT syndrome in both atrial and ventricular cardiomyocytes. Moretti and colleagues further identified a novel dominant negative deactivation defect in a subset of cardiomyocytes derived from long-QT patients, which was associated with specific genetic mutations in KCNQ1 (Moretti et al. 2010). Itzhaki and colleagues later applied these techniques to model type

2 long-QT syndrome, associated with mutations in KCNH2 (Itzhaki et al. 2011).

Using iPS cell derived cardiomyocytes from patients with type 2 long-QT syndrome, Itzhaki et al evaluated existing and novel pharmacological agents for their ability to modulate electrophysiological abnormalities exhibited by type 2 long-

QT cardiomyocytes, identifying several new candidate drugs. Collectively, these studies have demonstrated the powerful use of iPS cell technology for modeling

53 and uncovering pathology associated with disease, understanding genotypic- phenotypic correlations, and discovery of new pharmaceutics.

Methods for deriving patient specific iPS cells have allowed new exploration into the use of stem cells for treatment of human disease. Toward this end, Wernig and colleagues generated a population of mouse iPS cell derived neural precursor cells. Upon transplantation into the fetal mouse brain, these neural precursor cells differentiated into neurons that integrated functionally within host neural circuits

(Wernig et al. 2008). Furthermore, Wernig et al directed the differentiation of mouse iPS cells into dopaminergic neurons exhibiting expression of tyrosine hydroxylase and the dopamine transporter DAT, features of terminal dopaminergic identity. When transplanted into the striatum of Parkinsonian rats, these iPS cell- derived dopaminergic neurons allowed functional recovery of motor deficits arising in this model.

One important goal in the development of cell reprogramming technologies is to generate methods for derivation of autologous, disease-relevant populations of cells for use in treatment. In cases of congenital genetic disorders, however, correction of genetic abnormalities that underlie disease is requisite to the use of these cells clinically. Work done by Hanna and colleagues has demonstrated the combination of cell reprogramming technologies with methods for gene correction as a means for autologous cell-replacement therapy in congenital genetic disorders. Hanna et al generated iPS cells from fibroblasts obtained from a humanized mouse model of sickle cell anemia. Hanna et al then corrected the sickle allele in iPS cells via gene targeting, and subsequently generated gene-

54 corrected hematopoietic progenitors by direct differentiation. When transfused into the humanized mouse model of sickle cell anemia, gene-corrected hematopoietic progenitors rescued the sickle phenotype (Hanna et al. 2007).

When Takahashi and Yamanaka identified transcription factors that could revert somatic cells to a pluripotent state, other groups started to explore whether pools of cell type-specific transcription factors could convert or ‘reprogram’ fibroblasts to other somatic cell types. Precedence for this type of direct reprogramming had existed for some time, on the basis that ectopic expression of

MyoD1 could convert fibroblasts to myoblasts (Pinney et al 1988; Tapscott et al

1988). Indeed, multiple groups have since succeeded in deriving various somatic cell types, including neurons (Caiazzo et al. 2011; Pang et al. 2011), hepatocytes

(Huang et al. 2014; Sekiya and Suzuki 2011), and cardiomyocytes (Efe et al. 2011;

Ieda et al. 2010) (to highlight only a few examples), by inducing the expression of key transcription factors in starting fibroblast populations. Although direct reprogramming acts as an additional method for generating cell types of interest by bypassing the pluripotency state, this technology has been met with relatively low efficiency. Nonetheless, direct reprogramming has demonstrated the remarkable plasticity of somatic cell fate and continues to provide technical alternatives for modeling disease, discovering new pharmaceutics, and obtaining cells for autologous based cell therapies.

1.5 Summary and research aims

A substantial percentage of the population is afflicted with myelin-related diseases, which include both acquired (e.g. multiple sclerosis) and congenital (e.g.

PMD and Krabbe) disorders. Regardless of etiology, there are currently no clinical treatments for dysmyelinating diseases. Recent work in animal models of human leukodystrophies has demonstrated the therapeutic potential of oligodendrocyte progenitor cell transplantation for treatment of dysmyelinating diseases (Bin et al.

2012; Goldman et al. 2012 Windrem et al. 2008; Yandava et al. 1999). For this reason, there exists a clinical need for derivation of autologous oligodendrocyte progenitor cells.

In cases of inherited disorders of myelin, genetic mutations preclude the function of autologously derived oligodendrocyte progenitor cells. In principle, correcting genetic mutations in patient-derived fibroblasts/iPS cells followed by induction of oligodendrocyte progenitor fate would provide an abundant supply of autologous OPCs for therapeutic purposes, but currently no autologous systems exist for deriving OPCs from non-neural cells. By modulating transcription factors to change the state of the cell, functional OPCs can be directly reprogrammed from autologous non-neural cells for potential patient specific therapies. Therefore, the aims of this research are to develop autologous methods for the generation of

OPCs from both starting fibroblast and iPS cell populations.

Future directions will focus on leveraging these reprogramming methods for the generation of autologous gene-corrected myelinogenic OPCs. Together these

56 studies will determine the therapeutic potential of treating hypomyelinating disorders with the use of gene-corrected autologous OPCs from a diseased starting somatic population.

Chapter 2: Transcription factor-mediated reprogramming of fibroblasts to expandable, myelinogenic oligodendrocyte progenitor cells

A modification of this chapter has been published as:

Najm FJ*, Lager AM*, Zaremba A, Wyatt K, Caprariello AV, Factor DC, Karl TK,

Maeda T, Miller RH, and Tesar PJ. Transcription factor-mediated reprogramming of fibroblasts to expandable, myelinogenic oligodendrocyte progenitor cells.

Nature Biotechnology 5, 426-433 (2013).

*These authors contributed equally to this work (Figures 2.1-2.11)

2.1 Abstract

Cell-based therapies for myelin disorders, such as multiple sclerosis and leukodystrophies, require technologies to generate functional oligodendrocyte progenitor cells. Here we describe direct conversion of mouse embryonic and lung fibroblasts to induced oligodendrocyte progenitor cells (iOPCs) using sets of either eight or three defined transcription factors. iOPCs exhibit a bipolar morphology and global gene expression profile consistent with bona fide OPCs. They can be expanded in vitro for at least five passages while retaining the ability to differentiate into multiprocessed oligodendrocytes. When transplanted to hypomyelinated mice, iOPCs are capable of ensheathing host axons and generating compact myelin.

Lineage conversion of somatic cells to expandable iOPCs provides a strategy to study the molecular control of oligodendrocyte lineage identity and may facilitate neurological disease modeling and autologous remyelinating therapies.

2.2 Introduction

Myelin loss or dysfunction affects millions of people worldwide and causes substantial morbidity and mortality. Diseases of myelin in the central nervous system (CNS) are often severely disabling and include adult disorders such as multiple sclerosis and childhood diseases such as cerebral palsy and congenital leukodystrophies. Oligodendrocyte progenitor cells (OPCs), the predominant source of myelinating oligodendrocytes in the CNS, have shown promise as a

59 cellular therapeutic in animal models of myelin diseases (Franklin and Ffrench-

Constant 2008; Goldman et al. 2012; Windrem et al. 2008). However, sources of

OPCs have been restricted largely to allogeneic fetal cells with limited expansion capacity (Sim et al. 2011). Thus, technologies to generate scalable and autologous sources of OPCs are of great interest as they would enable large-scale drug screening and cell-based regenerative medicine. Methods based on pluripotent stem cells or direct lineage reprogramming may meet these requirements.

Recently, we showed efficient differentiation of mouse pluripotent stem cells into pure populations of expandable, myelinogenic OPCs using defined developmental signals (Najm et al. 2011). In the present study, we sought to apply our understanding of oligodendrocyte development to directly convert mouse fibroblasts to expandable OPCs by forced expression of a small number of transcription factors (TFs) (Figure 2.1a). Several studies have laid the foundation for the use of lineage conversion in regenerative therapies for neurological disorders (Caiazzo et al. 2011; Han et al. 2012; Kim et al. 2011; Lujan et al. 2012;

Pang et al. 2011; Pfisterer et al. 2011; Son et al. 2011; Their et al. 2012;

Vierbuchen et al. 2010; Yoo et al. 2011). Although these reprogramming technologies have been applied to generate various neuronal fates, such as neurons and neural stem cells, production of myelinogenic OPCs has remained elusive. Here we show that defined sets of transcription factors can reprogram mouse fibroblasts into myelinogenic iOPCs. With further optimization, this approach could provide a source of functional OPCs that will complement, and

60 possibly obviate, the use of pluripotent stem cells and fetal cells in cell-based remyelinating therapies.

2.3 Methods

Isolation of Plp1-eGFP, R26-M2rtTA fibroblasts. Both MEFs and MLFs were isolated at embryonic day 13.5 (E13.5) from embryos generated through timed natural matings between Plp1-eGFP mice and rtTA mice (B6.Cg-

Gt(ROSA)26Sortm1(rtTA*M2)Jae/J; Jackson Laboratory) (Mallon et al. 2002). For

MEFs, the head, spinal cord and all internal organs were carefully removed to eliminate contamination with any neural precursors. The remainder of the tissue was cut into small pieces and dissociated using 0.125% trypsin-EDTA (Invitrogen).

Cells were expanded for one passage and cryopreserved for future use. MLFs were isolated by dissociating pooled lung lobes using 0.125% trypsin-EDTA, expanded for two passages and cryopreserved for future use. Both MEFs and

MLFs were derived in DMEM supplemented with 10% FBS (FBS), 2 mM glutamax,

1× nonessential amino acids and 0.1 mM 2-mercaptoethanol.

Selection of 8TFs. The following publically available GEO data sets were used for Figure 2.1b: GSM241931, GSM241936, GSM241929, GSM241937,

GSM241934, and GSM241933 (Cahoy et al. 2008). Putative transcription factors were filtered by selecting genes with both a 'GO cellular component term' “nucleus” and a 'GO molecular function term' “DNA binding.” Transcription factors that were

61 enriched over threefold in a particular lineage were selected and cross-referenced with our own microarray data of stem cell–derived OPCs and oligodendrocytes

(GEO data set: GSE31562). Data were then z-scored and plotted in R using the heatmap.2 function of the gplots package.

Production of lentivirus. The mouse coding regions of Myrf, Myt1, Nkx2.2, Olig1,

ST18, Nkx6.2, Olig2 and Sox10 were cloned into the pLVX-Tight-Puro vector

(Clontech). VSV-G pseudotyped lentivirus was generated according to the manufacturer's protocol using the Lenti-X HT Packaging Mix and Lenti-Phos or

Cal-Phos Mammalian Transfection Kit (all from Clontech). 293T cells (Clontech) cultured on rat tail collagen I coated plasticware (BD Biosciences) were seeded to a density between 6.0–8.5 × 104 cells/cm2 and transfected 16 h later. Individual supernatants containing virus were harvested at 48 and 72 h post-transfection and filtered with 0.45 μm PVDF membrane (Millipore).

iOPC generation. MEFs or MLFs were seeded at 1.3 × 104 cells/cm2, allowed to attach overnight and infected with fresh lentivirus supplemented with polybrene (8

μg/ml) four times over a 2-d period. For 8TF infection, an equal volume of fresh lentiviral supernatant was mixed from each of the 8TFs before infection. To facilitate the comparison of data between 3TF and 8TF experiments, 3TF infections were done by mixing equal volumes of fresh lentiviral supernatant from each of the 3TFs and diluted with five equivalent volumes of MEF medium. For

'high viral titer' experiments in Figure 2.9, an equal volume of lentiviral supernatant

62 from the 3TFs was mixed and added directly to cells without further dilution. The end of the virus infection period was termed 'day 0'. Cells were either uninduced or induced with 2 μg/ml doxycycline (Clontech) for 3 d in MEF culture conditions.

Cells were then lifted with TrypLE Select (Invitrogen) and either frozen or seeded at 2.0 × 104cells/cm2 on Nunclon-Δ plates precoated with 0.1 mg/ml poly-L- ornithine (Sigma) and 10 μg/ml laminin (Sigma; L2020) and cultured in OPC medium, which consisted of DMEM/F12 (Invitrogen, 11320) supplemented with 1×

N-2 Plus or 1× N-2 Max (R&D Systems), 1× B-27 without vitamin A (Invitrogen), 2 mM Glutamax (Invitrogen), 200 ng/ml SHH (R&D Systems), 20 ng/ml FGF2 (R&D

Systems) and 20 ng/ml PDGF-AA (R&D Systems). Media was changed every 2 d.

Putative iOPCs (Plp1-eGFP+ cells) were typically sorted from day 14–21 using a

FACSAria (BD Biosciences) and further expanded in OPC medium with FGF2,

PDGF-AA and SHH in the presence or absence of doxycycline. iOPCs were passaged every 3–5 d with TrypLE Select and could be readily frozen and thawed in DMEM supplemented with 10% FBS and 10% DMSO (Sigma).

iOPC differentiation to iOLs. For differentiation of 8TF-induced or 3TF-induced cells into iOLs, cells were seeded at 2.1 × 104 cells/cm2 (MEFs) or 1.1 ×

104 cells/cm2 (MLFs) and differentiated with DMEM/F12 supplemented with 1× N-

2,1x B-27 without vitamin A, 2 mM Glutamax, 40 ng/ml T3 (Sigma), 200 ng/ml

SHH, 100 ng/ml Noggin, 50 μM cAMP, 100 ng/ml IGF and 10 ng/ml NT3, either in the presence or absence of doxycycline on poly-L-ornithine– and laminin-treated cultureware. Cultures were fixed after 3 d and stained for MBP. iOLs were

63 quantified by manually counting the number of multiprocessed MBP+ cells relative to the number of cells seeded. For 3TF lineage differentiation experiments seen in Figure 2.9d, cells were cultured in either neuronal differentiation medium consisting of Neurobasal (Invitrogen, 21103-049) supplemented with DMEM/F12

(Invitrogen, 11320-033), 1× N-2, 1× B-27 with vitamin A (Invitrogen,17504004), 2 mM Glutamax, and 20 ng/ml BDNF (R&D Systems) for 7 d or astrocyte differentiation medium consisting of DMEM/F12 supplemented with 1× N-2, 1× B-

27 without vitamin A, 2 mM Glutamax, 103 units/ml LIF and 50 ng/ml BMP4 (R&D

Systems) for 3 d.

Immunocytochemistry. Cells were prepared for immunostaining by fixation in 4% paraformaldehyde (Electron Microscopy Sciences) for 15 min and subsequent permeabilization for 10 min with 0.2% Triton-X in PBS. Cells were then blocked for nonspecific binding with filtered 10% normal goat (Abcam) or 10% donkey serum

(Abcam) in PBS for 1–2 h at room temperature. Primary antibodies were diluted in blocking solution and incubated with the samples overnight at 4 °C. Samples were rinsed with PBS and incubated with the appropriate fluorescently labeled Alexa-

Fluor secondary antibodies (Invitrogen, 1:500) for 1 h at room temperature.

Nuclear staining samples were incubated with 1 μg/ml DAPI (Sigma) for 5 min.

Primary antibodies used were: Sox10 (R&D Systems, AF2864; 2 μg/ml), Olig2

(Millipore, AB9610; 1:1,000), Nkx6.2 (Abcam, ab58708; 1 μg/ml), Sox1 (R&D

Systems, AF3369; 1 μg/ml), Sox2 (R&D Systems, MAB2018; 1 μg/ml), Pax6

(Covance, PRB-278P; 0.67 μg/ml), Oct3/4 (Santa Cruz, SC-5279; 0.4 μg/ml),

Nkx2.2 (DSHB, 74.5A5; 4.4 μg/ml), GFAP (DAKO, Z0334; 0.58 μg/ml), MAP2

(Millipore, AB5622; 2 μg/ml), MBP (Covance, SMI-99P; 2 μg/ml), MBP (Abcam, ab7349; 1:100), myelin-associated glycoprotein (Millipore, MAB1567;10 μg/ml) and myelin oligodendrocyte glycoprotein (Millipore, MAB5680; 5 μg/ml). For O4 staining, cells were incubated live with 10% donkey serum and O4 antibody (Miller

Lab; 1:10) for 20 min. Cells were then gently rinsed three times with cell medium and fixed with 4% PFA in PBS. Staining was then completed as detailed above.

FACS and flow cytometry. For Plp1-eGFP expression analysis, cells were analyzed on a FACSAria or LSR flow cytometer (BD Biosciences) and plots were generated with WinList 3D 7.0 software. Gates for Plp1-eGFP were set with negative control cells (wild-type MEFs without a GFP transgene) at <0.1% positive cells. For A2B5 immunosorting, cells were collected from culture and blocked in

10% normal donkey serum for 30 min. Cells were then stained with A2B5 primary antibody (R&D Systems, MAB 1416; 5 μg/ml) for 30 min followed by incubation with Alexa Fluor–labeled secondary antibody (Invitrogen; 4 μg/ml) for 20 min.

Isotype control antibody was used as a staining control and to set gates (Mouse

IgM, Invitrogen; 5 μg/ml) with Alexa Fluor secondary antibody (Invitrogen; 4 μg/ml).

Some experiments were carried out with APC-conjugated A2B5 (Miltenyi Biotec,

130-093-582; 1:11) and conjugated isotype control (Miltenyi Biotec, 130-093-176;

1:11). PDGFRa and NG2 flow cytometry was carried out as detailed previously

(Najm et al. 2011).

RNA isolation and qPCR. Total RNA was isolated as for gene expression analysis. 400 ng of RNA was reverse transcribed with SuperScript III Reverse

Transcriptase (Invitrogen) and qPCR was performed using 8 ng of cDNA with

TaqMan Gene Expression Master Mix and TaqMan probes: Sox10

(Mm01300162_m1), Nkx6.2 (Mm00807812_g1), Olig1 (Mm00497537_s1),

Nkx2.2 (Mm01275962_m1), Myt1 (Mm00456190_m1), ST18 (Mm01236999_m1),

Gm98 (Myrf) (Mm01194959_m1) and Olig2 (AJVI3GC, custom) on the 7300 Real-

Time PCR System (Applied Biosystems). Endogenous Olig2 expression was detected using the Olig2 (Mm01210556_m1) TaqMan probe in which one primer sits outside of the CDS and therefore does not detect expression from the Olig2- inducible lentiviral vector. All expression data were normalized to Gapdh (Mm99999915_g1) and samples in which no expression was detected were given an arbitrary Ct value of 40. All analyses were performed with quadruplicate technical replicates for each of a minimum of three independent biological replicates. Relative expression levels were determined by calculating

2−ΔΔCt with corresponding s.e.m.

Global gene expression. Cells were lysed in 1 ml TRIzol (Invitrogen) and stored at −80 °C until ready for use. Chloroform separation was enhanced with Phase-

Lock Gel Tubes (5 Prime). The aqueous phase was collected and the RNA isolation completed with the RNeasy Plus Kit (Qiagen) according to the manufacturer's protocol. Sample labeling and hybridization to Affymetrix Mouse

Gene 1.0 ST arrays (containing probes covering 28,853 mouse genes) were

66 carried out in the Gene Expression and Genotyping Core Facility of the Case

Comprehensive Cancer Center. Data were extracted, and Robust Multi-array

Average (RMA) normalized using Affymetrix Expression Console software (ver.

1.1). All data are available on the NCBI Gene Expression Omnibus website through GEO Series accession (GSE45440, GSM241931, GSM241936,

GSM241929, GSM241937, GSM241934,GSM241933 and GSE31562). For heat maps in Figures 2.4g and 2.7d, data were z-scored and plotted in R using the heatmap.2 function of the gplots package. Plots were rank ordered by the ratio of

MEF expression to OPC expression where MEF-specific genes were at the top and OPC-specific genes were at the bottom. Genes were removed from the analysis if signal was not detected above background in any of the six samples analyzed. The plots therefore included values for 13,919 genes. To analyze the global changes during reprogramming, genes increased or decreased twofold between 8TF-induced cells or 8TF A2B5+ iOPCs and MEFs were calculated. Files in BED format containing the transcription start sites ± 100 base pairs of all the genes within each class (genes upregulated in 8TF-induced cells, genes downregulated in 8TF-induced cells, genes upregulated in A2B5+ iOPCs and genes downregulated in A2B5+ iOPCs), were assembled and compared to the background set using the GREAT (http://great.stanford.edu).

Organotypic slice culture myelination analysis. Experiments were carried out as described previously (Najm et al. 2011). The forebrains of early postnatal day 5 homozygous shiverer (C3Fe.SWV-Mbpshi/Mbpshi; Jackson Laboratory) were

67 dissected and 300-μm slices produced on a Leica Vibratome. Slices were cultured in a DMEM/BME base supplemented with 15% horse serum, modified N-2 supplement and PDGF-AA for 3 d (Mi S et al. 2009). 5 × 104–2 × 105 cells (8TF- induced, 3TF-induced, A2B5+ 8TF-induced or uninduced controls) were manually transplanted with a pulled glass pipette into each slice and grown for an additional

10 d in culture. For staining, slices were then fixed in 4% paraformaldehyde, treated with ice-cold 5% acetic acid/95% methanol and assayed for MBP expression (Covance, SMI99 and/or SMI94; 4 μg/ml) with either enzymatic secondary substrate (Jackson Labs, Biotin-anti-mouse IgG; Vector Labs, ABC;

Sigma, DAB) or Alexa-Fluor secondary antibody (Invitrogen; 4 μg/ml). For confocal imaging of iOPC ensheathment of axons, d10 A2B5+ iOPC-transplanted forebrain slices were fixed in 4% paraformaldehyde, treated with 0.2% Triton-X and labeled with neurofilament cocktail (Covance, SMI-311 and SMI-312; 1:1,000) and GFP

(Aves Labs, 1020; 10μg/ml) antibodies overnight. Alexa-Fluor secondary antibodies (Invitrogen; 4 μg/ml) were used for detection. Slices were mounted using Vectashield (Vector Labs) and images were acquired with a Zeiss LSM 510

META laser scanning confocal microscope (Carl Zeiss MicroImaging, Jenna,

Germany) using a 40× C-Apochromat, NA 1.2, water immersion objective. All images presented are maximum intensity projections of a Z series consisting of 1-

μm optical slices collected every 0.5 μm. Although Triton-X was necessary for the

NF and GFP antibodies, it is known to disrupt membrane proteins (that is, myelin) and therefore its use was minimized as much as possible when staining forebrain slices. For electron microscopy, slices were fixed in electron microscopy fixative

(4% paraformaldehyde and 2% glutaraldehyde in 0.1 M cacodylate buffer, pH 7.4).

Slices were prepared for electron microscopy by incubation in 1% osmium tetroxide and staining en bloc in uranyl acetate. Samples were then dehydrated and embedded in Poly/Bed 812 epoxy. Thick (1 μm) transverse sections were cut and stained with toluidine blue. Thin (90 nm) sections were cut, collected on 300-

μm nickel grids, stained with uranyl acetate and lead citrate, and carbon-coated for imaging on a JEOL JEM-1200-EX electron microscope.

Spinal cord transplantation. Cells were lifted with TrypLE Select, thoroughly rinsed three times with cell media, and concentrated at ~1.0 × 105 cells/μl.

Postnatal day 3–4 homozygous shiverer mice were anesthetized with isofluorane and positioned lying prone on a thin roll of gauze such that the animal's thoracic spine rested higher than the rest of the anterior-posterior body axis. Using the rib cage as a landmark for the lower thoracic spinal level 13, a 30-gauge needle attached to a 10-μl Hamilton syringe was inserted between two lamina just below the bone at a depth of ~2 mm accounting for skin thickness. As slowly as the unassisted hand could manage, 5 × 104 cells (in a volume not exceeding 1 μl) were injected into the dorsal white matter. The needle was left in place for ~1 minute to avoid liquid reflux upon needle withdrawal. After 9–14 d mice were deeply anesthetized with rodent cocktail (ketamine, xylazine and acepromazine), perfused transcardially with 0.9% saline at room temperature and then perfused with ice-cold 4% paraformaldyhyde, spinal columns were dissected out and post- fixed in ice-cold 4% paraformaldyhyde for 2 h. Spinal cords were dissected out of

69 the spinal columns and vibratome sectioned into individual 300-μm sections that were visualized for the presence of Plp:eGFP+ cells in the dorsal column white matter. Sections containing Plp:eGFP+ cells were imaged and immediately transferred to electron microscopy fixative (4% paraformaldehyde and 2% glutaraldehyde in 0.1 M cacodylate buffer, pH 7.4) and incubated overnight.

Sections were prepared for electron microscope by incubation in 1% osmium tetroxide and staining en bloc in uranyl acetate and then dehydrated and embedded in Poly/Bed 812 epoxy. Thick (1 μm) transverse sections were cut and stained with toluidine blue. Thin (90 nm) sections were cut, collected on 300-μm nickel grids and carbon-coated for electron microscopy on a JEOL JEM-1200-EX electron microscope. G-ratios were calculated using image analysis software

(Adobe Photoshop) by dividing axon diameter with total diameter of the myelinated fiber.

Immunostaining of MBP in epoxy-embedded sections. 0.5 μM and 1 μM thick sections of Poly/Bed 812 embedded wild-type and cell-injected shiverer spinal cord were etched using a modification of a process described previously35. Sections were treated with Target Antigen Retrieval solution (DAKO, pH 9.0) and rinsed with

1× D-PBS (Cellgro). They were then incubated in a 1:200 dilution of anti-Myelin

Basic Protein antibody (SMI-94, Covance) for 4 nights at 4 °C, rinsed several times with 1× D-PBS (Cellgro) and incubated at ambient temperature in a 1:200 dilution of horseradish peroxidase–conjugated donkey anti-mouse IgG antibody (Jackson

ImmunoResearch) for 1.5 h. The staining was visualized using diaminobenzidine

(SigmaFast kit). The sample was imaged using transmitted light and oil immersion lens at 100× on a Leica DM 5500B light microscope with a Leica DFC 500 camera.

Serial block face scanning electron microscopy and 3D reconstruction. Sections of cell-injected spinal cord were prepared for 3D electron microscopy using a modified version of previously published methods (Denk and Horstmann 2004;

Mikula et al. 2012). Samples were post-fixed in 2% paraformaldehyde and 2.5% glutaraldehyde with 2 mM calcium chloride in 0.1 M cacodylate buffer, pH 7.4.

Samples were then incubated in 2% osmium tetroxide, subsequently stained en bloc in uranyl acetate and then Walton's lead aspartate. They were dehydrated and embedded in Durcupan ACM resin (EMS). Thick (0.5 μm) transverse sections were cut and stained with a 1% toluidine blue/1% sodium borate solution, and the region of interest was determined and trimmed. Serial blockface scanning electron microscopy was done using a Gatan 3View in-chamber ultramicrotome mounted on a Carl Zeiss Sigma VP scanning electron microscope. Images were obtained in 100 nm increments for an ROI bounded by ~50 μm on each side, resulting in a

3D stack of 570 images (actual ROI dimensions: x = 64 μm, y = 76 μm, z = 57 μm).

Images were analyzed using Fiji-ImageJ (NIH) to align the stack, followed by Amira

5.4.2 for segmentation and 3D reconstruction.

2.4 Results

Expression of oligodendrocyte-lineage TFs in fibroblasts. Using microarray data (Cahoy et al. 2008; Najm et al. 2011), we identified TFs highly enriched in each of the three major CNS lineages: astrocytes (29 TFs), neurons (13 TFs), and

OPCs and oligodendrocytes (52 TFs) (Figure 2.1b). We selected eight TFs from the OPC and oligodendrocyte lists on the basis of their known roles during oligodendrocyte development or their ability to enhance oligodendrogenesis when expressed in neural progenitors and cloned the coding region of each gene individually into a doxycycline-inducible lentiviral vector (Olig1, Olig2, Nkx2.2,

Nkx6.2, Sox10, ST18, Gm98 (Myrf) and Myt1; collectively referred to as 8TF)

(Figure 2.2a) (Liu et al. 2007; Zhang et al. 2005). The 8TF lentiviral pool was used to infect mouse embryonic fibroblasts (MEFs) isolated from mice constitutively expressing the reverse tetracycline-controlled transactivator (rtTA) and a modified

Plp1-eGFP transgene, which is expressed specifically in both OPCs and oligodendrocytes (Beard et al. 2006; Mallon et al. 2002). The Plp1-eGFP, R26-

M2rtTA MEFs were carefully isolated to be free of all neural tissue, as demonstrated by the lack of expression of neural stem cell, neuronal, astrocytic,

OPC and oligodendrocytic markers by immunostaining, qPCR, microarray and flow cytometry (Figure 2.1c, Figure 2.2b, and Figure 2.3a,b).

In all experiments, we monitored both the percentage of infected cells, by immunostaining of the individual TFs, as well as the transgene induction levels, by qPCR (Figure 2.2b). Typically, 30–60% of cells were infected with an individual

72 factor. Therefore, when cells were infected with multiple viruses, only a small proportion of cells received all TFs. In spite of this, infection of MEFs with the 8TF pool followed by doxycycline induction (a population designated '8TF-induced'

MEFs below) consistently resulted in a large percentage of cells expressing the

OPC- and oligodendrocyte-specific Plp1-eGFP transgene at day 21 when cells were cultured in defined OPC-promoting culture conditions, containing FGF2,

PDGF-AA and sonic hedgehog (SHH) supplements (32.4% ± 9.9%; n = 19 independent biological replicates from three independent lots of lentivirus) (Figure

2.1c,d). Uninfected (no TFs) and uninduced (without doxycycline) Plp1-eGFP

MEFs cultured under identical conditions for the entire 21-d time course did not express the Plp1-eGFP transgene (Figure 2.1c,d).

8TF-induced fibroblasts exhibit properties of OPCs. We examined the 8TF- induced MEFs for cellular or molecular features consistent with those of bona fide

OPCs. During development, OPCs first emerge from the ventral ventricular zone of the spinal cord, have a bipolar morphology, proliferate in response to PDGF and

FGF, express a defined set of oligodendrocyte lineage genes and are uniquely able to generate myelinating oligodendrocytes required for CNS myelin maintenance and repair (Bogler et al. 1990; Cahoy et al. 2008; Crang et al. 1998;

Noble et al. 1988; Noll and Miller 1993; Richardson et al. 1988; Rowitch and

Kriegstein 2010; Watkins et al. 2008). After induction of the 8TF-transduced cells, a subpopulation of the cells underwent a marked morphological change within 21 d, from large, flat, spindle-shaped cells (fibroblasts) to small, bipolar cells, termed

73 iOPCs after further characterization (Figure 2.4a,b). We assessed whether the

8TF-induced cells could differentiate into oligodendrocytes in response to growth factor removal and addition of thyroid hormone (T3), a known inducer of oligodendrocyte differentiation, in vitro (Barres et al. 1994). Notably, within 3 d some of the 8TF-induced cells differentiated into cells with a multiprocessed morphology typical of oligodendrocytes (Figure 2.4c), called induced oligodendrocytes (iOLs). All iOLs expressed myelin basic protein (MBP), an integral protein component of the myelin sheath, and other defining markers of mature oligodendrocytes, including myelin-associated glycoprotein and myelin oligodendrocyte glycoprotein (Figure 2.4d-f).

The efficiency of reprogramming fibroblasts to iOPCs and iOLs is difficult to calculate as the cells proliferate during the 21-d induction time course and only 1–

2% receive all 8TFs from the initial lentiviral infections. However, we calculated that, at day 21, ~1 in 900 cells in our bulk 8TF-induced MEF cultures were capable of generating multiprocessed MBP+iOLs after culture in oligodendrocyte differentiation conditions for an additional 3 d (Figure 2.5a). Generation of iOLs was dependent upon 8TF induction, as uninfected (no TFs with doxycycline) or uninduced (8TFs without doxycycline) cells never gave rise to iOLs under identical differentiation conditions (Figure 2.5).

8TF-induced fibroblasts globally express OPC genes. Although the bulk 8TF- induced MEF cultures at day 21 contained only ~0.1–1% fully reprogrammed cells, as evidenced by the efficiency of forming MBP+ iOLs, global gene expression

74 analysis of bulk 8TF-induced MEF cultures showed substantial downregulation of the MEF-specific program and large-scale activation of genes specific to the oligodendrocyte lineage (Figure 2.4g). As eight of the OPC-specific genes were initially expressed from our inducible lentiviral vectors, we confirmed, using specific qPCR primers, that the endogenous Olig2 gene, which is required for oligodendrocyte lineage specification, was activated (Figure 2.5b). We functionally annotated the gene expression changes caused by 8TF induction using the genomic regions enrichment of annotations tool (GREAT) (McLean et al. 2010).

GREAT analysis of genes upregulated in 8TF-induced MEF cultures showed significant association (all P < 1 × 10−5) with Gene Ontology (GO) biological processes, such as “myelination” and “gliogenesis”; with Mouse Genome

Informatics (MGI) phenotype ontology terms associated with “oligodendrocyte morphology” and “glial cell morphology”; with MGI expression ontology terms, such as “TS22 spinal cord; lateral wall; ventricular layer”; and with Disease Ontology terms, such as “demyelinating disease” and “schizophrenia” (Figure 2.5c). Genes downregulated in 8TF-induced MEF cultures showed significant association with a large number of mesodermal processes, consistent with inactivation of the global fibroblast gene expression program (Figure 2.5d).

8TF-induced fibroblasts generate compact myelin. We studied the ability of

8TF-induced MEFs to myelinate axons of hypomyelinated shiverer (Mbpshi/shi) mice, which completely lack MBP and compact myelin and serve as a model of congenital dysmyelinating disorders (Chernoff 1981). Compact myelin is required

75 for effective saltatory conduction of action potentials along nerve fibers. We first transplanted the cells into organotypic slice cultures of early postnatal shiverer forebrain in vitro (Figure 2.6a) (Bai et al. 2012; Gahwiler et al. 1997; Najm et al.

2011). The cells engrafted into forebrain slices, colonized major white-matter tracts, including the corpus callosum, and generated characteristically aligned

MBP+ myelin sheaths in 10 d (Figure 2.6b). Furthermore, ultrastructural analysis by electron microscopy showed that the cells generated multilayered compact myelin sheaths around hypomyelinated shiverer host axons in slice culture (Figure

2.6c-e).

We next tested whether 8TF-induced cells could function to myelinate shiverer axons in vivo without continued doxycycline induction of the transgenes.

We transplanted 5 × 104 8TF-induced cells into the dorsal region of the spinal cord of early-postnatal (P3-4) shiverer mice (n = 4) and analyzed them after 9–14 d

(Figure 2.6f). Transplanted cells colonized the dorsal column white matter of shiverer mice and appeared to generate compact myelin sheaths around dorsal column axons (Figure 2.6g,h). As shiverer mice are devoid of MBP and therefore lack compact myelin in the CNS, definitive proof of myelination by transplanted cells requires more detailed analysis. We therefore stained sections of shiverer spinal cord transplanted with 8TF-induced cells and found that the myelin produced was MBP+ (Figure 2.6i,j). This shows that the myelin produced was of donor origin and not derived from shiverer host peripheral Schwann cells that may have migrated into the CNS during transplantation. Moreover, electron microscopy analysis of the produced myelin showed clear evidence of ultrastructurally normal

76 myelin and the presence of major dense lines (Figure 2.6k). We further analyzed and quantified the myelin produced by 8TF-induced cells by calculating g-ratios— a g-ratio is the ratio of axon diameter to total diameter of a myelinated fiber. The g-ratios of myelin produced by 8TF-induced cells was indistinguishable from that of wild-type myelin (wild type, 0.69 ± 0.07; shiverer, 0.88 ± 0.05; 8TF in vitro, 0.68

± 0.07; 8TF in vivo, 0.70 ± 0.07) (Figure 2.6l-o).

We noted that the myelin produced from 8TF-induced cells in slice cultures showed clear properties of oligodendrocyte myelin in that individual cells myelinated multiple axons, whereas the same cells transplanted in vivo seemed to myelinate only a single axon, a property consistent with Schwann cell myelination.

To explore this issue, we conducted serial block-face scanning electron microscopy on the dorsal column of shiverer mice after transplantation of 8TF- induced cells.

Prospective enrichment of expandable iOPCs. We sought to purify the fully reprogrammed iOPCs from the bulk 8TF-induced cultures by immunosorting. As

OPCs are typically defined by the expression of cell-surface markers, including

PDGFRa (CD140a), NG2 (Cspg4) and A2B5, we attempted to prospectively isolate iOPCs using both the Plp1-eGFP transgene and an additional cell-surface marker. Both PDGFRa and NG2 were expressed on uninduced MEFs, but A2B5 was not. We sorted 8TF-induced MEF cultures at day 21 using A2B5 and Plp1- eGFP and found that 2.30 ± 1.62% (8TF: n = 4 biological replicates from two independent lots of lentivirus) of the cells expressing the Plp1-eGFP reporter were

A2B5+. The A2B5+cells were a near-homogeneous population of bipolar cells with a morphology similar to bona fide OPCs and different from MEFs (Figure 2.7a-c).

Hierarchical clustering and pair-wise comparisons of global gene expression data showed that 8TF-induced A2B5+ cells correlated tightly with bona fide OPCs

(Figure 2.7d-f). GREAT analysis of gene expression patterns in 8TF-induced

A2B5+ cells showed significant associations with such patterns in glial-, oligodendrocyte- and myelin-related processes, phenotypes and diseases.

The 8TF-induced A2B5+ cells could be stably expanded in culture for at least five passages. After six passages, 8TF-induced A2B5+ cells began to differentiate, senesce and lose Plp1-eGFP expression and were not used further.

During passages 1–6, 8TF-induced A2B5+ cells could be readily frozen and thawed without any apparent loss of potential. To analyze their myelinogenic potential, we injected 8TF-induced A2B5+ cells into organotypic slice cultures of early postnatal shiverer forebrain. Cells that were 8TF-induced and

A2B5+ preferentially colonized white matter tracts and differentiated into multiprocessed iOLs displaying extensive ensheathment of neuron axons labeled with neurofilament (NF) antibodies within 10 d (Figure 2.7g,h).

Reprogramming fibroblasts to iOPCs with three TFs. In an effort to reduce the number of transcription factors required to generate iOPCs, we induced the expression of eight separate 7TF pools, each lacking a single TF from the original

8TF pool (8TFs –1TF; n = 3 biological replicates), in the Plp1-eGFP/rtTA MEFs and used the percentage of Plp1-eGFP+ cells at day 21 as a surrogate assay for

78 reprogramming. Only pools lacking either Sox10 or Olig2 had significant decreases in the percentage of Plp1-eGFP+ cells (P < 0.05), indicating that these genes may be required for reprogramming (Figure 2.10a and Figure 2.8a). To determine whether these two factors alone were sufficient for reprogramming, we induced Sox10 and Olig2individually or in combination. We did not observe Plp1- eGFP+ cells at numbers similar to those observed with 8TFs (Figure 2.9a and

Figure 2.8b), and the Plp1-eGFP+cells that were produced did not generate any

MBP+ iOLs when cultured in differentiation conditions.

To investigate whether a third factor in combination with Sox10 and Olig2 would be adequate to produce iOPCs from MEFs, we induced the expression of three-TF pools. We found that Nkx6.2, when induced with Sox10 and Olig2 (collectively referred to as 3TF), was sufficient to produce

Plp1-eGFP+ cells (20.8% ± 1.5%; n = 3 biological replicates). After culture in oligodendrocyte differentiation conditions for 3 d, the 3TF-induced cells upregulated the early oligodendrocyte-specific cell-surface marker O4 (9.2% ±

1.5; n = 3 biological replicates), whereas uninduced and uninfected cells never gave rise to O4+ cells under identical culture conditions (Figure 2.9b,c). A subset of the 3TF-induced iOPCs also expressed the mature oligodendrocyte marker

MBP under oligodendrocyte differentiation conditions at a rate similar to that of

8TF-induced cells (Figure 2.9d,e).

To test whether 3TF-induced iOPCs could differentiate into other CNS cell fates, we cultured the cells in astrocyte- or neuron-promoting conditions in vitro (n =

3 replicates). The cells never gave rise to GFAP+ astrocytes or MAP2+ neurons in

79 these conditions, either in the presence or absence of doxycycline (Figure 2.9d).

As all 3TF-based experiments were matched to the same viral titer as our 8TF- based experiments, we determined whether increasing the viral titer would enhance reprogramming to iOPCs. A threefold increase in viral titer resulted in a fivefold increase in the percentage of MBP+ cells (Figure 2.9e and Figure 2.10a- c).

We evaluated the reprogramming time-course dynamics and the properties of the 3TF-induced cells. The reprogramming process was largely complete in 10–

14 d (Figure 2.10d). Global gene expression analysis showed that the 3TF-induced cells largely expressed the OPC-specific network of genes, including endogenous Olig2, and downregulated the MEF-specific network in a similar manner to 8TF-induced cells (Figure 2.7d and Figure 2.10e). When transplanted into shiverer forebrain slices, 3TF-induced cells colonized the corpus callosum and differentiated into MBP+ iOLs (Figure 2.9f,g and Figure 2.10f). Notably, the cells generated multilayered compact myelin with proper ultrastructure and g-ratios

(0.63 ± 0.09) (Figure 2.9f,h).

Finally, as all of our iOPC experiments were first performed on MEFs, we tested the 3TF pool on a different somatic cell type, mouse lung fibroblasts (MLFs)

(Figure 2.11a). 3TF-induced MLFs showed properties consistent with OPCs, were capable of extensive expansion in vitro, and consistently generated MBP+ iOLs at each passage upon growth factor withdrawal and exposure to T3 (Figure 2.11b,c).

Thus, Sox10, Olig2, and Nkx6.2 are sufficient to reprogram two separate somatic

80 cell types in 14–21 d to iOPCs capable of generating MBP+ myelinogenic oligodendrocytes.

Figure 2.1 - Eight transcription factors can reprogram mouse embryonic fibroblasts to induced oligodendrocyte progenitor cells. a, Experimental design overview and timeline for transcription factor-mediated reprogramming of Plp1:eGFP/rtTA fibroblasts to induced oligodendrocyte progenitor cells (iOPCs) which are expandable and capable of differentiating to induced oligodendrocytes (iOLs). The modified Plp1:eGFP transgene is expressed in both OPCs and OLs in vivo. b, Gene expression heat map showing transcription factors (TFs) enriched (yellow) in each of the three major CNS lineages (see Supplementary Table 1 for complete list of genes). c, Representative flow cytometry plots and the average percentage of Plp1:eGFP+ cells after 21 days in OPC culture conditions for: non-infected and uninduced cells (No TFs −Dox); non-infected and induced cells (No TFs +Dox); infected with 8TFs but not induced (8TFs −Dox); and infected with 8TFs and induced (8TFs +Dox). Only infection of 8TFs and induction gave rise to Plp:eGFP+ cells at day 21 (8TFs +Dox = 32.4% +/− 9.9%; n = 19 independent biological replicates from 3 independent lots of lentivirus). All other conditions were devoid of Plp1:eGFP+ cells at day 21 (<0.1%). d, Representative live-cell fluorescent images of Plp:eGFP MEF cultures that were infected with inducible lentiviruses containing the 8TF pool and cultured for 21 days in the absence (−Dox) or presence (+Dox) of TF induction. Scale bar, 50μm (d).

Figure 2.2 - Characterization of the selected eight transcription factor pool. a, Table listing the selected 8TFs along with their accession numbers and length (bp). Sequencing of our vectors showed an identical match to the coding sequence (CDS) of each gene except ST18 which differed at 1 base. b, qPCR results for 8TF +Dox MEFs 3 days after infection and induction compared to controls (No TFs +Dox and 8TFs -Dox). qPCR data are represented as mean ± S.E.M. Due to qPCR probe issues for Nkx2.2, we monitored Nkx2.2 induction using immunostaining (green). Scale bar, 50μm.

Figure 2. 3 - Characterization of MEFs utilized for reprogramming. a, Diagram of the strategy used to isolate MEFs devoid of neural tissue from E13.5 Plp1:eGFP/rtTA mice along with brightfield and fluorescent images of the embryos. b, Isolated Plp1:eGFP/rtTA MEFs cultures, which were used as the starting cell source for our reprogramming experiments, were negative for stem cell and neural cell lineage markers (n > 1,400 cells manually scored from triplicate wells for eight markers). Positive control cell types that were stained simultaneously with MEFs to ensure function of each antibody: embryonic stem cells (Oct4 and Sox2), pluripotent stem cell derived neural rosettes (Sox1 and Pax6), pluripotent stem cell derived OPCs (Olig2, Nkx2.2, and Sox10), and pluripotent stem cell-derived astrocytes (GFAP). Scale bars, 1mm (a) 50μm (b).

Figure 2.4 - Eight transcription factor induced MEFs exhibit properties of bona fide OPCs. a, b, Phase-contrast images highlighting the dramatic morphological differences between 21 day 8TF-uninduced (a; −Dox) and induced (b; +Dox) MEFs. Non-reprogrammed cells exhibit typical fibroblast morphology (black arrowheads) while a portion of the 8TF-induced cultures show the characteristic bipolar morphology of OPCs (white arrowheads). c, Phase-contrast image of day 21 8TF-induced MEFs passaged into oligodendrocyte differentiation media for 3 days showing the generation of induced oligodendrocytes (iOLs; green arrowheads) that exhibit the distinctive multiprocessed morphology of oligodendrocytes. d–f, Representative immunofluorescent images of iOLs differentiated from 8TF-induced MEFs, containing the Plp1:eGFP reporter and expressing the specific and defining markers of mature oligodendrocytes MBP (d), MAG (e), and MOG (f). g, Clustered heat map of z-scored global gene expression values comparing pluripotent stem cell-derived bona fide OPCs, 8TF-induced MEFs (8TFs +Dox), MEFs, and uninfected MEFs plus doxycycline (No TFs +Dox). Plot is rank ordered with OPC-specific genes at the top and MEF-specific genes at the bottom and includes >13,000 genes for which there was signal above background in at least one of the samples. Scale bars, 50μm (a), 100μm (b, c), 25μm (d–f).

Figure 2.5 - Properties of 8TF-induced MEFs. a, Quantification of the efficiency of day 21 8TF-induced MEFs to differentiate into MBP+ iOLs when exposed to differentiation conditions 4 for 3 days. Data are presented as mean ± S.E.M. of MBP+ iOLs per 4x10 cells seeded (n = 5 biological replicates from 3 independent lots of lentivirus). b, qPCR analysis showing activation of the endogenous Olig2 gene in 8TF-induced MEFs at day 21. Data are presented as mean ± S.E.M. c, d, Plots of select functional annotations associated with the genes up regulated (c) or down regulated (d) by 8TF induction in MEFs for 21 days. Functional annotations shown include gene ontology (GO) biological process (green), gene ontology (GO) cellular components (red), mouse phenotype (blue).

Figure 2.6 - Eight transcription factor induced MEFs function to generate compact myelin. a, Experimental scheme for testing the ability of 8TF-induced MEFs to myelinate axons in vitro. 8TF-induced MEFs were transplanted into P5 shiverer forebrain slices and cultured for 10 days. b, Representative immunofluorescent image of MBP+ myelin tracts generated from expanded (passage 3, day 32) 8TF-induced MEFs 10 days after transplantation into coronal forebrain slice cultures of shiverer mutant mice (lethally hypomyelinated due to a lack of Mbp). c–e, Electron micrograph images of multi-layered compact myelin (black arrowheads) generated by donor 8TF-induced MEFs 10 days after transplantation into coronal forebrain slice cultures of shiverer mutant mice. f, Experimental scheme for testing the ability of 8TF-induced MEFs to myelinate axons in vivo. 8TF-induced MEFs were transplanted into the dorsal spinal cord of P3-4 shiverer mutant mice. g, h, Representative immunofluorescent image (g) and matched toluidine blue (tol blue) stained section (h) showing localization of 8TF-induced cells (containing Plp1:eGFP transgene) 9 days after transplantation into the dorsal spinal cord of shiverer mutant mice (n=4 mice). The pia mater of the dorsal spinal cord is indicated by the dashed lines. (h, inset) Enlarged view of black box from (h) showing numerous myelinated axons generated from 8TF-induced cells. i–j, Representative immunostaining of MBP showing that the myelin produced in shiverer hosts 9 days after transplantation with 8TF-induced MEFs is of donor origin (i). Identically processed wild type control staining is shown in (j). k, Electron micrograph images of multi-layered compact myelin generated by 8TF-induced MEFs 9 days after transplantation into the dorsal spinal cord of shiverer mutant mice. Major dense lines are evident and indicated by black arrowheads. l–n, Electron micrographs of wild type dorsal column axons (l), untreated shiverer dorsal column axons (m), and shiverer dorsal column axons myelinated by transplanted 8TF-induced MEFs (n). o, g-ratios were calculated for wild type in vivo spinal cord (0.69±0.07), shiverer in vivo spinal cord (0.88±0.05) and 8TF-induced MEF (in vitro slices: 0.68±0.07 and in vivo spinal cord: 0.70±0.07) myelin. Differences between wild type and each of the other groups was compared using a two-tailed Student’s t-test −16 (***p<2.2×10 wild type vs. shiverer. All others not significant). Scale bars, 25μm (b), 2μm (c, l–n) 1μm (d), 500nm (e), 100μm (g, h), 100nm (k), and 10μm (i, j)

Figure 2.7 - A2B5 immunosorting allows for the prospective enrichment of iOPCs. a– c, Phase contrast images highlighting the bipolar morphology of 8TF-induced MEFs (sorted at day 21 for both Plp1:eGFP and A2B5; denoted as 8TF A2B5+ iOPCs) (a) compared to bona fide OPCs (b), and MEFs (c). d, Clustered heat map of z-scored global gene expression values comparing 8TF A2B5+ iOPCs to the same three control cell samples in Figure 2g [MEFs, uninfected MEFs plus doxycycline (No TFs +Dox), and pluripotent stem cell-derived bona fide OPCs]. Plot is rank ordered with OPC-specific genes at the top and MEF-specific genes at the bottom and includes >13,000 genes for which there was signal above background in at least one of the samples. e, f, Pairwise comparison of log2-adjusted global gene expression values of 8TF-induced A2B5+ iOPCs with MEFs (e) and bona fide OPCs (f). Blue lines denote a 2-fold difference in gene expression. Characteristic MEF-enriched (Thy1) and OPC-enriched (all others cited) genes are indicated with red arrows. g, h, Confocal images collected 10 days after transplantation of 8TF A2B5+ iOPCs, containing the Plp1:eGFP reporter, at passage 3 into coronal forebrain slice cultures of shiverermutant mice showing extensive ensheathment of neuron axons by 8TF A2B5+ iOLs. Neurons were visualized with anti-neurofilament (NF) and iOLs with anti-GFP antibodies. The corpus callosum (cc) is indicated with dashed white lines. Zoomed insets are presented to the right of each image. Scale bars, 50μm (a–c, g, h), and 10μm (g, h insets).

Figure 2.8 - Narrowing down the 8TF pool. a, Representative flow cytometry plots quantifying the percentage of Plp1:eGFP+ cells after individually removing single factors from the 8TF pool. MEFs were induced (+Dox) and analyzed at day 21. n = 3 biological replicates from 1 lot of lentivirus. b, Representative flow cytometry plots quantifying the induction of Plp1:eGFP+ cells by individual genes or pairs of the 3TF pool in MEFs. Cells were induced (+Dox) and analyzed at day 21. n = 3 biological replicates from 1 lot of lentivirus.

Figure 2.9 - Sox10, Olig2, and Nkx6.2 are sufficient to reprogram fibroblasts to iOPCs. a, Summary graph quantifying the percentage of Plp1:eGFP+ cells induced by subsets of the original 8TF pool at day 21 (n = 3 independent biological replicates from 1 lot of lentivirus; see Supplementary Figure 4 for representative flow cytometry plots). A 3TF pool of Sox10, Olig2, andNkx6.2 showed the robust ability to induce Plp1:eGFP+ cells from MEFs (20.8% +/− 1.5%). Differences between groups were compared using a two-tailed Student’s t-test (**p<0.02 and *p<0.05 versus 8TFs +Dox). b, c,Immunofluorescent (b) and quantification (c) data showing the capacity of 3TF-induced MEFs at day 21 (3TFs +Dox) to respond to differentiation signals (3TFs +Dox differentiated) and generate multiprocessed O4+ oligodendrocytes. Note that the undifferentiated cultures (3TFs +Dox) contain a population of O4+ cells which are largely bipolar. 3TF-uninduced MEFs (3TFs −Dox differentiated) and non-infected induced MEFs (No TFs +Dox differentiated) yielded no O4+ cells. O4+ cells were manually scored from triplicate wells and data are presented as mean ± S.E.M. (n = 3 independent biological replicates from 1 lot of lentivirus). d, Representative immunofluorescent images showing the differentiation potential of 3TF-induced MEFs (3TFs +Dox) when exposed to three different lineage inducing conditions. 3TF-induced MEFs differentiated in 3 days into iOLs that expressed MBP when exposed to oligodendrocyte differentiation conditions both in the presence (+Dox) or absence (−Dox) of doxycycline. 3TF-induced MEFs never gave rise to neurons (MAP2) or astrocytes (GFAP) either in the presence (+Dox) or absence (−Dox) of doxycycline when exposed to the respective neuron or astrocyte promoting culture conditions. Positive control cell types that were stained simultaneously to ensure function of each antibody: pluripotent stem cell derived oligodendrocytes (MBP), astrocytes (GFAP), and neurons (MAP2).

90 e, Quantitative efficiency of 3TF-induced MEFs (3TF +Dox) to differentiate into MBP+ oligodendrocytes when exposed to oligodendrocyte differentiation conditions for 3 days. Data 4 are presented as mean ± S.E.M. of MBP+ iOLs per 4×10 cells seeded (n = 10 independent biological replicates from 3 lots of lentivirus). 3TF +Dox cells generated with a high viral titer showed a parallel increase in the efficiency of generating MBP+ iOLs (3TF +Dox high virus titer; n= 8 independent biological replicates from 2 lots of lentivirus). f, Electron micrograph image of multi-layered compact myelin generated from day 21 3TF-induced MEFs 10 days after transplantation into coronal forebrain slice cultures of shiverer mutant mice. g, Immunofluorescent images of engraftment and morphology of Plp1:eGFP+ 3TF-induced MEFs 10 days after transplantation into P5 coronal forebrain slice cultures of shiverer mutant mice. h, g-ratios were calculated from 3TF-induced MEFs transplanted into shiverer forebrain slices (0.63±0.09). Differences between groups and wild type (shown are the same control samples as in Figure 3n: wild type (0.69±0.07), shiverer (0.88±0.05) and 8TF-induced MEFs transplanted into shiverer forebrain slices and dorsal spinal cords (0.69±0.07)) were compared using a two- −16 tailed Student’s t-test (***p<2.2×10 wild type vs. shiverer. All others not significant).. Scale bars, 25μm (b, d), 100μm (g), and 100nm (f).

Figure 2.10 - Properties of 3TF-induced MEFs. a, Representative infection and induction efficiency of our 3TF lentiviral vectors in MEFs. Cells were fixed, stained, and counted at day 3. b, qPCR results for 3TF +Dox cells 3 days after infection and induction compared to controls (No TFs +Dox and 8TFs -Dox). qPCR data are represented as mean ± S.E.M. Note that the olig2 probe utilized detects both vector and endogenous Olig2 expression and differs from that employed in Supplementary Figures 3 and 5e (see Methods). c, Representative infection and induction efficiency of our lentiviral vectors in MEFs using a high viral titer. Cells were fixed, stained, and counted at day 3. Note the increased number of cells expressing each factor as compared to our standard viral titer in (a). d, Percentage of Plp1:eGFP+ cells during the 21 day 3TF induction time course. n = 3 biological replicates from 1 lot of lentivirus. Data are presented as mean ± S.E.M. e, qPCR analysis showing activation of the endogenous Olig2 gene in 3TF- induced MEFs at day 14. Data are presented as mean ± S.E.M. f, Representative histochemical image of MBP+ (black) myelin tracts generated from 3TF-induced MEFs 10 days after transplantation into coronal forebrain slice cultures of shiverer mutant mice. Scale bar, 25μm.

Figure 2.11 - Three transcription factors are able to induce iOPCs from an additional somatic cell source. a, Representative flow cytometry plots quantifying the percentage of Plp1:eGFP+ cells induced by 3TFs from mouse lung fibroblasts (MLFs) at day 21. b, Representative immunofluorescent images showing that 3TF-induced MLFs, containing the Plp1:eGFP reporter, can be passaged and maintain the ability to differentiate in 3 days into iOLs that express MBP. c, Quantification of the efficiency of in vitro expanded 3TF-induced MLFs to 4 differentiate into MBP+ iOLs. Data are presented as mean ± S.E.M. of MBP+ cells per 4x10 cells seeded (n = 2 biological replicates from 1 lot of virus). Scale bars, 50μm (b).

2.5 Discussion

Here we show that functional iOPCs can be produced by delivering defined sets of transcription factors to mouse fibroblasts. Specifically, expression of three transcription factors, Sox10, Olig2 and Nkx6.2, is sufficient to convert two different sources of mouse fibroblasts to iOPCs that exhibit morphological and molecular features consistent with that of bona fide OPCs. In contrast to the ability of OPCs to form both oligodendrocytes and astrocytes, the lineage of iOPCs appears restricted to oligodendrocytes as they do not generate neurons or astrocytes when exposed to differentiation conditions in vitro. It remains possible that iOPCs could access neuron or astrocyte fates under other conditions. The myelination capacity of iOPCs was tested using organotypic slice cultures, which provide a complex 3D tissue representative of the CNS. When transplanted to postnatal forebrain slices, iOPCs myelinated multiple host axons and generated compact myelin. In contrast, iOPCs transplanted in vivo into the spinal cord appeared to myelinate only single axons, a property exhibited by Schwann cells in the peripheral nervous system.

Although this result was initially surprising, bona fide CNS OPCs are known to produce Schwann-like cells in vivo and myelinate only single axons (Zawadzka et al. 2010). Collectively, our data show that iOPCs function in vitro and in vivo to generate compact myelin and that different environments may direct them to myelinate single or multiple axons.

As with most current reprogramming strategies, the efficiency of generating iOPCs is low. We demonstrated that increasing the viral titer of the reprogramming

94 factors resulted in an increase in the efficiency of generating functional iOPCs.

This suggests that further refinement of the stoichiometry and expression levels of the reprogramming factors will lead to increased efficiency of functional iOPC production. In spite of the low reprogramming efficiencies, we showed that iOPCs could be prospectively isolated from the bulk reprogramming cultures using the monoclonal A2B5 antibody. Sorted A2B5+ iOPCs could be expanded for up to five passages while maintaining the ability to differentiate into oligodendrocytes and myelinate host axons after transplantation. Immunosorting of expandable iOPCs should facilitate the use of these cells in molecular and transplantation-based studies that require large numbers of cells. The potential of cell-based therapies for myelin disorders relies on the ability to generate autologous myelinogenic cells for transplantation. The most promising cell source for such therapies is OPCs.

Mature oligodendrocytes largely fail to remyelinate host axons after transplantation. Although neural stem cells and induced neural stem cells can generate oligodendrocytes, the efficiency of this process is quite low, and the cells have a propensity to form neurons and astrocytes. In contrast, iOPCs appear restricted to the oligodendrocyte lineage. We have shown that iOPCs integrate into the CNS and myelinate axons of congenitally dysmyelinated mice in vivo after transplantation. However, for iOPCs to have clinical relevance, future studies must extend this reprogramming strategy to human somatic cells and demonstrate extensive CNS myelination and long-term functional benefit to transplant recipients.

Chapter 3: Rapid screening platform for elucidating the role of candidate genes in the oligodendrocyte lineage

I would like to acknowledge Hannah Olsen, Jared M Cregg, Jason D Heaney, and

Paul J Tesar for their efforts in this project.

3.1 Introduction

Myelin facilitates saltatory propagation of action potentials in circuits of the vertebrate nervous system, enabling neural programs to be executed with temporal precision. The functional significance of myelin is underscored by the prevalence of several congenital and acquired neurological disorders of myelin, which affect millions of people worldwide. In the central nervous system, myelin is generated by oligodendrocytes, which arise from a population of oligodendrocyte progenitor cells (OPCs) shortly after birth. An abundant pool of OPCs is also maintained into adulthood, where these progenitors allow for CNS homeostasis by replacing damaged oligodendrocytes in conditions of health (Yueng et al. 2014) and disease (Hughes et al. 2013; Kang et al. 2010). Importantly, whereas mature oligodendrocytes are amitotic, symmetric division of OPCs allows their self- renewal and proliferation.

Based on their proliferative properties, OPCs may be harnessed for myelin repair in cases of congenital leukodystrophies and acquired disorders of myelin

(Goldman et al. 2012; Windrem et al. 2008). In addition to their potential use for

96 cell-based therapies, pure populations of OPCs may allow for high-throughput identification of small molecule compounds as they relate to drug based therapies for remyelination or for genome-wide interrogation of molecular programs that regulate acquisition of terminal oligodendrocyte identity. To these ends, methods for obtaining large populations of oligodendrocyte progenitors are critical.

Previous methods for generating OPCs from pluripotent cells have allowed experimental access to oligodendrocyte lineage cells, but these methods are limited by low-efficiency and typical generation of heterogeneous mixtures of poorly characterized, tripotent neural progenitors. Current methods utilize various approaches (e.g. immunopanning, cell-sorting, antibiotic resistance) for improving the purity of these populations of cells, but these techniques are laborious and usually generate only small populations of pure OPCs (Billon et al. 2002; Brustle et al. 1999; Nistor et al. 2005). We have previously developed methods for robust generation of pure populations of OPCs from epiblast stem cells (EpiSCs), methods that allows expansion of OPCs in culture and further differentiation into myelinogenic oligodendrocytes (Najm et al. 2011). Although EpiSCs are an ideal system for investigating the molecular regulation of cell-fate transitions during early mammalian development, the isolation and maintenance of EpiSCs is challenging.

To circumvent these issues, we have aimed in this study to establish methodologies for generating OPCs from mouse pluripotent stem cells. We demonstrate rapid derivation of pure populations of OPCs by systematic treatment of mouse ESCs or iPSCs with small molecules and growth factors that mimic endogenous morphogen gradients specifying oligodendrocyte progenitor fate

97 during embryonic development. Pluripotent stem cell-derived OPCs can be expanded in culture and exhibit the capacity to differentiate into myelinogenic oligodendrocytes. To highlight the power of this method, we demonstrate autologous derivation of OPCs from shiverer mice, a model of human leukodystrophies, which recapitulate shiverer pathologies in vitro. Additionally, we demonstrate CRISPR/Cas9 directed knockout of several genes critical for oligodendrocyte identity in ESCs and concordant oligodendrocyte pathologies in vitro. Thus, through these methodologies we establish a platform for rapid generation and phenotypic characterization of oligodendrocyte lineage cells.

Because these methodologies are readily implemented and exhibit compatibility with gene-editing tools and a variety of publically available reporter mouse ESC lines, we expect our platform will allow rapid progress in understanding oligodendrocyte lineage specification and pathologies associated with human disorders of myelin.

3.2 Methods

Isolation of shiverer fibroblasts. Mouse embryonic fibroblasts (MEFs) were isolated at embryonic day 13.5 (E13.5) from embryos generated through timed natural matings between shiverer homozygous mice (C3Fe.SWV-Mbpshi/J;

Jackson Laboratory). The head, spinal cord, and all internal organs were carefully removed to eliminate contamination with any neural precursors. The remainder of the tissue was cut into small pieces and dissociated using 0.125% trypsin-EDTA

(Invitrogen). Cells were expanded for one passage and cryopreserved for future use. MEFs were derived in 10% MEF medium, which consisted of DMEM supplemented with 10% fetal bovine serum (FBS; Invitrogen), 2 mM glutamax

(Invitrogen), 1x nonessential amino acids (Invitrogen), and 0.1 mM 2- mercaptoethanol (Sigma).

Production of lentivirus. Lentivirus was generated for pLVX-Tet-On-Puro

Advanced and pHAGE2-TetOminiCMV-StEMCCA-W-loxp or pHAGE2- hSTEMCCA-loxP (kindly gifted from Gustavo Mostoslavsky) according to the manufacturer’s protocol using the Lenti-X HT Packaging Mix and Lenti-Phos or

Cal-Phos Mammalian Transfection Kit (all from Clontech). 5.0x104 cells/cm2 293T cells (Clontech) were cultured on rat tail collagen I coated plastic-ware (BD

Biosciences) and transfected 16 hours later in 5% MEF medium, which consisted of DMEM (Invitrogen), 5% fetal bovine serum (FBS; Invitrogen), 2 mM glutamax

(Invitrogen), 1x nonessential amino acids (Invitrogen), 0.1 mM 2-mercaptoethanol

(Sigma). Individual supernatants containing virus were harvested and filtered with a 0.45 µm PVDF membrane (Millipore) 24 and 48 hours later.

Generation of shiverer iPSCs. Shiverer MEFs were seeded at 1.3x104 cells/cm2 on Nunclon-Δ plates, allowed to attach overnight, and infected with 50/50 (vol/vol) of pLVX-Tet-On-Puro Advanced and pHAGE2-TetOminiCMV-StEMCCA-W-loxp lentivirus supplemented with polybrene (8 µg/ml) or 50/50 (vol/vol) of pHAGE2- hSTEMCCA-loxP and culture medium supplemented with polybrene (8 µg/ml)

(Sommer et al. 2009). Cells were incubated in lentivirus for 3 hours followed by replacing the medium with 10% MEF medium, supplemented with 2 µg/ml doxycycline (Clontech). Cells were cultured in 10% MEF medium supplemented with doxycycline for 3 days. 3 days post lentivirus infection cells were lifted with

0.25% Trypsin-EDTA (Invitrogen) and either frozen or seeded at 3-6x104 cells/cm2 on Nunclon-Δ plates pre-plated with 4.5 x105 cells/cm2 irradiated mouse embryonic fibroblast (iMEF) feeder layer and cultured in mouse ES cell medium, which consisted of Knockout DMEM (Invitrogen) supplemented with 5% fetal bovine serum (FBS; Invitrogen), 15% knockout replacement serum (KSR; Invitrogen), 2 mM glutamax (Invitrogen), 1x nonessential amino acids (Invitrogen), 0.1 mM 2- mercaptoethanol (Sigma), and supplemented with 103 units/ml leukemia inhibitory factor (LIF; Millipore), supplemented with 2µg/ml doxycycline (Clontech). Media was changed every other day until colonies started to emerge. Colonies were picked and dissociated in 0.25% Trypsin-EDTA (Invitrogen) and plated in individual

Nunclon-Δ wells pre-plated with 1.3x105 cells/cm2 irradiated mouse embryonic fibroblast (iMEF) feeder layer and cultured in mouse ES cell medium supplemented with 103 units/ml leukemia inhibitory factor (LIF; Millipore). The day of picking, the colonies are considered ‘passage 0’ (p0). Media was changed every day. Colonies were cultured, expanded, and frozen as passage 2.

BAC modification. Bacterial artificial chromosome RP24-285N19 (Chori) was modified to contain neomycin/kanamycin resistance. Briefly, 500 ng of BAC DNA,

50 ng of plasmid PL452 (NCI at Frederick), and Cre Recombinase and buffer

100

(NEB) were incubated at 37°C for 2 hours followed by 70°C for 5 minutes, and ice for 60 minutes. Reaction was electroporated with a BioRad MicroPulser (BioRad) into DH10B competent cells (Invitrogen) according to manufacturer’s protocol and selected on kanamycin LB/agar plates.

sgRNA design. Two sgRNAs were designed for each of the following genes:

PLP (CAGGCACAGGAGTTCAACTT – PLP sgRNA-Cas9-1,

GCTTCACTGCCAACGAATCC – PLP sgRNA-Cas9-2);

MBP (CCAGGCATGGGCTTCCTCCCA – MBP sgRNA-Cas9-1,

GGCGCTTCTTTAGCGGTGAC – MBP sgRNA-Cas9-2);

MYRF (GCGCTGCAGCGCTTCTTCGA – MYRF sgRNA-Cas9-1,

TTCGAAGGTGAGAGACCGCG – MYRF sgRNA-Cas9-2); and miR-219 (ACAATCAGGAGCCGCGGCCC – miR-219 sgRNA-Cas9-1,

CTCCGGCCGAGAGTTGCGTC – miR-219 sgRNA-Cas9-2) according to Zhang,

2003 (cripr.mit.edu) and synthesized by Sigma to contain the sgRNA under the

U6 promoter and upstream of Cas9-2A-GFP.

Shiverer iPSC electroporations. iPSCs were seeded at 3.1x104 cells/cm2 on an iMEF feeder layer in mouse ES cell medium supplemented with 103 units/ml LIF.

Medium was changed every day for 3 days. On day 3, cells were dissociated with

0.25% trypsin-EDTA and electroporated with 2.5 µg of modified RP24-285N19

BAC using the Amaxa Nucleofector according to the manufacturer’s protocol. Cells were seeded at 2x105 cells/cm2 on drug resistant iMEFs (GlobalStem) coated

101

Nunclon-Δ plates in mouse ES cell medium supplemented with 103 units/ml LIF.

24 hours after electroporation medium was changed and cultures were fed with mouse ES cell media supplemented with 103 units/ml LIF, 200 µg/ml Geneticin

(Invitrogen) for 7 days.

Mouse ESC electroporations. Mouse ES cells were seeded at 3.1x104 cells/cm2 on an iMEF feeder layer in mouse ES cell medium supplemented with 103 units/ml

LIF. Medium was changed every day for 3 days. On day 3, cells were dissociated with 0.25% trypsin-EDTA and electroporated with 7 µg of sgRNA-Cas9-1, 7 µg of sgRNA-Cas9-2, and, 7 µg of EF1α-cre-IRES-puro using the Amaxa Nucleofector according to the manufacturer’s protocol. Cells were seeded at 2x105 cells/cm2 on drug resistant iMEFs (GlobalStem) coated Nunclon-Δ plates in mouse ES cell medium supplemented with 103 units/ml LIF. 24 hours after electroporation medium was changed and cultures were fed with mouse ES cell media supplemented with 103 units/ml LIF, 2 µg/ml puromycin (Invitrogen) for 2 days.

OPC generation from mouse pluripotent stem cells. All cells were cultured at

37 °C and 5% CO2 unless otherwise noted. mESCs and iPSCs were seeded at

3.4x104 cells/cm2 and maintained on an iMEF feeder layer in mouse ES cell medium, supplemented with 103 units/ml LIF 3 days prior to differentiation. On day

0 of the differentiation protocol, iPSCs were passaged free of the iMEF feeder layer with 1.5 mg/ml collagenase type IV (Invitrogen) and 0.25% trypsin-EDTA

(Invitrogen). iMEF free mESCs and iPSCs were seeded at 7.8 x104 cells/cm2 on

102 low attachment plates (Sigma) in mouse pluripotency medium, which consisted of

Knockout DMEM (Invitrogen) supplemented with 20% knockout replacement serum (KSR; Invitrogen), 2 mM glutamax (Invitrogen), 1x nonessential amino acids

(Invitrogen), 0.1 mM 2-mercaptoethanol (Sigma). On day 1, medium was changed and cultures were fed with mouse pluripotency medium supplemented with 0.2 µM

JAK inhibitor (Calbiochem). On day 2, medium was changed and cultures were fed with 50/50 (vol/vol) mouse pluripotency medium and neural medium, which consisted of DMEM/F12 (Invitrogen) supplemented with 1x N2 (R&D Systems), 1x

B-27 without vitamin A (Invitrogen), and 2 mM glutamax (Invitrogen), supplemented with 0.2 µM JAK inhibitor. On day 3, medium was changed and cultures were fed with 50/50 (vol/vol) mouse pluripotency medium and neural medium supplemented with 0.2 µM JAK inhibitor, 100 ng/ml noggin (R&D

Systems), 20 µM BS431542 (Sigma), and 2 µM dorsomorphin (EMD). On day 4 and 5, medium was changed and cultures were fed with 50/50 (vol/vol) mouse pluripotency medium and neural medium supplemented with 100 ng/ml noggin, 20

µM BS431542, and 2 µM dorsomorphin. On day 6, medium was changed and cultures were fed with 50/50 (vol/vol) mouse pluripotency medium and neural medium supplemented with 100 ng/ml noggin. On day 7 and 8, medium was changed and cultures were fed with 25/75 (vol/vol) mouse pluripotency medium and neural medium supplemented with 100 ng/ml noggin, 10 µM all-trans retinoic acid (Sigma), and 200 ng/ml SHH (R&D Systems). On day 9, cells were collected and split 1:2 on Nunclon-Δ wells coated with poly(L-ornithine) (Sigma) followed by laminin (Sigma) and cultured in neural medium supplemented with 100 ng/ml

103 noggin, 200 ng/ml SHH, 20 ng/ml FGF2 (R&D Systems), and 20 ng/ml PDGF-AA

(R&D Systems). At this point the cells are considered ‘passage 0’. On day 10, medium was changed and cultures were fed with neural medium supplemented with 200 ng/ml SHH, 20 ng/ml FGF2, and 20 ng/ml PDGF-AA. Medium was changed every other day with ‘day 10’ medium. Cells were passaged at 80-90% confluence and seeded at 2-2.6 x104 cells/cm2. Cultures of iPSC derived OPCs were maintained and expanded on Nunclon-Δ wells coated with poly(L-ornithine) followed by laminin in neural medium supplemented with 200 ng/ml SHH, 20 ng/ml

PDGF-AA, 100 ng/ml noggin, 100 ng/ml IFG-1 (R&D Systems), 10 µM cyclic AMP

(Sigma), and 10 ng/ml NT3 (R&D Systems). OPCs could be readily frozen and thawed and were cryopreserved in DMEM supplemented with 10% FBS and 10%

DMSO (Sigma).

Counting patterned spheres. Cell culture suspensions were plated onto

Nunclon-Δ wells coated with poly(L-ornithine) and laminin. Plates spheres were cultured in appropriate patterning medium conditions for eight hours followed by fixation with 4% PFA. Cells were stained with antibodies against Oct4, Pax6, and

Olig2. Twenty five individual spheres from each of the mES cell lines (ESF58/2,

ESF75, ESF112, and ESF122) were scored for each gene (Oct4, Pax6, and Olig2) on each patterning day (day 1-9). Colonies were considered positive if more than

50% of the cells in the colony expressed the factor.

104

OPC differentiation to OLs. OPCs were seeded at 2-2.6 x104 cells/cm2 on

Nunclon-Δ wells coated with poly(L-ornithine) followed by laminin in neural medium supplemented with 200 ng/ml SHH, 100 ng/ml noggin, 100 ng/ml IFG-1, 10 µM cyclic AMP, and 10 ng/ml NT3, and 20 ng/ml PDGF-AA for 2 days, changing media every other day. On day 3 media was aspirated and cells were cultured in neural medium supplemented with 200 ng/ml SHH, 100 ng/ml noggin, 100 ng/ml IGF-1,

10 µM cyclic AMP, and 10 ng/ml NT3, and 40 ng/ml T3 for 3 days.

Immunocytochemistry. Cells were prepared for immunostaining by fixation in 4% paraformaldehyde (Electron Microscopy Sciences) for 15 minutes and subsequent permeabilization for 10 minutes with 0.2% Triton-X in PBS. Cells were then blocked for non-specific binding with filtered 10% normal donkey serum (Abcam) in PBS for 1 hour at room temperature. Primary antibodies were diluted in blocking solution and incubated with the samples overnight at 4°C. Samples were rinsed with PBS and incubated with the appropriate fluorescently labeled Alexa-Fluor secondary antibodies (Invitrogen 1:500) for 1 hour at room temperature. For nuclear staining, samples were incubated with 1μg/ml DAPI (Sigma) for 5 minutes.

Primary antibodies used were: Sox10 (R&D Systems, AF2864; 2µg/ml), Olig2

(Millipore, AB9610; 1:1000), Sox1 (R&D Systems, AF3369; 1µg/ml), Pax6

(Covance, PRB-278P; 0.67µg/ml), Oct3/4 (Santa Cruz, SC-5279; 0.4µg/ml),

Nkx2.2 (DSHB, 74.5A5; 4.4μg/ml), MBP (Covance, SMI-99P; 2µg/ml), O4 (kindly gifted from Robert Miller; 1:10), PLP (kindly gifted from Bruce Trapp; 1:1000),

Nanog (Abcam, AB21624; 1µg/ml), and Tuj1 (R&D Systems, MAB1195; 1µg/ml).

105

Flow Cytometry. For NG2 (Millipore, AB5320A4; 10µg/ml) and PDGFRα

(eBiosciences, 17-1401; 2.5 μg/ml) expression analysis, cells were analyzed on a

FACSAria flow cytometer (BD Biosciences) and plots were generated with WinList

3D 7.0 software. Gates were set with negative control cells (unstained) at less than 0.2% positive cells. For live cell immunostaining, cells were collected from culture and blocked in N2B27 medium supplemented with 0.5% BSA and 2mM

EDTA for 10 minutes. Cells were then stained with conjugated primary antibody for 45 minutes. Previously sorted PDGFRa+/NG2+ EpiSC-OPCs were used as a positive control (Najm et al. 2011).

OPC-DRG Cocultures. All cells were cultured at 37 °C and 5% CO2 unless otherwise noted. OPC-DRG coclutures were prepared as described previously

(Chan et al. 2004). Briefly, dorsal root ganglion (DRG) neurons were isolated and dissociated from E15 Sprague Dawley rats and seeded at 7x104 cells per 18-mm collagen coated glass coverslips. DRGs were cultured in medium supplemented with 100 ng/ml of NGF (Serotec, PMP04Z), 2 mM Uridine (Sigma, U3003), and 2 mM FDU (Sigma, F0503) for 3 weeks. DRGs were washed extensively with 1x

PBS before plating 9-10x104 OPCs per coverslip. Cocultures were cultured in neural medium for 10 days before fixation.

Immunohistochemistry of OPC-DRG cocultures. Cells were prepared for immunostaining by fixation in 100% ice-cold methanol for 20 minutes. Cultures were rinsed with PBS and blocked for non-specific binding with filtered 5% normal

106 donkey serum (Abcam) in 0.1% Triton-X at room temperature for 1 hour. Primary neurofilament antibodies were diluted in 2% normal donkey serum in 0.1% saponin and incubated overnight at 4°C. Samples were rinsed with PBS and incubated with appropriate fluorescently labeled Alexa-Fluor secondary antibody (Invitrogen

1:500) for 1 hour at room temperature. Cultures were rinsed with PBS and blocked with 2% normal donkey serum in 0.1% saponin for 1 hour at room temperature.

Primary PLP, MBP and Sox10 antibodies were diluted in 2% normal donkey serum in 0.1% saponin and incubated overnight at 4°C. Samples were rinsed with PBS and incubated with appropriate fluorescently labeled Alexa-Fluor secondary antibody (Invitrogen 1:500) for 1 hour at room temperature. For nuclear staining, samples were incubated with 1μg/ml DAPI (Sigma) for 5 minutes. Primary antibodies used were: Sox10 (R&D Systems, AF2864; 1:100), MBP (Abcam, ab7349; 1:100), and neurofilament cocktail (Covance, SMI-311 and SMI-312;

1:100).

Karyotyping and FISH analysis. Cytogenetic analysis was performed on twenty

G-banded metaphase spreads from each of the four mouse ES cell lines (ESF58/2,

ESF75, ESF112, and ESF122) (Cell Line Genetics; Madison, WI). FISH analysis was performed on metaphase cells at Cell Line Genetics (Madison, WI). A green probe was used as an internal control to detect 11qE2 whereas a custom red probe was prepared from BAC RP24-285N19 to detect the shiverer locus specific to chromosome 18qE3.

107

3.3 Results

Generation of OPCs from mESCs. During mammalian development, acquisition of oligodendrocyte progenitor fate is coordinated by growth factors presented in a spatially and temporally specific manner. Here we hypothesized that we could direct the differentiation of mouse ESCs to oligodendrocyte progenitors by using small molecules and growth factors to mimic growth factor conditions specifying oligodendrocyte fate during development. To this end, we selected four ES cell lines for our studies—ESF58/2, ESF75, ESF112, and ESF122—each of which is derived from a different strain of mouse, and exhibits expression of the pluripotency markers Oct4 and Nanog (Figure 3.1).

Previous work has demonstrated that inhibition of JAK/STAT3 signaling regulates the transition of embryonic stem cells to a later stage of primed pluripotency more closely resembling epiblast stem cells of the post-implantation embryo (Tesar and Chenoweth et al. 2007). To transition mouse ES cells to a state of primed pluripotency, we blocked JAK/STAT3 signaling by treatment of ES cells with a JAK inhibitor (Figure 3.2a). Upon treatment, primed mouse pluripotent stem cells retained expression of Oct4, a canonical marker of pluripotency (Figure 3.2b).

Classical studies using Xenopus and mammalian systems have identified inhibitors of the BMP pathway as critical neural-inducing factors (Sasai et al 1994;

Hemmati-Brivanlou et al 1994; Smith and Harland 1992; Valenzuela et al 1995).

In addition, inhibition or deficiency of activin-nodal receptor signaling, another

TGFβ superfamily signaling pathway, leads to pronounced induction of

108 neuroectoderm (Camus et al. 2006; Smith et al. 2008). To pattern primed pluripotent stem cells to a neuroectodermal lineage, we inhibited TGFβ superfamily signaling pathways with the synergistic use of small-molecule inhibitors. We cultured JAK inhibitor-primed pluripotent stem cells with SB431542, a small molecule which acts to inhibit the phosphorylation of activin-nodal type I receptors ALK4, ALK5, and ALK7, dorsomorphin, an inhibitor of BMP type I receptors ALK2, ALK3, and ALK6, and noggin, a BMP antagonist (Figure 3.2a). In response to treatment with SB431542, dorsomorphin, and noggin, primed pluripotent stem cells drastically downregulated the expression of Oct4, and upregulated genes associated with neuroectoderm induction, including Pax6 and

Sox1 (Figure 3.2b and Figure 3.3). By day 5 of patterning, 2 ±0.29% of scored colonies expressed Oct4, whereas 88 ±0.91% of colonies expressed Pax6. Thus, inhibition of TGFβ superfamily signaling robustly patterns pluripotent stem cells to the neuroectoderm lineage.

During embryonic development, OPCs initially emerge from the pMN domain within the ventral ventricular zone of the developing spinal cord, relying on local dorsoventral gradients of SHH, BMP, RA, and other growth factors to pattern their development (Lara-Ramirez et al. 2013; Noll and Miller 1993; Orentas and

Miller 1996; Trousse et al. 1995). In order to regionally pattern Pax6/Sox1 positive cells towards an OPC fate, we cultured these spheres in defined media containing specific concentrations of sonic hedgehog (SHH), noggin, and retinoic acid (RA)

(Figure 3.2a). Upon treatment, we observed downregulation of Pax6 expression, associated with transition to a more mature developmental state. We further

109 observed the emergence of a population of Olig2+ progenitors on day 8, where expression of Olig2 is associated with identity of pMN domain progenitors (Figure

3.2b).

After specification, OPCs proliferate and migrate throughout the embryonic spinal cord in response to platelet-derived growth factor (PDGF) and fibroblast growth factor (FGF) signaling (Bogler et al 1990; Noble et al. 1988). To facilitate the expansion of Olig2+ cells, we seeded patterned spheres on a laminin substrate in the presence of SHH, FGF, and PDGF (we denoted this initial plating as

‘passage 0’ or ‘p0’) (Figure 3.2a). After 1 day of culturing in the presence of SHH,

FGF, and PDGF, 20 ±2.61% of colonies expressed Olig2 (Figure 3.2b). We allowed cells to migrate from the plated spheres with media changes every other day. In p0, we observed Tuj1+ neurons emerging from the plated spheres along with migratory Olig2/Nkx2.2 and Sox10 positive oligodendrocyte progenitor cells

(Figure 3.4). These results parallel the in vivo specification of pMN domain progenitors in the developing spinal cord, where both motor neurons and OPCs emerge from the pMN domain in subsequent waves of development (Richardson et al. 1997).

We further expanded populations of OPCs by dissociation, passaging, and culturing OPCs on a laminin substrate in OPC promoting conditions. Through subsequent passaging, Olig2/Nkx2.2/Sox10 positive cells took on a bipolar morphology typical of bona fide OPCs (Figure 3.2c). In addition, 49 ±4.32% of passage 1 mESC derived OPCs robustly co-express the OPC-specific transcription factors Nkx2.2, Olig2, and Sox10 (Figure 3.2d,e) and also express

110 the OPC-specific cell-surface markers PDGFRa (CD140a) and NG2 (Cspg4) by flow cytometric analysis (Figure 3.5). We determined that further passaging results in a more pure population of OPCs, where 80 ±2.92% of passage 3 mESC derived

OPCs co-express Nkx2.2, Sox10, and Olig2 (Figure 3.2f), and 98 ±0.46% of p3

OPCs express NG2 (Figure 3.5). These results demonstrate that OPCs can be robustly generated from mouse ES cells by using defined media conditions that recapitulate early embryonic developmental transitions in vitro.

Differentiation of mESC derived OPCs to myelin producing oligodendrocytes. Before the onset of myelination, local environmental signals trigger OPCs to exit the cell cycle and initiate an oligodendrocyte-specific transcriptional program regulating terminal oligodendrocyte identity. To determine the capacity of our mESC derived OPCs to generate oligodendrocytes, we cultured

OPCs in the absence of PDGF and FGF, and in the presence of thyroid hormone

(T3), which plays an essential role in promoting the differentiation of oligodendrocytes both in vitro and in vivo (Barres et al 1994; Noble et al 1988).

After 3 days of treatment with T3, OPCs derived from passage 1 or passage 3 took on a highly ramified morphology characteristic of mature oligodendrocytes, and furthermore, exhibited expression of several oligodendrocyte identity features, including the cell-surface antigen O4, myelin basic protein (MBP), and proteolipid protein (PLP) (Figure 3.6a,b,c).

To assess the myelinogenic potential of mESC derived OPCs, we cultured these cells with dissociated rat embryonic dorsal root ganglion neurons (DRGs)

111

(Kleitman et al. 1991). After coculturing OPCs and DRGs for 10 days in the absence of T3, OPCs gave rise to MBP positive oligodendrocytes that generated segmented tracts of MBP in close apposition with neurofilament (NF) positive DRG axons, suggestive of mature oligodendrocyte myelin (Figure 3.6d). Taken together, these findings demonstrate that mESC derived OPCs give rise to functional oligodendrocytes in vitro by integrating extrinsic environmental signals.

Recapitulation of myelin deficient phenotype in vitro. We sought to determine whether our protocol for direct differentiation of mESCs to OPCs could also be applied to iPSCs, enabling the in vitro modeling of mutant mouse pathologies.

Toward this end, we first generated four independent iPSC lines from fibroblasts derived from the shiverer mouse, a mouse model of human hypomyelination harboring a large genomic deletion in MBP. We used lentiviral transduction to introduce an inducible polycistronic cassette containing the four Yamanaka reprogramming factors Sox2, Klf4, cMyc, and Oct4 into shiverer fibroblasts

(Takahashi and Yamanaka 2006; Sommer et al. 2009). Upon infection and doxycycline mediated induction, individual colonies were expanded and maintained as individual shiverer iPSC lines A, B, C, and D. Shiverer iPSC colonies exhibited similar morphological appearance to wild type mESCs, and expressed the markers of pluripotency Oct4 and Nanog (Figure 3.1a,b and Figure 3.7a,b).

To determine the potential of shiverer derived iPSCs to differentiate into

OPCs, we subjected shiverer iPSC lines A-D to our OPC differentiation protocol established for mESCs (Figure 3.2a). We determined that shiverer iPSCs could

112 efficiently differentiate into OPCs, exhibiting a bipolar morphology and expression of the OPC-specific genes Sox10, Olig2, and Nkx2.2 (Figure 3.8a,b). We found that by passage 3, 78 ±4.43% of OPCs derived from shiverer iPSC lines A-D co- expressed Sox10, Olig2, and Nkx2.2 (Figure 3.8c). By flow cytometric analysis, shiverer iPSC derived OPCs expressed the OPC-specific cell-surface markers

PDGFRa and NG2 (Figure 3.9). Shiverer iPSC derived OPCs could also be passage-purified, with 95 ±1.04% of the shiverer OPCs expressing NG2 by passage 3 (Figure 3.9).

To assess their differentiation potential, we cultured shiverer iPSC derived

OPCs in the presence of T3 and in the absence of PDGF and FGF. In response to

T3, shiverer OPCs differentiated into multiprocessed oligodendrocytes expressing the early oligodendrocyte marker O4 and the mature oligodendrocyte marker PLP, but failed to express MBP (Figure 3.8d). The absence of MBP expression is consistent with the shiverer MBP genotype and associated oligodendrocyte pathologies observed in vivo (Chernoff 1981). These results demonstrate that

OPCs and oligodendrocytes can be efficiently generated from iPSCs, and furthermore, that mutant pathologies can be modeled in vitro using these methods for directed differentiation of OPCs.

Gene correction of shiverer genotype. To assess the feasibility of coupling our direct reprogramming method with gene correction we conducted preliminary studies demonstrating the feasibility of introducing a full length copy of wild type

MBP into the genome of shiverer iPSCs. We modified mouse BAC clone RP24-

113

285N19, which contains the full length wild type MBP gene, to contain a neomycin selectable marker. Upon electroporation and neomycin selection, six individual neomycin resistant shiverer iPSC colonies were isolated and expanded individually. We analyzed one of the neomycin resistant lines for BAC integration by fluorescent in situ hybridization (FISH). A custom FISH probe was generated from BAC clone RP24-285N19, and upon hybridization with metaphase spreads, three signals were detected. As expected, two signals were localized to the native shiverer MBP locus at 18qE3, and in addition, a smaller third signal localized to

17qE5 (Figure 3.10). We will use our rapid phenotyping platform to determine whether MBP transgenic shiverer iPSC lines can generate functional OPCs and rescue shiverer oligodendrocyte pathologies in vitro, with an ultimate goal of carrying out preclinical studies aimed at assessing the ability of gene-corrected

OPCs to reverse mutant pathologies in vivo.

Rapid phenotyping of oligodendrocyte lineage genes. Our differentiation protocol has the ability to rapidly phenotype candidate genes implicated to be imortatnt in the oligodendrocyte lineage. As proof-of-principle we employed the

CRISPR-Cas9 RNA based gene editing system in wild type mESCs to knock out genes important for various aspects of mature oligodendrocyte function, including

PLP, MBP, microRNA 219 (miR-219), and myelin regulatory factor (MRF). We designed two individual guide RNAs (gRNAs) to target each of these genes near exon 1 (Figure 3.11). Each pair of gRNAs was electroporated into wild type mESCs

(ESF75), along with plasmids allowing expression of Cas9 and resistance to

114 puromycin. For each gene, twenty puromycin resistant colonies were isolated and expanded individually. Five colonies from each targeted gene were selected for further analysis, and were found to contain appropriately targeted genetic perturbations by PCR of genomic DNA followed by Sanger sequencing (Figure

3.11). We next used our direct differentiation methods to generate OPCs from

ΔmiR-219, ΔMRF, ΔPLP, and ΔMBP mESCs (Figure 3.2a), and determined whether genetic deletion of these genes lead to associated oligodendrocyte pathologies by culturing these lines in T3 differentiation medium.

miR-219 is an important factor regulating the differentiation of OPCs into mature oligodendrocytes (Figure 3.12a). Dugas et al previously demonstrated that miR-219 is both necessary and sufficient for promoting oligodendrocyte differentiation, where miR-219 acts directly to repress the expression of factors promoting OPC proliferation (Dugas et al. 2010). Here, upon culturing in the presence of T3, ΔmiR-219 OPCs differentiated into multiprocessed oligodendrocytes that expressed O4, but lacked expression of MBP (Figure 3.12b).

Interestingly, Dugas et al suggest that expression of miR-219 is specifically induced by mitogen withdrawal and that T3 differentiation does not require miR-

219 expression (Dugas et al. 2010). Our results are consistent with those from

Dugas et al in that ΔmiR-219 OPCs were able to differentiate into oligodendrocytes in the presence of T3. Furthermore, we demonstrate that although ΔmiR-219

OPCs exhibit differentiation into oligodendrocytes, ΔmiR-219 oligodendrocytes lacked expression of MBP, a feature of terminal oligodendrocyte identity (Figure

115

3.12b). These data suggest that expression of miR-219 may act to regulate specific aspects of the developmental program specifying terminal oligodendrocyte fate.

The transcription factor MRF plays an essential role in promoting the maturation of pre-myelinating oligodendrocytes to mature myelinating oligodendrocytes (Emery et al. 2009). We hypothesized that, upon T3 induced differentiation, ΔMRF OPCs would exhibit marked deficits in the acquisition of mature oligodendrocyte identity features. Indeed, upon T3 differentiation of ΔMRF

OPCs, we observed the formation of O4 positive multiprocessed oligodendrocytes, however, ΔMRF oligodendrocytes failed to express MBP (Figure 3.12b).

Oligodendrocyte maturation in the CNS is tightly coupled with the expression of PLP and MBP, proteins that are essential for the formation of compact myelin (Figure 3.12a). When we cultured our ΔMBP and ΔPLP OPCs in oligodendrocyte promoting conditions we observed the formation of multiprocessed oligodendrocytes. ΔMBP oligodendrocytes exhibited expression of

PLP, but did not express MBP (Figure 3.12b). Furthermore, ΔPLP oligodendrocytes stained positive for MBP, but did not exhibit expression of PLP

(Figure 3.12b).

116

Figure 3.1 - Mouse embryonic stem cells express canonical markers of pluripotency. (a) Phase-contrast and (b) fluorescent images of mouse embryonic stem cells (mESCs) from four individual lines (ESF58/2, ESF75, ESF112, and ESF 122) which express Oct4 and Nanog (scale bar, 50 μm). (c) Cytogenetic analysis was performed on twenty G-banded metaphase cells from each of the four individual mESC male lines (ESF58/2, ESF75, ESF112, and ESF 122). mESC line ESF58/2 was derived from a 129 strain and 12 of the analyzed metaphase cells were karyotypically normal. mESC line ESF75 was derived from a C57BL/6 strain and 16 of the analyzed metaphase cells were karyotypically normal. mESC line ESF112 was derived from an in-house strain and 19 of the analyzed metaphase cells were karyotypically normal. mESC line ESF122 was derived from a CBA/J strain and was determined to be karyotypically abnormal with the most common abnormality observed being an abnormal chromosome 1 with an addition of an unidentifiable material translocation to the distal long-arm.

117

Figure 3.2 - Generation of a robust population of OPCs from patterned mESCs. (a) Schematic diagram depicting the patterning of mESC to the OPC lineage through the use of small molecules and growth factors. (b) During the patterning process 100% of the starting spheres were positive for the pluripotency marker Oct4. Upon patterning towards the neuroectoderm by blocking both BMP and activin-nodal signaling through the treatment of noggin, dorsomorphin, and SB431542 colonies were observed to down regulate the expression of Oct4 and up regulate the expression of Pax6, a marker of neuroectoderm. Upon culturing in the presence of retinoic acid and SHH the spheres began to down regulate the expression of Pax6. After patterning the Pax6+ colonies with FGF and PDGF growth factors the spheres began to upregulate Olig2, an early marker of the OPC lineage. (c) Phase-contrast and (d) Fluorescent images of mESC derived OPCs. Upon passaging the patterned cells onto a laminin substrate a majority of the cells exhibited a bipolar morphology and expressed canonical markers of OPCs including Sox10, Olig2, and Nkx2.2 (scale bar, 50 μm). (e-f) Patterned cells can be cultured for multiple passages while still retaining expression of OPC markers Olig2, Nkx2.2, and Sox10. A purer population of OPCs can be obtained by culturing cells in self selecting defined media conditions (n=4, mean ± s.e.m.).

118

Figure 3.3 - mESC patterned cells express markers of the neuroectoderm. Fluorescent image of patterned sphere when cultured in the presence of BMP and activin-nodal signaling blockers, resulting in the expression of Pax6 and Sox1, markers of the neuroectoderm (scale bar, 50 μm).

119

Figure 3.4 - mESC patterned cells give rise to neurons. Fluorescent images of patterned sphere cultures seeded and grown on a laminin substrate in the presence of neural medium supplemented with FGF2, PDGF-AA, and SHH. Tuj1+ neurons were observed to emerge from the plated spheres along with Olig2+, Sox10+, and Nkx2.2+ cells (scale bar, 50 μm).

120

Figure 3.5 - mESC derived OPCs robustly express cell surface markers NG2 and PDGFRa. Flow cytometry analysis indicates that both early (passage 1) and later (passage 3) passaged mESC derived OPCs express OPC cell surface markers NG2 and PDGFRa when compared to both negative and positive controls (n=4, mean ± s.e.m.).

121

Figure 3.6 - mESC derived OPCs differentiate into myelin protein expressing oligodendrocytes. (a-c) Fluorescent images of mESC derived OPCs cultured in differentiation- inducing conditions for 3 days. OPC differentiated oligodendrocytes exhibit a multiprocessed morphology and express early oligodendrocyte marker O4 (a) and mature oligodendrocyte markers MBP and PLP1 (b,c). Early (passage 1) and later (passage 3) passaged OPCs are able to give rise to mature oligodendrocytes (b,c). (d) Fluorescent images of mESC derived OPCs seeded on in vitro cultured rat embryonic dorsal root ganglion neurons (DRGs) (scale bars, 50 μm).

122

Figure 3.7 - Shiverer induced pluripotent stem cells express canonical markers of pluripotency. (a) Phase-contrast and (b) fluorescent images of shiverer induced pluripotent stem cells (iPSCs) from four individual lines (A, B, C, and D) which express Oct4 and Nanog (scale bar, 50 μm).

123

Figure 3.8 - Shiverer iPSC derived OPCs generate MBP negative oligodendrocytes. (a) Phase-contrast and (b) fluorescent images of shiverer iPSC derived OPCs seeded on a laminin substrate (scale bars, 50 μm). Shiverer OPCs exhibit a bipolar morphology (a) and express canonical markers of OPCs including Sox10, Olig2, and Nkx2.2 (b). (c) Shiverer iPSC derived OPCs can be quantified based on their expression of Sox10, Olig2, and Nkx2.2 (n=4, mean ± s.e.m.). (d) Phase-contrast and fluorescent images of shiverer iPSC derived OPCs in differentiation-inducing culture conditions for 3 days (scale bar, 50 μm). Shiverer oligodendrocytes exhibit a multiprocessed morphology and express early (O4) and late (PLP1) markers of oligodendrocytes. Shiverer oligodendrocytes do not express late oligodendrocyte marker MBP which is consistent with their MBP gene deletion (scale bar, 50 μm).

124

Figure 3.9 – Shiverer iPSC derived OPCs robustly express cell surface markers NG2 and PDGFRa. Flow cytometry analysis indicates that both early (passage 1) and later (passage 3) passaged iPSC derived OPCs express OPC cell surface markers NG2 and PDGFRa when compared to both negative and positive controls (n=4, mean ± s.e.m.).

125

Figure 3.10 – Gene correction of shiverer MBP deletion. Fluorescent in situ hybridization (FISH) analysis of shiverer iPSCs electroporated with modified BAC clone RP24-285N19 which contains the full length wild type myelin basic protein (MBP) gene and neomycin selectable marker. Probe 259 was generated from BAC clone RP24-285N19 to detect BAC incorporation. Hybridization of probe 259 to metaphase chromosomes demonstrated three signals, two of which localize to their native locus at 18qE3 and a smaller third signal localizing to 17qE5.

126

Figure 3.11 – CRISPR-Cas9 mediated gene perturbation. Schematic of the Cas9-gRNA perturbed genes. Depicted in green are two individual gRNAs that were designed to target each gene (miR-219, MRF, PLP1, and MBP). For MRF, PLP1, and MBP translation start sites are represented in yellow. Sanger sequencing was used to confirm gene perturbations.

127

Figure 3.12 – Perturbations of known oligodendrocyte lineage genes cause oligodendrocytes to display deficits in myelin protein expression. (a) Schematic of oligodendrocyte differentiation. miR-219 is important for promoting oligodendrocyte differentiation whereas MRF is important for the maturation of pre-myelinating oligodendrocytes to MBP and PLP1 expressing mature oligodendrocytes. (b) Fluorescent images of gene perturbed lines ΔmiR-219, ΔPLP1, ΔMRF, and ΔMBP OPCs in differentiation-inducing culture conditions for 3 days (scale bar, 50 μm).

128

3.4 Discussion

Here we report the robust generation of OPCs by systematic treatment of mouse pluripotent stem cells with small molecules and growth factors that mimic morphogen profiles regulating the induction of OPC fate during development.

Using wild type mESC lines derived from four different mouse strains, we demonstrate that a highly pure and proliferative population of OPCs can be routinely generated from mESCs in less than 10 days. Upon culture in oligodendrocyte promoting conditions, mESC derived OPCs give rise to multiprocessed oligodendrocytes expressing O4, PLP, and MBP. In addition, when cultured with unmyelinated DRGs, OPCs differentiate into highly ramified oligodendrocytes that generate segmented tracts of MBP in close apposition with axons, suggestive of mature oligodendrocyte myelin. We further demonstrate that our protocol can be used to generate OPCs from iPSCs; we derived iPSCs from shiverer mouse fibroblasts, and demonstrate the direct differentiation of shiverer iPSCs to OPCs exhibiting a bipolar morphology and expression of Sox10, Nkx2.2, and Olig2. Upon differentiation of shiverer OPCs in T3, OPCs took on features of terminal oligodendrocyte identity but completely lacked expression of MBP. Thus, through these methods we establish a platform for rapid generation and phenotypic characterization of oligodendrocyte lineage cells that may be useful for in vitro modeling of mutant pathologies.

Using our methodologies for generating large populations of OPCs from autologously derived mutant fibroblasts, we may begin to address the preclinical

129 feasibility of using patient-specific populations of OPCs for treatment of myelin related disorders. In cases of congenital leukodystrophies, genetic mutations in oligodendrocyte lineage-specific genes preclude the generation of functional

OPCs by autologous means. Future studies will focus on generating populations of autologously derived, gene-corrected OPCs for preclinical studies and ultimate use in human therapy.

In addition, a variety of genomic perturbations can be readily performed in mouse pluripotent stem cells. As such, gene-editing techniques applied in pluripotent stem cells may be used in combination with our platform for rapid generation and phenotypic characterization of oligodendrocyte lineage cells. This system may allow rapid first-tier modeling of genetic determinants of dysmyelinating diseases and characterization of oligodendrocyte-specific genes with unknown function. From our preliminary data, we have demonstrated that the

CRISPR/Cas9 RNA based gene editing system can be used with our platform to rapidly generate and carry out phenotypic analyses of mutant oligodendrocyte lineage cells in vitro. Future studies will aim to determine the repertoire of phenotypes our platform is capable of uncovering, including deficits in differentiation, expression of oligodendrocyte-specific genes, and myelination of dorsal root ganglion axons. In addition, these results lend strong support to the idea that this platform can be adopted for use in understanding oligodendrocyte pathologies associated with human leukodystrophies and for uncovering the function of poorly understood oligodendrocyte lineage-specific genes.

130

Chapter 4: Discussion of future directions

4.1 Summary

Oligodendrocytes are essential for accurate information transfer in central nervous system circuits. The primary function of oligodendrocytes is to ensheath axons with myelin, a multilayer protein-lipid membrane that allows saltatory conduction of action potentials down the length of the axon. These segments of myelin serve to increase action potential velocity by as much as 100-fold. Given this role, it is not surprising that various neurological deficits (e.g. motor dis- coordination, seizures) arise in patients that exhibit dysmyelination. Indeed, dysmyelination is the hallmark characteristic underlying a broad spectrum of neurological disorders, categorized clinically as leukodystrophies.

Leukodystrophies are associated with mutations in over 40 different genes that function in aspects of oligodendrocyte development and myelin biogenesis. As there are currently no clinical treatments available for those suffering from leukodystrophies, many of these patients die before the second decade of life.

Mouse genetic models are available for a subset of leukodystrophies and have served as an invaluable resource for understanding the etiology, pathology, and progression of dysmyelinating diseases as a whole. Additionally, these animal models have allowed experimental therapies (e.g. cell transplantation, viral- mediated gene transfer) to be tested for their potential to modify disease progression. Transplantation of oligodendrocyte progenitor cells has demonstrated

131 particularly promising potential for mitigating the pathology of leukodystrophies in pre-clinical studies, but sourcing the appropriate cells for transplantation has remained a significant barrier to their translation clinically: Donor derived cells must match a panel of immunological compatibility criterion in order to avoid host rejection, and derivation of large populations of oligodendrocyte progenitor cells has been technically infeasible. Therefore, generating an autologous population of oligodendrocyte precursor cells would represent a major advance in potential treatment options for those afflicted with dysmyelinating diseases.

Using the mouse as a model system, we have demonstrated the feasibility of deriving large populations of oligodendrocyte progenitor cells from autologous sources. We identified eight transcription factors specific to the oligodendrocyte lineage by gene expression profiling. By inducing the expression of these transcription factors in fibroblasts and culturing under oligodendrocyte progenitor cell promoting conditions, we were able to generate induced oligodendrocyte progenitor cells (iOPCs) that resemble bona fide oligodendrocyte progenitor cells on the basis of morphology, gene expression profiles, and the ability to differentiate into myelinating oligodendrocytes. Furthermore, when injected into the central nervous system of hypomyelinated mice, these iOPCs differentiate into mature oligodendrocytes that produce layers of compact myelin. Thus we have demonstrated for the first time that functional populations of myelinogenic oligodendrocyte progenitor cells can be generated from starting populations of somatic cells.

132

In patients afflicted with leukodystrophies, correction of the genetic abnormalities underlying disease is requisite to the use of autologous somatic cells as a source from which to obtain functional oligodendrocyte progenitor cells. As fibroblasts do not exhibit clonal colony growth, currently available strategies for gene correction would be difficult to employ in these somatic cells. Therefore we have developed a second method for deriving oligodendrocyte progenitor cells from populations of wild-type or mutant mouse embryonic and induced pluripotent stem cells, cells which exhibit clonal expansion in culture. By systematically treating embryonic or induced pluripotent stem cells with small molecules and growth factors that mimic growth factor conditions during development, we have developed a tractable method for obtaining a pure population of oligodendrocyte progenitor cells capable of differentiating into myelinating oligodendrocytes. This method of directed differentiation significantly improves the versatility of cells sourced by autologous means, and may allow for correction of genetic abnormalities that underlie disease.

Oligodendrocytes are a highly specialized population of cells which exhibit ramified processes that myelinate a number of neighboring axons. As such, technical limitations preclude the isolation of pure populations of oligodendrocytes from central nervous system tissues. Our protocols for obtaining oligodendrocyte progenitor cells in culture may therefore allow new understanding of the oligodendrocyte lineage by allowing experimental access to this previously inaccessible cell type. By leveraging the ease in which genetic manipulations can be performed in mouse pluripotent stem cells, we may be able to identify novel

133 genes essential for oligodendrocyte development and maturation through forward- and reverse-genetic screens. Additionally, we may be able to study cis-regulatory control of oligodendrocyte terminal identity features. Furthermore, we may also use these methods as an alternative to generating genetically engineered mice; we may quickly model genetic variants that underlie disease in cultured oligodendrocytes and understand how these genetic variants give rise to oligodendrocyte dysfunction. Therefore the future promise of these methods lies not only in their potential to allow treatment options for those afflicted with dysmyelinating diseases, but also in their potential for addressing outstanding fundamental questions concerning oligodendrocyte biology.

4.2 Generation of autologous gene-corrected cell based therapies for human genetic disorders of myelin

Cell reprogramming technologies have the potential to offer autologous treatment modalities for cell type-specific disorders. In disorders with genetic etiology, however, populations of autologous somatic cells harbor deleterious genetic abnormalities that preclude their use in therapy. In leukodystrophies, a wide variety of mutations—ranging from single nucleotide variants to kilobase deletions—cause various degrees of myelin or oligodendrocyte loss in the central nervous system. Gene editing platforms coupled with cell reprogramming technologies may allow us to address this problem: autologous somatic cells can be obtained from patients with leukodystrophies, gene editing platforms may be

134 used to correct genetic abnormalities underlying disease, and cell reprogramming technologies would allow us to obtain gene-corrected oligodendrocyte precursor cells for use in therapy. Leukodystrophies can exhibit dominant loss-of-function mutations that result in insufficient functional protein product or dominant-negative mutations that adversely affect the wild-type allele in the same cell (such as GALC mutations observed in Krabbe disease). Whereas loss-of-function or null mutations may therefore be corrected using transgenic approaches, dominant-negative mutations will require targeted gene correction.

The most reliable current approach for achieving seamless gene correction at a target genetic locus is the use of homologous recombination with donor DNA containing the wild-type sequence of interest. Homologous recombination of donor

DNA with the target genetic locus has historically been rather inefficient, occurring at very low frequencies. With the advent of the CRISPR-Cas9 RNA based gene editing system, however, techniques for homologous recombination are expected to become more tractable.

Bacteria and archaea have evolved a protective mechanism against invasion of viruses and plasmids though the use of an RNA-based adaptive immune system composed of CRISPR (clustered regulatory interspaced short palindromic repeat) RNAs and Cas (CRISPR-associated) proteins (Horvath and

Barrangou 2010; Wiedenheft et al. 2012). This adaptive immune system acquires resistance to invading viruses and plasmids by uptake of short fragments of invasive DNA called spacers (Barrangou et al. 2007). CRISPR spacers are transcribed and processed into sets of short CRISPR RNAs that contain a

135 conserved fragment and spacer sequences that are complimentary to the invading nucleic acid (Brouns et al. 2008). These short CRISPR RNAs join with Cas nucleases to form a complex that recognizes (by complementary base pairing) and cleaves foreign nucleic acid sequences (Hale et al. 2009). Furthermore, it has recently been established that CRISPR RNAs complexed with Cas9 nuclease can induce targeted double-strand breaks on synthetic oligodeoxynucleotides or plasmid DNA in vitro on the basis of CRISPR RNA complementarity.

Precise genetic modification can be achieved by harnessing endogenous double-strand break repair mechanisms. Repair of double stranded breaks usually occurs in one of two ways: Non-homologous end joining allows cells to repair double-strand breaks by direct joining of nicked ends, usually resulting in deletions or insertions (indels) at the break site. Homology-directed repair, however, allows cells to accurately repair double-strand breaks using a homologous donor sequence. With this knowledge, Xie and colleagues used homologous plasmid

DNA to correct both a point mutation and a four base pair deletion in human induced pluripotent stem cells using the CRISPR/Cas9 RNA-based gene editing system to induce double-strand breaks at the target site (Xie et al. 2014). To demonstrate the feasibility of using this system to correct large genetic mutations in human cells, Byrne and colleagues used homologous donor DNA derived from the mouse genome to replace a 2.7 kilobase gene in human induced pluripotent stem cells (Byrne et al. 2014). These reports lay exciting ground work toward seamless or site-specific correction of human genetic mutations in autologous pluripotent stem cells.

136

To date, seamless gene correction of genetic mutations associated with leukodystrophies has not yet been demonstrated—likely owing to the fact that protocols for generating myelinogenic oligodendrocytes to test the functionality of corrected genetic abnormalities have not been widely available. By combining our oligodendrocyte generation methods with the CRISPR/Cas9 RNA-based gene editing system, we may now be able to generate populations of autologous gene- corrected oligodendrocyte progenitor cells toward their use in cell transplantation therapies for clinical management of dysmyelinating diseases. While our protocols for generating oligodendrocyte progenitor cells have been developed in the mouse model system, we expect that future development of these methods will allow us to obtain oligodendrocyte progenitor cells from human somatic or pluripotent stem cells. Furthermore, access to mouse oligodendrocyte progenitor cells will allow us to perform a number of proof-of-principle pre-clinical transplantation and gene- correction studies in mouse models of leukodystrophies to assess the potential of these technologies to translate clinically.

4.3 Oligodendrocyte in vitro differentiation method as a first tier platform for mouse model generation

Mouse models of human myelin disease (e.g. jimpy, rumpshaker, twitcher, shiverer, etc.) have elucidated genotype-phenotype relationships and the basis for oligodendrocyte dysfunction in a subset of leukodystrophies, and thus have been instrumental to our current understanding of the pathobiology of dysmyelinating diseases as a whole. As the generation of mouse models can be expensive,

137 tedious, and slow, these models currently account for <1% of genetic variants associated with human leukodystrophies. Therefore very little is known about how specific genetic abnormalities underlie cellular dysfunction, overt disease pathology, and neurological or behavioral outcomes for a vast majority of human leukodystrophies. In point, a majority of leukodystrophies exhibit no clear genotype-phenotype correlation as genetic mutations in a single gene can manifest clinically with a spectrum of neurological symptoms.

This fundamental gap in our knowledge has the potential to be addressed using our protocols in two different ways: First, we may obtain somatic cells from those patients afflicted with leukodystrophies and use adapted protocols for direct- reprogramming of human somatic cells to oligodendrocyte precursor cells. By obtaining patient-specific oligodendrocyte progenitor cells, we may model the contribution of patient-specific genetic abnormalities to oligodendrocyte dysfunction in vitro. Second, using mouse pluripotent stem cells in combination with CRISPR-Cas RNA-based gene editing tools, we may knock-out or introduce specific mutations in genes implicated in dysmyelinating diseases. We can then subsequently use our protocol for directed differentiation of oligodendrocyte progenitors from induced pluripotent stem cells to model the contribution of specific genetic perturbations to oligodendrocyte dysfunction in vitro.

Oligodendrocyte dysfunction may manifest in vitro in a number of ways:

Mutant cell lines may exhibit overt functional deficits in morphology, cell or cell process motility, self-renewal/proliferation, myelin biogenesis, or the ability to differentiate and acquire features of terminal identity. As mutant cells are readily

138 accessible to experimental interrogation, we can investigate the molecular mechanisms underlying phenotypic abnormalities at the cellular level including potential deficits in protein trafficking, accumulation of toxic compounds, or abnormal signaling. Furthermore, access to mutant cells may allow the discovery of small molecules that improve oligodendrocyte function in vitro. Thus, our versatile protocols offer a rapid first-tier platform for modeling the genetic determinants of dysmyelinating diseases at a cellular and molecular level and have the potential to allow discovery of candidate drugs for treatment of leukodystrophies.

Recent access to high-throughput expression profiling platforms has generated rich data sets on oligodendrocyte-specific gene expression. These platforms have identified both well-characterized oligodendrocyte-specific genes with previously ascribed function, as well as novel oligodendrocyte-specific genes of unknown function (Cahoy et al. 2008). With our methods of generating oligodendrocytes in vitro, we can begin to rapidly assess the function of newly identified genes (also lncRNAs/miRNAs) in the development and maturation of oligodendrocytes. In point, Emery et al. used publicly available gene expression data sets to identify myelin-gene regulatory factor (MRF) as a transcription factor required for central nervous system myelination (Emery et al. 2009). By using siRNAs to knock-down the expression of MRF in cultured oligodendrocyte progenitor cells obtained using the laborious technique of immunopanning dissociated mouse brains followed by lengthy culture protocols, Emery and colleagues were able to demonstrate that MRF is required for the expression of

139 several oligodendrocyte-specific terminal identity features (Emery et al. 2009). We may be able to quickly assess the role of candidate genes/lncRNAs/miRNAs in oligodendrocyte development and maturation by using our rapid method for direct differentiation of oligodendrocyte progenitor cells from pluripotent stem cells in combination with CRISPR/Cas9 gene editing methods. These experiments offer a first-tier approach for characterizing oligodendrocyte-specific genes of unknown function, informing subsequent phenotypic analyses in whole animal models.

4.4 Identifying the genetic basis of oligodendrocyte identity by high- throughput in vitro screening

CRISPR/Cas RNA-based genome editing has demonstrated great potential for modifying or editing precise genomic loci in both human and mouse cells. The

CRISPR/Cas system has also recently been used as a tool for high-throughput, genome-wide loss-of-function screens (Koike-Yusa et al. 2014; Shalem et al. 2014;

Wang et al. 2014; Zhou et al. 2014). Until the discovery and utilization of

CRISPR/Cas for mammalian genome editing, arrayed or pooled RNA interference

(RNAi) screens acted as method of choice for genome-wide loss-of-function screening (Agaisse et al. 2005; Karlas et al. 2010; Luo et al. 2009; Moffat et al.

2006;). RNAi-based screens use short hairpin RNA (shRNA)-expressing vectors or synthetic short interfering RNAs (siRNAs) to knock-down individual genes by targeting messenger RNA (mRNA) in a sequence-specific manner. Although RNAi has been a powerful tool for identifying candidate genes important in cellular

140 processes of interest, RNAi has significant shortcomings; sh/siRNAs exhibit insufficient knock-down of gene expression/protein product and have an alarming rate of off-target effects that cause false-negative and false-positive results

(Booker el al. 2011; Jackson et al. 2006).

As an alternative to RNAi, several groups have adapted the CRISPR/Cas system for high-throughput, genome-wide loss-of-function screening (Koike-Yusa et al. 2014; Shalem et al. 2014; Wang et al. 2014; Zhou et al. 2014). Loss-of- function CRISPR/Cas screens utilize single gRNAs complexed with Cas9 to induce double-strand breaks at target loci. The 20 nucleotide variable region at the 5’ end of a gRNA allows complementary base pairing of the gRNA to genomic DNA, and thus regulates the specificity of a gRNA toward its genomic target. Once bound to its target, gRNAs complex with Cas9 nuclease to induce double-strand breaks.

These double strand breaks result in the induction of non-homologous end joining, causing frame-shift/deletion mutations (indels) at the break site, and ultimately generate loss-of-function alleles.

To assess the contribution of candidate genes to a given cellular process in a high-throughput manner, pooled libraries of single guide RNA (gRNA)- expressing lentiviruses have been constructed against both the human and mouse genomes. In these libraries, gRNAs along with Cas9 have been cloned into single lentiviral vectors that allow for positive mammalian selection. The rationale behind the use of lentiviruses for high-throughput screens is twofold: First, lentiviruses can be easily titrated to control transgene copy number, which is important for ensuring that single genes are perturbed in single infected cells. Second, lentiviruses exhibit

141 genomic integration and are thus maintained within the host genome during subsequent rounds of cell division. This feature allows a posteriori identification of perturbed genes; each gRNA functions as a unique DNA barcode that can be identified and associated with target genetic loci.

Publicly available gRNA libraries may allow genome-wide loss-of-function screens aimed at identifying genes involved in a variety of cellular processes.

Koike-Yusa and colleagues have reported the development a mouse gRNA library that contains over 87,000 gRNAs targeting over 19,000 mouse protein-coding genes, with at least two-fold coverage of each gene. gRNAs were individually cloned into lentiviral vectors under the U6 RNA polymerase III promoter, which exhibits ubiquitous activity in mammalian cells. Using their library, Koike-Yusa et al. identified 27 known and 4 previously unknown genes implicit to mammalian resistance to either Clostridium septicum alpha-toxin or 6-thioguanine. They further demonstrated that 50 of 52 sampled gRNAs were functional; 50 of 52 sampled gRNAs induced double-strand breaks and generated indels at the correct locus. Additionally, although some off-target effects were detected, the probability that two different gRNAs targeting the same gene exhibited an off-target effect on the phenotype of interest was extremely low. Therefore, Koike-Yusa and colleagues have developed a highly efficient gRNA library for loss-of-function screening in mouse cells.

We are interested in using such gRNA libraries to identify genes implicit in the developmental transition from the oligodendrocyte progenitor to the mature oligodendrocyte. This might be achieved by transducing a pure population of

142 mouse pluripotent stem cell derived oligodendrocyte progenitor cells with a gRNA library designed against the mouse genome (Koike-Yusa et al. 2013). To efficiently identify genes necessary for the development of mature oligodendrocyes, we may employ the use of oligodendrocyte specific transgenes to select for loss-of-function populations of oligodendrocyte progenitor cells that fail to develop into mature oligodendrocytes. Several genes (e.g. MBP, MAG, MOG, etc.) act as oligodendrocyte terminal identity features, that is, genes which are expressed in mature oligodendrocytes but not in oligodendrocyte progenitor cells. A population of oligodendrocyte progenitor cells that contains a transgene in which the expression of caspase-9 is driven by transcriptional regulation of myelin basic protein (MBP) may therefore be aptly suited for a loss-of-function screen for genes required in the oligodendrocyte progenitor to oligodendrocyte transition

(Caprariello et al. 2012). If a gRNA-disrupted gene is not required for oligodendrocyte maturation, then differentiation of oligodendrocyte progenitors into mature oligodendrocytes would trigger cell apoptosis via expression of caspase-9.

However, if a gRNA-disrupted gene is required for the maturation of oligodendrocytes, oligodendrocyte progenitor cells harboring these disrupted genes would escape apoptosis. Sequencing gRNA barcodes in this remaining population of oligodendrocyte progenitor cells would enable identification of candidate genes essential for the maturation of oligodendrocytes.

Importantly, candidate genes will require validation and phenotypic characterization. As with any high-throughput screening method, there is potential for off-target effects (e.g. off-target genes or chromatin landscape alterations) that

143 lead to false positive and negative results. Candidate genes can be validated in transgene-bearing cells by transduction of the appropriate cDNA (see Koike-Yusa et al. 2013), or in wild-type cells by transfection of gRNAs, shRNAs, or siRNAs.

Additionally, our protocols allow for functional characterization of candidate genes identified in genome-wide loss-of-function screens; we can disrupt candidate genes in wild-type cells and determine how these genetic perturbations preclude the development of mature oligodendrocytes.

Similar approaches might be used to discover genes that govern various stages of oligodendrocyte development and/or myelination. For example, we may utilize gRNA libraries in combination with our protocols for directed differentiation of oligodendrocyte progenitor cells from pluripotent stem cells to identify genes required for the development of oligodendrocyte progenitors. Furthermore, strategies may be devised to understand the genetic basis for oligodendrocyte myelination of axons. Through a better understanding of myelination, the process by which mature oligodendrocytes ensheath axons with multiple layers of compact protein-lipid membrane, we may begin to understand the molecular basis of several dysmyelinating diseases and why remyelination often fails despite the presence of an abundant pool of oligodendrocytes/oligodendrocyte progenitors

(Franklin et al. 2008).

144

4.5 Elucidating gene-regulatory networks of the oligodendrocyte lineage

The body is composed of diverse cell types with varying and distinct functions that contribute to the whole of the organism. Although lineage specification of many cell types has been established on the basis of cell type- specific gene expression, how these genes are regulated remains largely unknown. Transcriptional enhancer elements are noncoding regions of the DNA that work to finely tune the expression of genes in a given cell type. Interestingly, enhancer profiles exhibit greater cell type-specificity than the gene expression profiles which they govern, and therefore, the specification of distinct cell types is defined by chromatin state (Heintzman et al. 2007).

Access to large populations of oligodendrocyte lineage cells offers us the first-hand ability to apply next-generation sequencing technologies toward understanding gene-regulatory networks of the oligodendrocyte lineage. Until now, a lack of access to oligodendrocyte lineage cells has made it difficult to understand how oligodendrocyte specific genes are modulated and controlled. With our directed differentiation protocol we can now study the complex regulatory mechanisms underlying oligodendrocyte lineage development and understand how disruption of these regulatory programs contribute to disease pathogenesis.

4.5.1 Understanding the role of oligodendrocyte enhancers in the diagnosis of rare myelin diseases

145

Recently, several groups have developed computational prediction methods that link putative enhancer elements to their predicted gene targets

(Corradin et al. 2014; Ernst et al. 2011; Shen et al. 2012; Thurman et al.

2012). These computational methods work by utilizing comparative analysis across diverse cell types to identify enhancers, marked by monomethylation of histone 3 lysine 4 (H3K4me1) and genes with concordant activity (Corradin et al.

2014). With access to oligodendrocyte lineage cells, we might obtain H3K4me1 profiles (using ChIP-seq) and gene expression profiles (using RNA-seq) for discrete developmental stages of the oligodendrocyte lineage (e.g. progenitor vs. terminally differentiated oligodendrocyte). Using these data sets in combination with recently developed computational methods, we may be able to define enhancer/chromatin profiles and enhancer-gene relationships for the oligodendrocyte lineage, allowing us to understand how enhancers regulate the expression of oligodendrocyte identity features.

Identifying enhancer-gene interactions in the oligodendrocyte lineage may become particularly important for deciphering the functional consequence of noncoding variants in patients with undiagnosed myelin diseases. Indeed,

Corradin et al. have used such an approach to demonstrate the impact of noncoding variants, located in enhancer elements, on disease susceptibility

(Corradin et al. 2013). As enhancers work to modulate gene expression, these methods will help to identify how genetic perturbations in noncoding regions impact gene expression and underlie the pathogenesis of dysmyelinating diseases.

146

As an example, in cases of thalassaemia, inactivation or deletion of globin genes, resulting in an imbalance in the ratio of α-globin to β-globin chains in red blood cells, have been readily identified as the pathogenic cause of α- and β- thalassaemia (Ingram 1957), but deletions or mutations in the globin genes rarely explain all cases of thalassaemaia. It was eventually discovered, through extensive long-range mapping and DNA sequencing techniques that thalassaemaia patients lacking globin protein-coding mutations harbored deletions or rearrangements of non-coding elements that resulted in the repositioning of distant-acting enhancers required for normal globin gene expression (Kioussis et al. 1983; Semenza et al.

1984). Therefore it’s possible that patients presenting with PMD-like neurological symptoms, but lack mutations in the PLP protein coding gene harbor mutations in enhancers that have been predicted to modulate the expression of PLP.

In 2008, the National Institutes of Health (NIH) Office of Rare Disease

Research (ORDR) started an initiative to investigate individuals with undiagnosed disorders. The goal of the NIH Undiagnosed Diseases Program (UPD) is to achieve a diagnosis for patients who remain undiagnosed after exhaustive workup through single nucleotide polymorphism (SNP) arrays, whole exome sequencing

(WES), and whole genome sequencing (WGS). These large data sets usually identify multiple variants of unknown significance (VUS) which often fall into noncoding regions of the genome. By generating enhancer-gene interaction data sets in the oligodendrocyte lineage, we may start to understand the functional role of VUS in patients with undiagnosed dysmyelinating diseases by cross-referencing

VUS data sets with predicted oligodendrocyte lineage enhancers. Therefore, by

147 understanding the functional significance of regions of noncoding DNA in the oligodendrocyte lineage, we may be able to establish causative relationships between VUS and cellular dysfunction.

4.5.2 Delineating enhancers that contribute to oligodendrocyte development

Enhancer elements typically come in two distinct varieties: poised enhancers and active enhancers. Poised enhancers are marked by H3K4me1 and

H3K27me3 whereas active enhancers are marked by H3K4me1 and H3K27ac

(Rada-Iglesias et al. 2011; Zentner et al. 2011). Poised and active enhancers exhibit differential modulation of associated gene transcription in human embryonic stem cells: Active enhancers correlate with genes that are expressed in the early embryo, and in contrast, poised enhancers are linked to genes that are inactive in the early embryo but become active upon subsequent differentiation to more specialized tissues (e.g. neuroectoderm, Rada-Iglesias et al. 2011; Zentner et al. 2011). Collectively these studies indicate that unique enhancer signatures likely prime progenitor cells to respond appropriately to developmental cues. In addition, it has been postulated that misexpression of poised enhancers during development underlies subsequent developmental abnormalities (Zentner et al.

2011).

Several groups have further identified enhancer clusters termed “super enhancers” which are hypothesized to act as cell fate determinant switches. Whyte and colleagues defined super enhancers in mouse embryonic stem cells as cell

148 type-specific enhancers that exhibit exceptionally large, clustered enhancer domains, are enriched for binding motifs of several master transcription factors, exhibit high-density binding of master transcription factors at these loci, and are highly sensitive to perturbation (Whyte et al. 2013). Additionally, super enhancers tend to associate with genes that act as key regulators of cell identity, which in turn bind to the super enhancers that regulate their expression. Therefore, super enhancers act to initiate feed-forward transcriptional programs that define cell fate

(Whyte et al. 2013). Interestingly, Whyte et al. determined that in mouse embryonic stem cells, super enhancer-associated genes are highly sensitive to reduced levels of enhancer bound transcription factors. Based on these results, super enhancers are particularly important for determining cell fate.

With this knowledge we can use our directed differentiation platform to characterize active, poised, and super enhancer landscapes for oligodendrocyte progenitor cells, oligodendrocytes, and myelinating oligodendrocytes. Through these future analyses we may be able to gain novel insight into chromatin conformations that govern each developmental state. As multiple enhancers are often predicted to target and modulate the same gene, functional validation of predicted enhancers is essential for determining their impact on gene expression

(Corradin et al. 2013). We may directly ascertain the functional role of candidate enhancers by using our protocols for direct differentiation of oligodendrocyte lineage cells from mouse pluripotent stem cells; we may perturb or knock-out predicted enhancers in pluripotent stem cells and assess their contribution to oligodendrocyte development and maturation.

149

References

Agaisse, H. et al. Genome-wide RNAi screen for host factors required for intracellular bacterial infection. Science. 5738, 1248-1251 (2005).

Alberta, J.A. et al. Sonic hedgehog is required during an early phase of oligodendrocyte development in mammalian brain. Mol Cell Neurosci. 4, 434-441 (2001).

Anderson, T.J., Montague, P., Nadon, N., Nave, K.A. & Griffiths, I.R. Modification of Schwann cell phenotype with Plp transgenes: evidence that the PLP and DM20 isoproteins are targeted to different cellular domains. J Neurosci Res. 1, 13-22 (1997).

Baguisi, A. et al. Production of goats by somatic cell nuclear transfer. Nat Biotechnol. 5, 456-461 (1999).

Bai, L. et al. Hepatocyte growth factor mediates mesenchymal stem cell-induced recovery in multiple sclerosis models. Nat. Neurosci. 15, 862–870 (2012).

Barbarese, E., Carson, J.H. & Braun, P.E., Accumulation of the four myelin basic proteins in mouse brain during development. J Neurochem 4, 779-782 (1978).

Barbarese, E., Nielson, M.L. & Carson, J.H. The effect of the shiverer mutation on myelin basic protein expression in homozygous and heterozygous mouse brain. J Neurochem 6, 1680-1686 (1983).

Barrangou, R. et al. CRISPR provides acquired resistance against viruses in prokaryotes. Science. 5819, 1709-1712 (2007).

Barres, B.A. et al. Cell death in the oligodendrocyte lineage. J Neurobiol. 9, 1221-1230 (1992).

Barres, B.A., Lazar, M.A. & Raff, M.C. A novel role for thyroid hormone, glucocorticoids and retinoic acid in timing oligodendrocyte development. Development 120, 1097–1108 (1994).

Baumann, N., Pham-Dinh, D. Biology of oligodendrocyte and myelin in the mammalian central nervous system. Physiol Rev. 2, 871-927 (2001).

Beard, C., Hochedlinger, K., Plath, K., Wutz, A. & Jaenisch, R. Efficient method to generate single-copy transgenic mice by site-specific integration in embryonic stem cells. Genesis 44, 23–28 (2006).

150

Belo, J.A. et al. Cerberus-like is a secreted factor with neutralizing activity expressed in the anterior primitive endoderm of the mouse gastrula. Mech Dev. 1-2, 45-57 (1997).

Benninger, Y. et al. Beta1-integrin signaling mediates premyelinating oligodendrocyte survival but is not required for CNS myelination and remyelination. J Neurosci. 29, 7665-7673 (2006).

Billings-Gagliardi, S. et al. Jimpy 4J: a new X-linked mouse mutation producing severe CNS hypomyelination. Dev Neurosci. 5-6, 300-310 (1995).

Billon, N., Jolicoeur, C., Ying, Q.L., Smith, A. & Raff, M. Normal timing of oligodendrocyte development from genetically engineered, lineage-selectable mouse ES cells. J Cell Sci. Pt 18, 3657-3665 (2002).

Bin, J.M., Leong, S.Y., Bull, S., Antel, J.P. & Kennedy, T.E. Oligodendrocyte Precursor Cell Transplantation into Organotypic Cerebellar Shiverer Slices: A Model to Study Myelination and Myelin Maintenance PLoS One 7, (2012).

Bogler, O., Wren, D., Barnett, S.C., Land, H. & Noble, M. Cooperation between two growth factors promotes extended self-renewal and inhibits differentiation of oligodendrocyte-type-2 astrocyte (O-2A) progenitor cells. Proc Natl Acad Sci USA 87, 6368–6372 (1990).

Booker, M. et al. False negative rates in Drosophila cell-based RNAi screens: a case study. BMC Genomics. 12, 50 (2011).

Borda, J.T. et al. Clinical and immunopathologic alterations in rhesus macaques affected with globoid cell leukodystrophy. Am J Pathol. 1, 98-111 (2008).

Briggs, R. & King T.J. Changes in the nuclei of differentiating endoderm cells as revealed by nuclear transplantation. J Morphol 100, 269-312 (1957).

Briggs, R. & King, T.J. Transplantation of Living Nuclei from Blastula Cells into Enucleated Frogs' Eggs. Proc Natl Acad Sci USA. 5, 455-463 (1952).

Briscoe, J. et al. Homeobox gene Nkx2.2 and specification of neuronal identity by graded Sonic hedgehog signaling. Nature. 6728, 622-627 (1999).

Briscoe, J., Pierani, A., Jessell, T.M. & Ericson, J. A homeodomain protein code specifies progenitor cell identity and neuronal fate in the ventral neural tube. Cell. 4, 435-445 (2000).

Bromhall, J. D. Nuclear transplantation in the rabbit egg. Nature. 5537, 719-722 (1975).

151

Brouns, S.J. et al. Small CRISPR RNAs guide antiviral defense in prokaryotes. Science. 5891, 960-964 (2008).

Brustle, O. et al. Embryonic stem cell-derived glial precursors: a source of myelinating transplants. Science. 5428, 754-756 (1999).

Bujalka, H. et al. MYRF is a membrane-associated transcription factor that autoproteolytically cleaves to directly activate myelin genes. PLoS Biol. 8, e1001625 (2013).

Byrne, J.A. et al. Producing primate embryonic stem cells by somatic cell nuclear transfer. Nature. 7169, 497-502 (2007).

Byrne, S.M., Ortiz, L., Mali, P., Aach, J. & Church, G.M. Multi-kilobase homozygous targeted gene replacement in human induced pluripotent stem cells. Nucleic Acids Res. 3, e21 (2014).

Cahoy, J.D. et al. A transcriptome database for astrocytes, neurons, and oligodendrocytes: a new resource for understanding brain development and function. J. Neurosci. 28, 264–278 (2008).

Cai, J. et al. Generation of oligodendrocyte precursor cells from mouse dorsal spinal cord independent of Nkx6 regulation and Shh signaling. Neuron. 1, 41-53 (2005).

Caiazzo, M. et al. Direct generation of functional dopaminergic neurons from mouse and human fibroblasts. Nature 476, 224–227 (2011).

Cailloux, F. et al. Genotype–phenotype correlation in inherited brain myelination defects due to proteolipid protein gene mutations. Eur J Hum Genet 8, 837–845 (2000).

Calver, A.R. et al. Oligodendrocyte population dynamics and the role of PDGF in vivo. Neuron. 5, 869-882 (1998).

Camara, J. et al. Integrin-mediated axoglial interactions initiate myelination in the central nervous system. J Cell Biol. 4, 699-712 (2009).

Campbell, K.H., McWhir, J., Ritchie, W.A. & Wilmut, I. Sheep cloned by nuclear transfer from a cultured cell line. Nature. 6569, 64-66 (1996).

Camus, A., Perea-Gomez, A., Moreau, A. & Collignon, J. Absence of Nodal signaling promotes precocious neural differentiation in the mouse embryo. Dev Biol. 2, 743-755 (2006).

152

Caprariello, A.V., Mangla, S., Miller, R.H. & Selkirk, S.M. Apoptosis of oligodendrocytes in the central nervous system results in rapid focal demyelination. Ann Neurol. 3, 395-405 (2012).

Castelvetri, L.C. et al. Axonopathy is a compounding factor in the pathogenesis of Krabbe disease. Acta Neuropathol. 1, 35-48 (2011).

Chambers, S.M. et al. Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD signaling. Nat Biotechnol. 3, 275-280 (2009).

Chandran, S. et al. FGF-dependent generation of oligodendrocytes by a hedgehog-independent pathway. Development. 26, 6599-6609 (2003).

Chan, J.R. et al. NGF controls axonal receptivity to myelination by Schwann cells or oligodendrocytes. Neuron. 2, 183-191 (2004).

Chernoff, G.F. Shiverer: an autosomal recessive mutant mouse with myelin deficiency. J. Hered. 72, 128 (1981).

Cheong, H.T., Takahashi, Y. & Kanagawa, H. Birth of mice after transplantation of early cell-cycle-stage embryonic nuclei into enucleated oocytes. Biol Reprod. 5, 958-963 (1993).

Chesné, P. et al. Cloned rabbits produced by nuclear transfer from adult somatic cells. Nat Biotechnol. 4, 366-369 (2002).

Chiang, C. et al. Cyclopia and defective axial patterning in mice lacking Sonic hedgehog gene function. Nature. 6599, 407-413 (1996).

Chun, S.J., Rasband, M.N., Sidman, R.L., Habib, A.A. & Vartanian, T. Integrin- linked kinase is required for laminin-2-induced oligodendrocyte cell spreading and CNS myelination. J Cell Biol. 2, 397-408 (2003).

Cody, J.D. et al. Narrowing critical regions and determining penetrance for selected 18q- phenotypes. Am. J. Med. Genet. A. 7, 1421-1430 (2009).

Comandon, J. & de Fonbrune, P. Greffe nucldaire totale, simple ou multiple, chez une Amibe. C. R. Seanc. Soc. Biol.130, 740-748 (1939).

Corradin, O. et al. Combinatorial effects of multiple enhancer variants in linkage disequilibrium dictate levels of gene expression to confer susceptibility to common traits. Genome Res. 1, 1-13 (2014).

Costantino-Ceccarini, E. et al. Transduction of cultured oligodendrocytes from normal and twitcher mice by a retroviral vector containing human galactocerebrosidase (GALC) cDNA. Neurochem Res. 2, 287-293 (1999).

153

Costello, D.J., Eichler, A.F & Eichler, F.S. Leukodystrophies: classification, diagnosis, and treatment. Neurologist. 6, 319-328 (2009).

Cram, D.S., Song, B. & Trounson, A.O. Genotyping of Rhesus SCNT pluripotent stem cell lines. Nature. 7169, E12-14 (2007).

Crang, A.J., Gilson, J. & Blakemore, W.F. The demonstration by transplantation of the very restricted remyelinating potential of post-mitotic oligodendrocytes. J. Neurocytol. 27, 541–553 (1998).

Crome, L., Hanefeld, F., Patrick, D. & Wilson, J. Late onset globoid cell leukodystrophy. Brain. 4, 841-848 (1973).

Cui, Q.L. et al. Response of human oligodendrocyte progenitors to growth factors and axon signals. J Neuropathol Exp Neurol. 9, 930-944 (2010).

Dautigny, A. et al. The structural gene coding for myelin-associated proteolipid protein is mutated in jimpy mice. Nature. 6073, 867-869 (1986). de Ferra, F. et al. Alternative splicing accounts for the four forms of myelin basic protein. Cell. 42, 721-727 (1985).

Deber, C.M. & Reynolds, S.J. Central nervous system myelin: structure, function, and pathology. Clin Biochem. 2, 113-134 (1991).

Demerens, C. et al. Induction of myelination in the central nervous system by electrical activity. Proc Natl Acad Sci USA. 18, 9887-8992 (1996).

Denk, W. & Horstmann, H. Serial block-face scanning electron microscopy to reconstruct three-dimensional tissue nanostructure. PLoS Biol. 2, e329 (2004).

Dolcetta, D. et al. Design and optimization of lentiviral vectors for transfer of GALC expression in Twitcher brain. J Gene Med. 8, 962-971 (2006).

Duchen, L.W., Eicher, E.M., Jacobs, J.M., Scaravilli, F. & Teixeira, F. Hereditary leucodystrophy in the mouse: the new mutant twitcher. Brain. 3, 695-710 (1980).

Dugas, J.C. et al. Dicer1 and miR-219 Are required for normal oligodendrocyte differentiation and myelination. Neuron. 5, 597-611 (2010).

Duncan, I.D., Hammang, J.P., Goda, S. & Quarles, R.H. Myelination in the jimpy mouse in the absence of proteolipid protein. Glia. 3, 148-154 (1989).

Dupouey, P. et al. Immunochemical studies of myelin basic protein in shiverer mouse devoid of major dense line of myelin. Neurosci Lett. 12, 113-118 (1979).

154

Efe, J.A. et al. Conversion of mouse fibroblasts into cardiomyocytes using a direct reprogramming strategy. Nat Cell Biol. 3, 215-222 (2011).

Emery, B. et al. Myelin gene regulatory factor is a critical transcriptional regulator required for CNS myelination. Cell. 1, 172-185 (2009).

Ernst, J. et al. Mapping and analysis of chromatin state dynamics in nine human cell types. Nature. 7345, 43-49 (2011).

Escolar, M.L. et al. Transplantation of umbilical-cord blood in babies with infantile Krabbe's disease. N Engl J Med. 20, 2069-2081 (2005).

Fiumara A. et al. Krabbe leukodystrophy in a selected population with high rate of late onset forms: longer survival linked to c.121G>A (p.Gly41Ser) mutation. Clin Genet. 5, 452-458 (2011).

Fogarty, M., Richardson, W.D. & Kessaris, N. A subset of oligodendrocytes generated from radial glia in the dorsal spinal cord. Development. 8, 1951-1959 (2005).

Franklin, R.J. & Ffrench-Constant, C. Remyelination in the CNS: from biology to therapy. Nat. Rev. Neurosci. 9, 839–855 (2008).

Furuya, H. et al. Adult onset globoid cell leukodystrophy (Krabbe disease): analysis of galactosylceramidase cDNA from four Japanese patients. Hum Genet. 3-4, 450-456 (1997).

Gahwiler, B.H., Capogna, M., Debanne, D., McKinney, R.A. & Thompson, S.M.Organotypic slice cultures: a technique has come of age. Trends Neurosci. 20,471–477 (1997).

Gama Sosa, M.A. et al. Correction of the galactocerebrosidase deficiency in globoid cell leukodystrophy-cultured cells by SL3-3 retroviral- mediated gene transfer. Biochem Biophys Res Commun. 3, 766-771 (1996).

Gasiunas, G., Barrangou, R., Horvath, P. & Siksnys, V. Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria. Proc Natl Acad Sci USA. 39, 2579-2586 (2012).

Gencic, S., Abuelo, D., Ambler, M. & Hudson, L.D. Pelizaeus-Merzbacher disease: an X-linked neurologic disorder of myelin metabolism with a novel mutation in the gene encoding proteolipid protein. Am J Hum Genet. 3, 435-442 (1989).

Goldman, S.A., Nedergaard, M. & Windrem, M.S. Glial progenitor cell-based treatment and modeling of neurological disease. Science 338, 491–495 (2012).

155

Gow, A. & Lazzarini, R.A. A cellular mechanism governing the severity of Pelizaeus-Merzbacher disease. Nat Genet 13, 422–428 (1996).

Gow, A., Gragerov, A., Gard, A., Colman, D.R. & Lazzarini, R.A. Conservation of topology, but not conformation, of the proteolipid proteins of the myelin sheath. J Neurosci 17, 181–189 (1997).

Gupta, N. et al. Neural stem cell engraftment and myelination in the human brain. Sci Transl Med. 155, 155ra137 (2012).

Gurdon, J.B. The developmental capacity of nuclei taken from intestinal epithelium cells of feeding tadpoles. J Embryol Exp Morphol. 10, 622-640 (1962).

Gyllensten, L. & Malmfors, T. Myelinization of the optic nerve and its dependence on visual function--a quantitative investigation in mice. J Embryol Exp Morphol. 11, 255-266 (1963).

Hale, C.R. et al. RNA-guided RNA cleavage by a CRISPR RNA-Cas protein complex. Cell. 5, 945-956 (2009).

Hammerling, J. Über genomwirkungen und Formbildungsfähigkeit bei Acetabularia. Arch Entw Mech. Org.132,424-462 (1934).

Han, D.W. et al. Direct reprogramming of fibroblasts into neural stem cells by defined factors. Cell Stem Cell 10, 465–472 (2012).

Hanna, J. et al. Treatment of sickle cell anemia mouse model with iPS cells generated from autologous skin. Science. 5858, 1920-1923 (2007).

Heintzman, N.D. et al. Histone modifications at human enhancers reflect global cell-type-specific gene expression. Nature. 7243, 108-112 (2009).

Hemmati-Brivanlou, A., Kelly, O.G. & Melton, D.A. Follistatin, an antagonist of activin, is expressed in the Spemann organizer and displays direct neuralizing activity. Cell. 2, 283-295 (1994).

He, Y. et al. The transcription factor Yin Yang 1 is essential for oligodendrocyte progenitor differentiation. Neuron. 2, 217-230 (2007).

Hoogerbrugge, P.M. et al. Effect of bone marrow transplantation on enzyme levels and clinical course in the neurologically affected twitcher mouse. J Clin Invest. 6, 1790-1794 (1988).

Hoogerbrugge, P.M., Poorthuis, B.J., Wagemaker, G., van Bekkum, D.W. & Suzuki, K. Alleviation of neurologic symptoms after bone marrow transplantation in twitcher mice. Transplant Proc. 1 Pt 3, 2980-2981 (1989).

156

Horvath, P. & Barrangou, R. CRISPR/Cas, the immune system of bacteria and archaea. Science. 5962, 167-170 (2010).

Howng, S.Y. et al. ZFP191 is required by oligodendrocytes for CNS myelination. Genes Dev. 3, 301-311 (2010).

Hu, J., Deng, L., Wang, X. & Xu, X.M. Effects of extracellular matrix molecules on the growth properties of oligodendrocyte progenitor cells in vitro. J Neurosci Res. 13, 2854-2862 (2009).

Huang, P. et al. Direct reprogramming of human fibroblasts to functional and expandable hepatocytes. Cell Stem Cell. 3, 370-384 (2014).

Hudson, L.D., Berndt, J.A., Puckett, C., Kozak, C.A. & Lazzarini, R.A. Aberrant splicing of proteolipid protein mRNA in the dysmyelinating jimpy mutant mouse. Proc Natl Acad Sci USA. 5, 1454-1458 (1987).

Hudson, L.D., Puckett, C., Berndt, J., Chan, J. & Gencic, S. Mutation of the proteolipid protein gene PLP in a human X chromosome-linked myelin disorder. Proc Natl Acad Sci USA. 20, 8128-8131 (1989).

Hughes, E.G., Kang, S.H., Fukaya, M. & Bergles, D.E. Oligodendrocyte progenitors balance growth with self-repulsion to achieve homeostasis in the adult brain. Nat Neurosci. 6, 668-676 (2013).

Huxley, A.F. & Stampfli, R. Evidence for saltatory conduction in peripheral myelinated nerve fibres. J Physiol. 3, 315-339 (1949).

Ichioka, T., Kishimoto, Y., Brennan, S., Santos, G.W. & Yeager, A.M. Hematopoietic cell transplantation in murine globoid cell leukodystrophy (the twitcher mouse): effects on levels of galactosylceramidase, psychosine, andgalactocerebrosides. Proc Natl Acad Sci USA. 12, 4259-4263 (1987).

Ieda, M. et al. Direct reprogramming of fibroblasts into functional cardiomyocytes by defined factors. Cell. 3, 375-386 (2010).

Ingram, V.M. Gene mutations in human haemoglobin: the chemical difference between normal and sickle cell haemoglobin. Nature. 4581, 326-328 (1957).

Inoue, K. et al. Genomic rearrangements resulting in PLP1 deletion occur by non-homologous end-joining and cause different dysmyelinating phenotypes in males and females. Am J Hum Genet. 71, 838–853 (2002).

Inoue, K. et al. Proteolipid protein gene duplications causing Pelizaeus- Merzbacher disease: molecular mechanism and phenotypic manifestations. Ann Neurol. 45, 624–632 (1999).

157

Inoue, Y., Nakamura, R., Mikoshiba, K. & Tsukada, Y. Fine structure of the central myelin sheath in the myelin deficient mutant Shiverer mouse, with special reference to the pattern of myelin formation by oligodendroglia. Brain Res. 219, 85–94 (1981).

Itoh, M. et al. Mind bomb is a ubiquitin ligase that is essential for efficient activation of Notch signaling by Delta. Dev Cell. 1, 67-82 (2003).

Itzhaki, I. et al. Modeling the long QT syndrome with induced pluripotent stem cells. Nature. 7337, 225-229 (2011).

Jackson, A.L. et al. Widespread siRNA "off-target" transcript silencing mediated by seed region sequence complementarity. RNA. 7, 1179-1187 (2006).

Jacobs, J.M., Scaravilli, F. & De Aranda, F.T. The pathogenesis of globoid cell leucodystrophy in peripheral nerve of the mouse mutant twitcher. J Neurol Sci. 3, 285-304 (1982).

Jacque, C., Delassalle, A., Raoul, M. & Baumann, N. Myelin basic protein deposition in the optic and sciatic nerves of dysmyelinating mutants quaking, jimpy, Trembler, mld, and shiverer during development. J Neurochem. 5, 1335- 1340 (1983).

Joe, E.H. & Angelides, K.J. Clustering and mobility of voltage-dependent sodium channels during myelination. J Neurosci. 7, 2993-3005 (1993).

Kang, S.H., Fukaya, M., Yang, J.K., Rothstein, J.D. & Bergles, D.E. NG2+ CNS glial progenitors remain committed to the oligodendrocyte lineage in postnatal life and following neurodegeneration. Neuron. 4, 668-681 (2010).

Karlas, A. et al. Genome-wide RNAi screen identifies human host factors crucial for influenza virus replication. Nature. 7282, 818-822 (2010).

Kato, Y. et al. Eight calves cloned from somatic cells of a single adult. Science. 5396, 2095-2098 (1998).

Kim, J. et al. Direct reprogramming of mouse fibroblasts to neural progenitors. Proc Natl Acad Sci USA. 108, 7838–7843 (2011).

Kimura, M. et al. Restoration of myelin formation by a single type of myelin basic protein in transgenic Shiverer mouse. Proc Natl Acad Sci USA. 86, 5661–5665 (1989).

Kioussis, D., Vanin, E., deLange, T., Flavell, R.A. & Grosveld, F.G. Beta-globin gene inactivation by DNA translocation in gamma beta-thalassaemia. Nature. 5944, 662-666 (1983).

158

Kleitman, N., Wood, P.M. & Bunge, R.P. Tissue culture methods for the study of myelination. In: Banker G, Goslin K, editors. Culturing Nerve Cells. Cambridge, MA: MIT Press; 337–377 (1991).

Knapp, P.E., Skoff, R.P. & Redstone, D.W. Oligodendroglial cell death in jimpy mice: an explanation for the myelin deficit. J Neurosci. 10, 2813-2822 (1986). Kobayashi, S., Katayama, M., Satoh, J., Suzuki, K. & Suzuki, K. The twitcher mouse. An alteration of the unmyelinated fibers in the PNS. Am J Pathol. 2, 308-319 (1988).

Kobayashi, T., Yamanaka, T., Jacobs, J.M., Teixeira, F. & Suzuki, K. The Twitcher mouse: an enzymatically authentic model of human globoid cell leukodystrophy (Krabbe disease). Brain Res. 2, 479-783 (1980).

Koike-Yusa, H., Li, Y., Tan, E.P., Velasco-Herrera Mdel, C. & Yusa, K. Genome- wide recessive genetic screening in mammalian cells with a lentiviral CRISPR- guide RNA library. Nat Biotechnol. 3, 267-273 (2014).

Kondo, T. & Raff, M. Basic helix-loop-helix proteins and the timing of oligodendrocyte differentiation. Development. 14, 2989-2998 (2000a).

Kondo, T. & Raff, M. The Id4 HLH protein and the timing of oligodendrocyte differentiation. EMBO J. 9, 1998-2007 (2000b).

Landrum, M.J. et al. ClinVar: public archive of relationships among sequence variation and human phenotype. Nucleic Acids Res. 42, D980-985 (2014).

Lara-Ramírez, R., Zieger, E. & Schubert, M. Retinoic acid signaling in spinal cord development. Int J Biochem Cell Biol. 7, 1302-1313 (2013).

Lee, K.K. et al. Dominant-negative beta1 integrin mice have region-specific myelin defects accompanied by alterations in MAPK activity. Glia. 8, 836-844 (2006).

Lee, S. et al. A culture system to study oligodendrocyte myelination processes using engineered nanofibers. Nat Methods. 9, 917-922 (2012).

LeVine, S.M., Wetzel, D.L. & Eilert, A.J. Neuropathology of twitcher mice: examination by histochemistry, immunohistochemistry, lectin histochemistry and Fourier transform infrared microspectroscopy. Int J Dev Neurosci. 4, 275-288 (1994).

Liang, X., Draghi, N.A. & Resh, M.D. Signaling from integrins to Fyn to Rho family GTPases regulates morphologic differentiation of oligodendrocytes. J Neurosci. 32, 7140-7149 (2004).

159

Liem, K.F. Jr., Jessell, T.M. & Briscoe, J. Regulation of the neural patterning activity of sonic hedgehog by secreted BMP inhibitors expressed by notochord and somites. Development. 22, 4855-4866 (2000).

Lin, D. et al. AAV2/5 vector expressing galactocerebrosidase ameliorates CNS disease in the murine model of globoid-cell leukodystrophy more efficiently than AAV2. Mol Ther. 3, 422-340 (2005).

Lin, D., Donsante, A., Macauley, S., Levy, B., Vogler, C. & Sands, M.S. Central nervous system-directed AAV2/5-mediated gene therapy synergizes with bone marrow transplantation in the murine model of globoid-cell leukodystrophy. Mol Ther. 1, 44-52 (2007).

Lin, D.S. et al. CNS-targeted AAV5 gene transfer results in global dispersal of vector and prevention of morphological and function deterioration in CNS of globoid cell leukodystrophy mouse model. Mol Genet Metab. 4, 367-377 (2011).

Liu, Z. et al. Induction of oligodendrocyte differentiation by Olig2 and Sox10: evidence for reciprocal interactions and dosage-dependent mechanisms. Dev. Biol. 302, 683–693 (2007).

Lu, Q.R. et al. Common developmental requirement for Olig function indicates a motor neuron/oligodendrocyte connection. Cell. 1, 75-86 (2002).

Lu, Q.R. et al. Sonic hedgehog--regulated oligodendrocyte lineage genes encoding bHLH proteins in the mammalian central nervous system. Neuron. 2, 317-329 (2000).

Lujan, E., Chanda, S., Ahlenius, H., Sudhof, T.C. & Wernig, M. Direct conversion of mouse fibroblasts to self-renewing, tripotent neural precursor cells. Proc Natl Acad Sci USA 109, 2527–2532 (2012).

Luo, J. et al. A genome-wide RNAi screen identifies multiple synthetic lethal interactions with the Ras oncogene. Cell. 5, 835-848 (2009).

Luzi, P. et al. Generation of a mouse with low galactocerebrosidase activity by gene targeting: a new model of globoid cell leukodystrophy (Krabbe disease). Mol Genet Metab. 3, 211-223 (2001).

Lyon, G., Fattal-Valevski, A. & Kolodny, E.H. Leukodystrophies: clinical and genetic aspects. Top Magn Reson Imaging. 4, 219-242 (2006).

Macklin, W.B., Campagnoni, C.W., Deininger, P.L. & Gardinier, M.V. Structure and expression of the mouse myelin proteolipid protein gene. J Neurosci Res. 3, 383-394 (1987).

160

Mallon, B.S., Shick, H.E., Kidd, G.J. & Macklin, W.B. Proteolipid promoter activity distinguishes two populations of NG2-positive cells throughout neonatal cortical development. J. Neurosci. 22, 876–885 (2002).

Mar, S. & Noetzel, M. Axonal damage in leukodystrophies. Pediatr Neurol. 4, 239-242 (2010).

Marin-Husstege, M., Muggironi, M., Liu, A. & Casaccia-Bonnefil, P. Histone deacetylase activity is necessary for oligodendrocyte lineage progression. J Neurosci. 23, 10333-10345 (2002).

McKinnon, R.D., Matsui, T., Dubois-Dalcq, M. & Aaronson, S.A. FGF modulates the PDGF-driven pathway of oligodendrocyte development. Neuron. 5, 603-614 (1990).

McLean, C.Y. et al. GREAT improves functional interpretation of cis-regulatory regions. Nat. Biotechnol. 28, 495–501 (2010).

Meng, X.L., Shen, J.S., Watabe, K., Ohashi, T. & Eto, Y. GALC transduction leads to morphological improvement of the twitcher oligodendrocytes in vivo. Mol Genet Metab. 4, 332-343 (2005).

Meno, C. et al. Mouse Lefty2 and zebrafish antivin are feedback inhibitors of nodal signaling during vertebrate gastrulation. Mol Cell. 3, 287-298 (1990).

Merzbacher, L. Eine eigenartige familiäre-hereditäre Erkrankungsform (Aplasia axialis extracorticalis congenita) Z Ges Neurol Psychiatr 3:1, 138 (1910).

Mi, S. et al. Promotion of central nervous system remyelination by induced differentiation of oligodendrocyte precursor cells. Ann. Neurol. 65, 304– 315(2009).

Mikula, S., Binding, J. & Denk, W. Staining and embedding the whole mouse brain for electron microscopy. Nat. Methods. 9, 1198–1201 (2012).

Mimault, C. et al. Proteolipoprotein gene analysis in 82 patients with sporadic Pelizaeus-Merzbacher disease: duplications, the major cause of the disease, originate more frequently in male germ cells, but point mutations do not. Am J Hum Genet. 65, 360–369 (1999).

Mizuguchi, R. et al. Combinatorial roles of olig2 and neurogenin2 in the coordinated induction of pan-neuronal and subtype-specific properties of motoneurons. Neuron. 5, 757-771 (2001).

Moffat, J. et al. A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen. Cell. 6, 1283-1298 (2006).

161

Molineaux, S.M., Engh, H., de Ferra, F., Hudson, L. & Lazzarini, R.A. Recombination within the myelin basic protein gene created the dysmyelinating shiverer mouse mutation. Proc. Nat. Acad. Sci. USA. 83, 7542- 7546 (1986).

Moretti, A. et al. Patient-specific induced pluripotent stem-cell models for long-QT syndrome. N Engl J Med. 15, 1397-1409 (2010).

Nagara, H., Kobayashi, T., Suzuki, K. & Suzuki, K. The twitcher mouse: normal pattern of early myelination in the spinal cord. Brain Res. 2, 289-294 (1982).

Najm, F.J. et al. Rapid and robust generation of functional oligodendrocyte progenitor cells from epiblast stem cells. Nat. Methods 8, 957–962 (2011).

Nakatani, H. et al. Ascl1/Mash1 promotes brain oligodendrogenesis during myelination and remyelination. J Neurosci. 23, 9752-9768 (2013).

Nave, K.A., Lai, C., Bloom, F.E. & Milner, R.J. Jimpy mutant mouse: a 74-base deletion in the mRNA for myelin proteolipid protein and evidence for a primary defect in RNA splicing. Proc Natl Acad Sci USA. 23, 9264–9268 (1986).

Nave, K.A., Bloom, F.E. & Milner, R.J. A single nucleotide difference in the gene for myelin proteolipid protein defines the jimpy mutation in mouse. J Neurochem. 6, 1873-1877 (1987).

Nistor, G.I., Totoiu, M.O., Haque, N., Carpenter, M.K. & Keirstead, H.S. Human embryonic stem cells differentiate into oligodendrocytes in high purity and myelinate after spinal cord transplantation. Glia. 3, 385-396 (2005).

Niu, J. et al. Phosphorylated olig1 localizes to the cytosol of oligodendrocytes and promotes membrane expansion and maturation. Glia. 9, 1427-1436 (2012).

Noble, M., Murray, K., Stroobant, P., Waterfield, M.D. & Riddle, P. Platelet- derived growth factor promotes division and motility and inhibits premature differentiation of the oligodendrocyte/type-2 astrocyte progenitor cell. Nature. 333, 560–562 (1988).

Noebels, J.L., Marcom, P.K. & Jalilian-Tehrani, M.H. Sodium channel density in hypomyelinated brain increased by myelin basic protein gene deletion. Nature. 352, 431–434 (1991).

Noll, E. & Miller, R.H. Oligodendrocyte precursors originate at the ventral ventricular zone dorsal to the ventral midline region in the embryonic rat spinal cord. Development. 118, 563–573 (1993).

162

Novitch, B.G., Chen, A.I. & Jessell, T.M. Coordinate regulation of motor neuron subtype identity and pan-neuronal properties by the bHLH repressor Olig2. Neuron. 5, 773-789 (2001).

Oehlmann, R., Zlotogora, J., Wenger, D.A. & Knowlton R.G. Localization of the Krabbe disease gene (GALC) on chromosome 14 by multipoint linkage analysis. Am J Hum Genet. 6, 1250-1255 (1993).

Olmstead, C.E. Neurological and neurobehavioral development of the mutant 'twitcher' mouse. Behav Brain Res. 2, 143-153 (1987).

Orentas, D.M. & Miller, R.H. The origin of spinal cord oligodendrocytes is dependent on local influences from the notochord. Dev. Biol. 177, 43–53 (1996). Pang, Z.P. et al. Induction of human neuronal cells by defined transcription factors. Nature. 476, 220–223 (2011).

Parras, C.M. et al. The proneural gene Mash1 specifies an early population of telencephalic oligodendrocytes. J Neurosci. 16, 4233-4242 (2007).

Pelizaeus, F. Über eine eigentümliche Form spastischer Lähmung mit cerebral Erscheinungen auf hereditärer Grundlage (multiple Sklerose). Arch Psychiatr Nervenkr. 16, 698–710 (1885).

Perea-Gomez, A. et al. Nodal antagonists in the anterior visceral endoderm prevent the formation of multiple primitive streaks. Dev Cell. 5, 745-756 (2002).

Pevny, L.H., Sockanathan, S., Placzek, M. & Lovell-Badge, R. A role for SOX1 in neural determination. Development. 10, 1967-1978 (1998).

Pfisterer, U. et al. Direct conversion of human fibroblasts to dopaminergic neurons.Proc. Natl Acad Sci USA. 108, 10343–10348 (2011).

Phillips, R.J. Jimpy, a new totally sex linked gene in the house mouse. Z Indukt Abstamm Vererbungsl. 3, 322-326 (1954).

Pierani, A., Brenner-Morton, S., Chiang, C. & Jessell, T.M. A sonic hedgehog- independent, retinoid-activated pathway of neurogenesis in the ventral spinal cord. Cell. 7, 903-915 (1999).

Pinney, D.F., Pearson-White, S.H., Konieczny, S.F., Latham, K.E. & Emerson, C.P. Jr. Myogenic lineage determination and differentiation: evidence for a regulatory gene pathway. Cell. 5, 781-793 (1988).

Polejaeva, I.A. et al. Cloned pigs produced by nuclear transfer from adult somatic cells. Nature. 6800, 86-90 (2000).

163

Prather, R.S., Sims, M.M. & First, N.L. Nuclear transplantation in early pig embryos. Biol Reprod. 3, 414-418 (1989).

Privat, A., Jacque, C., Bourre, J.M., Dupouey, P. & Baumann, N. Absence of the major dense line in myelin of the mutant mouse "shiverer". Neurosci Lett. 12, 107-112 (1979).

Qi, Y. et al. Control of oligodendrocyte differentiation by the Nkx2.2 homeodomain transcription factor. Development. 14, 2723-2733 (2001).

Qin, E.Y. et al. Bone marrow transplantation increases efficacy of central nervous system-directed enzyme replacement therapy in the murine model of globoid cell leukodystrophy. Mol Genet Metab. 1-2, 186-196 (2012).

Rada-Iglesias, A. et al. A unique chromatin signature uncovers early developmental enhancers in humans. Nature. 7333, 279-283 (2011).

Rafi, M.A. et al. Retroviral vector-mediated transfer of the galactocerebrosidase (GALC) cDNA leads to overexpression and transfer of GALC activity to neighboring cells. Biochem Mol Med. 2, 142-150 (1996).

Raskind, W.H., Williams, C.A., Hudson, L.D., Bird, T.D. Complete deletion of the proteolipid protein gene (PLP) in a family with X-linked Pelizaeus-Merzbacher disease. Am J Hum Genet. 49, 1355–1360 (1991).

Readhead, C. et al. Expression of a myelin basic protein gene in transgenic shiverer mice: correction of the dysmyelinating phenotype. Cell. 48, 703–712 (1987).

Reddy, A.S. et al. Bone marrow transplantation augments the effect of brain- and spinal cord-directed adeno-associated virus 2/5 gene therapy by altering inflammation in the murine model of globoid-cell leukodystrophy. J Neurosci. 27, 9945-9957 (2011).

Regis, S. et al. Genotype-phenotype correlation in five Pelizaeus-Merzbacher disease patients with PLP1 gene duplications. Clin Genet. 3, 279-287 (2008).

Reissmann, E. et al. The orphan receptor ALK7 and the Activin receptor ALK4 mediate signaling by Nodal proteins during vertebrate development. Genes Dev. 15, 2010-2022 (2001).

Richardson, W.D., Pringle, N., Mosley, M.J., Westermark, B. & Dubois-Dalcq, M. A role for platelet-derived growth factor in normal gliogenesis in the central nervous system. Cell. 53, 309–319 (1988).

164

Richardson, W.D., Pringle, N.P., Yu, W.P. & Hall, A.C. Origins of spinal cord oligodendrocytes: Possible developmental and evolutionary relationships with motor neurons. Dev. Neurosci. 19, 58–68 (1997).

Roach, A., Boylan, K., Horvath, S., Prusiner, S.B. & Hood, L.E. Characterization of cloned cDNA representing rat myelin basic protein: absence of expression in shiverer mutant mice. Cell. 34, 799-806 (1983).

Roach, A., Takahashi, N., Pravtcheva, D., Ruddle, F. & Hood, L. Chromosomal mapping of mouse myelin basic protein gene and structure and transcription of the partially deleted gene in shiverer mutant mice. Cell. 42, 149-155 (1985). Rosenbluth J Axoglial junctions in the mouse mutant Shiverer. Brain Res. 208, 283–297 (1981).

Rosenbluth, J. Central myelin in the mouse mutant shiverer. J Comp Neurol. 1, 639-648 (1980).

Rosenfeld, J. & Freidrich, V.L. Jr. Axonal swellings in jimpy mice: does lack of myelin cause neuronal abnormalities? Neuroscience. 3, 959-966 (1983).

Roussel, G., Neskovic, N.M., Trifilieff, E., Artault, J.C. & Nussbaum, J.L. Arrest of proteolipid transport through the Golgi apparatus in Jimpy brain. J Neurocytol. 2, 195-204. (1987).

Rowitch, D.H. & Kriegstein, A.R. Developmental genetics of vertebrate glial-cell specification. Nature. 468, 214–222 (2010).

Sakai, N. et al. Molecular cloning and expression of cDNA for murine galactocerebrosidase and mutation analysis of the twitcher mouse, a model of Krabbe's disease. J Neurochem. 3,1118-1124 (1996).

Santambrogio, S. et al. The galactocerebrosidase enzyme contributes to maintain a functional neurogenic niche during early post-natal CNS development. Hum Mol Genet. 21, 4732-4750 (2010).

Sasai, Y. et al. Xenopus chordin: a novel dorsalizing factor activated by organizer-specific homeobox genes. Cell. 79, 779–790 (1994).

Schier, A.F. Nodal signaling in vertebrate development. Annu Rev Cell Dev Biol. 19, 589-621 (2003).

Schneider, A. et al. Uncoupling of hypomyelination and glial cell death by a mutation in the proteolipid protein gene. Nature. 6389, 758-761 (1992).

165

Schneider, A.M., Griffiths, I.R., Readhead, C. & Nave, K.A. Dominant-negative action of the jimpy mutation in mice complemented with an autosomal transgene for myelin proteolipid protein. Proc Natl Acad Sci USA. 10, 4447–4451 (1995).

Seitelberger, F. [Merzbacher-Pelizaeus disease; clinico-anatomic studies of its position among the diffuse scleroses]. Wien Z Nervenheilkd Grenzgeb. 3, 228- 289 (1954).

Sekiya, S. & Suzuki, A. Direct conversion of mouse fibroblasts to hepatocyte- like cells by defined factors. Nature. 7356, 390-393 (2011).

Semenza, G.L. et al. The silent carrier allele: beta thalassemia without a mutation in the beta-globin gene or its immediate flanking regions. Cell. 1, 123- 128 (1984).

Shalem, O. et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 6166, 84-87.

Shen, J.S., Watabe, K., Ohashi, T. & Eto, Y. Intraventricular administration of recombinant adenovirus to neonatal twitcher mouse leads to clinicopathological improvements. Gene Ther. 14, 1081-1087 (2001).

Shen, Y. et al. A map of the cis-regulatory sequences in the mouse genome. Nature. 7409, 116-120 (2012).

Shinoda, H., Kobayashi, T., Katayama, M., Goto, I. & Nagara, H. Accumulation of galactosylsphingosine (psychosine) in the twitcher mouse: determination by HPLC. J Neurochem. 1, 92-99 (1987).

Shin, T. et al. A cat cloned by nuclear transplantation. Nature. 6874, 859 (2002).

Siddiqi, Z.A., Sanders, D.B. & Massey, J.M. Peripheral neuropathy in Krabbe disease: effect of hematopoietic stem cell transplantation. Neurology. 2, 268-272 (2006).

Sidman, R.L, Dickie, M.M. & Appel S.H. Mutant mice (quaking and jimpy) with deficient myelination in the central nervous system. Science. 3616, 309-311 (1964).

Sidman, R.L., Conover, C.S. & Carson, J.H. Shiverer gene maps near the distal end of chromosome 18 in the house mouse. Cytogenet. Cell Genet. 39, 241-245 (1985).

Sim, F. et al. CD140a identifies a population of highly myelinogenic, migration- competent, and efficiently engrafting human oligodendrocyte progenitor cells. Nat. Biotechnol. 29, 934-941 (2011).

166

Simpson, P.B. & Armstrong, R.C. Intracellular signals and cytoskeletal elements involved in oligodendrocyte progenitor migration. Glia. 1, 22-35 (1999).

Sims, M. & First, N.L. Production of calves by transfer of nuclei from cultured inner cell mass cells. Proc Natl Acad Sci USA. 13, 6143-6147 (1994).

Sistermans, E.A. et al. A (G-to-A) mutation in the initiation codon of the proteolipid protein gene causing a relatively mild form of Pelizaeus-Merzbacher disease in a Dutch family. Hum Genet. 97, 337–339 (1996).

Sistermans, E.A., de Coo, R.F.M., De Wijs, I.J. & Van Oost, B.A. Duplication of the proteolipid protein gene is the major cause of Pelizaeus-Merzbacher disease. Neurology. 50, 1749–1754 (1998).

Smith, B. et al. Peripheral neuropathy in the Twitcher mouse involves the activation of axonal caspase3. ASN Neuro. 4 (2011).

Smith, J.R. et al. Inhibition of Activin/Nodal signaling promotes specification of human embryonic stem cells into neuroectoderm. Dev. Biol. 313, 107–117 (2008).

Smith, W.C. & Harland, R.M. Expression cloning of noggin, a new dorsalizing factor localized to the Spemann organizer in Xenopus embryos. Cell. 70, 829– 840 (1992).

Snaidero, N. et al. Myelin membrane wrapping of CNS axons by PI(3,4,5)P3- dependent polarized growth at the inner tongue. Cell. 1-2, 277-290 (2014).

Sommer, C.A. et al. Induced pluripotent stem cell generation using a single lentiviral stem cell cassette. Stem Cells. 3, 543-549 (2009).

Son, E.Y. et al. Conversion of mouse and human fibroblasts into functional spinal motor neurons. Cell Stem Cell. 9, 205–218 (2011).

Stevens, B., Porta, S., Haak, L.L., Gallo, V. & Fields, R.D. Adenosine: a neuron- glial transmitter promoting myelination in the CNS in response to action potentials. Neuron. 5, 855-868 (2002).

Stice, S.L. & Robl, J.M. Nuclear reprogramming in nuclear transplant rabbit embryos. Biol Reprod. 3, 657-664 (1988).

Stolt, C.C. et al. The Sox9 transcription factor determines glial fate choice in the developing spinal cord. Genes Dev. 13, 1677-1689 (2003).

Stolt, C.C. et al. SoxD proteins influence multiple stages of oligodendrocyte development and modulate SoxE protein function. Dev Cell. 5, 697-709 (2006).

167

Stottmann, R.W., Berrong, M., Matta, K., Choi, M. & Klingensmith, J. The BMP antagonist Noggin promotes cranial and spinal neurulation by distinct mechanisms. Dev Biol. 2, 647-663 (2006).

Sugimori, M. et al. Ascl1 is required for oligodendrocyte development in the spinal cord. Development. 7, 1271-1281 (2008).

Suzuki, K. Globoid cell leukodystrophy (Krabbe's disease): update. J Child Neurol. 9, 595-603 (2003).

Suzuki, K., Hoogerbrugge, P.M., Poorthuis, B.J., Bekkum, D.W. & Suzuki, K. The twitcher mouse. Central nervous system pathology after bone marrow transplantation. Lab Invest. 3, 302-309 (1988).

Svennerholm, L., Vanier, M.T. & Månsson, J.E. Krabbe disease: a galactosylsphingosine (psychosine) lipidosis. J Lipid Res. 1, 53-64 (1980).

Tachibana, M. et al. Human embryonic stem cells derived by somatic cell nuclear transfer. Cell. 6, 1228-1238 (2013).

Takahashi, K. & Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 4, 663-676 (2006).

Takebayashi, H. et al. The basic helix-loop-helix factor olig2 is essential for the development of motoneuron and oligodendrocyte lineages. Curr Biol. 13, 1157- 1163 (2002).

Tappino, B. et al. Identification and characterization of 15 novel GALC gene mutations causing Krabbe disease. Hum Mutat. 12, 1894-1914 (2010).

Tapscott, S.J. et al. MyoD1: a nuclear phosphoprotein requiring a Myc homology region to convert fibroblasts to myoblasts. Science. 4877, 405-411 (1988).

Tauber, H., Waehneldt, T.V. & Neuhoff, V. Myelination in rabbit optic nerves is accelerated by artificial eye opening. Neurosci Lett. 3, 235-238 (1980).

Terada, N. et al. Bone marrow cells adopt the phenotype of other cells by spontaneous cell fusion. Nature. 6880, 542-545 (2002).

Tesar, P.J &, Chenoweth, J.G. et al. New cell lines from mouse epiblast share defining features with human embryonic stem cells. Nature. 7150, 196-199 (2007).

Thier, M. et al. Direct conversion of fibroblasts into stably expandable neural stem cells. Cell Stem Cell. 10, 473–479 (2012).

168

Thomson, C.E. et al. The early phenotype associated with the jimpy mutation of the proteolipid protein gene. J Neurocytol. 3, 207-221 (1999).

Thurman, R.E. et al. The accessible chromatin landscape of the human genome. Nature. 7414, 75-82 (2012).

Torchiana, E. et al. Retroviral-mediated transfer of the galactocerebrosidase gene in neural progenitorcells. Neuroreport. 17, 3823-3827 (1998).

Trapp, B.D., Nishiyama, A., Cheng, D. & Macklin, W. Differentiation and death of premyelinating oligodendrocytes in developing rodent brain. J Cell Biol. 2, 459- 468 (1997).

Trofatter, J.A., Dlouhy, S.R., DeMyer, W., Conneally, P.M. & Hodes, M.E. Pelizaeus-Merzbacher disease: tight linkage to proteolipid protein gene exon variant. Proc Natl Acad Sci USA. 23, 9427-9430 (1989).

Tropepe, V. et al. Direct neural fate specification from embryonic stem cells: a primitive mammalianneural stem cell stage acquired through a default mechanism. Neuron. 1, 65-78 (2001).

Tsai, H.H. et al. The chemokine receptor CXCR2 controls positioning of oligodendrocyte precursors in developing spinal cord by arresting their migration. Cell. 3, 373-383 (2002).

Trousse, F. et al. Notochord and floor plate stimulate oligodendrocyte differentiation in cultures of the chick dorsal neural tube. J. Neurosci. Res. 41,552–560 (1995).

Tsai, H.H., Tessier-Lavigne, M. & Miller, R.H. Netrin 1 mediates spinal cord oligodendrocyte precursor dispersal. Development. 10, 2095-2105 (2003).

Valenzuela, D.M. et al. Identification of mammalian noggin and its expression in the adult nervous system. J. Neurosci. 15, 6077–6084 (1995).

Vallstedt, A., Klos, J.M. & Ericson J. Multiple dorsoventral origins of oligodendrocyte generation in the spinal cord and hindbrain. Neuron. 1, 55-67 (2005).

Vanier, M. & Svennerholm, L. Chemical pathology of Krabbe disease: the occurrence of psychosine and other neutral sphingoglycolipids. Adv Exp Med Biol. 68, 115-126 (1976).

Vierbuchen, T. et al. Direct conversion of fibroblasts to functional neurons by defined factors. Nature. 463, 1035–1041 (2010).

169

Wakayama, T., Perry, A.C., Zuccotti, M., Johnson, K.R. & Yanagimachi, R. Full- term development of mice from enucleated oocytes injected with cumulus cell nuclei. Nature. 6691, 369-374 (1998).

Wang, H., Allen, M.L., Grigg, J.J., Noebels, J.L. & Tempel, B.L. Hypomyelination alters K+ channel expression in mouse mutants shiverer and trembler. Neuron. 15,1337–1347 (1995).

Wang, S. et al. Human iPSC-derived oligodendrocyte progenitor cells can remyelinate and rescue a mouse model of congenital hypomyelination. Cell Stem Cell. 2, 252-264 (2013).

Wang, T., Wei, J.J., Sabatini, D.M. & Lander, E.S. Genetic screens in human cells using the CRISPR-Cas9 system. Science. 6166, 80-84 (2014).

Wang, Z., Colognato, H. & Ffrench-Constant, C. Contrasting effects of mitogenic growth factors on myelination in neuron-oligodendrocyte co-cultures. Glia. 5, 537-545 (2007).

Watkins, T.A., Emery, B., Mulinyawe, S. & Barres, B.A. Distinct stages of myelination regulated by gamma-secretase and astrocytes in a rapidly myelinating CNS coculture system. Neuron. 60, 555–569 (2008).

Weismann, A. The Germ-Plasm: A Theory of Heredity. Walter Scott Ltd., London (1893).

Wenger, D.A., Rafi, M.A., Luzi, P., Datto, J. & Costantino-Ceccarini, E. Krabbe disease: genetic aspects and progress toward therapy. Mol Genet Metab. 1, 1-9 (2000).

Wernig, M. et al. Neurons derived from reprogrammed fibroblasts functionally integrate into the fetal brain and improve symptoms of rats with Parkinson's disease. Proc Natl Acad Sci USA. 15, 5856-5861 (2008).

Whyte, W.A. et al. Master transcription factors and mediator establish super- enhancers at key cell identity genes. Cell. 2, 307-319 (2013).

Wiedenheft, B., Sternberg, S.H. & Doudna, J.A. RNA-guided genetic silencing systems in bacteria and archaea. Nature. 7385, 331-338 (2012).

Wight, P.A., Duchala, C.S., Shick, H.E., Gudz, T.I. & Macklin, W.B. Expression of a myelin proteolipid protein (Plp)-lacZ transgene is reduced in both the CNS and PNS of Plp(jp) mice. Neurochem Res. 2, 343-51 (2007).

Willadsen, S.M. Nuclear transplantation in sheep embryos. Nature. 6057, 63-65 (1986).

170

Willard, H.F. & Riordan, J.R. Assignment of the gene for myelin proteolipid protein to the X chromosome: implications for X-linked myelin disorders. Science. 4728, 940-942 (1985).

Wilmut, I., Schnieke, A.E., McWhir, J., Kind, A.J. & Campbell, K.H. Viable offspring derived from fetal and adult mammalian cells. Nature. 6619, 810-813 (1997).

Windrem, M.S. et al. Neonatal chimerization with human glial progenitor cells can both remyelinate and rescue the otherwise lethally hypomyelinated shiverer mouse. Cell Stem Cell. 2, 553–565 (2008).

Won, J.S., Kim, J., Paintlia, M.K., Singh, I. & Singh, A.K. Role of endogenous psychosine accumulation in oligodendrocyte differentiation andsurvival: implicatio n for Krabbe disease. Brain Res. 1508, 44-52 (2013).

Xie, F. et al. Seamless gene correction of β-thalassemia mutations in patient- specific iPSCs using CRISPR/Cas9 and piggyBac. Genome Res. 9, 1526-1533 (2014).

Yandava, B.D., Billinghurst, L.L. & Snyder, E.Y. Global cell replacement is feasible via neural stem cell transplantation: evidence from the dysmyelinated shiverer mouse brain. Proc Natl Acad Sci USA. 96, 7029–7034 (1999).

Yang, X. et al. Notch1 signaling influences v2 interneuron and motor neuron development in the spinal cord. Dev Neurosci. 1-2, 102-117 (2006).

Yano, S. et al. An antigen retrieval method using an alkaline solution allows immunoelectron microscopic identification of secretory granules in conventional epoxy-embedded tissue sections. J. Histochem. Cytochem. 51, 199–204 (2003).

Yeager, A.M., Brennan, S., Tiffany, C., Moser, H.W. & Santos, G.W. Prolonged survival and remyelination after hematopoietic cell transplantation in the twitcher mouse. Science. 4666, 1052-1054 (1984).

Yeung, M.S. et al. Dynamics of oligodendrocyte generation and myelination in the human brain. Cell. 4, 766-774 (2014).

Ying, Q.L., Nichols, J., Evans, E.P. & Smith, A.G. Changing potency by spontaneous fusion. Nature. 6880, 545-548 (2002).

Yoo, A.S. et al. MicroRNA-mediated conversion of human fibroblasts to neurons. Nature. 476, 228–231 (2011).

171

Zawadzka, M. et al. CNS-resident glial progenitor/stem cells produce Schwann cells as well as oligodendrocytes during repair of CNS demyelination. Cell Stem Cell. 6, 578–590 (2010).

Zeman, W., Demyer, W. & Falls, H.F. Pelizaeus-merzbacher disease. A study in nosology. J Neuropathol Exp Neurol. 23, 334-354 (1964).

Zentner, G.E., Tesar, P.J. & Scacheri, P.C. Epigenetic signatures distinguish multiple classes of enhancers with distinct cellular functions. Genome Res. 8, 1273-1283 (2011).

Zhang, X. et al. Induction of oligodendrocytes from adult human olfactory epithelial-derived progenitors by transcription factors. Stem Cells. 23, 442–453 (2005).

Zhou, Y. et al. High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells. Nature. 7501, 487-491 (2014).

Zlotogora, J., Chakraborty, S., Knowlton, R.G. & Wenger DA. Krabbe disease locus mapped to chromosome 14 by genetic linkage. Am J Hum Genet. 1, 37-44 (1990).

172