DOCSLIB.ORG

High-Dose Ionizing Radiation Regulates Gene Expression Changes in the MCF7 Breast Cancer Cell Line

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
High-Dose Ionizing Radiation Regulates Gene Expression Changes in the MCF7 Breast Cancer Cell Line ANTICANCER RESEARCH 35: 2577-2592 (2015) High-dose Ionizing Radiation Regulates Gene Expression Changes in the MCF7 Breast Cancer Cell Line VALENTINA BRAVATÀ1*, LUIGI MINAFRA1*, GIORGIO RUSSO1, GIUSI IRMA FORTE1, FRANCESCO P. CAMMARATA1, MARILENA RIPAMONTI1, CARLO CASARINO1, GIUSEPPA AUGELLO2, FRANCESCA COSTANTINI2, GIOVANNA BARBIERI2, CRISTINA MESSA1,4,5 and MARIA C. GILARDI1,3,5 1Institute of Bioimaging and Molecular Physiology, National Research Council (IBFM-CNR) -LATO, Cefalù (PA), Italy; 2Institute of Biomedicine and Molecular Immunology “Alberto Monroy”- National Research Council (IBIM-CNR), Palermo, Italy; 3Nuclear Medicine, San Raffaele Scientific Institute, Milan, Italy; 4Nuclear Medicine Center, San Gerardo Hospital, Monza, Italy; 5Department of Health Sciences, Tecnomed Foundation, University of Milano-Bicocca, Milan, Italy Abstract. Background: Intraoperative electron radiation during IOERT boost and exclusive treatments, respectively) therapy (IOERT) is a therapeutic technique which administers by cDNA microarrays. Real-Time Quantitative Reverse a single high dose of ionizing radiation immediately after Transcription PCR (qRT-PCR), immunofluorescence and surgical tumor removal. IOERT induces a strong stress immunoblot experiments were performed to validate response: both tumor and normal cells activating pro- and candidate IOERT biomarkers. We also conducted clonogenic antiproliferative cell signaling pathways. Following treatment, tests and cellular senescence assays to monitor for radiation- several genes and factors are differently modulated, induced effects. Results: The analyses highlighted a producing an imbalance in cell fate decision. However, the transcriptome dependent on the dose delivered and a number contribution of these genes and pathways in conferring of specific key genes that may be proposed as new markers of different cell radiosensitivity and radioresistance needs to be radiosensitivity. Cell and molecular traits observed in MCF7 further investigated, in particular after high-dose treatments. cells revealed a typical senescent phenotype associated with Despite the documented and great impact of IOERT in breast cell proliferation arrest after treatments with 9- and 23-Gy cancer care, and the trend for dose escalation, very limited doses. Conclusion: In this study, we report genes and cellular data are available regarding gene-expression profiles and cell networks activated following high-dose IOERT. The selected networks activated by IOERT or high-dose treatment. The aim validated genes were used to design two descriptive models of the study was to analyze the main pathways activated for each dose delivered. We believe that this study could following high radiation doses in order to select for potential contribute to the understanding over the complex mechanisms new biomarkers of radiosensitivity or radioresistance, as well which regulate cell radiosensitivity and radioresistance in as to identify therapeutic targets useful in cancer care. order to improve personalized radiotherapeutic treatment. Materials and Methods: We performed gene-expression profiling of the MCF7 human breast carcinoma cell line after Intraoperative radiation therapy is a therapeutic technique which treatment with 9- and 23-Gy doses (conventionally used consists of administering a single high dose of ionizing radiation (IR) immediately after surgical removal of tumor to destroy the residual cancer cells that may be left in the tumor site. Indeed, this typically represents a site at high risk for recurrence. The This article is freely accessible online. rationale for the use of this segmental radiation therapy in place of whole-breast irradiation is based on the finding that *These Authors contributed equally to this study. approximately 85% of local relapses are confined to the same quadrant of the breast from which the primary tumor was Correspondence to: Luigi Minafra, e-mail: [email protected]; excised (1-4). Interest in intraoperative radiation therapy for Valentina Bravatà, e-mail: [email protected] breast cancer (BC) has increased in the last few years thanks to Key Words: Intraoperative electron radiation therapy, IOERT, the development of the partial breast irradiation strategy with ionizing radiation, IR, MCF7 breast cancer cells, microarray. the aim of avoiding tumor recurrence. Intraoperative electron 0250-7005/2015 $2.00+.40 2577 ANTICANCER RESEARCH 35: 2577-2592 (2015) Table I. Primer sequences used for Real-Time Quantitative Reverse Transcription PCR analyses of MCF7 cells treated with 9 Gy and 23 Gy. Gene symbol Full name Forward primer 5'>3' Reverse primer 5'>3' Template size (base pairs) ADAMTS9 ADAM metallopeptidase with thrombospondin tcgctccactgttcactgtc ctgttgagggctctctctgg 297 type 1 motif, 9 ADRB1 Adrenoceptor beta 1 ctccttcttctgcgagctgt agcacttggggtcgttgtag 266 ADRB2 Adrenoceptor beta 2 ctgctatgccaatgagacctg gtcttgagggctttgtgctc 272 C2CD2 C2 calcium-dependent domain containing 2 ggccgttaatatccagcccaa aagacgtggatgttcctcacc 252 CACNB2 Calcium channel, voltage-dependent, beta 2 subunit tcctatggttcggcagactc ttaccaatcgccctatccacc 286 Cav1 Caveolin 1, caveolae protein, 22kDa tctctacaccgttcccatcc tccaaatgccgtcaaaactgtg 219 CDC25C Cell division cycle 25C tctggccaaggaaagctcag cgacagtaaggcagccact 207 CDC42 Cell division cycle 42 cttctttgctgctgcttcctg ctgagcatcaggcaactcaag 224 CDKN1A/p21 Cyclin-dependent kinase inhibitor 1 cggcttcatgccagctactt tcaccctgcccaaccttaga 245 FAM49B Family with sequence similarity 49, member B gggacttcccaggagaaaag cagaagggtctgatggaagc 243 FAS FAS cell surface death receptor tcagtacggagttggggaag caggccttccaagttctgag 207 Fos FBJ murine osteosarcoma viral oncogene homolog caacttcattcccacggtcac tcccttcggattctccttttct 259 FosB FBJ murine osteosarcoma viral oncogene homolog B aacccaccctcatctcttcc acccttcgcttctcctcttc 265 H2AFX H2A histone family, member X cgggcgtctgttctagtgttt agtgattcgcgtcttcttgttg 293 HIST1H4E Histone cluster 1, H4e acatccagggcattaccaagc agagtgcgtccctgtctctt 216 HIST2H2AB Histone cluster 2, H2ab gagtacctgaccgcggaaatt aaagagcctttggggtgaatga 268 HIST2H2AC Histone cluster 2, H2ac tgtctggtcgtggcaaacaag ctgttcagttcctcgtcgttg 286 HISTH1B Histone cluster 1, H1b gcattaagctgggcctcaaga gctcttcgccacctttttgac 273 HISTH4B Histone cluster 1, H4b gataacatccaaggcatcacca gaggccattggaagaaaactga 266 ITPR1 Inositol 1,4,5-trisphosphate receptor, type 1 gatcctggaggcagtaacca ggacatcctctcccgaattga 226 JUN JUN proto-oncogene ccacgcaagagaagaaggac gaaaagtcgcggtcactcact 280 JUNB JUN B proto-oncogene cggcagctacttttctggtc cacgtggttcatcttgtgcag 261 LEF-1 Lymphoid enhancer-binding factor 1 agcagactggtttgcagtgaat gatgacagttttgggcaaaggc 211 LMNB1 Lamin B1 ccttcttcccgtgtgacagt cctcccattggttgatcctg 224 MMP9 Matrix metallopeptidase 9 gagaccggtgagctggata tacacgcgagtgaaggtgag 236 MOAP1 Modulator of apoptosis 1 cgcctgtggtctggcatattt cctcctgaacatccttccaag 222 NFKB Nuclear factor of kappa light polypeptide gene cagctggatgtgtgactgga gtgggggaaaaatctccaaa 136 enhancer in B-cells inhibitor, alpha NR3C1 Nuclear receptor subfamily 3, group C, member 1 actggctgtcgcttctcaatc tgctgaactcttggggttctc 289 (glucocorticoid receptor) NR4A3 Nuclear receptor subfamily 4, group A, member 3 tccgctcctcctacactctc tccatggtcagcttggtgtag 200 PLK1 Polo-like kinase 1 tgccacctcagtgacatgct cagtgccgtcacgctctatg 265 SNAI1 SNAIL family zinc finger 1 gcgagctgcaggactctaat ggacagagtcccagatgagc 135 TGFB2 Transforming growth factor, beta 2 gaccccacatctcctgctaa taagctcaggaccctgctgt 268 TNF Tumor necrosis factor ctatctgggaggggtcttc ggttgagggtgtctgaagga 201 radiation therapy (IOERT), using an electron linear accelerator, radioresistance on cancer cells in order to improve RT effects. according to specific eligibility criteria may be: exclusive with Both X-rays, mainly used in conventional external beam RT, the provision of a single radiation dose of 21-23 Gy and high-energy electrons generated by linear accelerators corresponding to the administration of the entire sequence of a induce a strong cellular stress response, which leads to an conventional adjuvant radiotherapy (RT), or an anticipated boost imbalance in survival versus cell death decisions (7, 8). of 9-12 Gy, followed by conventional external RT to guarantee Increasing evidence is revealing that induction of cell death is a for optimal accuracy in dose delivery (5, 6). very complex mechanism accounting for the different Although preliminary results of partial breast irradiation with therapeutic effects of IR (9, 10). Indeed, cell fate in response to IOERT, either as an anticipated boost or as exclusive treatment, IR is controlled by multiple signals that determine whether pro- seem be promising in terms of local disease control, little or antiproliferative factors that normally function in equilibrium information has been collected about the biological basis of the will ultimately predominate in response to the stress. Different effects of IOERT, in particular those regarding molecular stress IR-induced genes activate complex linked intracellular networks mechanisms (3, 4). To date, several radiobiology research regulating several processes, such as cell-cycle progression, cell groups have focused their studies on understanding the survival and death, DNA repair and inflammation (11-13). molecular mechanisms that confer radiosensitivity or However, the contribution of these genes and the signaling 2578 Bravatà et al: Gene Expression Response of MCF7 Cells Following IOERT Treatment Table II. PubMatrix analysis of selected validated genes. This table shows the number
Load more

Recommended publications
  • Product Data Sheet
    For research purposes only, not for human use Product Data Sheet HIST1H4E siRNA (Human) Catalog # Source Reactivity Applications CRH5487 Synthetic H RNAi Description siRNA to inhibit HIST1H4E expression using RNA interference Specificity HIST1H4E siRNA (Human) is a target-specific 19-23 nt siRNA oligo duplexes designed to knock down gene expression. Form Lyophilized powder Gene Symbol HIST1H4E Alternative Names H4/E; H4FE; Histone H4 Entrez Gene 8367 (Human) SwissProt P62805 (Human) Purity > 97% Quality Control Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency. Components We offers pre-designed sets of 3 different target-specific siRNA oligo duplexes of human HIST1H4E gene. Each vial contains 5 nmol of lyophilized siRNA. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. Our siRNA oligos are also chemically modified (2’-OMe) at no extra charge for increased stability and enhanced knockdown in vitro and in vivo. Directions for Use We recommends transfection with 100 nM siRNA 48 to 72 hours prior to cell lysis. Application key: E- ELISA, WB- Western blot, IH- Immunohistochemistry,
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Cancer TNT Ashwin Ram 12/5/2017 Background: Chromatin Writers, Readers, Erasers
    Cancer TNT Ashwin Ram 12/5/2017 Background: Chromatin Writers, Readers, Erasers writer effector eg. HAT, HMT reader eg. bromodomain eraser eg. HDAC, KDM The writer HAT1: A known H4 lysine 5,12 di-acetyltransferase writer siHAT1 siControl HAT1 H4 K12Ac H4 K5Ac actin Western blot for histone H4 modifications after control and HAT1 siRNA transfections. HAT1: EGF-stimulated immunoprecipitation specific specific - - HAT1 IgG HAT1 IgG - - R α non R α non EGF: + + + - - - WB: HAT1 Immunoprecipitation / WB to measure HAT1 levels +/- Heatmap of gene expression changes of all human histone EGF acetyltransferases +/- EGF and siRNA treatments shows HAT1 expression is EGF-dependent Working model of HAT1 : The oldest “new” histone acetyltransferase EGF EGFR plasma membrane HAT1 H4 H3 Rbap46/48 a nuclear membrane H4 H2A H3 H2B HAT1 S phase Surprise: HAT1 also binds (a few sites) on chromatin HAT1 ChipSeq signal sits on Hist1 locus on Chromosome 6 Read Depth HAT1 bound sites (zoom) HAT1 ChIP-seq peaks cluster at Read Depth histone H4 promoters. Hist1H2BE Hist1H4D Hist1H3D Hist1H4E Is HAT1 a transcription factor for its substrate (H4)? EGF EGFR plasma membrane HAT1 H4 H3 Rbap46/48 a nuclear membrane H4 H2A H3 H2B HAT1 S phase HAT1 is required for S-phase burst of histone H4 mRNA HAT1 Hist1H4B mRNA level 50 Rbap46 45 shCont-3 H4 40 shHAT1-A7 35 shHAT1-B6 30 25 B6 A7 - - 20 15 shHAT1 shHAT1 shControl 10 Gene actin)Expression (versus 5 HAT1 0 0 2 4 6 8 10 actin hours after release from double thymidine block G1 S G2/M HAT1 loss: Life with less histones EGF
    [Show full text]
  • (NM 001142939) Mouse Untagged Clone – MC215669
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MC215669 Gm20604 (NM_001142939) Mouse Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Gm20604 (NM_001142939) Mouse Untagged Clone Tag: Tag Free Symbol: Gm20604 Synonyms: AK010878-Moap1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >MC215669 representing NM_001142939 Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGCTTTCGGGCGAGTACGTCGGTTGTGACGGGGAGCCGCAGCGGCTACGAGTGTCCTGTGAGGCGT CGGGAGACGCGGACCCTCTCCAGAGCCTGTCGGCGGGCGTGGTCCGGATGAAGGAGTTGGTAGCGGAGTT CTTCGGGACCCTAGTGGAGCAGGACGCGCAAGGCTTGGCGGAAGATCCGGACGACGCTTTGGATGGCTCC CGGACCTCTGCGTGTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA Restriction Sites: SgfI-MluI ACCN: NM_001142939 Insert Size: 228 bp OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). RefSeq: NM_001142939.1, NP_001136411.1 RefSeq Size: 3835 bp RefSeq ORF: 228 bp This product is to be used for
    [Show full text]
  • The UVB-Induced Gene Expression Profile of Human Epidermis in Vivo Is Different from That of Cultured Keratinocytes
    Oncogene (2006) 25, 2601–2614 & 2006 Nature Publishing Group All rights reserved 0950-9232/06 $30.00 www.nature.com/onc ORIGINAL ARTICLE The UVB-induced gene expression profile of human epidermis in vivo is different from that of cultured keratinocytes CD Enk1, J Jacob-Hirsch2, H Gal3, I Verbovetski4, N Amariglio2, D Mevorach4, A Ingber1, D Givol3, G Rechavi2 and M Hochberg1 1Department of Dermatology, The Hadassah-Hebrew University Medical Center, Jerusalem, Israel; 2Department of Pediatric Hemato-Oncology and Functional Genomics, Safra Children’s Hospital, Sheba Medical Center and Sackler School of Medicine, Tel-Aviv University,Tel Aviv, Israel; 3Department of Molecular Cell Biology, Weizmann Institute of Science, Rehovot, Israel and 4The Laboratory for Cellular and Molecular Immunology, Department of Medicine, The Hadassah-Hebrew University Medical Center, Jerusalem, Israel In order to obtain a comprehensive picture of the radiation. UVB, with a wavelength range between 290 molecular events regulating cutaneous photodamage of and 320 nm, represents one of the most important intact human epidermis, suction blister roofs obtained environmental hazards affectinghuman skin (Hahn after a single dose of in vivo ultraviolet (UV)B exposure and Weinberg, 2002). To protect itself against the were used for microarray profiling. We found a changed DNA-damaging effects of sunlight, the skin disposes expression of 619 genes. Half of the UVB-regulated genes over highly complicated cellular programs, including had returned to pre-exposure baseline levels at 72 h, cell-cycle arrest, DNA repair and apoptosis (Brash et al., underscoring the transient character of the molecular 1996). Failure in selected elements of these defensive cutaneous UVB response.
    [Show full text]
  • Characterizing Novel Interactions of Transcriptional Repressor Proteins BCL6 & BCL6B
    Characterizing Novel Interactions of Transcriptional Repressor Proteins BCL6 & BCL6B by Geoffrey Graham Lundell-Smith A thesis submitted in conformity with the requirements for the degree of Master of Science Department of Biochemistry University of Toronto © Copyright by Geoffrey Lundell-Smith, 2017 Characterizing Novel Interactions of Transcriptional Repression Proteins BCL6 and BCL6B Geoffrey Graham Lundell-Smith Masters of Science Department of Biochemistry University of Toronto 2016 Abstract B-cell Lymphoma 6 (BCL6) and its close homolog BCL6B encode proteins that are members of the BTB-Zinc Finger family of transcription factors. BCL6 plays an important role in regulating the differentiation and proliferation of B-cells during the adaptive immune response, and is also involved in T cell development and inflammation. BCL6 acts by repressing genes involved in DNA damage response during the affinity maturation of immunoglobulins, and the mis- expression of BCL6 can lead to diffuse large B-cell lymphoma. Although BCL6B shares high sequence similarity with BCL6, the functions of BCL6B are not well-characterized. I used BioID, an in vivo proximity-dependent labeling method, to identify novel BCL6 and BCL6B protein interactors and validated a number of these interactions with co-purification experiments. I also examined the evolutionary relationship between BCL6 and BCL6B and identified conserved residues in an important interaction interface that mediates corepressor binding and gene repression. ii Acknowledgments Thank you to my supervisor, Gil Privé for his mentorship, guidance, and advice, and for giving me the opportunity to work in his lab. Thanks to my committee members, Dr. John Rubinstein and Dr. Jeff Lee for their ideas, thoughts, and feedback during my Masters.
    [Show full text]
  • Supplementary Materials
    Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine
    [Show full text]
  • Literature Mining Sustains and Enhances Knowledge Discovery from Omic Studies
    LITERATURE MINING SUSTAINS AND ENHANCES KNOWLEDGE DISCOVERY FROM OMIC STUDIES by Rick Matthew Jordan B.S. Biology, University of Pittsburgh, 1996 M.S. Molecular Biology/Biotechnology, East Carolina University, 2001 M.S. Biomedical Informatics, University of Pittsburgh, 2005 Submitted to the Graduate Faculty of School of Medicine in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Pittsburgh 2016 UNIVERSITY OF PITTSBURGH SCHOOL OF MEDICINE This dissertation was presented by Rick Matthew Jordan It was defended on December 2, 2015 and approved by Shyam Visweswaran, M.D., Ph.D., Associate Professor Rebecca Jacobson, M.D., M.S., Professor Songjian Lu, Ph.D., Assistant Professor Dissertation Advisor: Vanathi Gopalakrishnan, Ph.D., Associate Professor ii Copyright © by Rick Matthew Jordan 2016 iii LITERATURE MINING SUSTAINS AND ENHANCES KNOWLEDGE DISCOVERY FROM OMIC STUDIES Rick Matthew Jordan, M.S. University of Pittsburgh, 2016 Genomic, proteomic and other experimentally generated data from studies of biological systems aiming to discover disease biomarkers are currently analyzed without sufficient supporting evidence from the literature due to complexities associated with automated processing. Extracting prior knowledge about markers associated with biological sample types and disease states from the literature is tedious, and little research has been performed to understand how to use this knowledge to inform the generation of classification models from ‘omic’ data. Using pathway analysis methods to better understand the underlying biology of complex diseases such as breast and lung cancers is state-of-the-art. However, the problem of how to combine literature- mining evidence with pathway analysis evidence is an open problem in biomedical informatics research.
    [Show full text]
  • An Investigation of 53BP1 in Multiple Myeloma
    University of Calgary PRISM: University of Calgary's Digital Repository Graduate Studies The Vault: Electronic Theses and Dissertations 2017 An Investigation of 53BP1 in Multiple Myeloma Simms, Justin Simms, J. (2017). An Investigation of 53BP1 in Multiple Myeloma (Unpublished master's thesis). University of Calgary, Calgary, AB. doi:10.11575/PRISM/24911 http://hdl.handle.net/11023/4002 master thesis University of Calgary graduate students retain copyright ownership and moral rights for their thesis. You may use this material in any way that is permitted by the Copyright Act or through licensing that has been assigned to the document. For uses that are not allowable under copyright legislation or licensing, you are required to seek permission. Downloaded from PRISM: https://prism.ucalgary.ca UNIVERSITY OF CALGARY An Investigation of 53BP1 in Multiple Myeloma by Justin Andrew Simms A THESIS SUBMITTED TO THE FACULTY OF GRADUATE STUDIES IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE GRADUATE PROGRAM IN MEDICAL SCIENCE CALGARY, ALBERTA JULY, 2017 © Justin Andrew Simms 2017 Abstract Currently, multiple myeloma is the second most common hematological malignancy, and as of yet it remains incurable. Although many therapeutic advances have been made in the recent past, there is still room for improvement in the treatment of myeloma. Here, using CRISPR/Cas9 genome editing, we show that a therapeutic combination of proteasome inhibition in combination with PARP inhibition that is in clinical trials depends on the DNA damage response protein 53BP1. These findings contribute to the understanding of the mechanisms behind potential resistance to the combination of proteasome inhibitors with PAPR inhibitors.
    [Show full text]
  • Regulation of DNA Replication-Coupled Histone Gene Expression
    www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 55), pp: 95005-95022 Review Regulation of DNA replication-coupled histone gene expression Qianyun Mei1,*, Junhua Huang1,*, Wanping Chen1,2, Jie Tang1, Chen Xu1, Qi Yu1, Ying Cheng1, Lixin Ma1,2, Xilan Yu1,2 and Shanshan Li1,2 1Hubei Collaborative Innovation Center for Green Transformation of Bio-Resources, Hubei Key Laboratory of Industrial Biotechnology, College of Life Sciences, Hubei University, Wuhan, Hubei 430062, China 2Hubei Key Laboratory of Industrial Biotechnology, College of Life Sciences, Hubei University, Wuhan, Hubei 430062, China *These authors have contributed equally to this work Correspondence to: Xilan Yu, email: [email protected] Shanshan Li, email: [email protected] Keywords: DNA replication, histone gene transcription, cell cycle Received: August 08, 2017 Accepted: September 20, 2017 Published: October 16, 2017 Copyright: Mei et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License 3.0 (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT The expression of core histone genes is cell cycle regulated. Large amounts of histones are required to restore duplicated chromatin during S phase when DNA replication occurs. Over-expression and excess accumulation of histones outside S phase are toxic to cells and therefore cells need to restrict histone expression to S phase. Misregulation of histone gene expression leads to defects in cell cycle progression, genome stability, DNA damage response and transcriptional regulation. Here, we discussed the factors involved in histone gene regulation as well as the underlying mechanism.
    [Show full text]
  • Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts
    Role and regulation of the p53-homolog p73 in the transformation of normal human fibroblasts Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Lars Hofmann aus Aschaffenburg Würzburg 2007 Eingereicht am Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Dr. Martin J. Müller Gutachter: Prof. Dr. Michael P. Schön Gutachter : Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am Erklärung Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig angefertigt und keine anderen als die angegebenen Hilfsmittel und Quellen verwendet habe. Diese Arbeit wurde weder in gleicher noch in ähnlicher Form in einem anderen Prüfungsverfahren vorgelegt. Ich habe früher, außer den mit dem Zulassungsgesuch urkundlichen Graden, keine weiteren akademischen Grade erworben und zu erwerben gesucht. Würzburg, Lars Hofmann Content SUMMARY ................................................................................................................ IV ZUSAMMENFASSUNG ............................................................................................. V 1. INTRODUCTION ................................................................................................. 1 1.1. Molecular basics of cancer .......................................................................................... 1 1.2. Early research on tumorigenesis ................................................................................. 3 1.3. Developing
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 7.873,482 B2 Stefanon Et Al
    US007873482B2 (12) United States Patent (10) Patent No.: US 7.873,482 B2 Stefanon et al. (45) Date of Patent: Jan. 18, 2011 (54) DIAGNOSTIC SYSTEM FOR SELECTING 6,358,546 B1 3/2002 Bebiak et al. NUTRITION AND PHARMACOLOGICAL 6,493,641 B1 12/2002 Singh et al. PRODUCTS FOR ANIMALS 6,537,213 B2 3/2003 Dodds (76) Inventors: Bruno Stefanon, via Zilli, 51/A/3, Martignacco (IT) 33035: W. Jean Dodds, 938 Stanford St., Santa Monica, (Continued) CA (US) 90403 FOREIGN PATENT DOCUMENTS (*) Notice: Subject to any disclaimer, the term of this patent is extended or adjusted under 35 WO WO99-67642 A2 12/1999 U.S.C. 154(b) by 158 days. (21)21) Appl. NoNo.: 12/316,8249 (Continued) (65) Prior Publication Data Swanson, et al., “Nutritional Genomics: Implication for Companion Animals'. The American Society for Nutritional Sciences, (2003).J. US 2010/O15301.6 A1 Jun. 17, 2010 Nutr. 133:3033-3040 (18 pages). (51) Int. Cl. (Continued) G06F 9/00 (2006.01) (52) U.S. Cl. ........................................................ 702/19 Primary Examiner—Edward Raymond (58) Field of Classification Search ................... 702/19 (74) Attorney, Agent, or Firm Greenberg Traurig, LLP 702/23, 182–185 See application file for complete search history. (57) ABSTRACT (56) References Cited An analysis of the profile of a non-human animal comprises: U.S. PATENT DOCUMENTS a) providing a genotypic database to the species of the non 3,995,019 A 1 1/1976 Jerome human animal Subject or a selected group of the species; b) 5,691,157 A 1 1/1997 Gong et al.
    [Show full text]