University of Calgary PRISM: University of Calgary's Digital Repository
Graduate Studies The Vault: Electronic Theses and Dissertations
2017 An Investigation of 53BP1 in Multiple Myeloma
Simms, Justin
Simms, J. (2017). An Investigation of 53BP1 in Multiple Myeloma (Unpublished master's thesis). University of Calgary, Calgary, AB. doi:10.11575/PRISM/24911 http://hdl.handle.net/11023/4002 master thesis
University of Calgary graduate students retain copyright ownership and moral rights for their thesis. You may use this material in any way that is permitted by the Copyright Act or through licensing that has been assigned to the document. For uses that are not allowable under copyright legislation or licensing, you are required to seek permission. Downloaded from PRISM: https://prism.ucalgary.ca UNIVERSITY OF CALGARY
An Investigation of 53BP1 in Multiple Myeloma
by
Justin Andrew Simms
A THESIS
SUBMITTED TO THE FACULTY OF GRADUATE STUDIES
IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE
DEGREE OF MASTER OF SCIENCE
GRADUATE PROGRAM IN MEDICAL SCIENCE
CALGARY, ALBERTA
JULY, 2017
© Justin Andrew Simms 2017 Abstract
Currently, multiple myeloma is the second most common hematological malignancy, and as of yet it remains incurable. Although many therapeutic advances have been made in the recent past, there is still room for improvement in the treatment of myeloma. Here, using CRISPR/Cas9 genome editing, we show that a therapeutic combination of proteasome inhibition in combination with
PARP inhibition that is in clinical trials depends on the DNA damage response protein 53BP1.
These findings contribute to the understanding of the mechanisms behind potential resistance to the combination of proteasome inhibitors with PAPR inhibitors.
ii Table of Contents
Abstract ...... ii Table of Contents ...... iii List of Tables ...... v List of Figures and Illustrations ...... vi List of Symbols, Abbreviations and Nomenclature ...... viii
CHAPTER ONE: INTRODUCTION ...... 12 1.1 Multiple Myeloma ...... 12 1.2 Multiple Myeloma and Genome Instability ...... 13 1.3 Bortezomib ...... 15 1.4 Poly-ADP-Ribose Polymerase Inhibitors ...... 16 1.5 Double Stranded Break Repair ...... 17 1.5.1 Canonical non-homologous end joining double strand break repair ...... 18 1.5.2 Alternative end joining double strand break repair...... 19 1.5.3 Homologous recombination double strand break repair ...... 22 1.6 53BP1 recruitment and displacement ...... 26 1.6.1 53BP1 Recruitment ...... 26 1.6.2 53BP1 Displacement/Antagonism ...... 27 1.6.2.1 H4K16 acetylation and 53BP1 antagonism ...... 27 1.6.2.2 Ubiquitin and 53BP1 antagonism ...... 28 1.6.2.3 RIF1 antagonism to facilitate pathway switch ...... 29 1.7 Multiple Myeloma, bortezomib and PARP inhibitors ...... 30 1.7.1 Previous work from Bahlis lab: Neri et al. 2011 ...... 30 Hypothesized mechanism of action for PI and PARPi combination therapy in MM33 1.8 Experimental Aims: ...... 38
CHAPTER TWO: MATERIALS AND METHODS ...... 39 2.1 Antibodies, Plasmids, Primers, and Cell lines: ...... 39 2.2 Cell culture methods ...... 41 2.3 Lentiviral infection with sh53BP1 containing LV particles ...... 42 2.4 Cloning of CRISPR/Cas9 Constructs ...... 42 2.5 CRISPR/Cas9 packaging of lentiviral plasmids and lentiviral infection: ...... 43 2.6 Immunofluorescence Assays ...... 44 2.7 Western Blots ...... 46 2.7.1 Cell lysis buffers ...... 47 2.7.1.1 RIPA ...... 47 2.7.1.2 NP-40 (Ines) ...... 47 2.7.1.3 Hypotonic lysis buffer...... 47 2.8 RT-PCR and qPCR for transcript expression analysis ...... 48 2.9 RNA-seq Analysis ...... 48 2.9.1 Sequence Acquisition...... 48 2.9.2 Sequence Alignment ...... 48 2.9.3 Protein family gene acquisition ...... 49
iii 2.10 Surveyor Mutation Detection Assay ...... 49 2.11 Cell viability Assays ...... 50
CHAPTER THREE: ANALYSIS OF MM CELL LINES FOR MUTATIONS IN HISTONES AND DNA REPAIR PROTEINS ...... 51
CHAPTER FOUR: GENE EDITING USING CRISPR/CAS9...... 58 4.1 Using shRNA to silence 53BP1 in MM ...... 58 4.2 Using TALEN to generate 53BP1-/- MM cell lines ...... 61 4.2.1 TALEN mechanism of action and design to target 53BP1 ...... 61 4.2.2 Detection of mutation by SURVEYOR Mutation Detection assay ...... 65 4.2.3 Unsuccessful mutation of 53BP1 by TALEN ...... 66 4.3 Employing the CRISPR/Cas9 genome editing technique to knock-out 53BP1 ....70 4.3.1 CRISPR/Cas9 instead of TALEN? ...... 70 4.3.2 CRISPR/Cas9 mechanism of action ...... 70 4.3.3 Using CRISPR/Cas9 to edit 53BP1 and RNF168 ...... 73 4.3.3.1 pLENTICRISPRv2 CRISPR/Cas9 of 53BP1 ...... 73 4.3.3.2 pLENTICRISPRv2 targeting RNF168 in OPM2 ...... 85 4.4 Revisiting CRISPR/Cas9 editing of 53BP1 ...... 87 4.4.1 Using pSp-Cas9(BB)-2A-GFP to edit 53BP1...... 87 4.5 Other CRISPR/Cas9 targets that were unsuccessful ...... 98 4.6 Other CRISPR/Cas9 targets that were successful ...... 101
CHAPTER FIVE: 53BP1 AND MULTIPLE MYELOMA ...... 103 5.1 High RNF168 expression levels does not correlate with an increase in basal levels of 53BP1 foci in MM ...... 116 5.2 RNF168 loss does not confer resistance to synergy seen with concomitant treatment of MM with ABT-888 and BTZ ...... 121 5.3 53BP1 is necessary for the synergistic activity of PI and PAPRi in MM...... 124
CHAPTER SIX: DISCUSSION AND FUTURE DIRECTIONS ...... 128
REFERENCES ...... 131
SUPPLEMENTARY MATERIALS ...... 141
iv List of Tables
Table 1-1: Classification of MM by genetic alterations ...... 14
Table 1-2: Known DNA repair pathways ...... 25
Table 2-1: List of antibodies used for experiments detailed herein...... 39
Table 2-2: Cloning primers made to generate CRISPR/Cas9 mediated gene editing. These primers were inserted into pLENTICRISPRv2, pLentiGuide-Puro or pSpCas9(BB)-2A- GFP...... 40
Table 2-3: Plasmids used for experiments described herein...... 41
Table 3-1: Analysis of histone variants for expression and mutation ...... 53
Table 3-2: Sequence analysis of DNA repair proteins...... 56
Table 4-1 Screening for 53BP1 knock-outs by immunofluorescence ...... 92
Table 5-1: Foci per cell in U2OS cells irradiated after pre-treatment with BTZ at varying dosages ...... 106
Table 5-2: Foci per cell in MM1S cells irradiated after pre-treatment with BTZ at varying dosages ...... 108
v List of Figures and Illustrations
Figure 1-1: Simplified schematic of NHEJ mediated DSB repair in G0/G1 phase ...... 21
Figure 1-2: Simplified schematic of HR mediated DSB repair in S/G2 phase ...... 24
Figure 1-3: Diagram of PARPi and BTZ combination therapy model ...... 32
Figure 1-4: Schematic representation of how BRCA1-/- cells gain resistance to PARPi by loss of 53BP1 ...... 35
Figure 1-5: Proteasome inhibition abrogates 53BP1 foci formation in U2OS cells but not MM1S cells ...... 36
Figure 1-6: Schematic representation of predicted mechanism of action of PI and PARPi combination’s synthetic lethality in MM ...... 37
Figure 3-1: IGV sequence alignment of a mutation in H3.5...... 52
Figure 4-1: shRNA targeting 53BP1 verification of knock-down ...... 60
Figure 4-2: Design of recognition sequences for TALEN and CRISPR/Cas9 targeting 53BP1 .. 64
Figure 4-3: Schematic representation of the SURVEYOR Mutation Detection Assay ...... 66
Figure 4-4: SURVEYOR assay for mutation of 53BP1 by TALEN ...... 69
Figure 4-5: Mechanism of CRISPR/Cas9 genome editing ...... 72
Figure 4-6: Single cell sorting of suspension cells ...... 75
Figure 4-7: CRISPR 53BP1 Exon2 verification of mutation and knockout ...... 76
Figure 4-8: Testing of 53BP1 antibody specificity by western blot ...... 79
Figure 4-9: Testing of 53BP1 specificity by immunofluorescence ...... 84
Figure 4-10: Verification of OPM2RNF168-/- CRISPR knock-out ...... 86
Figure 4-11: Schematic of CRISPR/Cas9 editing process for cells transfected with pSp- Cas9(BB)-2A-GFP ...... 90
Figure 4-12: Technique for screening CRISPR/Cas-9 edited cells for IRIF ability ...... 91
Figure 4-13: Verification of gene editing of 53BP1 by CRISPR/Cas9 in MM1S cells ...... 97
Figure 4-14: Western blot analyses for CRISPR infected cells – unsuccessful ...... 100
vi Figure 4-15: Successful CRISPR/Cas9 gene editing for other projects...... 102
Figure 5-1 The effects of BTZ on γ-irradiation induced 53BP1 foci in U2OS ...... 107
Figure 5-2 The effects of BTZ on γ-irradiation induced 53BP1 foci in MM ...... 109
Figure 5-3: Effects of BTZ on IR induced 53BP1 and poly-Ub localization ...... 113
Figure 5-5: Mutagenesis and expression of FLAG-H2A Constructs ...... 114
Figure 5-6: Western blot analysis of H2A and H2AX in response to IR in MM1S cells ...... 115
Figure 5-7: Relative expression of RNF168 in various MM cell lines ...... 118
Figure 5-7: RNF168 expression analysis in MM cell lines ...... 119
Figure 5-9: Analysis of 53BP1 and γH2AX foci in MM cell lines H929 and KMS18 ...... 120
Figure 5-10: FACS analysis of cell viability in OPM2WT and OPM2RNF168-/- cells treated with BTZ and ABT-888 ...... 123
Figure 5-10: FACS analysis of cell viability in MM1SWT and MM1SC50 cells treated with BTZ and ABT-888 ...... 127
Supplemental Figure 7-1: FACS analysis of MM cell lines KMS11 and OPM2 treated with BTZ and ABT-888 ...... 141
Supplementary Figure 7-2: FACS analysis of MM1SWT, MM1SC3, MM1SC19, and MM1SC50 cell lines treated with BTZ and ABT-888 (48 Hours) ...... 142
Supplementary Figure 7-3: FACS analysis of MM1SWT, MM1SC3, MM1SC19, and MM1SC50 cell lines treated with BTZ and ABT-888 (24 Hours) ...... 143
Supplementary Figure 7-4: FACS analysis of cell viability in OPM2WT and OPM2RNF168-/- cells treated with BTZ and ABT-888 ...... 144
Supplementary Figure 7-5: FACS analysis of MM1S cells treated with BTZ and ABT-888 .... 145
vii List of Symbols, Abbreviations and Nomenclature
Symbol/Abbr Definition MM multiple myeloma IgH immunoglobluin heavy chain IgL immunoglobulin light chain MGUS monoclonal gammopathy of undetermined significance IMiD immunomodulatory drug PI proteasome inhibitor BTZ bortezomib MMSET multiple myeloma SET domain containing protein MS MMSET class MF MAF class CD1 CCND1 class CD2 CCND3 class HY hyperdiploid class LB low bone disease class TP53 tumor protein 53 PCL plasma cell lymphoma DNA deoxyribonucleic acid HAT histone acetyl transferase H2A histone 2A H2B histone 2B H3 histone 3 H4 histone 4 OE overexpression DNMT3A DNA methyltransferase 3A DNMT3B DNA methyltransferase 3B PARP poly-ADP-ribose polymerase PARPi poly-ADP-ribose polymerase inhibitor FDA Food and Drug Administration NFκB nuclear factor κB IκB inhibitor of κB IL-6 interleukin 6 VEGF vascular endothelial growth factor HIF1α hypoxia inducible factor 1α DKK1 dikkopf related protein 1 p21 protein expressed by p21 gene p27 protein expressed by p27 gene viii p53 protein expressed by p53 gene JNK c-Jun N-terminal kinase SAPK stress activated protein kinase UPR ubiquitin proteasome response ER endoplasmic reticulum ROS reactive oxygen species ADP adenosine diphosphate PAR poly-ADP-ribose BER base excision repair BRCA1 breast cancer 1 BRCA2 breast cancer 2 HR homologous recombination BAP1 BRCA1 associated protein 1 FA Fanconi Anemia PALB2 partner and localizer of BRCA2 NBS1 nibrin WRN Werner syndrom RecQ like helicase BRIP1 BRCA1 interacting protein 1 BLM Bloom helicase DDR DNA damager response DSB double-strand break NHEJ non-homologus end joining CNHEJ canonical non-homologous end joining Alt-EJ alternative end joining Alt-NHEJ alternative non-homologous end joining Ku70/Ku80 ku70 and ku80 heterodimer DNA-PKcs DNA protein kinase catalytic subunit PNKP poly-nucleotide kinase phosphatase XLF non-homologous end joining protein 1 XRCC4 x-ray repair cross compliment 4 MRN Mre11 Rad50 Nbs1 complex CtIP CTBP interacting protein γΗ2ΑΧ phosphorylated histone H2AX at S139 MDC1 mediator of DNA damage checkpoint 1 ATM ataxia telangiectasia mutated RNF8 ring finger protein 8 RNF168 ring finger protein 168 K48 lysine 48 K63 lysine 63 PTM post-translational modification
ix 53BP1 tumor protein 53 binding protein 1 RIF1 RAP1 interacting factor PTIP PAX transactivation domain protein ssDNA single-stranded DNA dsDNA double-stranded DNA Exo1 exonuclease 1 CDK cyclin dependent kinase RPA replication protein A Rad51 Rad51 recombinase NER nucleotide excision repair MMR mis-match repair SSBR single-stranded break response HDR homology directed repair SSA single-stranded annealing H4K20me2 histone 4 dimethylated lysine 20 UDR ubiquitin determining region H4K16-Ac histone 4 acetylated lysine 16 H2A(X)K15/13- Ub histone 2A(X) ubiquitinated lysine 13 or 15 Ub ubiquitin L3MBTL1 lethal malignant brain tumor L3-1 KDM4A lysine specific demethylase 4A JMJD2A jumonji C domain containing protein 2A HDAC1 histone deacetylase 1 HDAC2 histone deacetylase 2 TIP60 tat interacting protein 60 kDa MBTD1 MBT domain containing protein 1 IRIF ionizing radiation induced foci DUB deubiquitinase OUT domain containing ubiquitin aldehyde binding protein OTUB1 1 RNF169 ring finger protein 169 KEAP1 Kelch-like ECH associated protein ABT-888 Abbot laboratories 888 CSR class switch recombination V(D)J variable domain junction SMH somatic hypermutation IGV integrated genome browser RNA-seq ribonucleic acid sequencing RNA ribonucleic acid
x H3.5 histone 3 variant 3.5 USCS University of California, Santa Cruz Hg19 human genome 19 KAT5 lysine acetyl transferase 5 PSMD14 proteasome 26s subunit non-ATPase 14 HECT and RLD domain containing E3 ubiquitin protein HERC2 ligase 2 BARD1 BRCA1 associated RING domain 1 BACH1 BTB domain and CNC homolog 1 ABRAXAS Abraxas protein RAP80 receptor associated protein 80 RIP1 receptor interacting serine threonin kinase 1 LV lentiviral mRNA messenger RNA RT-qPCR reverse-transcriptase quantitative polymerase chain reaction
xi 8======D
CHAPTER ONE: Introduction
1.1 Multiple Myeloma
Multiple myeloma (MM) is a hematological malignancy derived from plasma cells. The most prominent risk factor for MM is age and the presentation of the disease usually begins with the appearance of monoclonal gammopathy of undetermined significance (MGUS) – a pre-malignant state where excess amounts of the immunoglobin heavy chain (IgH) and immunoglobin light chain (IgL) proteins can be detected, but the neoplasia is usually not symptomatic. MGUS can progress to smoldering MM, a condition similar to MGUS, however, with an increased tumor burden and likelihood of progression to MM. In some severe cases, plasma cell leukemia (PCL), an aggressive form of plasma cell lymphoproliferative disorders, can arise from MM as part of relapsed/refractory progression of the disease (1). Clinically, it is characterized by a number of pathologies and significant symptoms; characteristic bone marrow pathology, a high level of immunoglobulin proteins (β-2-microglobulin and λ/κ light chain) in the serum and urine, immunoparesis, and osteolytic bone lesions are the most classic presentations of the disease
(2). It is also common for MM patients to have secondary symptoms such as chronic infections, anemia, hypercalcemia, and pathological fractures (2). The Canadian Cancer
Society and American Cancer Society estimate that in Canada and the United States,
30,000 people will be newly diagnosed with MM and approximately 15,000 MM patients will succumb to this disease in 2015 (3, 4).
12 8======D
The treatment of MM has made tremendous strides in the past twenty years. In early 1990s the survival of a MM patient was three years, at best. Since the 1990’s the development of novel therapeutic agents and use of autologous stem cell transplants have drastically improved the clinical outcome of MM. (reviewed in (5)). Immunomodulatory drugs
(IMiDs) were first introduced as MM therapeutics in 1999 and have been successful in targeting plasma cell biology to manage this disease (6). Proteasome inhibitors (PIs) have also come to the clinic in the past decade as myeloma specific therapeutics. Bortezomib
(BTZ) was the inaugural PI and today there are a number of second generation PI’s in use or development (reviewed in (7)).
Unfortunately, drug resistance and progression of the disease are currently inevitable and despite an exemplary effort to combat MM it remains incurable. It is due to this that novel therapeutic strategies will be necessary in the cure of MM.
1.2 Multiple Myeloma and Genome Instability
Genomic studies of MM have identified a high level of genomic instability in MM. Many characteristic and complex genetic rearrangements occur frequently in MM. Translocations at the switch regions of the IgH and IgL loci and gains/losses of entire chromosomes have enabled researchers to classify MM into 7 classes: MMSET (MS), MAF (MF), CCND1
(CD1), CCND3 (CD2), Hyperdiploid (HY), Low bone disease (LB) (
Table 1-1)(8).
13 8======D
In addition to common IgH translocations, aneuploidy, deletion of TP53, epigenetic alterations, and MYC amplifications/translocations, occur frequently in MM patients (9–
21). Interestingly, the rearrangements that juxtapose a gene with the Ig locus are often early events that occur during the benign disease MGUS and they are carried through tumor progression to MM and PCL (22). Although this suggests that translocations to the IgH locus are not drivers of progression from MGUS to MM, understanding the factors that lead to errors in class switch recombination (CSR), somatic hypermutation (SMH), and
V(D)J recombination would be beneficial in understanding the pre-symptomatic initiation of this disease.
Table 1-1: Classification of MM by genetic alterations MM classes as defined by Zhan et al. (23) * Indicates class associated with poor prognosis. (24)
Class Name Genetic Change MS* MMSET/FGFR3 t4;14 MF* MAF/MAFB t14;16 and t14;20 CD1 CCND1 t11;14 q13;q32 CD2 CCND3 t16;14 q21;q32 HY Hyperdiploid trisomy 3,5,7,9,11,15,19,21 LB low bone disease low expression of bone disease related genes PR* proliferation high expression of progression/proliferation genes
Epigenetically, DNA methylation patterns are known to be irregular in MM, when compared to healthy plasma cells. The translocation t4:14, which juxtaposes the IgH locus to MMSET, a histone methyltransferase, results in increases in H3K36 methylation; it is unclear what role MMSET plays in tumor survival/progression (20, 25). Overexpression
14 8======D
(OE) of DNA methyltransferase 3 A and B (DNMT3A/B) have also been reported (26–
28).
Genetic alterations and genomic instability in MM have been extensively reviewed in (22,
29).
Finally, chromothripsis has also been reported to occur in a small number of MM samples
(30). The genetic instability of this disease is likely one of the important characteristics of the disease that allows it to overcome drug sensitivity (31). To strengthen this argument, genetic analysis of high-risk MM patients indicated that, compared to standard risk MM patients, they have a heightened level of genetic changes over time (32). However, the inherent genomic instability of MM may also be exploitable and targeting MM with DNA repair inhibiting drugs, such as poly-ADP-ribose polymerase inhibitors (PARPi), may prove clinically effective (33, 34).
1.3 Bortezomib
Bortezomib is a dipeptide boronic acid which reversibly inhibits the catalytic activity of the proteasome by a direct interaction between the boronic acid of BTZ and the chemotryptic β5 subunit of the 20S proteasome (35). BTZ was the first proteasome inhibitor to be used in human clinical trials. BTZ was first synthesized by Myogenics in
1995, later being purchased by Millennium Pharmaceuticals in 1999 and was used in its’ first clinical trial. (36, 37) The US Food and Drug Administration (FDA) approved the use
15 8======D of BTZ to treat newly diagnosed and relapsed/refractory MM in 2003, after showing promising results (38).
The therapeutic activity of BTZ has been shown to be a result of the effect it has on numerous different cellular activities such as: NFκB downregulation via inhibition of IκB, inhibition of pro-growth proteins (eg. IL-6, VEGF, HIF-1α, and DKK-1), stabilization of pro-apoptotic proteins (Bim, Bik, Noxa, Bax, p21, p27 and p53), osteoclast inhibition, pro- apoptotic signalling by JNK/SAPK induction, interference of MM and bone marrow stromal cell interaction, accumulation of poly-ubiquitinated proteins and unfolded protein response (UPR) induction, endoplasmic reticulum (ER) stress response, and generation of reactive oxygen species (ROS) (39).
1.4 Poly-ADP-Ribose Polymerase Inhibitors
The canonical role of poly-ADP-ribose polymerase (PARP) 1 and 2 is catalyzing the poly-
ADP-ribosylation of chromatin and proteins at the site of nucleotide bases that have been modified by alkylation, oxidation, deamination and depurination. These genomic lesions occur at an approximate rate of 5000, 1500, 500, and 10000 lesions per cell per day, respectively (40). The addition of PAR (poly-ADP-ribose) polymers at these lesions acts as a signalling event to activate the base-excision repair (BER) pathway, however, the use of PARP1 and PARP2 inhibitors results in these lesions being unresolved (41–43). When the DNA replication fork encounters an unresolved lesion it may stall and/or collapse and a double-stranded DNA break (DSB) may be generated (44). Normally, this type of DNA
16 8======D damaging event would be repaired by the homologous recombination repair mechanism
(HR) (45). In 2005, two independent groups were able to show that the use of PARP inhibitors were synthetically lethal in breast and ovarian cancers that harbored familial mutations in the breast and ovarian cancer susceptibility genes 1 and 2 (BRCA1 and
BRCA2) (42, 44). In the absence of functional HR, as is the case in BRCA1 and BRCA2 null mutants, there occurs an accumulation of DSBs which results in genomic instability, cell-cycle arrest and apoptosis (42, 44). Although these are specific examples relating to
BRCA1 and BRCA2, the concept of “BRCAness” has been used to describe instances where an HR defect is present in cells that do not harbor BRCA1/2 defects. BRCAness has been associated with the loss/mutation of other HR proteins (eg. BAP1, FA proteins,
PALB2, NBS1, WRN, RAD51, BRIP1, BLM) that may also benefit from PARP inhibition if defective (42, 46, 47).
1.5 Double Stranded Break Repair
There are numerous different DNA repair pathways that exist to monitor and protect the integrity of the genome. The DNA damage response (DDR) refers to multiple different biochemical pathways that are each uniquely equipped to respond to and repair the long list of genotoxic lesions that occur to our genetic material. Table 1-2 summarizes the different pathways, and the specific type(s) of genetic lesions that each pathway deals with
(see reference (40) for a detailed review). Most relevant to this body of work are the two main DSB repair pathways: non-homologous end joining (NHEJ), and homologous recombination.
17 8======D
NHEJ is active at all stages of the cell cycle, and acts to quickly ligate broken DNA ends .
HR, however, is only active during mid-late S phase and G2 as it requires a sister chromatid to use as a template for repair of genetic lesions (48, 49). Currently, it is thought that these two pathways are constantly competing with one another, depending on the stage of the cell cycle, and their interplay is a delicate balance of signaling events (50).
1.5.1 Canonical non-homologous end joining double strand break repair
NHEJ DSB repair has two facets: canonical NHEJ (C-NHEJ), and non-canonical NHEJ
(alt-EJ; also known as alt-NHEJ). C-NHEJ is significantly more simplistic than alt-EJ, however, both pathways serve the same purpose; they both simply ligate broken DNA ends together with minimal processing of the DNA.
C-NHEJ is relatively fast cascade of events where within seconds the Ku70/Ku80 heterodimer sense and bind to the ends DSBs, and activates DNA protein kinase catalytic subunit (DNA-PKcs) which functions to stabilize the broken DNA ends and recruit downstream NHEJ repair factors (51, 52). ARTEMIS, and poly-nucleotide kinase 3’- phosphatase (PNKP) are recruited by DNA-PKcs for processing of non-ligatable end groups such as 5’ hydroxyls and 3’ phosphates; after ligatable end groups are established, ligation is carried out by the non-homologous end joining factor 1 (XLF), x-ray repair cross complementing 4 (XRCC4) and DNA ligase IV complex (51).
18 8======D
1.5.2 Alternative end joining double strand break repair
C-NHEJ is not always adequate to repair complex DNA lesions, and in other cases the
Ku70/80 heterodimer may be beat to the punch by other DSB sensing proteins such as the
Mre11-Rad50-Nbs1 (MRN) complex and PARP (53). The DSB signal transduction pathway (in the event that a DSB is not repaired by C-NHEJ) is complex and requires many levels of regulation. Importantly, many of the steps upstream of final DSB resolution are identical for both alt-EJ, and HR. When C-NHEJ fails to repair a DNA break it is MRN complex or PARP1/2 that first respond to the DNA break, nucleolytic activity of Mre11 or
CTBP interacting protein (CtIP) are responsible for trimming 5-20 nucleotides from the
DSB, committing the DSB to alt-EJ. Phosphorylation of histone 2A variant H2AX on S139
(γH2AX) by activated ataxia telangiectasia mutated (ATM) sets the stage for DDR signalling propagation (54, 55). Concomitant dephosphorylation of T142 of H2AX allows for recruitment of mediator of DNA damage checkpoint protein 1 (MDC1) to the DSB
(56). MDC1 and the MRN complex act to tether ATM to the DSB site, and facilitate the recruitment of the E3 ubiquitin ligases RNF8 and RNF168 (ring finger proteins 8 and 168)
(57–61). RNF8 and RNF168 coordinate K-48 and K-63 linked ubiquitinylation of a number of proteins at DSB sites. H2A and H2AX ubiquitinylation on lysine 13/15 is carried out by
RNF8 and RNF168, which is a necessary nucleosome post translational modification
(PTM) for tumor suppressor TP53 binding protein 1 (53BP1) recruitment (62). Recently,
(53BP1) has been shown to be a key regulator in suppressing HR during G1 phase by restricting the amount of end resection that occurs and thereby promoting NHEJ/alt-EJ
(63–67). 53BP1 recruits RAP1-interacting factor (RIF1) and PAX transactivation domain
19 8======D interacting protein (PTIP), in an ATM-dependent manner, in order to be effective at blocking HR (68–77). It is at this point, when 53BP1 RIF1 and PTIP have assembled at a
DNA break, where DSB repair meets a fork in the road; alt-EJ in one direction or HR in the other. The choice is dependent on the phase of the cell cycle. If the cell is in G0/G1 phase, 53BP1-RIF1-PTIP will direct resolution of the DSB down the C-NHEJ pathway.
20 8======D
Figure 1-1: Simplified schematic of NHEJ mediated DSB repair in G0/G1 phase DSBs are predominantly repaired by NHEJ in the G0/G1 phases of the cell cycle. 53BP1 is recruited to the ends of DSBs to protect them from resection. The protected ends of the DSB can be ligated back together by the XLF-XRCC4-DNA Ligase IV complex. NHEJ is rapid, and simple, however, is more error prone than other forms of DSB repair.
21 8======D
1.5.3 Homologous recombination double strand break repair
The choice between these two pathways becomes critically important in ensuring that DSB repair is appropriately managed without inducing further genomic instability (Reviewed in
(50)). DSB repair pathway choice ultimately comes down to the amount of end resection that occurs at the DSB termini. As this is essential to generate a 3’ ssDNA overhang capable of searching for homologous region of a sister chromatid template for repair during HR.
End resection in the absence of a sister chromatid template can lead to loss of genetic material resulting in deleterious mutations at the hands of endogenous nucleolytic enzymes
(50). In light of this, it is apparent that the cell needs mechanisms in place that allow it to regulate the extent of end resection and ultimately repair pathway choice. Upon progression from G0/G1 into S-phase/G2, and ultimately repair pathway switch from NHEJ to HR, the block that 53BP1 poses to resection must be lifted in order for HR to proceed. Currently, it is unclear how 53BP1 is displaced from DSB sites to allow HR, however, the BRCA1 complex, CtBP-interacting protein (CtIP) and the MRN complex are essential to this process (78–81).
Once 53BP1 is displaced from DSB ends, MRN and CtIP act concertedly to initiate resection and exonuclease 1 (EXO1) can then further processes the DSB end to generate the long 3’ overhangs necessary for HR (82–84). Additionally, activation of both CtIP and
EXO1 is dependent on their phosphorylation of cyclin-dependent kinases (CDKs), indicating that cell cycle stage dependent phosphorylation events are a necessary event for the switch to HR (85, 86). Single-stranded 3’ overhangs are bound by replication protein
22 8======D
A (RPA) which protects the ssDNA from endogenous nucleases (87). RPA is in constant competition with RAD51 for binding of ssDNA, and the BRCA2 complex plays an important role in shifting the ssDNA binding preference to RAD51. Once the ssDNA-
RAD51 nucleoprotein filament is formed, homology search and D-loop formation requires can begin to use the homologous sequence to resolve the DSB (88).
23 8======D
Figure 1-2: Simplified schematic of HR mediated DSB repair in S/G2 phase DSBs are predominantly repaired by HR in the S/G2 phase of the cell cycle. 53BP1 is recruited to the ends of DSBs to protect them from resection which is important in G0/G1 phases of the cell cycle, however, in S/G2 phases resection is necessary for HR mediated repair. The BRCA1 complex is responsible for the displacement of 53BP1 and thereby facilitating resection by nucleases such as CTIP/Exo1. ssDNA left over after resection is protected by RPA proteins (green) as the single stranded overhang is needed for repair. Rad51 (red) mediated strand invasion can allow the cell to use the sister chromosome as a template to repair the DSB.
24 8======D
Table 1-2: Known DNA repair pathways A list of known DNA repair pathways, with a description of the types of DNA lesions each pathway is responsible for repairing.
Pathway Abbr. Type of Lesions Repaired Oxidized bases, alkylated bases, damaged Base Excision Repair BER bases, abasic sites Nucleotide Excision Thymine dimers, 6,4-photoproducts, bulky Repair NER lesions and interstrand cross-links
Mis-match Repair MMR Mispaired DNA bases Single-Strand Break single stranded breaks caused by ROS, IR and Repair SSBR DNA repair pathways Non-Homologous End Joining NHEJ Double stranded breaks Homologous HR or Recombination HDR Double stranded breaks
Alternative End Joining alt-EJ Double stranded breaks
Single Strand Annealing SSA Double stranded breaks
Fanconi Anemia pathway FA Replication associated damage
25 8======D
1.6 53BP1 recruitment and displacement
1.6.1 53BP1 Recruitment
The recruitment of 53BP1 to DSB sites is preceded by a series of chromatin modifications and other DSB responsive factors. Ultimately, 53BP1 localization to a DSB is dependent on 1) tandem TUDOR domain binding to dimethylated lysine 20 of H4 (H4K20me2), 2) the ubiquitin determining region (UDR) binding to mono-ubiquitinylated H2A and H2AX on lysine 13 and lysine 15 (H2A(X)K13/15-Ub), 3) and the absence of acetylated lysine
16 on histone H4 (H4K16-Ac) (62, 89–91).
As mentioned previously, phosphorylation of H2AX on S139 by ATM, dephosphorylation of T142 of H2AX, MDC1 recruitment, MRN recruitment and RNF8/168 recruitment all precede 53BP1 recruitment. RNF8 and RNF168 coordinate K-48 and K-63 linked ubiquitinylation of a number of proteins at DSB sites. The obligate PTM for 53BP1 recruitment, H2A and H2AX ubiquitinylation on lysine 13/15, is carried out by RNF8 and
RNF168 (62). Additionally, RNF8 and RNF168 have been shown to be involved in displacement and/or degradation of TUDOR domain containing proteins lethal 3 malignant brain tumor L3-1 (L3MBTL1), lysine specific demethylase 4A (KDM4A), and possibly jumonji C domain containing histone demethylase 2A (JMJD2A), which can occupy
H4K20me2 sites leaving 53BP1 unable to bind to chromatin (92, 93). The presence of
H4K20me2 on chromatin is, however, not DNA damage dependent and present across a vast majority of the genome; H4K20me2 is therefore unlikely to be limiting factor to
26 8======D
53BP1 localization (94). The interaction of 53BP1’s TUDOR domains with H4K20me2 can be disrupted by acetylation of H4K16 and the deacetylation of H4K16-Ac, likely by histone deacetylases 1 and 2 (HDAC1 and HDAC2), is necessary for the 53BP1-chromatin interaction to be stable (90, 91, 95).
1.6.2 53BP1 Displacement/Antagonism
As mentioned previously, 53BP1 must be displaced from the site of a DSB in order to proceed to HR mediated repair, or upon entry into mitosis. Currently, the mechanism of displacement of 53BP1 from the site of DNA damage is unclear. Recently, there have been a few insights into the mechanisms behind antagonism of 53BP1 binding to chromatin. As one might expect, most of the research in this area has focused on antagonism of the known
PTM requirements of 53BP1 recruitment (mentioned above). I intend to highlight some of the research in this area to highlight the complexity of alt-EJ and HR competition, rather than for its direct relevance to my work.
1.6.2.1 H4K16 acetylation and 53BP1 antagonism
H4K16-Ac was shown to be antagonistic to 53BP1 IRIF by depletion of the histone acetyltransferase (HAT) tat interacting protein 60kDa (TIP60), and also by inhibition of
HDAC1 and HDAC2 (96, 97) Recently, the H4K16 acetylation activity of TIP60 has been shown to rely on H4K20me recognition by a Nu4A/TIP60 complex subunit malignant
27 8======D brain tumor domain containing 1 (MBTD1); the loss of MBTD1 results in a decrease in
HR, and persistence of 53BP1 foci over time (98).
1.6.2.2 Ubiquitin and 53BP1 antagonism
Ubiquitin dynamics have also been shown to be important in 53BP1 antagonism. Logically, the known DUB activity of the BRCA1/BRCA2-containing complex subunit 36 (BRCC36) was the first to be investigated. Depletion of BRCC36 was shown to increase 53BP1 ionizing radiation induced foci (IRIF) signal strength, and an increase in RNF8 ubiquitination on proteins known to be necessary for 53BP1 recruitment (99). Since, there have been numerous deubiquitinating enzymes (DUBs) that have been shown to antagonize
53BP1 recruitment to chromatin. OUT domain-containing ubiquitin aldehyde-binding protein 1 (OTUB1) was shown to inhibit the activity RNF168, by binding and inhibiting the E2 ubiquitin ligase UBC13. Interestingly, this interaction did not require the DUB activity of OTUB1 (100). Another DUB and subunit of the 19S proteasome, POH1, has been investigated for its role in the DNA damage response. POH1 depletion was shown to result in an increase in the number of 53BP1 foci seen in response to DNA damage (101).
Interestingly, POH1 depletion also showed an increase in 53BP1 focus size that eclipsed the size of γΗ2AX focus size (101). The activity of BRCA1 in S phase was shown to displace 53BP1 to the periphery of IRIF focus, pericentric to BRCA1 focus formation
(102). This phenomenon was shown again by an independent group, who also showed that
POH1 activity was necessary for the formation of RPA foci in the core of IRIF (103). Due to this evidence it has been hypothesized that displacement of 53BP1 from the core of IRIF
28 8======D is mediated by the BRCA1 complex, which may allow POH1 to remove ubiquitin from chromatin/DDR proteins to facilitate resection.
DUB activity of RNF169 was also shown to be able to inhibit 53BP1 foci formation (104).
The depletion of RNF169 was reported to result in an increase in 53BP1 IRIF formation, and depletion of HR while not affecting cell survival to PARPi (69, 104). Furthermore, overexpression of RNF169 showed marked increases in HR activity while conversely decreasing NHEJ activity (104). Interestingly, the activity of RNF169 is dependent on
RNF168 ubiquitination of chromatin; it is thought that RNF169 may act to merely keep the propagation of RNF168/RNF8 responsive recruitment of DDR proteins from extending too far beyond the break site (69).
Lastly, partner and localizer of BRCA2 (PALB2) was shown to be important in the switch from alt-EJ to HR. PALB2 ubiquitination by E3 ligase kelch-like ECH- associated protein
1 (KEAP1) prevents the formation of the BRCA1-PALB2-BRCA2 complex formation in
G1, and the DUB activity of USP11 removes ubiquitin chains from PALB2 in S/G2 allowing the formation of the BRCA1-PALB2-BRCA2 complex (105).
1.6.2.3 RIF1 antagonism to facilitate pathway switch
Although it is not direct antagonism of 53BP1, it has been proposed that the antagonism of
RIF1 can indirectly remove the block to resection that 53BP1-RIF1 poses (72). It has been shown that RIF1 loss also correlates with a loss of 53BP1 foci intensity, and BRCA1 foci
29 8======D formation in G1 (71, 77) Furthermore, the C-terminal end of RIF1 is necessary to inhibit
BRCA1, BRCA1 downregulates RIF1 foci in S/G2, and unlike 53BP1, RIF1 IRIF do not form outside of G1 phase (71, 72, 77)
1.7 Multiple Myeloma, bortezomib and PARP inhibitors
1.7.1 Previous work from Bahlis lab: Neri et al. 2011
In 2011, Neri and colleagues showed that PI in combination with PARPi was sufficient to induce synthetic lethality in MM I would like to briefly summarize the work done prior to my arrival in the lab. It was shown that the PARPi ABT-888 was not sufficient to cause death in MM cells as a single agent, however, when combined with BTZ, there was a synergistic effect and a significant increase in cell death when compared to either single agent alone. Importantly, the same drug combination showed no significant effect on cell survival of patient derived peripheral B cells. Mouse xenograft studies further validated that the use of PARPi with concomitant PI may be an effective therapeutic strategy for MM in humans.
The failure of ABT-888 to cause cell death in MM alone indicated that the additional inhibition of the proteasome was likely leading to a synthetically lethal “BRCAness” state by BTZ induced HR defect. Proteasome inhibition showed a marked reduction in the transcript levels and promoter activity of HR related genes Fanconi Anemia complementation group D2 (FANCD2), RAD51, BRCA1 and BRCA2 in MM cell lines.
30 8======D
Immunofluorescence staining indicated that BTZ treated MM cells failed to form BRCA1, poly-ubiquitin, and RAD51 foci upon treatment with ABT-888. Lastly, using the HR DR-
GFP reporter assay, it was shown that BTZ treatment abolished HR activity. Taken together, these findings strongly suggested a significant defect in HR was occurring with
BTZ treatment leading to the contextual synthetically lethal “BRCAness” state and efficacious use of ABT-888 in HR proficient MM (Figure 1-3). This work can be seen in reference (106).
31 8======D
Figure 1-3: Diagram of PARPi and BTZ combination therapy model Inhibition of PARP1 and PARP2 by ABT-888 leads to replication coupled DSBs. In cells that have functioning HR, these DSBs get repaired and the cells survive. However, the concomitant inhibition of the 26S proteasome, with bortezomib, and PARP1 and PARP2 leads to a synthetic lethality by impairing HR.
32 8======D
Hypothesized mechanism of action for PI and PARPi combination therapy in MM
As mentioned earlier, mutations such as BRCA1-/- leave cells vulnerable to PARP inhibition by impairing HR, and therefore the effect seen here may similarly be due the HR defect seen with bortezomib treatment. Interestingly, the loss of 53BP1 in triple-negative breast cancers rescues sensitivity to PARP inhibition, and restores HR mediated repair (63).
The restoration of HR is due to 53BP1-RIF1 no longer being able to inhibit CtIP and Exo1 from resecting the DNA to generate long 3’ overhangs required for HR; that is to say, without 53BP1-RIF1 BRCA1 is not needed for pathway switch/resection (63, 78,
80)(Figure 1-4). Intriguingly, it has been shown that PI leads to abolished 53BP1 recruitment to IRIF, and ultraviolet micro-laser induced DNA damage tracts in the osteosarcoma cell line U2OS, which is likely due to depletion of free nuclear ubiquitin
(107, 108). In MM, however, Li Ren was able to show that MM cells treated with BTZ readily formed PARPi induced 53BP1 foci, which was in stark contrast to U2OS cells which do not (Figure 1-5). In light of this it is possible 53BP1 is the linchpin molecule responsible for the HR defect, and subsequent sensitization to PARPI, seen with BTZ treatment of MM cells.
We hypothesized if, in MM, proteasome inhibition is unable to abrogate 53BP1 foci formation, but is capable of abolishing BRCA1 foci formation, then it stands to reason that
MM cells treated with BTZ would mimic the phenotype seen with BRCA1-/- cells in the context of PARP inhibition (Figure 1-6). Conversely, if, in non-MM cells, proteasome
33 8======D inhibition is able to abrogate 53BP1 foci formation, as well as abolish BRCA1 foci formation, then it stands to reason that non-MM cells treated with BTZ would mimic the phenotype seen with BRCA1-/- + 53BP1-/- cells (Figure 1-6). Additionally, due to the effects of ubiquitin depletion seen with proteasome inhibition, and the role that 53BP1 plays in critical plasma cell processes CSR and V(D)J recombination, we hypothesized that, in MM, there may be a differential recruitment mechanism for 53BP1 that does not require ubiquitin (106, 107, 109).
34 8======D
Figure 1-4: Schematic representation of how BRCA1-/- cells gain resistance to PARPi by loss of 53BP1 BRCA1-/- cells are sensitive to PARPi, likely due to being unable to displace 53BP1 from DSB sites which results in a HR defect. Cells defective in HR have an increased reliance on NHEJ; a less accurate mechanism of DSB repair. This reliance on NHEJ can lead to increased incidences of aberrantly repaired DSBs, and ultimately, cell death. However, it has been shown that loss of 53BP1 in addition to loss of BRCA1, can rescue sensitivity to PARPi by removing 53BP1’s block to resection and thereby restoring HR mediated repair.
35 8======D
Figure 1-5: Proteasome inhibition abrogates 53BP1 foci formation in U2OS cells but not MM1S cells Effect of BTZ on ABT-888 induced 53BP1 foci in osteosarcoma cell line U2OS (top) and in multiple myeloma cell line MM1S. Image acquisition was performed with an epifluorescence microscope (BX51; Olympus) and multispectral color camera (Nuance FX; CRi) with a 60x magnification oil immersion objective. These images were provided by Li Ren of Dr. Nizar Bahlis’ lab.
36 8======D
Figure 1-6: Schematic representation of predicted mechanism of action of PI and PARPi combination’s synthetic lethality in MM It has been shown previously that 53BP1 IRIF fail to form in when cells are treated with a proteasome inhibitor. In non-MM cells we predict that treatment with PARPi in combination with PI will result in the loss of 53BP1’s DSB end protection, allowing repair of DSB’s by HR. This is akin to 53BP1-/- BRCA1-/- double knockouts resulting in resistance to PARPi. In MM, much like in BRCA1-/- 53BP1+/+, cells we predict that 53BP1 is acting to block HR from occurring even when the proteasome is inhibited.
37 8======D
1.8 Experimental Aims:
In order to determine if 53BP1 is necessary for the synthetically lethal effects seen in MM cells concomitantly treated with BTZ and ABT-888 I tested the following aims.
Aim 1: Determine if H2AK15-Ub is necessary for 53BP1 recruitment in MM
Aim 2: Establish CRISPR/Cas9 mediated knockout of 53BP1 and RNF168
Aim 3: Determine if, in MM, the 26S proteasome inhibition induced
“BRCAness” state is dependent on 53BP1
38 8======D
CHAPTER TWO: Materials and Methods
2.1 Antibodies, Plasmids, Primers, and Cell lines:
Table 2-1: List of antibodies used for experiments detailed herein. Dilution Target Catalogue Buffer WB IF Protein Manufacturer Number (WB) Dilution Dilution NB100- 53BP1 Novus 304 5% Milk 1/2500 1/1000 γH2AX Millipore 05-636 5% Milk 1/1000 1/1000 FK2 Millipore 04-263 5% Milk 1/5000 1/5000 FLAG Sigma F3165 5% Milk 1/1000 1/1000 H2A AbCam ab13923 5% Milk 1/500 H2A Cell Signalling #2578 5% Milk 1/1000 GAPDH Cell Signalling #2118 5% Milk 1/5000 αTubulin Cell Signaling #2144 5% Milk 1/10000 RNF168 Millipore ABE367 5% Milk 1/1000 GFP Cell Signalling #2555 5% Milk 1/1000 αRabbit Santa Cruz sc-2004 5% Milk 1/4000 αMouse Santa Cruz sc-2005 5% Milk 1/4000 αRabbit AF488 Life Tech A11008 NA NA 1/500 αMouse AF594 Life Tech A11005 NA NA 1/500 αMouse AF555 Life Tech A21424 NA NA 1/500
39 8======D
Table 2-2: Cloning primers made to generate CRISPR/Cas9 mediated gene editing. These primers were inserted into pLENTICRISPRv2, pLentiGuide-Puro or pSpCas9(BB)-2A- GFP. Target Primer Sequence F CACCGTGTATGTGATGTCGGCAGAC CRBN R AAACGTCTGCCGACATCACATACAC F CACCGGCAGCTTGACTCAAAATTCC STAT1 R AAACGGAATTTTGAGTCAAGCTGCC F CACCGTTGGAAGCACGGCCTACGGC IRF3 R AAACGCCGTAGGCCGTGCTTCCAAC F CACCGCGCAGCCGATGTCGTCTCGC DIS3 R AAACGCGAGACGACATCGGCTGCGC F CACCGTCGCCTTTTCGACGGTCGAC RNF168 R AAACGTCGACCGTCGAAAAGGCGAC F CACCGTTCGTCACAGGAGACCGCGC RNF8 R AAACGCGCGGTCTCCTGTGACGAAC R AAACTTCAAGGTGTTCGGGTAAAGC F CACCGCGCTACCGGTGAACCAGCGC PSMB5 R AAACGCGCTGGTTCACCGGTAGCGC F CACCGGACAGACTTCTTAGACTTGG PSMD14 R AAACCCAAGTCTAAGAAGTCTGTCC R AAACCGGGGTCGCTTTCCATGAGGC F CACCGGGACCCTACTGGAAGTCAGT 53BP1 R AAACACTGACTTCCAGTAGGGTCCC
40 8======D
Table 2-3: Plasmids used for experiments described herein. Backbone Insert Source Zhang Lab (purchased from LentiCRISPR_v2 Various Addgene) psPAX2 NA Addgene pCMV-VSV-g NA Addgene pCDNA3.1+ FLAG-H2A Gift from Titia Sixma Derived from Titia Sixma WT pCDNA3.1+ FLAG-H2A-K15R plasmid Derived from Titia Sixma WT pCDNA3.1+ FLAG-H2A-K119/120R plasmid pCDNA3.1+ Empty Gift from Susan P. Lees-Miller pSpCas9(BB)-2A- GFP Various Addgene pTAL.EF1α.025104 53BP1 targeting sequence Cellectis pTAL.EF1α.025105 53BP1 targeting sequence Cellectis pTAL.EF1α.025102 53BP1 targeting sequence Cellectis pTAL.EF1α.025103 53BP1 targeting sequence Cellectis
2.2 Cell culture methods
Human MM cell lines were maintained in RPMI 1640 medium (Gibco Thermo-Fisher) containing 10% FBS (Gibco Thermo-Fischer) with L-glutamine supplemented 100 U/mL of penicillin and 100 µg/mL of streptomycin (Gibco Thermo-Fisher).
Human U2OS cells were maintained in DMEM medium (Gibco Thermo-Fisher) containing 10% FBS with L-glutamine supplemented 100 U/mL of penicillin and 100
µg/mL of streptomycin.
41 8======D
2.3 Lentiviral infection with sh53BP1 containing LV particles
1x105 cells were plated in 1mL of RPMI1640 (Invitrogen) supplemented with 10% FBS and 1% PS in a 24 well plate. Polybrene was added to the media at a final concentration of
6µg/mL. Viral particles (sh53BP1 - V2LHS_56193 or control GPIZ – VGH5526 from
Thermo Scientific) were added to the cells at an MOI =10. The mixture was gently mixed on an orbital shaker briefly, and thereafter the plate was centrifuged for 5 minutes at RT (5 min). After 24 hours of infection, the cells were spun down and the LV containing media was discarded. The infected cells were resuspended in 1mL of RPMI1640 supplemented with 20% FBS and 1%PS and incubated for 48 hours. Thereafter, the cells were again resuspended in 10% FBS RPMI, and 2µg/mL of puromycin (Invitrogen) was added to the media for selection. The cells were always cultured in RPMI 1640 supplemented with 10%
FBS, 1%PS and 2µg/mL puromycin after initial selection.
2.4 Cloning of CRISPR/Cas9 Constructs
In order to ectopically express the CRISPR guide and Cas9 nuclease in MM cells, I used the pLENTICRISPRv2 single-plasmid lentiviral transfection system from the Zhang lab.
The pLENTICRISPRv2 plasmid is designed to easily clone single-target guide oligos. 5µg of pLENTICRISPRv2 plasmid was digested using 10U of BsmBI restriction enzyme
(NEB). The digestion reaction was ran on a 1% agarose gel and the 8kb linear plasmid was purified using the Qiagen QIAquick gel extraction kit. To insert the guide sequence the forward and reverse oligos are first phosphorylated using T4 PNK (NEB), and then
42 8======D annealed by heating the phosphorylation reaction to 95˚C for 5 minutes, and subsequently decreasing the temperature of the reaction by 5˚C/min to a final temperature of 4˚C. The phosphorylated and annealed oligos are then diluted 1:200 in water. 50ng of the BsmBI digested pLENTICRISPRv2 plasmid and 1µL of the 1:200 diluted oligo duplex are annealed using the NEB Quick ligase kit. After ligation the plasmid with inserted guide sequence was transformed into the RecA deficient, chemically competent Stbl3 E. coli strain (Invitrogen). The transformed Stbl3 were plated on 50µg/mL LB agar plates, and cultured at 37˚C overnight. Single colonies were picked and grown up in 3mL of 100µg/mL
LB broth overnight. 1mL of the bacterial broth culture was used to extract the plasmid
DNA using the QIAprep Spin Miniprep kit (Qiagen). The extracted plasmids were sequenced using a primer designed in the U6 promoter of the pLENTICRISPRv2 plasmid and the resulting data was used to determine successful incorporation of the intended guide oligo. Upon verification 1mL of the bacterial culture was used to inoculate 300mL of
100µg/mL LB broth, and incubated at 37˚C overnight to propagate the plasmid to obtain appropriate quantities for packaging into a lentiviral vector. The 300mL bacterial culture was then harvested for plasmid purification by Maxi prep (Qiagen).
2.5 CRISPR/Cas9 packaging of lentiviral plasmids and lentiviral infection:
Packaging of the pLENTICRISPRv2 gene specific guide plasmids into lentiviral particles was carried out in human 293FT cells. The pLENTICRISPRv2 constructs were co- transfected using second generation lentiviral packaging plasmids psPAX2 and p-CMV-
VSVg in a 20:15:6 ratio, respectively. Transfection was carried out using the Turbofect
43 8======D
(Thermo Scientific) reagent as described by the manufacturer protocol. 24 hours post- transfection, transfection media was removed and replaced with DMEM supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin antibiotics. The transfected
293FT cells were then cultured for 72 hours. Thereafter 1mL of the DMEM media, which contained lentiviral particles manufactured in the 293FT cells, was used to resuspend
2.5x105 MM cells and 8µg/mL of polybrene was added to catalyze the infection. The LV infection was cultured for 24 hours at 37˚C in a CO2 chamber. The cells were then spun down and resuspended in 1mL of RPMI1640 supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin. The cells were then cultured for 48 hours at 37˚C in a CO2 chamber to recover from the lentiviral infection. Thereafter, the CRISPR/Cas-9 LV infected cells were placed in 2µg/mL puromycin selection in RPMI1640 supplemented with 10% FBS and 1% Pen/Strep. The selection proceeded for 7 days before cells were removed from puromycin selection.
2.6 Immunofluorescence Assays
Cells that are able to adhere to glass slides (e.g. U2OS) were seeded and allowed to adhere to coverslips overnight. After adherence to coverslips, experimental conditions are then performed.
For suspension cells (e.g. MM cells), the cells are exposed to experimental conditions prior to fixation on poly-L-lysine or poly-D-lysine treated coverslips.
44 8======D
Chemical fixation is performed by incubation of the cells in 4% paraformaldehyde (w/v);
2% sucrose (w/v); PBS at room temperature (RT) for 15 minutes. The cells are then washed with PBS, and permeablized using 0.5% Triton-X100 (v/v) in PBS at RT for 5 minutes.
The cells are washed three times and incubated in Dual Endogenous Enzyme Block (Dako) for 15 minutes at RT; the enzyme blocking agent is thereafter aspirated from the coverslip.
The coverslip is then incubated for thirty minutes in Protein Block Serum-Free Ready-To-
Use (Dako) at RT; the protein blocking agent is thereafter aspirated from the coverslip. The coverslip is then incubated in primary antibody, at the appropriate dilution, in Antibody
Diluent with Background Reducing Components (Dako) overnight. The primary antibody solution is then aspirated, and the cells are washed three times for 5 minutes in PBS.
Secondary antibodies are diluted in Dako Antibody Diluent with Background Reducing
Components (Dako) and incubated at RT for 1-2 hours. The coverslips are then washed in
PBS three times for 10 minutes, removed from the PBS, dabbed to remove excess PBS, and placed on a mounting slide with 12µL of ProLong Gold Antifade Mountant with DAPI
(Life Technologies). The slides are allowed to cure for a minimum overnight before observation.
45 8======D
2.7 Western Blots
Cell lysis is performed one of the three buffers listed below. The cells are resuspended in the lysis buffer and incubated with periodic agitation on ice for fifteen minutes. The cell lysate is then sonicated with a Sonic Dismembrator Model 100 (Fisher Scientific) three times for five seconds (fifteen second intervals between sonications) at power level 4. The lysate is then centrifuged at 12 000g for 15 minutes at 4˚C; thereafter the supernatant is removed and placed in a clean microfuge tube. To quantify a protein concentration estimate, the cell lysate is compared to BSA standards diluted in the above mentioned lysis buffer using the Bio-Rad DC protein assay. An equivalent amount of protein, based on protein concentration estimation, is used for sample preparation for SDS-PAGE gel electrophoresis (50µg or 80µg is typically used). The protein sample is diluted with lysis buffer to normalize the total volume of sample, and NuPAGE sample reducing agent (Life
Technologies), and NuPAGE LDS sample buffer (Life Technologies) are added as per the manufacturer’s instructions. The samples are boiled for 10 minutes at 70˚C, centrifuged, and electrophoretically separated using pre-cast 4-12% Bis-Tris SDS-PAGE gradient gels
(Life Technologies) as per manufacturer’s instructions. The protein was transferred to a
PVDF membrane using the Life Technologies iBlot system or a nitrocellulose membrane by transferring in using a Mini Trans-Blot apparatus (BioRad) in electroblot buffer (50mM
Tris, 40mM Glycine, and 20% v/v methanol) for 80 minutes at 100 V in an ice bath. The
PVDF/nitrocellulose membrane was then blocked in 5% (w/v) milk for 1 hour prior to the addition of primary antibody. Primary antibodies for target proteins are incubated overnight at 4˚C in the appropriate dilution buffer (specified by the manufacturer), washed
46 8======D three times for 5 minutes in 0.05% TBST, and incubated with appropriate secondary antibody in the appropriate dilution buffer (specified by the manufacturer) for 1-2 hours at
RT. The membrane is again washed three times, for 10 minutes each wash, at RT in 0.05%
TBST. Chemiluminescent signal is produced by incubating the blot in ECL for one minute prior to x-ray film exposure.
2.7.1 Cell lysis buffers
2.7.1.1 RIPA
- 20mM Tris-HCl - 150mM NaCl - 1% NP-40 - 0.1% SDS - 1mM EDTA - 1mM EGTA - 0.5% sodium deoxycholate - 1mM Na3VO3 - 1mM NaF - 1 tablet complete mini EDTA-free protease inhibitors (Roche)
2.7.1.2 NP-40 (Ines)
- 50mM Tris-HCl - 150mM NaCl - 0.1% NP-40 - 1 tablet PhosphoSTOP (Roche) - 1 tablet complete mini (Roche)
2.7.1.3 Hypotonic lysis buffer
- 5mM HEPES - 85mM KCl - 0.5% NP-40 - 1 tablet complete mini (Roche) - 1 tablet PhosphoSTOP
47 8======D
2.8 RT-PCR and qPCR for transcript expression analysis
Cells were harvested and RNA was extracted using the QiaShredder and RNAEasy RNA extraction kits (Qiagen) as per the manufacturer’s instructions. Thereafter, cDNA was made from the RNA using SuperScript III Reverse Transcriptase (Invitrogen), as per the manufacturer’s instructions. 0.5µL of cDNA per reaction was used for transcript quantification using TaqMan Master Mix (Applied Biosystems), as per the manufacturer’s instructions. All target genes, and housekeeping genes were always analyzed in triplicate.
2.9 RNA-seq Analysis
2.9.1 Sequence Acquisition
The adapter trimmed FASTQ RNA-seq data for the MM1S and KMS11 cell lines used here was kindly provided by Nizar Bahlis. The reference genome used was the human
UCSC hg19 genome full data set. (http://tophat.cbcb.umd.edu/igenomes.shtml)
2.9.2 Sequence Alignment
The FASTQ files for both the MM1S and B cell RNA-seq experiments were processed into sorted BAM files using TopHat (http://tophat.cbcb.umd.edu); the alignment using the
Bowtie2 algorithm. The sorted BAM output files were indexed using SAMtools to be viewable in the Integrated Genome Browser (IGV version 2.3.32). Variations within
48 8======D interrogated sequences were determined using IGV. Variations were input into the Broad
Institutes computational applet Oncotator (www.broadinstitute.org/oncotator/), for variation characterization.
2.9.3 Protein family gene acquisition
Histone protein families H2A, H2B, H3 and H4 information was downloaded from
BioMart using the Ensmbl protein family accession numbers. Histone genes are clustered into a number of structured loci on various chromosomes, and each cluster is represented here. There are also variant histone proteins that do not reside in the histone clusters, and have different annotations than the canonical histones; these are also listed here.
2.10 Surveyor Mutation Detection Assay
The gDNA was extracted using the DNEasy Blood & Tissue gDNA extraction kit
(Qiagen), and resuspended in TE buffer. The amplicon flanking the cut site within 53BP1 was amplified using Hi-Fidelity Plus polymerase (Roche) and 5’
AACGAGGAATGGTGACTTGG 3’ forward and 5’ TGTTTGCTGGTTTTCGGTTT 3’ reverse primers, as per the manufactorer’s instructions. The Surveyor Mutation Detection
Assay (Integrated DNA Technologies) was conducted as per the manufacturer’s instructions. The resulting DNA was run on a 1% agarose gel at 120V for 35 minutes at room-temperature.
49 8======D
2.11 Cell viability Assays
Cells were incubated in the indicated concentrations of ABT-888 and/or BTZ, for the indicated time intervals (24 or 48 hours). Thereafter the cells were centrifuged at 1000g for 5 minutes, and the media was discarded. Cell viability was assayed by resuspending the cell pellets in Annexin Binding Buffer (BioVision) supplemented with the apoptotic marker Annexin-V conjugated to FITC (BioVision), and cell necrosis marker propidium iodide (BioVision) as per the manufacturer’s instructions. The flow cytometric data was acquired and analyzed with a BD LSRII flow cytometer at the University of Calgary
Flow Cytometry Core Facility.
50 8======D
CHAPTER THREE: Analysis of MM cell lines for mutations in histones and DNA repair proteins
As 53BP1 is known to bind to nucleosomes that possess mono-ubiquitinylated H2A-K15, in addition to dimethylated H4K20 but lack H4K16 acetylation. We hypothesized that it was possible that myeloma cells have developed variations within the nucleosome itself that facilitate 53BP1 binding. Using IGV to view the cell line RNA-seq alignments, it was apparent that most of the histone genes did not have transcripts that aligned to them.
However, of the few histone genes that did have transcripts that aligned, only a single histone gene contained a variation in MM1S and KMS11: H3F3C. This histone H3 variant
(H3.5) harbors a single nucleotide deletion of a cytosine residue causing a frame shift starting at amino acid 127 of the H3.5 protein. (Figure 3-1) Although this is not likely playing a role in the DNA damage response, it is mentionable. A list of interrogated histone loci can be seen in Table 3-1. There was also a frame shift causing deletion observed in the gene that encodes the histone H2A variant H2AX (Gene name: H2AFX). 50% of KMS11 reads, and 60% of MM1S reads contained this deletion, however, based on the flanking sequence having a number of repetitive cytosine residues it is most probable that this is an artifact of sequencing using the Ion Torrent technology (Table 3-1). In consideration that both MM1S and KMS11 cell lines readily form γH2AX IRIF, I did not investigate this mutation further.
51 8======D
Figure 3-1: IGV sequence alignment of a mutation in H3.5 Alignment of RNA-seq results for the myeloma cell line MM1S, with the UCSC genome hg19. Seen here is the likely deletion of a single cytosine residue within the histone H3 variant H3.5.
52 8======D
Table 3-1: Analysis of histone variants for expression and mutation A list of human nucleosomal proteins H2A, H2B, H3 and H4 that were used to detect variations that may alter the DNA damage response dynamics in myeloma cells. Cell line used: Multiple Myeloma established cell lines MM1S and KMS11. Syn indicates a non- protein changing variation in the nucleotide sequence. *H2AFX is likely an artifact of sequencing.
H2A MM1S KMS11 Variations Coverage Coverage
H2AFJ low no none
H2AFX good good Del*
HIST1H2AA no no none
HIST1H2AB no low none
HIST1H2AC low good none
HIST1H2AD no low none
HIST1H2AE no low none
HIST1H2AG low low none
HIST1H2AH low low none
HIST1H2AI low low none
HIST1H2AJ low low none
HIST1H2AK low low none
HIST1H2AL no low none
HIST1H2AM low good none
HIST2H2AA3 low good none
HIST2H2AA4 low good none
HIST2H2AB no low none HIST3H2A no no none
HIST2H2AC low low none H2B MM1S KMS11 Variations Coverage Coverage
HIST3H2BB no no none
HIST2H2BF no low none
HIST2H2BE low no none
HIST1H2BO low low none
HIST1H2BN no good none
HIST1H2BM no low none
HIST1H2BL no good none
HIST1H2BK good good none
HIST1H2BJ low low none
HIST1H2BI no low none
HIST1H2BH good good none
HIST1H2BG low low none
HIST1H2BF low good Syn
53 8======D
HIST1H2BE low low none
HIST1H2BD low low none
HIST1H2BC low low none
HIST1H2BB no no none
HIST1H2BA no no none H3 MM1S KMS11 Variations Coverage Coverage
H3F3A good good none
H3F3B good good none
H3F3C good good chr12:31944722delC
HIST1H3A no no none
HIST1H3B low no none
HIST1H3C no no none
HIST1H3D low low none
HIST1H3E low low none
HIST1H3F no no none
HIST1H3G no no none
HIST1H3H low low none
HIST1H3I no no none
HIST1H3J low low none
HIST2H3A low good none
HIST2H3C low good none
HIST2H3D no low none
HIST3H3 no low none H4 MM1S KMS11 Variations Coverage Coverage
HIST1H4A no no none
HIST1H4B no no none
HIST1H4C no no none
HIST1H4D no no none
HIST1H4E no no none HIST1H4G no no none
HIST1H4F no no none
HIST1H4H good good Syn
HIST1H4I no low none
HIST1H4J no no none
HIST1H4K no no none
HIST1H4L no no none
HIST2H4A low good none
HIST2H4B low good none
HIST4H4 low low none
54 8======D
As previously mentioned, there are a number of other proteins that are known to directly interact with 53BP1; namely: RIF1, PTIP, RNF8, RNF168, KAT5 (TIP60), PSMD14
(POH1), HERC2, BARD1, BACH1, ABRAXAS, RAP80, CtIP, EXO1, RIP1, Ubc13 and
BRCA1. Mutations that arise in these proteins are either known to cause genomic instability, or are candidates for genomic instability, due to their involvement in the DDR.
It is the case that both KMS11 as well as MM1S cell lines are sensitized by bortezomib to the treatment of PARPi. That being said, it was then most logical to look for variations that occur in both of these cell lines, as those are the most likely candidates for the seen effect.
Of the 57 variations that were seen in the aforementioned genes, 12 were predicted to have no effect on protein function, 8 were predicted to be deleterious and 37 were unable to be determinately deleterious or not by computation using PolyPhen2 (data not shown) Out of the 8 variations, only 2 occurred in both KMS11, as well as MM1S (Table 3-2).
Unfortunately, RNA-seq data contains a high error rate, and the Ion Torrent system used here sees issues in regions that have more repetitive sequences (eg. CCCTCCCGGCC would likely have errors that produce artificial variations not legitimately present). For the mutations that are potentially due to homopolymer repeats it would be necessary to use more rudimentary sequencing methods to determine if the mutations detected by RNA-seq are bona-fide or a result of this limitation of the Ion-Torrent system.
55 8======D
Table 3-2: Sequence analysis of DNA repair proteins Of the 57 variations found by manually interrogating 53BP1, RIF1, PTIP, RNF8, RNF168, KAT5, PSMD14, HERC2, BARD1, BACH1, ABRAXAS, RAP80, CtIP, EXO1, RIP1, Ubc13 and BRCA1 these 24 result in a frame shift or were predicted to be deleterious using Oncotator, which uses PolyPhen2. PP: PolyPhen2 prediction, AA: Amino Acid change, FS: Frame shift, MS: Missense mutation, FAM175A = RAP80, UIMC1 = CtIP, UBE2N = Ubc13. Green indicates the variation occurred in both cell lines. Blue indicates that the variation occurred in only one of the two cell lines. The number of reads that contained the mutation are indicated as a percentage of total reads that covered that particular alteration.
KMS11 MM1S Gene Variation AA PP2 Homopolymer Reads Reads
EXO1 MS p.R723C Del Yes 55% Yes 100% Unlikely
FANCA MS p.T266A Del Yes 31% Yes 100% Unlikely
HERC2 MS p.R1998Q Del No NA Yes 50% Likely
HERC2 MS p.D941A Del No NA Yes 50% Unlikely
HERC2 MS p.E1846A Del No NA Yes 57% Likely
HERC2 MS p.R2126L Del Yes 38% No NA Likely
HERC2 MS p.D658G Del No NA Yes 88% Likely
HERC2 MS p.M1999I Del No NA Yes 50% Unlikely
RNF168 MS p.P401Q Del No NA Yes 87% Unlikely
UIMC1 MS p.P435L Del Yes 97% No NA Unlikely
Interestingly, the mutation in Exo1 is predictably deleterious, occurs in both KMS11 and
MM1S cells, and Exo1 is involved in switch between NHEJ and HR. Exo1 is responsible for nuclease activity, downstream of displacement of 53BP1, and is unlikely to be a candidate for the effect we are predicting. Exo1 is redundantly active with CtIP for resection of DSBs, and the absence of Exo1 produces only a weak mutator phenotype
(110). Furthermore, I would expect that if the mutation in Exo1 was affecting the ability of 56 8======D
MM cells to undergo HR, the use of PARPi would likely be effective in the absence of proteasome inhibition. The other predictably deleterious mutation that is seen in both
MM1S and KMS11 is FANCA. FANCA is not part of the switch between NHEJ and HR, but it is part of the core Fanconi Anemia E3 ubiquitin ligase complex which plays an integral role in interstrand crosslink repair, and repair at stalled replication forks (88).
Although our current hypothesis of 53BP1 recruitment and/or retention blocking HR being the key reason we see synergy between PARPi and PIs has no role for FANCA, it is tempting to speculate that a mutation in FANCA could render these cells sensitive to
PARPi by affecting single-ended breaks that occur at stalled replication forks, for example.
In order to tease out any possible genetic causes of sensitivity to the combination of PARPi and PIs, it would be beneficial to use additional MM cell lines RNA-seq data for mutations in particular genes that are involved in the switch between NHEJ and HR. For example, some of the mutations that PolyPhen2 was unable to computationally indicate the mutations effect on protein function occurred in RIF1, BARD1, BRIP, BACH1, and
UBC13. If these mutations also appeared in other MM cells lines, I would be increasingly more interested in investigating if they played a potential role in MM sensitivity to the combination therapy.
57 8======D
CHAPTER FOUR: Gene editing using CRISPR/Cas9
4.1 Using shRNA to silence 53BP1 in MM
In an effort to understand the role that 53BP1 plays in the synthetically lethal combination of ABT-888 and BTZ in MM, I sought to knock-down the expression of 53BP1 by shRNA.
MM1S cells were infected with two different shRNA carrying lentiviruses (sh53BP1-1:
V2LHS-56191; ThermoFisher and sh53BP1-2: V2LHS-56192;ThermoFisher). Infected cells were maintained in selection to ensure the stability of the infection for all subsequent experiments.
Unfortunately, the efficacy of the sh53BP1-1 and sh53BP1-2 was inadequate to knock- down the expression of 53BP1. sh53BP1-1 showed no change in protein expression by western blot, and a measly 28% reduction in 53BP1 mRNA levels as quantified by RT- qPCR (Figure 4-1(a)). Similarly, the efficacy of sh53BP1-2 was inadequate, showing a modest reduction of 53BP1 protein by western blot, and a 37% reduction in 53BP1 mRNA expression as quantified by RT-qPCR (Figure 4-1(a)).
Interestingly, when MM1S cells infected with sh53BP1-2 were continued to be cultured in puromycin selection media, the culture seemed to partition itself into two separate fractions: cells that remained in suspension, and cells that became unusually adherent to the tissue culture flask. As I had previously noticed that U2OS53BP1-/- cells had morphological changes, and differences in adherence to their flask when compared with
58 8======D their wild-type counterparts (data not shown), I wanted to determine if there was a difference in 53BP1 expression between the two populations I noticed emerging in MM1S.
I extracted protein, and RNA from the different populations, as well as from the two populations combined. Western blot analysis of the protein expression of the population that remained in suspension and the combination of suspension and adherent cells showed a modest reduction in protein expression of 53BP1, and the adherent population showed very little reduction in 53BP1 protein (Figure 4-1(b)). RT-qPCR analysis of the adherent, suspension and combined populations indicated reductions in mRNA levels to be 58%,
57% and 56%, respectively (Figure 4-1(b)).
We decided that the use of these cells, with such modest changes in protein and mRNA expression, would be ineffective in analyzing the effects of 53BP1 when undergoing combined treatment with ABT-888, and BTZ. Using shRNA to knock-down 53BP1 was abandoned at this point.
59 8======D
Figure 4-1: shRNA targeting 53BP1 verification of knock-down (a) MM1S cells were infected with LV particles containing shRNA for 53BP1 or a non- targeting control vector GIPZ. Two different LV particle clones were used: sh53BP1-1 (V2LHS-56191; ThermoFisher), and sh53BP1-2 (V2LHS-56192;ThermoFisher). (b) Cells from sh53BP1-2 in (a) were cultured for and additional 5 days in selection media. Many of the cells had become abnormally adherent and RNA and protein was extracted from adherent cells (sh53BP1-A), suspension cells (sh53BP1-F), and a colloidal mix of the two fractions (sh53BP1-AF).
60 8======D
4.2 Using TALEN to generate 53BP1-/- MM cell lines
4.2.1 TALEN mechanism of action and design to target 53BP1
A technician in our lab had mutated 53BP1 in the osteosarcoma cell line U2OS using zinc- finger nucleases, however, he was unable to do so in MM. Due to ZnF not working in MM, we decided to pursue a seemingly more promising technology known as Transcription
Activator Like Effector Nucleases (TALEN).
TALENs are a fusion of the Transcription Activator Like Effector domain (TALE) from the plant pathogen Xanthomonas, that bind to DNA in a sequence specific manner, and the
FokI nuclease which creates double stranded breaks. (111–113) By altering the sequence of the TALE domain such that it has affinity to a specific sequence of DNA, it is possible to direct the TALEN to a site specific region of the genome to utilize the DSB generating
FokI nuclease. Editing of the region of DNA that the FokI nuclease targets relies on errors being made by DNA repair machinery. Upon incidence of a deleterious mutation due to
DNA repair failure, the gene should no longer produce functional protein and it will be possible to study the effect of the loss of the protein of interest; in our case the protein of interest being 53BP1.
To target 53BP1, I sent the sequence from Figure 4-2 to Cellectis; a company who specializes in making TALENs to target your region of interest for gene editing. The specific sequence used to design the TALEN recognition site was the entire second exon
61 8======D of 53BP1. The second exon of 53BP1 was used for two reasons: 1) the first exon is made up of almost entirely 5’ UTR sequence, encoding only 7 residues that will eventually be translated and 2) the second exon contains an alternative start site, which makes an isoform of 53BP1 that lacks the first 5 amino acids of the full length protein. Targeting the 5’ UTR in the first exon would likely have resulted in either a functional protein as it would be unlikely to affect the translated protein. Additionally, the first exon was unsuitable as it would be difficult to create a deleterious mutation in 7 nucleotide region after the start site and before the first splice junction. Lastly, even in the event that targeting the first exon was successful, functional protein could be made using the alternate start site in the second exon. Cellectis produced, and validated, two different pairs of TALENS targeting 53BP1’s second exon near the 5’ splice junction: pTAL.EF1α.025102/3 and pTAL.EF1α.02104/5
(Figure 4-2).
Each set of TALEN constructs recognizes two distinct sequences flaking the region intended to be cut. The 5’ recognition region is bound by one TALEN, called the left arm, and the 3’ recognition sequence is bound by a second TALEN called the right arm. The left arm, pTAL.EF1α.025102, binds to the sequence 5’ TGTTATTCCATTCCAGG 3’ and the right arm, pTAL.EF1α.025103, binds to the sequence 5’ ACTGGAAGTCAGTTGGA
3’; these two recognition sites flank the cut region 5’ GGAGCAGATGGACCCT 3’. The left arm, pTAL.EF1α.025104, binds to the sequence 5’ TTCCAGGGGAGCAGATG 3’ and the right arm, pTAL.EF1α.025105, binds to the sequence 5’
AGTCAGTTGGATTCAGA 3’; these two recognition sites flank the cut region 5’
GACCCTACTGGA 3’ (Figure 4-2). When the two complementary TALENS bind to their
62 8======D respective sequences, spaced by an optimal 12-21 bp region, the FokI nucleases monomers dimerize to cleave the region between the two recognition sequences. (111) The pairs described here both targeting exon 2 of 53BP1 in the spacer regions between the TALEN pairs.
63 8======D
Figure 4-2: Design of recognition sequences for TALEN and CRISPR/Cas9 targeting 53BP1 a) This sequence was used in the design of TALEN and CRISPR/Cas9 targeted editing of 53BP1. Depicted here is the sequence of Exon1/2 and intron 1/2 of 53BP1. The sequence was acquired from the Ensembl databank using the hg18 human genome. b) Diagramatic indication of the region of 53BP1 that was targeted for gene editing by TALENs
64 8======D
4.2.2 Detection of mutation by SURVEYOR Mutation Detection assay
The detection of successful mutation can be determined by numerous methods such as, denaturing high-performance liquid chromatography and heteroduplex analysis.
Sequencing may also be used; for example, Sanger sequencing could be used if homozygous single cell clones are established or next-generation sequencing could detect variants in a pooled population. Mutation detection using these methods would be rather costly, however. Here I used the SURVEYOR Mutation Detection assay to screen MM cells transfected with pTAL.EF1α.02102/3 and pTAL.EF1α.02104/5 TALEN pairs, and some CRISPR/Cas9 edited genes.
The SURVEYOR assay utilizes a mismatch specific nuclease of the CEL family that recognizes when a double-stranded DNA heteroduplex has a bulge due to mismatched bases. (114) The process of detection involves a number of steps: (1) gDNA extraction, (2)
PCR amplification of the region of interest, (3) denaturing of PCR product, (4) annealing of DNA to generate heteroduplexes, (5) SURVEYOR nuclease digestion and (6) agarose gel electrophoresis – see Figure 4-4 for a diagrammatic representation of the process behind the SURVEYOR Mutation Detection assay. (114)
65 8======D
Figure 4-3: Schematic representation of the SURVEYOR Mutation Detection Assay Primers for PCR are designed against a ~400bp region of DNA flaking the region targeted for mutation. This region is PCR amplified using high fidelity polymerases to minimize false positives. The PCR products are heat denatured and allowed to anneal. If the population of cells carries a cell line or allele that is mutated, the annealed product will differ and result in the formation of a mismatch bulky lesion. The SURVEYOR assay’s CEL mismatch-specific nuclease recognizes these lesions and cleaves both strands of the DNA, resulting in two smaller DNA fragments, which can be resolved by agarose gel electrophoresis.
4.2.3 Unsuccessful mutation of 53BP1 by TALEN
66 8======D
I made an initial attempt at using TALEN to knock-out 53BP1, where I transiently transfected 5 μg (2.5 µg of each plasmid) of pTAL.EF1α.025102/3 and pTAL.EF1α.025104/5 plasmid pairs, in duplicate, into MM1S cells. From each of the four different transfection conditions, gDNA was extracted and high-fidelity PCR was used to amplify the targeted region of 53BP1. Unfortunately, analysis for mutation using the
SURVEYOR mutation detection assay described above showed no evidence of a mutated population in the mix. Agarose gel electrophoresis detected the full length band, of ~450bp in length, that was expected to be produced in the event that a heteroduplex had not formed and was left uncleaved by the SURVEYOR nuclease (Figure 4-4 (A)). In the event that a mutation had occurred a band at ~225bp should be present, however, under these conditions there was no visible band (Figure 4-4 (A)).
In the first attempt at using TALEN, I used standard “recommended” transfection conditions for cell number and plasmid quantity. I reasoned that the previous transfection conditions may not have been optimal and therefore, I attempted a second set of transfections where I increased the plasmid quantities to 4-5 µg and used 1-2 x 106 cells per transfection. In addition, I added an equimolar equivalent of the pMAX-GFP plasmid as a positive control that the transfection was working. The pMAX-GFP plasmid contains only the required functional regions to express the GFP protein, and serves to provide a marker for cells that were successfully co-transfected with the other plasmids of interest.
Post nucleofection, there were identifiably green cells in the culture indicating the transfections were successful in allowing plasmid DNA to enter some cells under these conditions; based on my subjective assessment, the number of cells that were GFP positive
67 8======D was admittedly low. Although the transfection efficiency was likely low, I chose to carry out the necessary steps to test the transfected cell populations by the SURVEYOR assay.
As before, I was unable to detect a ~225bp band by agarose gel electrophoresis, indicating that these transfection conditions were also not suitable for editing of 53BP1 (Figure 4-4).
Cellectis performed these experiments in house, and sequenced the edited region of 53BP1 to validate that the constructs I was using were able to edit the targeted region. I do not think that the ability of the TALEN constructs to edit 53BP1 was the issue in these experiments, rather I believe it was a combination of two related factors: 1) a low transfection efficiency (which is compounded when there are two required plasmids) and
2) the untransfected/unedited population quickly diluting out any transfected and diluted clones that were present. Unfortunately, MM cells are notoriously difficult to transfect, and are typically only amenable to viral infection as a method of transduction of plasmid DNA.
Additionally, the plasmids provided by Cellectis lack any antibiotic selection cassette that would have enabled me to isolate cells that were able to uptake the needed plasmids.
68 8======D
Figure 4-4: SURVEYOR assay for mutation of 53BP1 by TALEN MM1S cells were transfected with TALEN plasmid pairs: pTAL.EF1α.025105 and pTAL.EF1α.025104 (C45), or, pTAL.EF1α.025102 and pTAL.EF1α.025103 (C23). 4 days post transfection (A) and 6 days post transfection (B), gDNA was extracted from the cells, and a ~400bp region of DNA flaking the 53BP1 cut site was PCR amplified. SURVEYOR mutation detection assay was used to analyze the editing of 53BP1. (A) First iteration of transfections done in duplicate where 2.5µg of each plasmid was electroporated into 2x106 cells by nucleofection. (B) Second iteration of transfections done with 4µg or 5µg of each plasmid (C45 only), or and 1x106, 1.5x106, or 2x106 cells per condition.
69 8======D
4.3 Employing the CRISPR/Cas9 genome editing technique to knock-out 53BP1
4.3.1 CRISPR/Cas9 instead of TALEN?
In consideration of the limitations previously mentioned for the TALEN constructs used as a method to edit 53BP1, I sought to find a way to increase the likelihood that I was able to successfully edit 53BP1. The highly popular and novel technique of CRISPR/Cas9 was just emerging at this time. The Zhang lab had published a paper on the use of CRISPR/Cas9 in genome wide drug screens, and deposited the backbone plasmids used in their experiments on Addgene. (115) The plasmids used in their work were inexpensive and seemed ideal for our purposes; they were able to be packaged into lentiviral particles increasing the likelihood of transduction, and had a selection cassette for puromycin.
Additionally, generating TALEN plasmids for other targets is significantly more difficult than it is to design CRISPR guides for other protein targets, therefore, CRISPR/Cas9 offered more flexibility with targets.
4.3.2 CRISPR/Cas9 mechanism of action
Clustered regularly interspaced short palindromic repeats and the CRISPR associated protein system (CRISPR/Cas9) for genome engineering was first described in 2013 by two independent groups (116, 117). Although this was not the first genome engineering tool developed, CRISPR/Cas9 has a distinct advantage over zinc-finger nucleases, and
TALENs; it is an RNA-guided system. Because the nuclease is localized to the discrete
70 8======D area of the genome by an RNA guide sequence, the ability to design guides to allow Cas9 mediated cleavage at specific areas of the genome is significantly simplified.
The guide-RNA (gRNA) sequence is 20 nucleotides (nt) in length and is juxtaposed to a trinucleotide sequence, NGG, known as a protospacer associated motif (PAM) (118). The
20 nt guide sequence requires the NGG motif (i.e. any nucleotide followed by two guanine residues) in order to direct the cleavage of DNA by the Cas9 nuclease (118). A second
RNA sequence is required for the nucleolytic cleavage of DNA; the trans-activating
CRISPR RNA (tracrRNA). The CRISPR/Cas9 systems used in my work consists gRNA fused to a tracrRNA. Conveniently, the Cas9 nuclease is also integrated into the plasmids used herein. When the gRNA, tracrRNA and Cas9 protein are expressed in a cell, the gRNA/tracrRNA fusion guide the Cas9 protein to the region of DNA complementary to the gRNA. When the gRNA forms a DNA-RNA hybrid, and the Cas9-gRNA-tracrRNA are assembled at the site, the Cas9 nuclease introduces a double-stranded DNA break three nucleotides upstream of the NGG PAM sequence (119).
After the introduction of a DSB by the Cas9 nuclease, the break requires repair. Just as with the TALEN system, the introduction of an insertion or deletion (indel) from repair error, most likely by NHEJ, is what determines the effective knock-out of the targeted protein. It has been shown that cells transduced with CRISPR/Cas9 introduce indels at their target loci at greater than 90% efficiency 11 days post-transduction (115). See Figure 4-5 for a simplified diagrammatic representation of CRISPR/Cas9 editing.
71 8======D
Figure 4-5: Mechanism of CRISPR/Cas9 genome editing Simplified schematic of how the CRISPR/Cas9 system is utilized to generate cells that are null mutants at a user-selected genetic locus. A 20NT guide RNA (gRNA), a tracrRNA and the Cas9 protein are all ectopically expressed. The 20NT gRNA serves as the “GPS coordinates” for the Cas9 and tracrRNA. Upon localization of all three components at the specified genetic loci, the Cas9 endonuclease cleaves both strands of the DNA double helix, resulting in a double-stranded DNA break. This will continue to happen so long as the cell expresses all three components of the gene-editing tool. Eventually, the error prone NHEJ DNA repair system will create an insertion or deletion that may disrupt protein function or expression. The cells expressing the CRISPR/Cas9 specific to your target can be separated into single cell clones, amplified, and screened for the inability to produce the target protein.
72 8======D
4.3.3 Using CRISPR/Cas9 to edit 53BP1 and RNF168
4.3.3.1 pLENTICRISPRv2 CRISPR/Cas9 of 53BP1
4.3.3.1.1 Designing guides for TP53BP1
Designing the guides sequences for targeting TP53BP1 employed the same reasoning as designing the TALEN target recognition sequence. Due to there being very few amino acids that are translated in the first exon, and the alternate start codon in the second exon of the gene, I chose to target exon 2 for knock-out of 53BP1. In addition, I aligned the sequences for all of the 53BP1 transcripts that are protein coding, and would not translate into significantly truncated forms of the protein, to ensure that I would target as many isoforms of the protein as possible. The second exon is incorporated into the transcripts of all isoforms of 53BP1 and was therefore suitable for targeting. The sequence for the second exon of TP53BP1 was acquired from Ensembl using the transcript that expresses the full- length protein (transcript ID: ENST00000382044), and the CRISPR design tool by MIT
(crispr.mit.edu) was used to generate the 20 nt guide sequences to be inserted into the plasmid pLENTICRISPRv2. Guides were chosen based on their predicted fidelity for the target sequence, and were preferentially chosen if low off-target binding was predicted.
Please refer to Table 2-2 for guide sequences.
73 8======D
4.3.3.1.2 Screening for Mutation of TP53BP1
OPM2 cells were infected with lentiviral particles carrying pLENTICRISPRv2 with gRNA inserted designed to target exon 2 of TP53BP1. After selection with puromycin protein was extracted from the heterogenous population of cells transduced with pLENTICRISPRv253BP1-E1. Western blot analysis of 53BP1 expression in OPM2CRISPR-
53BP1-E2 cells showed a significant reduction of 53BP1 protein (Figure 4-7(a)). To establish a monoclonal population of cells, the OPM2CRISPR-53BP1-E2 cells were sorted into single cell colonies using the serial dilution technique (Figure 4-6). Two monoclonal populations,
OPM2CRISPR-53BP1-E2 C6 and OPM2CRISPR-53BP1-E2 C7, showed a significant reduction in
53BP1 protein by western blot analysis (Figure 4-7(b)). The OPM2CRISPR-53BP1-E2 C7 cells were also analyzed by SURVEYOR assay indicating successful cleavage of a mismatch in the heteroduplex DNA (Figure 4-7(c)). The western blot and SURVEYOR assays proved to be optimistic, however, when OPM2CRISPR-53BP1-E2 C6 and OPM2CRISPR-53BP1-E2 C7 were subjected to 10Gy of γ-irradiation, and stained for 53BP1, 53BP1 IRIF formed readily.
74 8======D
Initial Cell Placement
2nd series of doubling dilutions
s
n
o i
t 1 2 3 4 5 6 7 8 9 10 11 12
u l
i A 4000 2000 1000 500 250 125 63 31 16 8 4 2
d
g B 2000 1000 500 250 125 63 31 16 8 4 2 1
n i
l C 1000 500 250 125 63 31 16 8 4 2 1 0 b
u D 500 250 125 63 31 16 8 4 2 1 0 0 o
d E 250 125 63 31 16 8 4 2 1 0 0 0
f
o F 125 63 31 16 8 4 2 1 0 0 0 0
s G 63 31 16 8 4 2 1 0 0 0 0 0
e i
r H 31 16 8 4 2 1 0 0 0 0 0 0
e
s
t s
1 Figure 4-6: Single cell sorting of suspension cells Producing single cell clones by serial dilution. Cells seeded in the initial well (A1) are diluted down column 1. Using a multichannel pipette the 8 wells of column one are serially diluted across the rows until reaching the final column 12. The red region is unlikely to have single cell clones, and will have a heterogeneous population. The yellow region may have single cell clones, however, it is still less likely. Wells in the green region are the most likely to have a cell population derived from a single cell clone.
75 8======D
Figure 4-7: CRISPR 53BP1 Exon2 verification of mutation and knockout OPM2 cells were infected with LV particles carrying pLENTICRISPRv2 targeting exon 2 of 53BP1. (a) Post-selection with puromycin, OPM2 CRISPR 53BP1 cell whole cell lysates were compared to OPM2 WT by western blot. (b) OPM2 CRISPR 53BP1 cells were sorted into single cell clones using the methods in Figure 4-6 and amplified. Whole cell lysates from each individual clone were compared to OPM2 WT cells for 53BP1 expression by western blot. (c) C7 cells from (b) were gDNA extracted and the CRISPR target region was amplified by PCR. The fragment was then analysed using the SURVEYOR Mutation Detection assay. (d) OPM2 CRISPR 53BP1 clones C6 and C7 from (b) were analysed by immunofluorescence for 53BP1 foci formation in response to 10 Gy γ-irradiation.
76 8======D
4.3.3.1.3 53BP1 antibody validation by western blot
To ensure that the results seen in Figure 4-7 were genuine and not a result of the antibody binding to an off-target protein, I sought to test the 53BP1 antibodies I had available for their ability to detect 53BP1 by western blot and immunofluorescence. Whole cell protein extracts were prepared from U2OSWT, U2OS53BP1-/-, three different OPM253BP1-WT cell lines
(OPM2-R, OPM2-17B and OPM2-F1), OPM2CRISPR-53BP1-E2 C6, OPM2CRISPR-53BP1-E2 C7, and OPM2CRISPR-RNF168 cell lines. The extracts were run on two separate 8-12% SDS-PAGE gels, and transferred to two individual nitrocellulose membranes for wesetern blot analysis.
The first membrane was first probed with an antibody targeting 53BP1 between resuides
350 and 400 (NB100-304; Novus), which indicated that there was a band produced in all of the OPM2 cell lines and the U2OSWT, and no 53BP1 present in the U2OS53BP1-/- cell line
(Figure 4-8). This membrane was then reprobed with an antibody targeting DNA-PKcs to use as a size appropriate loading control. The membrane was then stripped and reprobed with an antibody targeting 53BP1 between residues 1925-1972 (NB100-305; Novus), which indicated a band in all cell lines except U2OS53BP1-/- (Figure 4-8). It should be noted that the dark band in Figure 4-8 when probed with NB100-305 is residual staining of DNA-
PKcs, and not 53BP1; 53BP1 is the faint band below DNA-PKcs and is hard to resolve at darker exposures due to DNA-PKcs antibody signal strength.
The second membrane was first probed for 53BP1 using an antibody targeting the residues translated by exons 11 and 12 (21083; Abcam), which showed a size appropriate band in
77 8======D all protein samples except U2OS53BP1-/- and a presumably non-specific band signifcantly lower in all samples (Figure 4-8). This membrane was then reprobed for DNA-PKcs, again as a size appropriate loading control, and indicated relatively equal loading between samples (Figure 4-8). The membrane was then stripped and reprobed with an antibody reared against GST-tagged full-length 53BP1 (PC712; CalBiochem), which indicated a size appropriate band for 53BP1 in all samples except U2OS53BP1-/- (Figure 4-8). Again, in this instance, the highest dark band present in all samples of this western blot is residual
DNA-PKcs (Figure 4-8).
Taken together, the results of these antibody validation experiments indicates that all four antibodies used were unable to detect a band in the U2OS53BP1-/- cell line thereby validating their use for 53BP1 knock-out screening. However, it is apparent that the cleanest antibody of the four is the Novus NB100-304 , which was exclusively used for all 53BP1 western blots after this validation experiment was performed. Additionally, it is apparent that the
OPM2CRISPR-53BP1-E2 C6 and OPM2CRISPR-53BP1-E2 C7 clones do indeed express 53BP1 and it is detectable by western blot. Consistently across all four antibodies used, it does seem that there was lower quantity of 53BP1 protein in the OPM2CRISPR-53BP1-E2 C6 line, which indicates that this population is heterogeneous for 53BP1 expression or possibly that the cell line is heterozygous for 53BP1.
78 8======D
Figure 4-8: Testing of 53BP1 antibody specificity by western blot Whole cell lysates from U2OSWT, U2OS53BP1-/-, three different clonal populations of OPM2, OPM2 CRISPR 53BP1 clones C6 and C7 as well as established OPM2RNF168-/- cells were probed using four different antibodies for 53BP1. Two individual, but identical, membranes were used. The first membrane was probed with NB100-304 (Novus), then NB100-305 (Novus) and lastly DNA-PKcs (ab18192, AbCam) as a size appropriate loading control. The second membrane was probed with 21083 (AbCam), PC712 (CalBiochem), and lastly DNA-PKcs (ab18192, AbCam) as a size appropriate loading control.
79 8======D
4.3.3.1.4 53BP1 antibody validation by immunofluorescence
U2OSWT and U2OS53BP1-/- cell lines that were irradiatied with 0 Gy or 10 Gy of γ-irradiation were used to validate the ability of the four aforementioned antibodies to detect 53BP1
IRIF. With all four antibodies, IRIF were easily detected for 53BP1, at 30 minutes post- irradiation, in the U2OSWT cell line. As expected, U2OS53BP1-/- cells were unable to form
53BP1 IRIF at 30 minutes after 10 Gy γ-irradiation; a result that was consistent across all four antibodies. These results can be seen in
Figure 4-9 (a) – (d).
80 8======D
81 8======D
82 8======D
83 8======D
Figure 4-9: Testing of 53BP1 specificity by immunofluorescence U2OSWT and U2OS53BP1-/- cells were stained for 53BP1 (AF488) and γH2AX (AF594). Available 53BP1 antibodies (a) NB100-304 (Novus), (b) NB100-305 (Novus), (c) ab21083 (Abcam), and (d) PC712 (CalBiochem) were tested for their ability to detect 53BP1 foci in response to IR. γH2AX was used to determine the extent and location of DSB induced by IR. Cells were irradiated with 10 Gy of γ-irradiation, and fixed 30 minutes post-IR.
84 8======D
4.3.3.2 pLENTICRISPRv2 targeting RNF168 in OPM2
4.3.3.2.1 RNF168 targeting guide-RNA design
Guide design was carried out using the same method as seen in 4.3.3.1.1. The guide I chose to target RNF168 was in the first exon. Please refer to Table 2-2 for primer sequences.
4.3.3.2.2 Validating OPM2RNF168-/- cell line
pLENTICRISPRv2RNF168 packaged into lentiviral particles was used to infect MM cell line
OPM2. Post-infection, and subsequent selection with puromycin, I wanted to verify that the heterogenous population of transduced cells had a sufficiently visible knockdown of
RNF168 before I proceeded to single cell cloning. Interestingly, the efficiency of the pLENTICRISPRv2 in this instance showed that there was no need of single cell sorting of these cells, as western blot analysis confirmed that no RNF168 was present (Figure
4-10(b)). Furthermore, RNF168 knockout has been shown to abrogate the formation of
53BP1 IRIF (62, 120). Using this as a secondary method of RNF168 knockout validation,
I subjected OPM2WT and OPM2RNF168-/- cells to γ-irradiation and assayed their ability to form 53BP1 IRIF by immunofluorescence. As expected, the wild-type OPM2 cells formed
IRIF dependent 53BP1 foci that co-localized with γH2AX (Figure 4-10(a)). In contrast, the
RNF168 deficient OPM2 cells showed diffuse, pan-cellular 53BP1 staining, that failed to form discrete 53BP1 foci that co-localized with γH2AX DNA damage positive sites
(Figure 4-10(a)).
85 8======D
Figure 4-10: Verification of OPM2RNF168-/- CRISPR knock-out OPM2 cells infected with LV particles carrying CRISPR/Cas9 targeting RNF168. (a) OPM2 CRISPR/Cas9 RNF168 infected cells were assayed for their ability to form IRIF induced 53BP1 foci. Cells were irradiated with 4 Gy IR, and fixed 3.5 hours post IR. Representative images of staining for 53BP1 and γH2AX shown here. (b) Western blot of whole cell lysates from OPM2 cells infected with CRISPR/Cas9 targeting RNF8, and RNF168, were analyzed for protein expression compared to WT OPM2 cells.
86 8======D
4.4 Revisiting CRISPR/Cas9 editing of 53BP1
To confirm the hypothesis that 53BP1 is the linchpin molecule behind the synthetic lethality seen with concomitant PARPi and PI, I stubbornly wanted to attempt to knockout
53BP1 in a slightly different way than before. After failing to knockout 53BP1 using the pLENTICRISPRv2 CRISPR/Cas9 plasmid mentioned previously (section 4.3), I reasoned that it might be easier to use a GFP-fused Cas9 system to sort for successfully transduced cells. This would then enable me to single cell sort by FACS based on GFP expression, where I could then screen clones for 53BP1 expression.
4.4.1 Using pSp-Cas9(BB)-2A-GFP to edit 53BP1
I obtained the pSp-Cas9(BB)-2A-GFP (PX458), developed in the Zhang lab at MIT, from
Addgene. Although this plasmid is not able to be packaged in a lentiviral vector, it has a
GFP-Cas9 fusion protein, rather than a selectable marker as used previously. In addition, this plasmid contains the gRNA/tracrRNA fusion required for Cas9 editing, making this a single plasmid system.
I transfected MM1S cells with the PX458 plasmid using TransIT-2020 (Mirus) lipid based transfection reagent and allowed them to recover from transfection. Epiflourescience microscopy confirmed that there were some positively transfected cells as indicated by
GFP fluorescence. I took these cells down to the flow cytometry core facility who were able to sort the GFP positive cells from the GFP negative cells into a single well of a six-
87 8======D well plate using the BD FACS AriaIII cell sorter. The final report of the cell sorting indicated that there were 86207 GFP positive cells out of 10458958 total cells counted; an
0.82% transfection efficiency was achieved. I then incubated the cells overnight to allow them to recover from the sorting. Thereafter I was able to single cell sort the cells in multiple 96 well plates by serial dilution, as described previously. A diagrammatic representation of this process can be seen in Figure 4-11. Three days after sorting the cells,
I observed the 96 well plate for wells that contained very few cells, as these were most likely to be derived from a single cell that had undergone one or two population doublings.
There were ~50 wells that met the criteria used for inclusion. The cells were then amplified until there were enough cells to be analyzed, however, I chose not to use western blot analysis or SURVEYOR mutation detection with this iteration of CRISPR/Cas9.
The goal of the CRISPR/Cas9 editing here was to generate cells that were unable to form
53BP1 IRIF when dosed with γ-irradiation, or PARPi. To this end, I elected to develop a method to screen clones in a batch-wise manner using immunofluorescence. To selectively adhere monoclonal populations to discrete areas of a glass coverslip I added poly-D-lysine
(PDL), a common reagent used to adhere suspension cells to glass slides, in 10 µL aliquots equally spaced from each other. After allowing the PDL coating to cure, monoclonal populations were concentrated in microfuge tubes and re-suspended in ~20 µL of culture media. 10 µL of the concentrated cells was added to the coverslips, where the PDL had been added previously, in a sequential manner. I then incubated the cells for 30 minutes to allow them to adhere to the coated surface, and I then carried out immunofluorescence staining as I describe in the methods section (Figure 4-12). This allowed me to screen 18
88 8======D different populations of cells, on a single 22x44mm coverslip using only 2 µL of each primary antibody (53BP1 and γΗ2AX) for all 50 monoclonal cell populations.
I scored the 50 monoclonal populations based on their ability to form 53BP1 IRIF in response to 4 Gy γ-irradiation. At 1 hour post IR, the cells were plated and stained for
53BP1 as described above. I found that of the 50 populations scored: 14 samples were of poor quality or had too few cells (possibly due to viability issues), 15 samples readily formed 53BP1 IRIF in all cells present, 14 samples showed a heterogenous population where some cells did form 53BP1 IRIF while others did not, and 7 samples that did not appear to form 53BP1 IRIF at all (Table 4-1).
I discarded all samples that were of poor quality, or formed 53BP1 IRIF in any capacity.
The 7 samples that did not form 53BP1 IRIF, were then cultured until sufficient numbers were available for immunofluorescence as done traditionally with a single sample on a
22x22mm cover slip.
89 8======D
Figure 4-11: Schematic of CRISPR/Cas9 editing process for cells transfected with pSp-Cas9(BB)-2A-GFP Cells are transfected with the pSp-Cas9(BB)-2A-GFP plasmid. Following transfection, GFP+ cells are sorted by FACS into a 6 well plate and cultured overnight to recover from sorting. GFP+ cells are then sorted into single cell clones by dilution.
90 8======D
Figure 4-12: Technique for screening CRISPR/Cas-9 edited cells for IRIF ability Poly-D-lysine is added in 10µL aliquots in uniformly spaced drops on a 22x44 mm No. 1.5 glass cover slip and allowed to incubate at RT for 10 minutes. The droplets are then aspirated, and the slide is left to dry. Cells are put into a 1.5µL microfuge tube and centrifuged at 500xg for 5 minutes. All but ~20µL of the media is aspirated from the microfuge tube. The cells are then resuspended in the remaining media, and added to the poly-D-lysine treated spots in 10µL droplets, and incubated until cells adhere to the treated cover slip. After cells have adhered to the poly-D-lysine, normal immunofluorescence staining can be carried out as per usual.
91 8======D
Table 4-1 Screening for 53BP1 knock-outs by immunofluorescence Clonal populations of MM1S cells transfected with CRISPR/GFP-Cas9 plasmid targeting 53BP1 and single cell sorted as described in Figure 4-11 and Figure 4-12 were scored for their ability to form 53BP1 foci in response to IR. + indicates 53BP1 IRIF were present, - indicates 53BP1 IRIF were absent, +/- indicates a heterogeneous population of cells with 53BP1 IRIF, and P/S indicates the sample was of too poor quality (likely due to poor viability) or no cells were present for analysis. Samples were scored using an AxioObserver.Z1 (Carl Zeiss) fitted with a 63x/1.4 NA oil immersion objective (Plan Apochromat)
Sample Foci? Sample Foci? 1 PS 26 +/- 2 +/- 27 +/- 3 - 28 + 4 - 29 PS 5 - 30 PS 6 + 31 +/- 7 + 32 PS 8 + 33 +/- 9 + 34 + 10 PS 35 PS 11 + 36 PS 12 PS 37 - 13 PS 38 + 14 + 39 PS 15 +/- 40 + 16 +/- 41 PS 17 +/- 42 + 18 +/- 43 +/- 19 - 44 +/- 20 + 45 - 21 PS 46 + 22 PS 47 +/- 23 + 48 +/- 24 PS 49 +/- 25 + 50 -
92 8======D
Of the 7 samples that were 53BP1 IRIF negative by high- throughput screening, 4 samples did form IRIF when analyzed with a large population, and three continued to show an inability to form 53BP1 IRIF: MM1SC3, MM1SC19, and MM1S C50 (Figure 4-13(a-d)). With
MM1SWT as a control, it is fairly clear that the wild-type cells show clear formation of discrete 53BP1 foci, whereas MM1SC3, MM1SC19, and MM1S C50 do not. There are some bright foci that seem to appear in some of the images of these clones, however, I believe those to be an artifact of imaging and image processing rather than true 53BP1 foci; using the wild-type cells and γH2AX staining for a comparison, it is easy to see that the 53BP1 staining does not appreciably change with respect to the non-irradiated controls for these three monoclonal populations.
Quizzically, when I analyzed these cells by western blot, there was a size appropriate band for 53BP1 present in all three clones (Figure 4-13(e)). The loading control αTubulin indicates that there was significantly more protein loaded for the wild-type control, than with the CRISPR/Cas9 treatead clones, however, the C50 clone seems to have quite a low level of 53BP1 (Figure 4-13). In the future I would like to analyze these clones for their
53BP1 genotype to find out exactly what is being expressed in these clones such that they
93 8======D are unable to form IRIF, but do seem to have 53BP1 present. The same antibody was used for the 53BP1 IRIF analysis by immunofluroescence and the western blot analysis.
94 8======D
95 8======D
c)
d)
96 8======D
e)
Figure 4-13: Verification of gene editing of 53BP1 by CRISPR/Cas9 in MM1S cells Single cell clones of MM1S cells that were 53BP1 IRIF negative by an initial high- throughput screen were stained en masse for 53BP1 and γΗ2AX +/- 4Gy IR. Representative images of 53BP1 and γH2AX staining are shown here for: (a) MM1SWT CTRL, (b) MM1SC3, (c) MM1SC19, and (d) MM1SC50. Whole cell lysates were also extracted from each of these cell lines and analyzed by western blot for 53BP1 expression (e). Samples were scored using an AxioObserver.Z1 (Carl Zeiss) fitted with a 63x/1.4 NA oil immersion objective (Plan Apochromat). Images were acquired using an AxioCam MRm Rev.3 (Carl Zeiss).
97 8======D
4.5 Other CRISPR/Cas9 targets that were unsuccessful
There were a few other target proteins that I sought to knockout by CRISPR/Cas9, but was unable to successfully do so: RNF8, PSMB5, POH1 (or PSMD14), and DIS3. Similar to the reason behind targeting RNF168, targeting of RNF8 was of interest due to its role in the DSB repair response upstream of 53BP1 recruitment where loss of RNF8 results in loss of 53BP1 IRIF formation (59, 121, 122). Unfortunately, I was unable to show any protein reduction in RNF8 after targeting with CRISPR/Cas9 by western blot (Figure 4-14(a)).
PSMB5 is the main catalytic subunit of the proteasome that is inhibited by BTZ and point mutations at the catalytic residue, and loss of or overexpression of PSMB5 result in MM resistance to BTZ (123). I wanted to determine if the changes in the DNA damage response seen with BTZ treatment would remain if the cells were resistant to BTZ. The antibody I had used to detect PSMB5 levels was unable to detect the protein in wild-type OPM2 cells and OPM2 CRISPR/Cas9PSMB5 infected cells (data not shown).
POH1, a deubiquitinating enzyme, ha s been shown to be involved in the removal of 53BP1 from DSB sites to favor pathway switch to HR in S/G2 phases of the cell cycle
(103). As POH1 is also a regulatory subunit of the 19S proteasome, I wanted to determine if POH1 ablation could recapitulate the effects seen with proteasome inhibition.
Unfortunately, OPM2 CRISPR/Cas9POH1 infected cells showed no decrease in POH1 protein when compared to their wild-type counterparts (Figure 4-14(b)).
98 8======D
DIS3 is an exoribonuclease that is mutated in ~10% of MM patients (11). Interestingly, it has also been shown that Dis3 mutations can result in the accumulation of R-loops and contribute to genome stability (124). As mentioned previously, MM tend to have high levels of DNA damage at baseline, and have a high level of genomic instability. To this end, I was curious to see if DIS3 ablation would affect the extent of DNA damage or DSB repair in MM. I was unable to detect a reduction in DIS3 protein, by western blot, in cells infected with CRISPR/Cas9DIS3 (Figure 4-14(c)).
The proteins in this section that I attempted to knockout with CRISPR/Cas9 were not pursued further, as priority was set on knocking out 53BP1 and RNF168.
99 8======D
Figure 4-14: Western blot analyses for CRISPR infected cells – unsuccessful (a) OPM2 cells were infected with pLENTICRISPR_v2 LV particles targeting RNF8 for protein knock out. (b) OPM2 cells were infected with pLENTICRISPR_v2 LV particles targeting POH1 and PSMB5 for protein knock out. No band could be detected for PSMB5 with the available antibodies and it is unknown if it was successful. PSMB5 CRISPR cells were frozen for analysis at a later date. (c) KMS11 cells were infected with pLENTICRISPR_v2 LV particles targeting DIS3 for protein knock out.
100 8======D
4.6 Other CRISPR/Cas9 targets that were successful
There are other ongoing projects in our lab be conducted by my colleagues that would have benefited from having CRISPR/Cas9 gene editing. I used the tools I had learned for
CRISPR/Cas9 and applied that to CRBN, IRF3 and STAT1; proteins that are being investigated for their roles in different therapeutic strategies for MM. I successfully generated CRISPR/Cas9 lentiviral particles targeting CRBN, IRF3 and STAT1. Dr. Paola
Neri was able to establish six OPM2CRBN-/- cell lines, one KMS11CRBN-/- cell line, one
OPM2IRF3-/- cell line, and one KMS11STAT1-/- cell line using these lentiviral particles.
101 8======D
Figure 4-15: Successful CRISPR/Cas9 gene editing for other projects. (a) KMS11 and OPM2 cells were infected with LV particles carrying pLENTICRISPR_v2 targeting CRBN (a), IRF3 (b), and STAT1 (c). Post-selection, cells were single cell sorted by serial dilution (see Figure 4-6). Western blot analyses of whole cell lysates to determine if CRISPR/Cas9 editing was successful. WT lysates were used as expression controls. Western blot analysis of cell lines by Paola Neri, Nizar Bahlis Lab.
102 8======D
CHAPTER FIVE: 53BP1 and Multiple Myeloma
When assessing 53BP1 foci in these experiments, rather than using ABT-888 to induce
DNA damage, I elected to use IR for many of my experiments due to the simplicity and consistency of dosage, and clarity of the results. Additionally, DNA damage induction with
ABT-888 would require that the cells be cultured in treated media for a substantial amount of time and to observe the effects of BTZ on 53BP1 foci would be difficult due to MM cells being extremely sensitive to even single-digit nanomolar doses of BTZ.
As previously mentioned, in U2OS cells treated with a proteasome inhibitor, but not in
MM cells, there is a reduction in 53BP1 foci in response to IR induced DNA damage
(Figure 1-5). The published reports on PI effects on 53BP1 recruitment to DNA damage were, however, conducted using the PI MG-132 which has a different dosage and toxicity profile than does BTZ and is not approved for clinical use against MM. In light of this, it was important that we utilized the PI BTZ for our experiments as it would be directly translatable to a clinical model. This required that I was to determine an appropriate assay for observing the effects of BTZ on 53BP1 in both U2OS as a control, and in MM cells.
This assay would require that the following conditions were met:
1) The dose of BTZ used was able to deplete 53BP1 IRIF in U2OS at a specified
time interval.
103 8======D
2) The dose determined in condition 1 did not cause significant cell death to MM
cells at the determined time interval.
First, I used U2OS cells to determine an appropriate dose of BTZ for 53BP1 foci abrogation in response to 2 Gy IR. I chose to do so at a 4 hour BTZ pre-treatment interval prior to IR
DNA damage induction due to BTZ being reported to have a 8.3 hour half-life in culture media (125). The cells were fixed at a minimum of 30 minutes post IR treatment, as it has been shown that 53BP1 foci formation peaks at this time and slowly dissipates thereafter
(126). I scored 53BP1 foci by immunofluorescence in U2OS cells that were treated with
BTZ for 4 hours, irradiated with 2 Gy IR, and fixed 1 hour post IR. BTZ doses were determined by serial doubling dilutions starting at 1250 nM continuing down to 10 nM.
The number of 53BP1 foci was compared to the number of γH2AX foci in order to determine the extent of 53BP1 foci loss at active DSB sites. At doses as low as 10 nM,
BTZ was able to significantly reduce the number of 53BP1 foci per cell when compared to
γH2AX foci (p = 1.49x10-5) (Figure 5-1). This effect was also directly proportional to increasing BTZ dose where 39 nM and 156 nM were also able to significantly reduce
53BP1 foci relative to γH2AX foci (p = 5.97x10-13, p = 2.19x10-11; respectively) (Figure
5-1 (a)). A summary of the mean number of 53BP1 and γH2AX foci per cell per condition and accompanying statistics can be seen in Table 5-1.
Next, to determine if these conditions were also suitable for analysis of MM cells, I performed the identical experiment in the MM cell line MM1S. For MM1S the mean number of 53BP1 foci per cell relative to the mean number of γΗ2AX foci was only
104 8======D significantly different in the control condition (Table 5-2). Although this is statistically significant, it is unlikely to be biologically significant and is possibly an artifact of the necessary steps of image processing spherical suspension cells; this processing is not required in U2OS, which are adherent and wonderful to image. Furthermore, it is clear that the number of 53BP1 foci, relative to the number of γH2AX foci remains fairly consistent across all the conditions tested, irrespective of the treatment of BTZ (Figure 5-2). A summary of the mean number of 53BP1 and γH2AX foci per cell, per condition, can be seen in Table 5-2.
105 8======D
Table 5-1: Foci per cell in U2OS cells irradiated after pre-treatment with BTZ at varying dosages U2OS cells were pre-treated with BTZ (0nM, 10nM, 39nM, or 156nM) for 4 hours before treatment with 0 Gy, or 2 Gy of γ-irradiation. 53BP1 (AF488) and γ-H2AX (AF594) were stained 1hr post IR to observe the effects of BTZ on 53BP1 foci formation. For each condition 30 cells were quantified by manual counting from a single experiment (n=1). P- values were determined using students t-test. * indicates statistical significance at a 95% confidence interval.
Mean Mean 53BP1 γH2AX Foci foci p-value
CTRL 1.96 1.23 0.16
2 Gy IR 28.3 34.2 0.036*
10 nM BTZ + 24.5 35.0 1.49x10^-5* 2 Gy IR 39 nM BTZ + 10.3 34.1 5.97x10^-13* 2 Gy IR 156 nM BTZ + 7.1 33.2 2.19x10^-11* 2 Gy IR
106 8======D
Figure 5-1 The effects of BTZ on γ-irradiation induced 53BP1 foci in U2OS U2OS cells were pre-treated with BTZ (0nM, 10nM, 39nM, or 156nM) for 4 hours before treatment with 0 Gy, or 2 Gy of γ-irradiation. 53BP1 (AF488) and γ-H2AX (AF594) were stained to observe the effects of BTZ on 53BP1 foci formation at 1hr post IR. (a) For each condition 30 cells were quantified by manual counting from a single experiment (n=1). The bright red dot indicates the mean foci per cell, and the whiskers indicate the standard deviation, calculated using R-statistics. (b) Representative images of U2OS cell staining. The cells were imaged with a Zeiss Axio Observer.Z1 (Carl Zeiss) using a Plan Apochromat 63x/1.4NA (oil immersion) objective, and AxioCam MRm Rev.3 (Carl Zeiss).
107 8======D
Table 5-2: Foci per cell in MM1S cells irradiated after pre-treatment with BTZ at varying dosages MM1S cells were pre-treated with BTZ (0nM, 10nM, 39nM, or 156nM) for 4 hours before treatment with 0 Gy, or 2 Gy of γ-irradiation. 53BP1 (AF488) and γ-H2AX (AF594) were stained 1hr post IR to observe the effects of BTZ on 53BP1 foci formation. For each condition 30 cells were quantified by manual counting from a single experiment (n=1). P- values were determined using students t-test. * indicates statistical significance at a 95% confidence interval.
Mean Mean 53BP1 γH2AX p-value Foci foci
CTRL 5.7 3.4 0.017*
2 Gy IR 14.3 15.2 0.35
10 nM BTZ + 15.7 16.6 0.42 2 Gy IR 39 nM BTZ + 16.5 18.4 0.29 2 Gy IR 156 nM BTZ + 14.3 14.3 0.51 2 Gy IR
108 8======D
Figure 5-2 The effects of BTZ on γ-irradiation induced 53BP1 foci in MM MM1S cells were pre-treated with BTZ (0nM, 10nM, 39nM, or 156nM) for 4 hours before treatment with 0 Gy, or 2 Gy of γ-irradiation. 53BP1 (AF488) and γ-H2AX (AF594) were stained to observe the effects of BTZ on 53BP1 foci formation at 1hr post IR. (a) For each condition 30 cells were quantified by manual counting from a single experiment (n=1). The bright red dot indicates the mean foci per cell, and the whiskers indicate the standard deviation, calculated using R-statistics. (b) Representative images of MM1S cell staining. The cells were imaged with a Zeiss Axio Observer.Z1 (Carl Zeiss) using a Plan Apochromat 63x/1.4NA (oil immersion) objective, and AxioCam MRm Rev.3 (Carl Zeiss). Z-stacks were acquired for the entire depth of the cell, deconvoluted using the fast iterative algorithm (Zen Pro; Carl Zeiss). A maximum intensity projection (Zen Pro; Carl Zeiss) of the Z-stack was used to make the final images seen above.
109 8======D
It has previously been shown, by our lab and others, that proteasome inhibition results in depletion of nuclear free ubiquitin and nuclear poly-Ub chains. (106, 127) As ubiquitin is so ubiquitous in the successful repair of DNA damage we wanted to determine if MM cells treated with BTZ resulted in depleted nuclear ubiquitin while retaining the ability to form
53BP1 foci. Treatment of MM1S cells with 156nM of BTZ for 4 hours resulted in a depletion of nuclear poly-Ub (FK2) staining; depletion of both diffuse staining and discrete foci formation (Figure 5-3). Similarly, depletion of FK2 staining was also evident when
BTZ treated cells were subsequently treated with γ-IR. (Figure 5-3) In contrast, MM1S cells not treated with BTZ readily formed FK2 foci that co-localize with 53BP1 foci
(Figure 5-3). It is particularly difficult to illustrate the extent of depletion of FK2 staining in the nuclear region of spheroid cells in two-dimensions, however, three-dimensional reconstruction of z-stacked images of the cells seen in Figure 5-3 show that FK2 staining is completely excluded from the nuclei of cells treated with BTZ. In addition, the 53BP1 foci formation is clearly visible in the nuclear region that is devoid of FK2 staining. (3D data not shown due to medium of thesis)
This result was interesting and indicated that MM cells may have a differential recruitment mechanism for 53BP1; one that lacks the requirement of H2A-K15/13-Ub. To further investigate the necessity of H2A-K15/13 ubiquitination for 53BP1 recruitment in MM, I used site directed mutagenesis on pCDNA3.1+ FLAG-H2AWT vector to generate lysine to arginine mutated vectors. Fradet-Turcotte et al. (2013) showed that ubiquitination of H2A on K13/15 was necessary for 53BP1 recruitment, but that it was difficult to detect this ubiquitination event due to the presence of a ubiquitin moiety frequently occurring on H2A
110 8======D at K119/120. Therefore, I mutagenized pCDNA3.1+ FLAG-H2AWT to both pCDNA3.1+
FLAG-H2AK13/15R and pCDNA3.1+ FLAG-H2AK119/120R (Figure 5-4). MM1S cells stably transfected with the empty pCDNA3.1+ vector, and pCDNA3.1+ carrying FLAG tagged H2AWT, H2AK13/15R, and H2AK119/120R were subjected to 0 Gy or 10 Gy γ-IR to determine if they were ubiquitinated in a damage dependent manner. Unfortunately, I was unable to detect a characteristic ~8 kDa ubiquitination shift on any of the FLAG tagged plasmids used post IR (Figure 5-4). This was unexpected, and to further investigate I again used these stably transfected cell lines, subjected to 0 or 10 Gy γ-IR, to look for a ubiquitination shift on both endogenous and FLAG-H2A constructs by blotting for H2A rather than the FLAG-tag. Western blot of H2A from these cell lines showed a H2A shifted band, as would be expected from constitutive K119/120 ubiquitination, however, there was no apparent difference between the amount of ubiquitination between cells that received 0 or 10 Gy γ-IR (Figure 5-5). Furthermore, it appeared that the H2A antibody used in this experiment was unable to detect the FLAG-H2A constructs. The addition of a FLAG-tag to the H2A protein causes a noticeable shift in size that can be differentiated from endogenous H2A by western blot by the appearance of two bands at the first ubiquitin shift
(data not shown) which is not seen here (Figure 5-5). Lastly, using the same membrane, I re-probed for γH2AX to determine if I could detect a ubiquitination shift on H2A variant.
Interestingly, I was readily able to detect the ubiquitination shift on γΗ2AX, but not H2AX
(Figure 5-5).
Due to being unable to detect the ubiquitination of the FLAG-H2A constructs, I did not continue to investigate the interaction between them and 53BP1. Rather, I decided to utilize
111 8======D the RNF168-/- MM cell line I engineered to determine if 53BP1 can be recruited to DSBs in the absence of H2A-K13/15 ubiquitination in MM. OPM2 cells deficient in RNF168 are unable to form discrete γ-IR induced 53BP1 foci, which is in contrast to their wild-type counter parts that form 53BP1 readily when irradiated. (Figure 4-10) Although this is not completely definitive, this suggests that 53BP1 recruitment to DSB sites does not have a differential mechanism and H2A-K13/15 ubiquitination is a requirement for 53BP1 foci formation.
112 8======D
Figure 5-3: Effects of BTZ on IR induced 53BP1 and poly-Ub localization MM1S cells were pretreated with 156nM BTZ for 4 hours, irradiated with 4Gy γ-radiation, or both. Cells were fixed 30 minutes post IR treatment and assayed for 53BP1 (AF488), and FK2 (AF594). The cells were imaged with a Zeiss Axio Observer.Z1 (Carl Zeiss) using a Plan Apochromat 63x/1.4NA (oil immersion) objective, and AxioCam MRm Rev.3 (Carl Zeiss). Z-stacks were acquired for the entire depth of the cell, deconvoluted using the fast iterative algorithm (Zen Pro; Carl Zeiss). A maximum intensity projection (Zen Pro; Carl Zeiss) of the Z-stack was used to make the final images seen above.
113 8======D
Figure 5-4: Mutagenesis and expression of FLAG-H2A Constructs (a) A protein alignment of pCDNA3.1+ mammalian expression vector encoded FLAG tagged H2A variants generated to study the H2A-K15Ub dependent recruitment of 53BP1. The FLAG-H2AWT was cloned from human cDNA. This vector was subjected to site directed mutagenesis to produce the FLAG-H2AK119/120R and FLAG-H2AK15R variants. (b) Western blot analysis of whole cell lysates from MM1S cells transfected with constructs: pCDNA3.1+ empty vector, FLAG-H2AWT, FLAG-H2AK15R, and FLAG-H2AK119/120R treated with either 0 or 10 Gy of γ-IR.
114 8======D
IR (10Gy) - + - + - + - +
IB: yH2AX
IB: H2A
IB: H2A (LE)
Figure 5-5: Western blot analysis of H2A and H2AX in response to IR in MM1S cells MM1S cells transfected with the indicated FLAG-H2A constructs were subjected to 10 Gy γ-irradiation and probed for γH2AX and H2A. A IR induced ubiquitination shift was only detected on γH2AX, and not H2A, in my hands. LE = lighter exposure
115 8======D
5.1 High RNF168 expression levels does not correlate with an increase in basal levels of 53BP1 foci in MM
It has been observed by myself, and other members our lab that MM cells appear to have high levels of DNA damage marker foci. Of specific interest to my work was the observation that 53BP1 foci were unusually numerous in MM cells in the absence of exogenous DNA damaging agents. Using the foci per cell data from Figure 5-1 and Figure
5-2, it can be seen that at baseline the average number of 53BP1 foci per cell in U2OS cells was 1.96 and in MM1S cells it was 5.7, which was statistically significant (p = 9.34x10-5-).
Interestingly, Simon Bekker-Jensen and colleagues had noticed that the overexpression of
RNF168 resulted in ubiquitination of H2A and formation of foci or “clumps” of DNA damage markers, independent of DNA damage inducing agents (verbal communication).
Fortunately, MM researchers in Texas (http://www.keatslab.org/) have made RNA-seq data for numerous MM cell lines publicly and freely available for download. I acquired
RNA-seq data from the Keats lab in order to investigate the level of RNF168 expression if different cell lines in an effort to determine if there was a correlation between RNF168 expression level and 53BP1 foci formation in the absence of DNA damage. RNA-seq data can be used to determine the relative expression of transcripts by utilizing the program
Cufflinks which calculates the fragments per kilobase of transcript per million mapped reads (FPKM). FPKM is essentially the measure of the number of reads that map to a particular gene per one million reads that mapped to any particular gene of the reference genome being used.
116 8======D
I organized the FPKM values for RNF168 across 60 different MM cell lines which indicated that there was a large range of expression of RNF168 expression in these cell lines with KMS18 and NCIH929 showing the highest and lowest FPKM for RNF168, respectively. (Figure 5-6) The cell lines that I had FPKM data on, I was only in possession of 9/60 cell lines: OPM2, KMS11-JAPAN, KMS18, JJN3, OPM1, NCIH929, MM1S,
MM1R, and U266. As transcript numbers do not always correlate perfectly to protein levels, I wanted to determine the level of protein expression of RNF168 in the cell lines that I had available. Western blot analysis and quantification using ImageJ indicated that
RNF168 expression to be OPM1, KMS18, U266, JJN3, MM1R, OPM2, KMS11-Japan,
MM1S, H929, and the control OPM2RNF168-/- (in order from highest to lowest
FPKM)(Figure 5-7). The protein levels for RNF168 in these cell lines recapitulated what was found for RNF168 FPKM data.
To determine if the number of 53BP1 foci was correlated to the expression level of
RNF168, I used the data from both western blot and FPKM to choose two cell lines that expressed the highest and lowest levels of RNF168 transcript and protein: KMS18, and
NCIH929, respectively (Figure 5-6 and Figure 5-7). Using these two cell lines, I cultured the cells in normal media without exogenous DNA damaging agents and stained for both
53BP1 and DNA damage marker γ-H2AX. Quantification of the number of 53BP1 foci indicated that KMS18 and NCIH929 had 6.20 and 4.87 foci per cell, respectively; this was not a statistically significant difference (p = 0.22) (Figure 5-8). In addition, both KMS18 and H929 showed no statistically significant difference between the number of 53BP1 foci and γH2AX foci (p = 0.55, and p = 0.15, respectively) (Figure 5-8).
117 8======D
Figure 5-6: Relative expression of RNF168 in various MM cell lines A graphical representation of RNF168 expression. mRNA-seq data, aligned with Tophat2 and FPKM estimations calculated with Cufflinks2, from Jonathan Keats’ lab was downloaded from their online repository (HMCL66_Transcript_expression_FPKM; http://www.keatslab.org/data-repository). FPKM data for RNF168 was isolated, and organized based on expression level.
Although these data indicate that MM cell lines have significantly higher basal levels of
DNA breaks than do U2OS cells, it is unlikely that high RNF168 expression correlates with increased DNA damage foci.
118 8======D
Figure 5-7: RNF168 expression analysis in MM cell lines Whole cell lysates from ten cell lines that ranged from high FPKM expression to low FPKM expression (see Figure 5-7) were probed from RNF168 to corroborate the protein expression profile with the FPKM expression profile. In addition γH2AX levels were probed for to determine if there was a correlation between RNF168 expression and basal levels of DNA damage. H2A and GAPDH probes were used as loading controls for γH2AX and RNF168, respectively. The western blot bands were quantified using ImageJ; RNF168 expression was normalized to GAPDH expression.
119 8======D
Figure 5-8: Analysis of 53BP1 and γH2AX foci in MM cell lines H929 and KMS18 Two cell lines with relatively high (KMS18), or low (H929), expression of RNF168 were left untreated and stained for 53BP1 and γH2AX by immunofluorescence. Foci were scored manually from acquired images for 30 cells per condition. Images were acquired on an Olympus IX81 FV1000 Laser Scanning Confocal microscope using a 60x PlanApo N/1.42NA (oil immersion) objective. n = 1
120 8======D
5.2 RNF168 loss does not confer resistance to synergy seen with concomitant treatment of MM with ABT-888 and BTZ
In order to determine the if the synthetic lethality seen in MM cells treated with BTZ and
ABT-888 described previously was dependent on the cells ability to form 53BP1 foci I chose to use flow cytometry to investigate the viability of MM cells treated with this drug combination.
Initially, due to many unsuccessful attempts at replicating the flow cytometry seen when combining ABT-888 and BTZ from Neri et al. 2011, I elected to re-optimize the experiment in my hands using KMS11 and OPM2 cell lines. These cell lines were chosen due to KMS11 showing the most sensitivity to the combination in Neri et al. 2011, and
OPM2 because at the time I had already generated the OPM2RNF168-/- cells using
CRISPR/Cas9. After trouble shooting the source and quality of the ABT-888 and BTZ I was using (data not shown), I determined that the optimal dosage for ABT-888 (5 µM) and
BTZ (5 nM) for both KMS11, and OPM2 (Supplemental Figure 0-1). Interestingly, the
KMS11 cells were synergistically sensitive to the combination therapy as early as 24 hours, however, OPM2 cells showed little synergy until 48 hours in culture had elapsed
(Supplemental Figure 0-1).
After determining the appropriate dosage required to see the synergistic affect between these drugs in OPM2 cells, I wanted to look at whether or not RNF168 loss would confer resistance to the combination therapy. As previously mentioned, RNF168 is required for
121 8======D
53BP1 recruitment to DNA breaks, therefore loss of RNF168 may have been able to be used as a proxy for 53BP1 loss, as 53BP1-/- MM cells had yet to be able to established. As expected, the loss of RNF168 in OPM2 cells did abrogate the OPM2 cells ability to form
53BP1 foci (Figure 4-10). Although the doses had been determined previously, fortunately multiple doses of BTZ and ABT-888 were still used to as the drugs seem to become ineffective over time, or from multiple freeze/thaw cycles. OPM2WT and OPM2RNF168-/- cells treated with ABT-888 alone showed very little change in viability (Figure 5-9).
Treatment with 3 nM and 4 nM BTZ showed a marked decrease in cell viability in both wild-type (3 nM; 42.7% and 4 nM; 68.2%) and RNF168-/- (3 nM; 52.1% and 4 nM; 74.1%)
OPM2 cells (Figure 5-9). Importantly, the addition of 10 µM ABT-888 concomitantly with
BTZ showed a statistically significant synergistic effect on cell viability in both wild-type
(3 nM; 22.8% p = 0.020 and 4 nM; 9.6% p = 0.020) and RNF168 (3 nM; 16.6% p = 0.0020 and 4 nM; 10.0% p = 0.010) deficient cells (Figure 5-9). These data indicate that RNF168 deficient cells are still synergistically sensitive to proteasome inhibition combined with
PARP inhibition, even though the cells fail to form 53BP1 foci. This suggests that RNF168 activity may be essential for the repair defect seen in MM cells treated with BTZ.
122 8======D
Figure 5-9: FACS analysis of cell viability in OPM2WT and OPM2RNF168-/- cells treated with BTZ and ABT-888 OPM2WT and OPM2RNF168 cells were cultured in 0µM, and 10µM ABT-888 and/or 0nM, 3nM, and 5nM BTZ for 48 hours. The cells were then stained with propidium iodide, and an Annexin V-FITC labelled conjugate to detect cell necrosis, and apoptosis, respectively. This data is representative of three independent experiments; statistical significance was determined by students t-test with a significance threshold of p=0.05, n = 3.
123 8======D
5.3 53BP1 is necessary for the synergistic activity of PI and PAPRi in MM
The main hypothesis of this project was that 53BP1 is the linchpin molecule behind the synergistic sensitivity seen between proteasome inhibition and PARP inhibition in MM.
After an extensive amount of effort, I was finally able to develop three MM cell lines that were unable to form 53BP1 foci by targeting exon 2 of 53BP1 using CRISPR/Cas9 (Figure
4-13). It should be mentioned that by western blot analysis, these three cell lines showed that the MM1SC3, MM1SC19, and MM1SC50 cell lines may have still retained some protein although they were not able to form 53BP1 foci.
MM1SWT cells, MM1SC3, MM1SC19, and MM1SC50 cells were first cultured in 0 nM, 3 nM, or 5 nM BTZ, with and without the addition of 10 µM ABT-888, for 24 hours. Flow cytometry for Annexin-V and propidium iodide indicated that the MM1S cells were sensitive to the BTZ, however, the MM1SWT cells failed to show any increased cell death with ABT-888 was added in combination with the BTZ (Supplementary Figure 0-3). It was reasoned that it was possible that there had not yet been enough time elapsed for the PARPi induced DNA damage to cause cell death, possibly due to the cells not enough cells progressing through S-phase. I elected that the experiment should be conducted at a 48 hour time point to account for enough time for cycle progression for a majority of the asynchronous population.
The dose required for MM1S cells at 48 hours had to be determined, therefore, MM1SWT cells were treated with 0 nM, 0.5 nM, 1 nM, 1.5 nM, and 2 nM BTZ with and without the
124 8======D addition of 10µM ABT-888. Flow cytometric analysis of Annexin-V and propidium iodide staining of these conditions indicated that at a 48 hour time point, 1 nM BTZ in combination with 10 µM ABT-888 showed the most synergistic response (Supplementary
Figure 0-5).
Using the aforementioned doses, MM1SWT, MM1SC3, MM1SC19, and MM1SC50 cells were cultured for 48 hours, and assayed for Annexin-V and propidium iodide using flow cytometry. Frustratingly, two problems arose: 1) the drug combination failed to synergize in the MM1SWT cells, and 2) the three CRISPR/Cas9 edited cell lines all became seemingly resistant to BTZ treatment (Supplementary Figure 0-2). Due to the variability of the effectiveness of the drug combination and the apparent lack of BTZ sensitivity in the edited cell lines I chose to work with only a single cell line of the three: MM1SC50. These cells were selected because they showed the largest reduction in 53BP1protein levels by western blot and also failed to form 53BP1 foci (Figure 4-13). Furthermore, up until this point the
BTZ that had been used for these experiments had been acquired from left over Velcade vials used to treat MM patients at the hospital pharmacy and it’s stability came into question. Fresh BTZ was acquired from Selleckchem to mitigate the unknown handling and storage of the pharmacy BTZ.
Similar to before, this meant that a range of BTZ doses was required to ensure that the cells would receive and appropriate dose. Starting at 100 nM, culture medium was used to make serial dilutions of BTZ in were made at an 8:10 ratio down to 17. This was done twice, where the second set of dilutions with cells would also receive a dose of 10 µM ABT-888.
125 8======D
Media and cells were added to these wells to achieve final concentrations ranging from 10 nM – 1.7 nM BTZ; this was done exactly the same for both MM1SWT and MM1SC50 cells.
This methodology was able to show promise, where MM1SWT cells showed 39.1% and
64.5% cell death using 1.7 nM and 2.1 nM BTZ, respectively (Figure 5-10). The addition of 10 µM ABT-888 to MM1SWT cells treated with 1.7 nM and 2.1 nM BTZ showed an
18.4% and 11.4% increase in cell death compared to BTZ treatment alone alone, respectively; ABT-888 treatment alone showed a 2.6% increase in cell death compared to the untreated control (Figure 5-10). Intriguingly, MM1SC50 cells showed 46.2% and 81.1% cell death using 3.3 nM and 4.1 nM BTZ, respectively (Figure 5-10). The addition of 10
µM ABT-888 to MM1SC50 cells treated with 3.3 nM and 4.1 nM BTZ showed an 5.1% and
7.9% decrease in cell death compared to BTZ treatment alone alone, respectively; ABT-
888 treatment alone showed a 2.1% increase in cell viability compared to the untreated control (Figure 5-10). It should be noted that there was an apparent difference in the sensitivity of MM1SWT and MM1SC50 cells to BTZ, and the concentrations reported reflect the concentrations showing roughly equivalent amounts of cell death at the 48 hour time interval. The reason for this difference in drug sensitivity is unknown.
These data support our hypothesis that 53BP1 is required for synergy between proteasome inhibition and PARP inhibition.
126 8======D
Figure 5-10: FACS analysis of cell viability in MM1SWT and MM1SC50 cells treated with BTZ and ABT-888 MM1SWT cells were cultured in 0µM, and 10µM ABT-888 and/or 0nM, 1.7nM, and 2.1nM BTZ for 48 hours (Top). MM1SC50 cells were cultured in 0µM, and 10µM ABT-888 and/or 0nM, 1.7nM, and 2.1nM BTZ for 48 hours (Bottom).The cells were then stained with propidium iodide, and an Annexin V-FITC labelled conjugate to detect cell necrosis, and apoptosis, respectively. n=1.
127 8======D
CHAPTER SIX: Discussion and Future Directions
As the use of PIs in combination with PARPi showed effectiveness in in vitro cell line studies, Dr. Bahlis and Dr. Neri were able to undertake a successful clinical trial in MM patients in their clinic at the Tom Baker Cancer Center (unpublished). Understanding the molecular mechanisms by which PIs and PARPis are effective in MM is of critical importance to ensure that this therapeutic regime is able to meet the clinical needs of MM patients. This is especially important in multiple myeloma, where treatment strategies change with the expansion of minor clonal sub-populations that are resistant to the current strategy being employed against the major sub-population of myeloma cells (32, 128). The ability to potentiate the effects of any given strategy would be beneficial in the maintenance of disease and illness free survival.
Overall, this project was intended to identify if 53BP1 has a role in sensitization of MM cells to the combined treatment of proteasome inhibitors and PARP inhibitors.
Investigation into DNA damage response protein 53BP1 was prompted after a previous study from Dr. Bahlis’ lab identified that BTZ was able to induce a defect in HR in MM cells, and that HR defect resulted in a synthetically lethal effect where subsequent treatment with ABT-888 resulted in a synergistic ability to cause cell death (106). This HR defect, being reminiscent of a BRCA null phenotype, and evidence that 53BP1 foci aberrantly persisted in MM cells treated with BTZ lead to the hypothesis that 53BP1 was the linchpin molecule blocking resection. This effect has been shown previously in BRCA1-/- cells that
128 8======D are also 53BP1-/- (81). Interestingly, the difference between 53BP1 foci formation/persistence in MM and 53BP1 foci abrogation in non-MM cells treat with BTZ supported the hypothesis that 53BP1 may be the reason synergy between proteasome inhibition and PARP inhibition occurred.
Using CRISPR/Cas9 targeted genome editing, I was able to establish cells that had diminished 53BP1 protein and lacked the ability to from 53BP1 foci, by targeting the
TP53BP1 gene at exon 2. Flow cytometric analysis of MM1S53BP1-/- cells, when compared to their wild-type counter parts, strongly suggests that the activity of 53BP1 is necessary for the synergy between BTZ and ABT-888. Although these data suggest that this is true, it is important to note that due to the variability of the success of these experiments I have yet to be able to replicate this data and these claims are representative of a single experiment. It will be absolutely necessary to replicate the experiments seen here to be confident that this experiment was not an anomaly. If it is solidified that 53BP1 loss is sufficient to rescue the effects seen here, it will be necessary to ectopically express 53BP1 in MM cells that lack 53BP1 and confirm that reintroduction of 53BP1 is the bona fide cause of resistance to the combination of BTZ and ABT-888.
Interestingly, the loss of RNF168 was not able to produce the same effect as the loss of
53BP1. MM cells lacking RNF168 were synergistically sensitive to the effects of BTZ and
ABT-888 combination treatment, suggesting that RNF168 may be necessary for the rescue of HR activity in MM. This is unusual, as it has previously been shown that loss of RNF168 and loss of 53BP1 show a similar ability to rescue sensitivity to PARPi in BRCA1 null
U2OS cells; although this was not in the context of BTZ treatment (129).
129 8======D
Regardless of the findings here, there is still a question of how it is that 53BP1 IRIF are not affected by proteasome inhibition in MM. It has been shown before for non-MM cell lines such as U2OS and HeLa, that the use of the proteasome inhibitor MG-132 is able to block the formation of 53BP1 IRIF and UV laser induced DNA damage (107, 108). It would be useful to investigate what unique biological characteristics MM cells have that allow this to occur.
One important aspect of MM biology that has been eluded to in this work, but has yet to be addressed, is the strangely high level of DNA damage in the absence of exogenous DNA damage inducing agents. Interestingly, as it can be seen in many figures in this thesis, MM cells consistently have significantly higher levels of 53BP1 and γΗ2AX foci in their normal state. Additionally, studies have been conducted that show that MM cell lines have significantly higher levels of DNA breaks than do fibroblasts or peripheral bone marrow cells (130). It is currently unknown what the cause of this phenomenon is, however, it is likely that it is contributing the inherently high state of genomic instability seen in MM
(29). One possibility is that there are proteins in MM that are deregulated in MM that have a specific tendency to affect mutational transitions at certain sites; for example one study has recently shown that 3.8% of 463 MM patients show an APOBEC mutational signature which was associated with c-MYC translocations and correlated with a poor prognosis
(131). In the future it would be informative to perform ChIP-seq studies by finding regions of chromatin that associate with 53BP1 and determine if there is an identifiable DNA damage signature.
130 8======D
References
1. C. Fernández de Larrea et al., Plasma cell leukemia: consensus statement on diagnostic requirements, response criteria and treatment recommendations by the International Myeloma Working Group. Leukemia. 27, 780–91 (2013).
2. R. Hoffman, L. E. Silberstein, E. J. Benz, Hematology : basic principles and practice (Elsevier Health Sciences, 1AD).
3. C. C. S. A. C. on C. Statistics, “Canadian Cancer Statistics 2014” (Toronto, ON, 2014).
4. R. L. Siegel, K. D. Miller, A. Jemal, Cancer statistics, 2015. CA. Cancer J. Clin. 65, 5–29 (2015).
5. S. K. Kumar et al., Improved survival in multiple myeloma and the impact of novel therapies. Blood. 111, 2516–20 (2008).
6. S. Singhal et al., Antitumor activity of thalidomide in refractory multiple myeloma. N. Engl. J. Med. 341, 1565–71 (1999).
7. P. Moreau et al., Proteasome inhibitors in multiple myeloma: 10 years later. Blood. 120, 947–59 (2012).
8. F. Zhan et al., The molecular classification of multiple myeloma. Blood. 108, 2020–8 (2006).
9. P. L. Bergsagel, W. M. Kuehl, Molecular pathogenesis and a consequent classification of multiple myeloma. J. Clin. Oncol. Off. J. Am. Soc. Clin. Oncol. 23, 6333–8 (2005).
10. R. Fonseca et al., International Myeloma Working Group molecular classification of multiple myeloma: spotlight review. Leukemia. 23, 2210–21 (2009).
11. M. A. Chapman et al., Initial genome sequencing and analysis of multiple myeloma. Nature. 471, 467–72 (2011).
12. S. V Rajkumar et al., Impact of primary molecular cytogenetic abnormalities and risk of progression in smoldering multiple myeloma. Leukemia. 27, 1738–44 (2013).
13. R. Fonseca et al., Genetics and cytogenetics of multiple myeloma: a workshop report. Cancer Res. 64, 1546–58 (2004).
14. S. Kumar et al., Trisomies in multiple myeloma: impact on survival in patients with high-risk cytogenetics. Blood. 119, 2100–5 (2012).
131 8======D
15. G. J. Morgan, B. A. Walker, F. E. Davies, The genetic architecture of multiple myeloma. Nat. Rev. Cancer. 12, 335–48 (2012).
16. H. Avet-Loiseau et al., Long-term analysis of the IFM 99 trials for myeloma: cytogenetic abnormalities [t(4;14), del(17p), 1q gains] play a major role in defining long-term survival. J. Clin. Oncol. Off. J. Am. Soc. Clin. Oncol. 30, 1949–52 (2012).
17. L. Lodé et al., Mutations in TP53 are exclusively associated with del(17p) in multiple myeloma. Haematologica. 95, 1973–6 (2010).
18. F. Pichiorri et al., Downregulation of p53-inducible microRNAs 192, 194, and 215 impairs the p53/MDM2 autoregulatory loop in multiple myeloma development. Cancer Cell. 18, 367–81 (2010).
19. H. Avet-Loiseau et al., Rearrangements of the c-myc oncogene are present in 15% of primary human multiple myeloma tumors. Blood. 98, 3082–6 (2001).
20. W.-J. Chng et al., Clinical and biological implications of MYC activation: a common difference between MGUS and newly diagnosed multiple myeloma. Leukemia. 25, 1026–35 (2011).
21. A. Dib, A. Gabrea, O. K. Glebov, P. L. Bergsagel, W. M. Kuehl, Characterization of MYC translocations in multiple myeloma cell lines. J. Natl. Cancer Inst. - Monogr., 25–31 (2008).
22. M. Chesi, P. L. Bergsagel, Advances in the pathogenesis and diagnosis of multiple myeloma. Int. J. Lab. Hematol. 37, 108–114 (2015).
23. F. Zhan et al., The molecular classification of multiple myeloma. Blood. 108, 2020–8 (2006).
24. J. D. Shaughnessy et al., A validated gene expression model of high-risk multiple myeloma is defined by deregulated expression of genes mapping to chromosome 1. Blood. 109, 2276–84 (2007).
25. M. Chesi et al., AID-dependent activation of a MYC transgene induces multiple myeloma in a conditional mouse model of post-germinal center malignancies. Cancer Cell. 13, 167–180 (2008).
26. O. Galm et al., DNA methylation changes in multiple myeloma. Leukemia. 18, 1687– 92 (2004).
27. B. A. Walker et al., Aberrant global methylation patterns affect the molecular pathogenesis and prognosis of multiple myeloma. Blood. 117, 553–62 (2011).
28. N. Amodio et al., DNA-demethylating and anti-tumor activity of synthetic miR-29b mimics in multiple myeloma. Oncotarget. 3, 1246–58 (2012).
132 8======D
29. P. Neri, N. J. Bahlis, Genomic instability in multiple myeloma: mechanisms and therapeutic implications. Expert Opin. Biol. Ther. 13 Suppl 1, S69–82 (2013).
30. F. Magrangeas, H. Avet-Loiseau, N. C. Munshi, S. Minvielle, Chromothripsis identifies a rare and aggressive entity among newly diagnosed multiple myeloma patients. Blood. 118, 675–8 (2011).
31. M. A. Shammas et al., Dysfunctional homologous recombination mediates genomic instability and progression in myeloma. Blood. 113, 2290–7 (2009).
32. J. J. Keats et al., Clonal competition with alternating dominance in multiple myeloma. Blood. 120, 1067–76 (2012).
33. P. Neri et al., Bortezomib-induced “BRCAness” sensitizes multiple myeloma cells to PARP inhibitors. Blood. 118, 6368–79 (2011).
34. D. N. Yarde et al., Targeting the Fanconi anemia/BRCA pathway circumvents drug resistance in multiple myeloma. Cancer Res. 69, 9367–75 (2009).
35. E. S. Lightcap et al., Proteasome Inhibition Measurements: Clinical Application. Clin. Chem. 46, 673–683 (2000).
36. D. Chen, M. Frezza, S. Schmitt, J. Kanwar, Q. P. Dou, Bortezomib as the First Proteasome Inhibitor Anticancer Drug: Current Status and Future Perspectives. Curr. Cancer Drug Targets. 11, 239–253 (2011).
37. J. Adams et al., Proteasome inhibitors: a novel class of potent and effective antitumor agents. Cancer Res. 59, 2615–2622 (1999).
38. R. C. Kane, P. F. Bross, A. T. Farrell, R. Pazdur, Velcade: U.S. FDA approval for the treatment of multiple myeloma progressing on prior therapy. The Oncologist. 8, 508–513 (2003).
39. G. Bianchi, I. M. Ghobrial, Molecular mechanisms of effectiveness of novel therapies in multiple myeloma. Leuk. Lymphoma. 54, 229–241 (2013).
40. A. Ciccia, S. J. Elledge, The DNA damage response: making it safe to play with knives. Mol. Cell. 40, 179–204 (2010).
41. B. W. Durkacz, O. Omidiji, D. A. Gray, S. Shall, (ADP-ribose)n participates in DNA excision repair. Nature. 283, 593–6 (1980).
42. H. Farmer et al., Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature. 434, 917–21 (2005).
43. F. Dantzer et al., Involvement of poly(ADP-ribose) polymerase in base excision repair. Biochimie. 81, 69–75 (1999).
133 8======D
44. H. E. Bryant et al., Specific killing of BRCA2-deficient tumours with inhibitors of poly(ADP-ribose) polymerase. Nature. 434, 913–7 (2005).
45. C. Arnaudeau, C. Lundin, T. Helleday, DNA double-strand breaks associated with replication forks are predominantly repaired by homologous recombination involving an exchange mechanism in mammalian cells. J. Mol. Biol. 307, 1235–45 (2001).
46. N. Turner, A. Tutt, A. Ashworth, Hallmarks of “BRCAness” in sporadic cancers. Nat. Rev. Cancer. 4, 814–9 (2004).
47. C. J. Lord, A. Ashworth, BRCAness revisited. Nat. Rev. Cancer. 16, 110–120 (2016).
48. K. Rothkamm, I. Krüger, L. H. Thompson, M. Löbrich, Pathways of DNA Double- Strand Break Repair during the Mammalian Cell Cycle. Mol. Cell. Biol. 23, 5706– 5715 (2003).
49. K. Karanam, R. Kafri, A. Loewer, G. Lahav, Quantitative Live Cell Imaging Reveals a Gradual Shift between DNA Repair Mechanisms and a Maximal Use of HR in Mid S Phase. Mol. Cell. 47, 320–329 (2012).
50. J. R. Chapman, M. R. G. Taylor, S. J. Boulton, Playing the end game: DNA double- strand break repair pathway choice. Mol. Cell. 47, 497–510 (2012).
51. K. Meek, V. Dang, S. P. Lees-Miller, DNA-PK: the means to justify the ends? Adv. Immunol. 99, 33–58 (2008).
52. B. L. Mahaney, K. Meek, S. P. Lees-Miller, Repair of ionizing radiation-induced DNA double-strand breaks by non-homologous end-joining. Biochem. J. 417, 639– 650 (2009).
53. J. Lukas, C. Lukas, J. Bartek, More than just a focus: The chromatin response to DNA damage and its role in genome integrity maintenance. Nat. Cell Biol. 13, 1161–9 (2011).
54. E. P. Rogakou, D. R. Pilch, A. H. Orr, V. S. Ivanova, W. M. Bonner, DNA double- stranded breaks induce histone H2AX phosphorylation on serine 139. J. Biol. Chem. 273, 5858–68 (1998).
55. S. Burma, B. P. Chen, M. Murphy, A. Kurimasa, D. J. Chen, ATM phosphorylates histone H2AX in response to DNA double-strand breaks. J. Biol. Chem. 276, 42462–7 (2001).
56. P. J. Cook et al., Tyrosine dephosphorylation of H2AX modulates apoptosis and survival decisions. Nature. 458, 591–6 (2009).
134 8======D
57. C. Spycher et al., Constitutive phosphorylation of MDC1 physically links the MRE11-RAD50-NBS1 complex to damaged chromatin. J. Cell Biol. 181, 227–40 (2008).
58. Z. Lou et al., MDC1 maintains genomic stability by participating in the amplification of ATM-dependent DNA damage signals. Mol. Cell. 21, 187–200 (2006).
59. N. Mailand et al., RNF8 ubiquitylates histones at DNA double-strand breaks and promotes assembly of repair proteins. Cell. 131, 887–900 (2007).
60. C. Doil et al., RNF168 binds and amplifies ubiquitin conjugates on damaged chromosomes to allow accumulation of repair proteins. Cell. 136, 435–46 (2009).
61. G. S. Stewart et al., The RIDDLE syndrome protein mediates a ubiquitin-dependent signaling cascade at sites of DNA damage. Cell. 136, 420–34 (2009).
62. A. Fradet-Turcotte et al., 53BP1 is a reader of the DNA-damage-induced H2A Lys 15 ubiquitin mark. Nature. 499, 50–4 (2013).
63. P. Bouwman et al., 53BP1 loss rescues BRCA1 deficiency and is associated with triple-negative and BRCA-mutated breast cancers. Nat. Struct. Mol. Biol. 17, 688– 95 (2010).
64. S. F. Bunting et al., 53BP1 inhibits homologous recombination in Brca1-deficient cells by blocking resection of DNA breaks. Cell. 141, 243–54 (2010).
65. J. R. Chapman, A. J. Sossick, S. J. Boulton, S. P. Jackson, BRCA1-associated exclusion of 53BP1 from DNA damage sites underlies temporal control of DNA repair. J. Cell Sci. 125, 3529–34 (2012).
66. M. Di Virgilio et al., Rif1 prevents resection of DNA breaks and promotes immunoglobulin class switching. Science. 339, 711–5 (2013).
67. M. Zimmermann, F. Lottersberger, S. B. Buonomo, A. Sfeir, T. de Lange, 53BP1 regulates DSB repair using Rif1 to control 5’ end resection. Science. 339, 700–4 (2013).
68. Z. Gong, Y.-W. Cho, J.-E. Kim, K. Ge, J. Chen, Accumulation of Pax2 transactivation domain interaction protein (PTIP) at sites of DNA breaks via RNF8- dependent pathway is required for cell survival after DNA damage. J. Biol. Chem. 284, 7284–93 (2009).
69. S. Panier et al., Tandem protein interaction modules organize the ubiquitin-dependent response to DNA double-strand breaks. Mol. Cell. 47, 383–95 (2012).
135 8======D
70. J. Silverman, H. Takai, S. B. C. Buonomo, F. Eisenhaber, T. de Lange, Human Rif1, ortholog of a yeast telomeric protein, is regulated by ATM and 53BP1 and functions in the S-phase checkpoint. Genes Dev. 18, 2108–19 (2004).
71. J. R. Chapman et al., RIF1 is essential for 53BP1-dependent nonhomologous end joining and suppression of DNA double-strand break resection. Mol. Cell. 49, 858– 71 (2013).
72. C. Escribano-Díaz et al., A cell cycle-dependent regulatory circuit composed of 53BP1-RIF1 and BRCA1-CtIP controls DNA repair pathway choice. Mol. Cell. 49, 872–83 (2013).
73. M. Zimmermann, F. Lottersberger, S. B. Buonomo, A. Sfeir, T. de Lange, 53BP1 regulates DSB repair using Rif1 to control 5’ end resection. Science. 339, 700–4 (2013).
74. M. Di Virgilio et al., Rif1 prevents resection of DNA breaks and promotes immunoglobulin class switching. Science. 339, 711–5 (2013).
75. E. Callen et al., 53BP1 mediates productive and mutagenic DNA repair through distinct phosphoprotein interactions. Cell. 153, 1266–80 (2013).
76. I. M. Munoz, P. A. Jowsey, R. Toth, J. Rouse, Phospho-epitope binding by the BRCT domains of hPTIP controls multiple aspects of the cellular response to DNA damage. Nucleic Acids Res. 35, 5312–5322 (2007).
77. L. Feng, K.-W. Fong, J. Wang, W. Wang, J. Chen, RIF1 Counteracts BRCA1- mediated End Resection during DNA Repair. J. Biol. Chem. 288, 11135–11143 (2013).
78. C. Escribano-Díaz et al., A cell cycle-dependent regulatory circuit composed of 53BP1-RIF1 and BRCA1-CtIP controls DNA repair pathway choice. Mol. Cell. 49, 872–83 (2013).
79. A. Kakarougkas et al., Co-operation of BRCA1 and POH1 relieves the barriers posed by 53BP1 and RAP80 to resection. Nucleic Acids Res., 1–14 (2013).
80. J. R. Chapman et al., RIF1 is essential for 53BP1-dependent nonhomologous end joining and suppression of DNA double-strand break resection. Mol. Cell. 49, 858– 71 (2013).
81. S. F. Bunting et al., 53BP1 inhibits homologous recombination in Brca1-deficient cells by blocking resection of DNA breaks. Cell. 141, 243–54 (2010).
82. N. Tomimatsu et al., Exo1 plays a major role in DNA end resection in humans and influences double-strand break repair and damage signaling decisions. DNA Repair. 11, 441–448 (2012). 136 8======D
83. O. Limbo et al., Ctp1 Is a Cell-Cycle-Regulated Protein that Functions with Mre11 Complex to Control Double-Strand Break Repair by Homologous Recombination. Mol. Cell. 28, 134–146 (2007).
84. A. A. Sartori et al., Human CtIP promotes DNA end resection. Nature. 450, 509–514 (2007).
85. M. H. Yun, K. Hiom, CtIP-BRCA1 modulates the choice of DNA double-strand- break repair pathway throughout the cell cycle. Nature. 459, 460–463 (2009).
86. N. Tomimatsu et al., Phosphorylation of EXO1 by CDKs 1 and 2 regulates DNA end resection and repair pathway choice. Nat. Commun. 5, 3561 (2014).
87. M. S. Wold, REPLICATION PROTEIN A:A Heterotrimeric, Single-Stranded DNA- Binding Protein Required for Eukaryotic DNA Metabolism. Annu. Rev. Biochem. 66, 61–92 (1997).
88. A. Ciccia, S. J. Elledge, The DNA damage response: making it safe to play with knives. Mol. Cell. 40, 179–204 (2010).
89. H. Pei et al., MMSET regulates histone H4K20 methylation and 53BP1 accumulation at DNA damage sites. Nature. 470, 124–8 (2011).
90. K.-Y. Hsiao, C. A. Mizzen, Histone H4 deacetylation facilitates 53BP1 DNA damage signaling and double-strand break repair. J. Mol. Cell Biol. 5, 157–65 (2013).
91. J. Tang et al., Acetylation limits 53BP1 association with damaged chromatin to promote homologous recombination. Nat. Struct. Mol. Biol. 20, 317–25 (2013).
92. K. Acs et al., The AAA-ATPase VCP/p97 promotes 53BP1 recruitment by removing L3MBTL1 from DNA double-strand breaks. Nat. Struct. Mol. Biol. 18, 1345–50 (2011).
93. F. A. Mallette et al., RNF8- and RNF168-dependent degradation of KDM4A/JMJD2A triggers 53BP1 recruitment to DNA damage sites. EMBO J. 31, 1865–78 (2012).
94. J. J. Pesavento, H. Yang, N. L. Kelleher, C. A. Mizzen, Certain and progressive methylation of histone H4 at lysine 20 during the cell cycle. Mol. Cell. Biol. 28, 468–86 (2008).
95. K. M. Miller et al., Human HDAC1 and HDAC2 function in the DNA-damage response to promote DNA nonhomologous end-joining. Nat. Struct. Mol. Biol. 17, 1144–51 (2010).
137 8======D
96. K. M. Miller et al., Human HDAC1 and HDAC2 function in the DNA-damage response to promote DNA nonhomologous end-joining. Nat. Struct. Mol. Biol. 17, 1144–51 (2010).
97. K.-Y. Hsiao, C. A. Mizzen, Histone H4 deacetylation facilitates 53BP1 DNA damage signaling and double-strand break repair. J. Mol. Cell Biol. 5, 157–65 (2013).
98. K. Jacquet et al., The TIP60 Complex Regulates Bivalent Chromatin Recognition by 53BP1 through Direct H4K20me Binding and H2AK15 Acetylation. Mol. Cell. 62, 409–421 (2016).
99. G. Shao et al., The Rap80-BRCC36 de-ubiquitinating enzyme complex antagonizes RNF8-Ubc13-dependent ubiquitination events at DNA double strand breaks. Proc. Natl. Acad. Sci. 106, 3166–3171 (2009).
100. S. Nakada et al., Non-canonical inhibition of DNA damage-dependent ubiquitination by OTUB1. Nature. 466, 941–6 (2010).
101. L. R. Butler et al., The proteasomal de-ubiquitinating enzyme POH1 promotes the double-strand DNA break response. EMBO J. 31, 3918–34 (2012).
102. J. R. Chapman, A. J. Sossick, S. J. Boulton, S. P. Jackson, BRCA1-associated exclusion of 53BP1 from DNA damage sites underlies temporal control of DNA repair. J. Cell Sci. 125, 3529–34 (2012).
103. A. Kakarougkas et al., Co-operation of BRCA1 and POH1 relieves the barriers posed by 53BP1 and RAP80 to resection. Nucleic Acids Res., 1–14 (2013).
104. M. Poulsen, C. Lukas, J. Lukas, S. Bekker-Jensen, N. Mailand, Human RNF169 is a negative regulator of the ubiquitin-dependent response to DNA double-strand breaks. J. Cell Biol. 197, 189–99 (2012).
105. A. Orthwein et al., A mechanism for the suppression of homologous recombination in G1 cells. Nature. 528, 422–426 (2015).
106. P. Neri et al., Bortezomib-induced “BRCAness” sensitizes multiple myeloma cells to PARP inhibitors. Blood. 118, 6368–79 (2011).
107. N. Mailand et al., RNF8 ubiquitylates histones at DNA double-strand breaks and promotes assembly of repair proteins. Cell. 131, 887–900 (2007).
108. R. Sakasai, R. Tibbetts, RNF8-dependent and RNF8-independent Regulation of 53BP1 in Response to DNA Damage. J. Biol. Chem. 283, 13549–13555 (2008).
109. S. Panier, S. J. Boulton, Double-strand break repair: 53BP1 comes into focus. Nat. Rev. Mol. Cell Biol. 15, 7–18 (2014).
138 8======D
110. E. M. Goellner, C. D. Putnam, R. D. Kolodner, Exonuclease 1-dependent and independent mismatch repair. DNA Repair. 32, 24–32 (2015).
111. J. C. Miller et al., A TALE nuclease architecture for efficient genome editing. Nat. Biotechnol. 29, 143–148 (2011).
112. F. Zhang et al., Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. Nat. Biotechnol. 29, 149–153 (2011).
113. J. Boch et al., Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors. Science. 326, 1509–1512 (2009).
114. P. Qiu et al., Mutation detection using Surveyor nuclease. BioTechniques. 36, 702– 707 (2004).
115. O. Shalem et al., Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 343, 84–7 (2014).
116. L. Cong et al., Multiplex Genome Engineering Using CRISPR/Cas Systems. Science. 339, 819–823 (2013).
117. P. Mali et al., RNA-Guided Human Genome Engineering via Cas9. Science. 339, 823–826 (2013).
118. F. J. M. Mojica, C. Díez-Villaseñor, J. García-Martínez, C. Almendros, Short motif sequences determine the targets of the prokaryotic CRISPR defence system. Microbiology. 155, 733–740 (2009).
119. M. Jinek et al., A Programmable Dual-RNA–Guided DNA Endonuclease in Adaptive Bacterial Immunity. Science. 337, 816–821 (2012).
120. F. Mattiroli et al., RNF168 ubiquitinates K13-15 on H2A/H2AX to drive DNA damage signaling. Cell. 150, 1182–95 (2012).
121. M. S. Y. Huen et al., RNF8 transduces the DNA-damage signal via histone ubiquitylation and checkpoint protein assembly. Cell. 131, 901–14 (2007).
122. N. K. Kolas et al., Orchestration of the DNA-damage response by the RNF8 ubiquitin ligase. Science. 318, 1637–1640 (2007).
123. R. Oerlemans et al., Molecular basis of bortezomib resistance: proteasome subunit beta5 (PSMB5) gene mutation and overexpression of PSMB5 protein. Blood. 112, 2489–99 (2008).
124. Y. A. Chan, P. Hieter, P. C. Stirling, Mechanisms of genome instability induced by RNA-processing defects. Trends Genet. 30, 245–253 (2014).
139 8======D
125. J. Clemens et al., Stability of the proteasome inhibitor bortezomib in cell based assays determined by ultra-high performance liquid chromatography coupled to tandem mass spectrometry. J. Chromatogr. A. 1345, 128–138 (2014).
126. L. B. Schultz, p53 Binding Protein 1 (53BP1) Is an Early Participant in the Cellular Response to DNA Double-Strand Breaks. J. Cell Biol. 151, 1381–1390 (2000).
127. N. P. Dantuma, T. A. M. Groothuis, F. A. Salomons, J. Neefjes, A dynamic ubiquitin equilibrium couples proteasomal activity to chromatin remodeling. J. Cell Biol. 173, 19–26 (2006).
128. J. B. Egan et al., Whole-genome sequencing of multiple myeloma from diagnosis to plasma cell leukemia reveals genomic initiating events, evolution, and clonal tides. Blood. 120, 1060–1066 (2012).
129. M. C. Muñoz et al., RING finger nuclear factor RNF168 is important for defects in homologous recombination caused by loss of the breast cancer susceptibility factor BRCA1. J. Biol. Chem. 287, 40618–28 (2012).
130. M. A. Shammas et al., Spontaneous DNA Damage and Aberrant Epigenome In Multiple Myeloma Constitute The Path To Disease Genomic Instability. Blood. 122, 4884–4884 (2013).
131. B. A. Walker et al., APOBEC family mutational signatures are associated with poor prognosis translocations in multiple myeloma. Nat. Commun. 6, 6997–6997 (2015).
140 8======D
Supplementary Materials
Supplemental Figure 0-1: FACS analysis of MM cell lines KMS11 and OPM2 treated with BTZ and ABT-888 OPM2 and KMS11 cells were cultured in 0µM, and 5µM ABT-888 and/or 0nM, 2.5nM, 5nM, 10nM and 100nM BTZ for 24 or 48 hours. The cells were then stained with propidium iodide, and an Annexin V-FITC labelled conjugate to detect cell necrosis, and apoptosis, respectively.
141 8======D
Supplementary Figure 0-2: FACS analysis of MM1SWT, MM1SC3, MM1SC19, and MM1SC50 cell lines treated with BTZ and ABT-888 (48 Hours) MM1SWT, MM1SC3, MM1SC19, and MM1SC50 were cultured in 0µM, and 10µM ABT-888 and/or 0nM, 1nM, 1.5nM and 2nM BTZ 48 hours. The cells were then stained with propidium iodide, and an Annexin V-FITC labelled conjugate to detect cell necrosis, and apoptosis, respectively.
142 8======D
Supplementary Figure 0-3: FACS analysis of MM1SWT, MM1SC3, MM1SC19, and MM1SC50 cell lines treated with BTZ and ABT-888 (24 Hours) MM1SWT, MM1SC3, MM1SC19, and MM1SC50 were cultured in 0µM, and 10µM ABT-888 and/or 0nM, 3nM, and 5nM BTZ 24 hours. The cells were then stained with propidium iodide, and an Annexin V-FITC labelled conjugate to detect cell necrosis, and apoptosis, respectively.
143 8======D
Supplementary Figure 0-4: FACS analysis of cell viability in OPM2WT and OPM2RNF168-/- cells treated with BTZ and ABT-888 OPM2WT and OPM2RNF168 cells were cultured in 0µM, and 5µM ABT-888 and/or 0nM, 3nM, and 4nM BTZ for 48 hours. The cells were then stained with propidium iodide, and an Annexin V-FITC labelled conjugate to detect cell necrosis, and apoptosis, respectively. Cells that were PI – and AV- were considered viable. Treatment conditions were normalized to the non-treated controls in the graph in (b). n = 1.
144 8======D
Supplementary Figure 0-5: FACS analysis of MM1S cells treated with BTZ and ABT- 888 MM1S cells were cultured in 0µM, and 10µM ABT-888 and/or 0nM, 0.5nM, 1nM, 1.5nM and 2nM BTZ 48 hours. The cells were then stained with propidium iodide, and an Annexin V-FITC labelled conjugate to detect cell necrosis, and apoptosis, respectively. Data was acquired with the BD LSRII flow cytometer at the University of Calgary Flow Cytometry Core Facility.
145