Genomic Profiling of Primary Histiocytic Sarcoma Reveals Two Molecular

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Hystiocyte DIsordes SUPPLEMENTARY APPENDIX Genomic profiling of primary histiocytic sarcoma reveals two molecular subgroups Caoimhe Egan, 1 Alina Nicolae, 1 Justin Lack, 2 Hye-Jung Chung, 1 Shannon Skarshaug, 1 Thu Anh Pham, 1 Winnifred Navarro, 1 Zied Abdullaev, 1 Nadine S. Aguilera, 3 Liqiang Xi, 1 Svetlana Pack, 1 Stefania Pittaluga, 1 Elaine S. Jaffe 1 and Mark Raffeld 1 1Laboratory of Pathology, National Cancer Institute, National Institutes of Health, Bethesda, MD; 2NIAID Collaborative Bioinformatics Resource (NCBR), National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD and 3University of Virginia Health System, Charlottesville, VA, USA ©2020 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol. 2019.230375 Received: June 25, 2019. Accepted: August 21, 2019. Pre-published: August 22, 2019. Correspondence: MARK RAFFELD - [email protected] Supplementary Material: Genomic profiling of primary histiocytic sarcoma reveals two molecular subgroups Caoimhe Egan1, Alina Nicolae1, Justin Lack2, Hye-Jung Chung1, Shannon Skarshaug1, Thu Anh Pham1, Winnifred Navarro1, Zied Abdullaev1, Nadine S Aguilera3, Liqiang Xi1, Svetlana Pack1, Stefania Pittaluga1, Elaine S Jaffe1 and Mark Raffeld1. 1Laboratory of Pathology, National Cancer Institute, National Institutes of Health, Bethesda, MD, USA. 2NIAID Collaborative Bioinformatics Resource (NCBR), National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD, USA. 3 University of Virginia Health System, 1215 Lee Street, Box 800214, Charlottesville, VA, USA. 1 Supplementary Methods Case selection. Twenty-one cases of primary histiocytic sarcoma (pHS) with a tumor content of at least 40% were identified from the files of the Hematopathology Section of the National Cancer Institute under an IRB approved protocol. All cases were reviewed by a panel of hematopathologists (ESJ, SP, CE, AN). Cases were defined as pHS if they showed typical histomorphology and expression of at least two of CD68, CD163, CD4 and lysozyme, no expression of CD20, CD3, CD30, no markers of Langerhans cell or follicular dendritic cell differentiation, and no known history of lymphoid malignancy or mediastinal germ cell tumor. One patient had a history of myelodysplastic syndrome with del(5q), but the cytogenetic aberration was not present in the HS. One case had insufficient material for a complete immunohistochemical panel but had an appropriate morphology and expressed histiocytic markers. The histologic and immunophenotypic features and clonality characteristics of the 21 cases are detailed in Figure 1 and Supplementary Table S3. Immunohistochemistry. Additional immunohistochemical studies were performed using antibodies to CD68 (KP-1, predilute; Roche, Indianapolis, IN, USA), CD163 (MRQ-26, predilute; Cell Marque, Rocklin, CA, USA), lysozyme (EC.3.2.1.17, 1:2000; Dako, Santa Clara, CA, USA), CD4 (SP35, predilute; Roche), CD21 (1F8, 1:30; Dako), clusterin (41D, 1:5000; Millipore, Burlington, MA, USA), CD1a (EP3622, predilute; Roche), langerin (12D6, 1:200; Leica Biosystems, Buffalo Grove, IL, USA), CD30 (JCM182, predilute; Leica Biosystems), CD20 (L26, predilute; Roche), CD3 (2GV6, predilute; Ventana, Tucson, AZ, USA), S100 (15E2E2, 1:8000; BioGenex, Fremont, CA, USA), AE1/AE3 (AE1/AE3, 1:100; Dako) and Ki67 (MIB-1, 1:200; Dako) if required. Immunohistochemistry was performed on either a Ventana Benchmark Ultra automated immunostainer using UltraView detection (Ventana) or on a Leica Bond Max using Bond Polymer Refine detection systems (Leica Biosystems). The proliferation index obtained using Ki67 immunohistochemistry was the percentage of positive cells counted in three high power fields (400x). Images were taken using an Olympus Microscope Digital Camera Model DP71 on an Olympus BX50 microscope and cells were counted with the Cell Counter plugin in ImageJ (https://imagej.nih.gov/ij/index.html)1. Nucleic acid extraction. DNA and RNA were extracted from formalin-fixed paraffin embedded (FFPE) tissue sections using QIAGEN QIAamp DNA FFPE Tissue Kit and RNeasy FFPE Kit on a QIAcube robotic system according to the manufacturer’s protocol (QIAGEN, Germantown, MD, USA). Co-extraction, when performed, used a modified version of the QIAGEN AllPrep DNA/RNA FFPE protocol. 2 Immunoglobulin gene and T-cell receptor gene rearrangement studies. Polymerase chain reaction (PCR) for immunoglobulin gene (IGH and IGK loci) and T-cell receptor gene (TRG locus) rearrangements was performed according to methods described in detail elsewhere2, 3. To interrogate IGH rearrangements, laboratory designed consensus primers directed against VH 4, 5 framework II, VH framework III and the joining region (JH) were employed as described previously , or alternatively, commercially available BIOMED-2 primer sets to all three VH framework regions (Invivoscribe Technologies, San Diego, CA, USA) were used. IGK analysis was performed using the commercially available BIOMED-2 primer sets (Invivoscribe Technologies) and interrogated rearrangements involving the Vκ loci and Jκ (Tube A), the Vκ locus and the κDE locus (Tube B) and the κ-intron RSS locus and the κDE locus (Tube B)6 as described by the supplier. The TRG locus was assessed using a single multiplexed PCR reaction, with primers directed at all known Vγ family members and the Jγ1/2, JP1/2 and JP joining segments3. PCR products were separated by capillary electrophoresis on an ABI 3130xl Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) and electropherograms were analyzed using GeneMapper software version 4.0. IGH/BCL2 (MBR) translocation. PCR was performed using assays modified from a previous study7 designed to detect translocations between the major breakpoint region (MBR) of BCL2 on chromosome 18q21 and the IGH joining region (JH) on chromosome 14q32. The primers/probe sequences used were: BCL2: 5’ –TTAGAGAGTTGCTTTACGTGGCCTG‐3’, JHa: 5’‐ ACCTGAGGAGACGGTGACC‐3’, BCL2 probe: FAM‐CACACAGACCCACCCAG. The PCR reaction was 50 μL in total volume composed of 25 μL QUANTITECT Master Mix Buffer 2X (QIAGEN), 2.5 μL of GAPDH primer/probe mix, 2.5 μL of IGH/BCL2 primer/probe mix and 15 μL nuclease-free water with a sample DNA input of 5 μL. The reaction was incubated at 95˚C for 15 minutes and run for 45 cycles of 95˚C for 45 seconds followed by 60˚C for 60 seconds. Whole exome sequencing. Library preparation was performed using Agilent SureSelectXT Human All Exon V5 + UTRs target enrichment kit (Agilent Technologies, Santa Clara, CA, USA). Sequencing was performed on either an Illumina HiSeq2500 with TruSeq V4 chemistry or on an Illumina HiSeq3000 with TruSeq V2 chemistry (Illumina, San Diego, CA, USA). Reads were trimmed using Trimmomatic v0.338 and mapped to the hs37d5 version of the human reference genome (ftp://ftp.1000genomes.ebi.ac.uk/vol1/ftp/technical/reference/phase2_reference_assembly_seque nce/hs37d5.fa.gz) using BWA-MEM v07.159. Following alignment, BAM files were processed using Samtools v1.3 (http://www.htslib.org/)10 and duplicates were marked using Picard v2.1.1 3 (http://broadinstitute.github.io/picard/). GATK v3.5.011 was used to perform indel realignment and base recalibration. Read- and alignment-level quality control visualization was performed using MultiQC v1.1 (http://multiqc.info/)12 to aggregate QC metrics from FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/), FastQ Screen (https://www.bioinformatics.babraham.ac.uk/projects/fastq_screen/), Picard, BamTools stats (http://github.org/pezmaster31/bamtools)13 and Trimmomatic. Variant calling was performed with MuTect 1.1.7 and MuTect214. A panel of normals, developed from ExAC (excluding the TCGA) r0.3.115 and the 1000 Genomes Project16 including only variants > 0.001 in frequency in the general population was used in cases without a matched germline. Tumor variants with an allele frequency of ≤ 0.05 and ≥ 0.99 were excluded. Variants were annotated using Ensembl VEP 9217, CADD GRCh37-v1.418 and the COSMIC database v88 (http://cancer.sanger.ac.uk)19. Identification of target genes. As matched germline samples were unavailable in most cases, we focused on genes with a known role in cancer to reduce the number of variants for assessment, an approach similar in concept to using a targeted sequencing panel. Genes were obtained from the COSMIC Cancer Gene Census v88 (http://cancer.sanger.ac.uk)20, excluding genes that were germline only or only associated with the terms ‘T’ (translocation), ‘F’ (fusion), ‘A’ (amplification) or ‘D’ (large deletions) and from a review of relevant literature (Supplementary Table S2), designed to also include genes associated with RASopathies21-24 and lymphoid malignancies25-49, as histiocytic sarcoma is known to harbor RAS pathway mutations and may be associated with B- and T-cell neoplasms. Genes from the exome data were included if they were mutated in ≥ 3 samples following application of the coverage, CADD score and minor allele frequency filters (described below) and verification of the mutations in the Integrative Genomics Viewer (IGV)50. The resulting targeted gene list (430 genes) is presented in Supplementary Table S9. Variant filtration. Synonymous mutations and variants in UTRs, intronic and intergenic locations and in the mitochondrial genome were excluded. Variants with < 6 reads and < 20x coverage by read proportions were also excluded. We applied a stringent filter based on population allele frequencies to remove as many potential germline events as possible,
Recommended publications
  • Identification of the Causative Gene for Simmental Arachnomelia Syndrome Using a Network-Based Disease Gene Prioritization Approach

    Identification of the Causative Gene for Simmental Arachnomelia Syndrome Using a Network-Based Disease Gene Prioritization Approach

    Identification of the Causative Gene for Simmental Arachnomelia Syndrome Using a Network-Based Disease Gene Prioritization Approach Shihui Jiao1., Qin Chu2., Yachun Wang1*, Zhenquan Xie3, Shiyu Hou3, Airong Liu5, Hongjun Wu4, Lin Liu6, Fanjun Geng7, Congyong Wang7, Chunhua Qin8, Rui Tan9, Xixia Huang10, Shixin Tan11, Meng Wu12, Xianzhou Xu12, Xuan Liu1, Ying Yu1, Yuan Zhang1 1 Key Laboratory of Agricultural Animal and Breeding, National Engineering Laboratory for Animal Breeding, College of Animal Science and Technology, China Agricultural University, Beijing, China, 2 Institute of Animal Husbandry and Veterinary Medicine, Beijing Academy of Agriculture and Forestry Sciences, Beijing, China, 3 Anshan Hengli Dairy Farm, Anshan, Liaoning, China, 4 Xiertala Breeding Farm, Hailaer Farm Buro, Hailaer, Inner Mongolia, China, 5 Hailaer Farm Buro, Hailaer, Inner Mongolia, China, 6 Beijing Dairy Cattle Centre, Beijing, China, 7 Dingyuan Seedstock Bulls Breeding Ltd. Company, Zhengzhou, Henan, China, 8 Ningxia Sygen BioEngineering Research Center, Yinchuan, Ningxia, China, 9 Xinjiang General Livestock Service, Urumqi, Xinjiang, China, 10 College of Animal Science, Xinjiang Agriculture University, Urumqi, Xinjiang, China, 11 Xinjiang Tianshan Animal Husbandry Bio-engineering Co. Ltd, Urumqi, Xinjiang, China, 12 Dalian Xuelong Industry Limited Group, Dalian, Liaoning, China Abstract Arachnomelia syndrome (AS), mainly found in Brown Swiss and Simmental cattle, is a congenital lethal genetic malformation of the skeletal system. In this study, a network-based disease gene prioritization approach was implemented to rank genes in the previously reported ,7 Mb region on chromosome 23 associated with AS in Simmental cattle. The top 6 ranked candidate genes were sequenced in four German Simmental bulls, one known AS-carrier ROMEL and a pooled sample of three known non-carriers (BOSSAG, RIFURT and HIRMER).
  • Establishing the Pathogenicity of Novel Mitochondrial DNA Sequence Variations: a Cell and Molecular Biology Approach

    Establishing the Pathogenicity of Novel Mitochondrial DNA Sequence Variations: a Cell and Molecular Biology Approach

    Mafalda Rita Avó Bacalhau Establishing the Pathogenicity of Novel Mitochondrial DNA Sequence Variations: a Cell and Molecular Biology Approach Tese de doutoramento do Programa de Doutoramento em Ciências da Saúde, ramo de Ciências Biomédicas, orientada pela Professora Doutora Maria Manuela Monteiro Grazina e co-orientada pelo Professor Doutor Henrique Manuel Paixão dos Santos Girão e pela Professora Doutora Lee-Jun C. Wong e apresentada à Faculdade de Medicina da Universidade de Coimbra Julho 2017 Faculty of Medicine Establishing the pathogenicity of novel mitochondrial DNA sequence variations: a cell and molecular biology approach Mafalda Rita Avó Bacalhau Tese de doutoramento do programa em Ciências da Saúde, ramo de Ciências Biomédicas, realizada sob a orientação científica da Professora Doutora Maria Manuela Monteiro Grazina; e co-orientação do Professor Doutor Henrique Manuel Paixão dos Santos Girão e da Professora Doutora Lee-Jun C. Wong, apresentada à Faculdade de Medicina da Universidade de Coimbra. Julho, 2017 Copyright© Mafalda Bacalhau e Manuela Grazina, 2017 Esta cópia da tese é fornecida na condição de que quem a consulta reconhece que os direitos de autor são pertença do autor da tese e do orientador científico e que nenhuma citação ou informação obtida a partir dela pode ser publicada sem a referência apropriada e autorização. This copy of the thesis has been supplied on the condition that anyone who consults it recognizes that its copyright belongs to its author and scientific supervisor and that no quotation from the
  • ACVR1 Antibody Cat

    ACVR1 Antibody Cat

    ACVR1 Antibody Cat. No.: 4791 Western blot analysis of ACVR1 in A549 cell lysate with ACVR1 antibody at 1 μg/mL in (A) the absence and (B) the presence of blocking peptide. Specifications HOST SPECIES: Rabbit SPECIES REACTIVITY: Human, Mouse HOMOLOGY: Predicted species reactivity based on immunogen sequence: Bovine: (100%), Rat: (93%) ACVR1 antibody was raised against a 14 amino acid synthetic peptide near the amino terminus of the human ACVR1. IMMUNOGEN: The immunogen is located within the first 50 amino acids of ACVR1. TESTED APPLICATIONS: ELISA, WB ACVR1 antibody can be used for detection of ACVR1 by Western blot at 1 μg/mL. APPLICATIONS: Antibody validated: Western Blot in human samples. All other applications and species not yet tested. At least four isoforms of ACVR1 are known to exist. This antibody is predicted to have no SPECIFICITY: cross-reactivity to ACVR1B or ACVR1C. POSITIVE CONTROL: 1) Cat. No. 1203 - A549 Cell Lysate Properties October 1, 2021 1 https://www.prosci-inc.com/acvr1-antibody-4791.html PURIFICATION: ACVR1 Antibody is affinity chromatography purified via peptide column. CLONALITY: Polyclonal ISOTYPE: IgG CONJUGATE: Unconjugated PHYSICAL STATE: Liquid BUFFER: ACVR1 Antibody is supplied in PBS containing 0.02% sodium azide. CONCENTRATION: 1 mg/mL ACVR1 antibody can be stored at 4˚C for three months and -20˚C, stable for up to one STORAGE CONDITIONS: year. As with all antibodies care should be taken to avoid repeated freeze thaw cycles. Antibodies should not be exposed to prolonged high temperatures. Additional Info OFFICIAL SYMBOL: ACVR1 ACVR1 Antibody: FOP, ALK2, SKR1, TSRI, ACTRI, ACVR1A, ACVRLK2, Activin receptor type-1, ALTERNATE NAMES: Activin receptor type I, ACTR-I ACCESSION NO.: NP_001096 PROTEIN GI NO.: 4501895 GENE ID: 90 USER NOTE: Optimal dilutions for each application to be determined by the researcher.
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model

    Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model

    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
  • Seq2pathway Vignette

    Seq2pathway Vignette

    seq2pathway Vignette Bin Wang, Xinan Holly Yang, Arjun Kinstlick May 19, 2021 Contents 1 Abstract 1 2 Package Installation 2 3 runseq2pathway 2 4 Two main functions 3 4.1 seq2gene . .3 4.1.1 seq2gene flowchart . .3 4.1.2 runseq2gene inputs/parameters . .5 4.1.3 runseq2gene outputs . .8 4.2 gene2pathway . 10 4.2.1 gene2pathway flowchart . 11 4.2.2 gene2pathway test inputs/parameters . 11 4.2.3 gene2pathway test outputs . 12 5 Examples 13 5.1 ChIP-seq data analysis . 13 5.1.1 Map ChIP-seq enriched peaks to genes using runseq2gene .................... 13 5.1.2 Discover enriched GO terms using gene2pathway_test with gene scores . 15 5.1.3 Discover enriched GO terms using Fisher's Exact test without gene scores . 17 5.1.4 Add description for genes . 20 5.2 RNA-seq data analysis . 20 6 R environment session 23 1 Abstract Seq2pathway is a novel computational tool to analyze functional gene-sets (including signaling pathways) using variable next-generation sequencing data[1]. Integral to this tool are the \seq2gene" and \gene2pathway" components in series that infer a quantitative pathway-level profile for each sample. The seq2gene function assigns phenotype-associated significance of genomic regions to gene-level scores, where the significance could be p-values of SNPs or point mutations, protein-binding affinity, or transcriptional expression level. The seq2gene function has the feasibility to assign non-exon regions to a range of neighboring genes besides the nearest one, thus facilitating the study of functional non-coding elements[2]. Then the gene2pathway summarizes gene-level measurements to pathway-level scores, comparing the quantity of significance for gene members within a pathway with those outside a pathway.
  • Stelios Pavlidis3, Matthew Loza3, Fred Baribaud3, Anthony

    Stelios Pavlidis3, Matthew Loza3, Fred Baribaud3, Anthony

    Supplementary Data Th2 and non-Th2 molecular phenotypes of asthma using sputum transcriptomics in UBIOPRED Chih-Hsi Scott Kuo1.2, Stelios Pavlidis3, Matthew Loza3, Fred Baribaud3, Anthony Rowe3, Iaonnis Pandis2, Ana Sousa4, Julie Corfield5, Ratko Djukanovic6, Rene 7 7 8 2 1† Lutter , Peter J. Sterk , Charles Auffray , Yike Guo , Ian M. Adcock & Kian Fan 1†* # Chung on behalf of the U-BIOPRED consortium project team 1Airways Disease, National Heart & Lung Institute, Imperial College London, & Biomedical Research Unit, Biomedical Research Unit, Royal Brompton & Harefield NHS Trust, London, United Kingdom; 2Department of Computing & Data Science Institute, Imperial College London, United Kingdom; 3Janssen Research and Development, High Wycombe, Buckinghamshire, United Kingdom; 4Respiratory Therapeutic Unit, GSK, Stockley Park, United Kingdom; 5AstraZeneca R&D Molndal, Sweden and Areteva R&D, Nottingham, United Kingdom; 6Faculty of Medicine, Southampton University, Southampton, United Kingdom; 7Faculty of Medicine, University of Amsterdam, Amsterdam, Netherlands; 8European Institute for Systems Biology and Medicine, CNRS-ENS-UCBL, Université de Lyon, France. †Contributed equally #Consortium project team members are listed under Supplementary 1 Materials *To whom correspondence should be addressed: [email protected] 2 List of the U-BIOPRED Consortium project team members Uruj Hoda & Christos Rossios, Airways Disease, National Heart & Lung Institute, Imperial College London, UK & Biomedical Research Unit, Biomedical Research Unit, Royal
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Supplementary Table 3 Complete List of RNA-Sequencing Analysis of Gene Expression Changed by ≥ Tenfold Between Xenograft and Cells Cultured in 10%O2

    Supplementary Table 3 Complete List of RNA-Sequencing Analysis of Gene Expression Changed by ≥ Tenfold Between Xenograft and Cells Cultured in 10%O2

    Supplementary Table 3 Complete list of RNA-Sequencing analysis of gene expression changed by ≥ tenfold between xenograft and cells cultured in 10%O2 Expr Log2 Ratio Symbol Entrez Gene Name (culture/xenograft) -7.182 PGM5 phosphoglucomutase 5 -6.883 GPBAR1 G protein-coupled bile acid receptor 1 -6.683 CPVL carboxypeptidase, vitellogenic like -6.398 MTMR9LP myotubularin related protein 9-like, pseudogene -6.131 SCN7A sodium voltage-gated channel alpha subunit 7 -6.115 POPDC2 popeye domain containing 2 -6.014 LGI1 leucine rich glioma inactivated 1 -5.86 SCN1A sodium voltage-gated channel alpha subunit 1 -5.713 C6 complement C6 -5.365 ANGPTL1 angiopoietin like 1 -5.327 TNN tenascin N -5.228 DHRS2 dehydrogenase/reductase 2 leucine rich repeat and fibronectin type III domain -5.115 LRFN2 containing 2 -5.076 FOXO6 forkhead box O6 -5.035 ETNPPL ethanolamine-phosphate phospho-lyase -4.993 MYO15A myosin XVA -4.972 IGF1 insulin like growth factor 1 -4.956 DLG2 discs large MAGUK scaffold protein 2 -4.86 SCML4 sex comb on midleg like 4 (Drosophila) Src homology 2 domain containing transforming -4.816 SHD protein D -4.764 PLP1 proteolipid protein 1 -4.764 TSPAN32 tetraspanin 32 -4.713 N4BP3 NEDD4 binding protein 3 -4.705 MYOC myocilin -4.646 CLEC3B C-type lectin domain family 3 member B -4.646 C7 complement C7 -4.62 TGM2 transglutaminase 2 -4.562 COL9A1 collagen type IX alpha 1 chain -4.55 SOSTDC1 sclerostin domain containing 1 -4.55 OGN osteoglycin -4.505 DAPL1 death associated protein like 1 -4.491 C10orf105 chromosome 10 open reading frame 105 -4.491
  • PROTEOMIC ANALYSIS of HUMAN URINARY EXOSOMES. Patricia

    PROTEOMIC ANALYSIS of HUMAN URINARY EXOSOMES. Patricia

    ABSTRACT Title of Document: PROTEOMIC ANALYSIS OF HUMAN URINARY EXOSOMES. Patricia Amalia Gonzales Mancilla, Ph.D., 2009 Directed By: Associate Professor Nam Sun Wang, Department of Chemical and Biomolecular Engineering Exosomes originate as the internal vesicles of multivesicular bodies (MVBs) in cells. These small vesicles (40-100 nm) have been shown to be secreted by most cell types throughout the body. In the kidney, urinary exosomes are released to the urine by fusion of the outer membrane of the MVBs with the apical plasma membrane of renal tubular epithelia. Exosomes contain apical membrane and cytosolic proteins and can be isolated using differential centrifugation. The analysis of urinary exosomes provides a non- invasive means of acquiring information about the physiological or pathophysiological state of renal cells. The overall objective of this research was to develop methods and knowledge infrastructure for urinary proteomics. We proposed to conduct a proteomic analysis of human urinary exosomes. The first objective was to profile the proteome of human urinary exosomes using liquid chromatography-tandem spectrometry (LC- MS/MS) and specialized software for identification of peptide sequences from fragmentation spectra. We unambiguously identified 1132 proteins. In addition, the phosphoproteome of human urinary exosomes was profiled using the neutral loss scanning acquisition mode of LC-MS/MS. The phosphoproteomic profiling identified 19 phosphorylation sites corresponding to 14 phosphoproteins. The second objective was to analyze urinary exosomes samples isolated from patients with genetic mutations. Polyclonal antibodies were generated to recognize epitopes on the gene products of these genetic mutations, NKCC2 and MRP4. The potential usefulness of urinary exosome analysis was demonstrated using the well-defined renal tubulopathy, Bartter syndrome type I and using the single nucleotide polymorphism in the ABCC4 gene.
  • ATP6V1B1 Gene Atpase H+ Transporting V1 Subunit B1

    ATP6V1B1 Gene Atpase H+ Transporting V1 Subunit B1

    ATP6V1B1 gene ATPase H+ transporting V1 subunit B1 Normal Function The ATP6V1B1 gene provides instructions for making a part (subunit) of a large protein complex known as vacuolar H+-ATPase (V-ATPase). V-ATPases are a group of similar complexes that act as pumps to move positively charged hydrogen atoms (protons) across membranes. Because acids are substances that can "donate" protons to other molecules, this movement of protons helps regulate the relative acidity (pH) of cells and their surrounding environment. Tight control of pH is necessary for most biological reactions to proceed properly. The V-ATPase that includes the subunit produced from the ATP6V1B1 gene is found in the inner ear and in nephrons, which are the functional structures within the kidneys. The kidneys filter waste products from the blood and remove them in urine. They also reabsorb needed nutrients and release them back into the blood. Each nephron consists of two parts: a renal corpuscle (also known as a glomerulus) that filters the blood, and a renal tubule that reabsorbs substances that are needed and eliminates unneeded substances in urine. The V-ATPase is involved in regulating the amount of acid that is removed from the blood into the urine, and also in maintaining the proper pH of the fluid in the inner ear (endolymph). Health Conditions Related to Genetic Changes Renal tubular acidosis with deafness More than 25 ATP6V1B1 gene mutations have been identified in people with renal tubular acidosis with deafness, a disorder involving excess acid in the blood (metabolic acidosis), bone weakness, and hearing loss caused by changes in the inner ear ( sensorineural hearing loss).
  • Datasheet: VPA00673 Product Details

    Datasheet: VPA00673 Product Details

    Datasheet: VPA00673 Description: RABBIT ANTI ATP5D Specificity: ATP5D Format: Purified Product Type: PrecisionAb™ Polyclonal Isotype: Polyclonal IgG Quantity: 100 µl Product Details Applications This product has been reported to work in the following applications. This information is derived from testing within our laboratories, peer-reviewed publications or personal communications from the originators. Please refer to references indicated for further information. For general protocol recommendations, please visit www.bio-rad-antibodies.com/protocols. Yes No Not Determined Suggested Dilution Western Blotting 1/1000 PrecisionAb antibodies have been extensively validated for the western blot application. The antibody has been validated at the suggested dilution. Where this product has not been tested for use in a particular technique this does not necessarily exclude its use in such procedures. Further optimization may be required dependant on sample type. Target Species Human Species Cross Reacts with: Mouse Reactivity N.B. Antibody reactivity and working conditions may vary between species. Product Form Purified IgG - liquid Preparation Rabbit polyclonal antibody purified by affinity chromatography Buffer Solution Phosphate buffered saline Preservative 0.09% Sodium Azide Stabilisers 2% Sucrose Immunogen Synthetic peptide encompassing part of the middle region of human ATP5D External Database Links UniProt: P30049 Related reagents Entrez Gene: 513 ATP5D Related reagents Specificity Rabbit anti Human ATP5D antibody recognizes ATP synthase subunit delta, mitochondrial, also known as ATP synthase subunit delta mitochondrial, F-ATPase delta subunit, mitochondrial ATP Page 1 of 2 synthase complex delta-subunit precusor, or mitochondrial ATP synthase, delta subunit. ATP5D gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation.
  • Saracatinib Is an Efficacious Clinical Candidate for Fibrodysplasia Ossificans Progressiva

    Saracatinib Is an Efficacious Clinical Candidate for Fibrodysplasia Ossificans Progressiva

    RESEARCH ARTICLE Saracatinib is an efficacious clinical candidate for fibrodysplasia ossificans progressiva Eleanor Williams,1 Jana Bagarova,2 Georgina Kerr,1 Dong-Dong Xia,2 Elsie S. Place,3 Devaveena Dey,2 Yue Shen,2 Geoffrey A. Bocobo,2 Agustin H. Mohedas,2 Xiuli Huang,4 Philip E. Sanderson,4 Arthur Lee,4 Wei Zheng,4 Aris N. Economides,5 James C. Smith,3 Paul B. Yu,2 and Alex N. Bullock1 1Centre for Medicines Discovery, University of Oxford, Oxford, United Kingdom. 2Department of Medicine, Cardiovascular Division, Brigham and Women’s Hospital, Harvard Medical School, Boston, Massachusetts, USA. 3Developmental Biology Laboratory, Francis Crick Institute, London, United Kingdom. 4National Center for Advancing Translational Sciences, NIH, Bethesda, Maryland, USA. 5Regeneron Pharmaceuticals Inc., Tarrytown, New York, USA. Currently, no effective therapies exist for fibrodysplasia ossificans progressiva (FOP), a rare congenital syndrome in which heterotopic bone is formed in soft tissues owing to dysregulated activity of the bone morphogenetic protein (BMP) receptor kinase ALK2 (also known as ACVR1). From a screen of known biologically active compounds, we identified saracatinib as a potent ALK2 kinase inhibitor. In enzymatic and cell-based assays, saracatinib preferentially inhibited ALK2, compared with other receptors of the BMP/TGF-β signaling pathway, and induced dorsalization in zebrafish embryos consistent with BMP antagonism. We further tested the efficacy of saracatinib using an inducible ACVR1Q207D-transgenic mouse line, which provides a model of heterotopic ossification (HO), as well as an inducible ACVR1R206H-knockin mouse, which serves as a genetically and physiologically faithful FOP model. In both models, saracatinib was well tolerated and potently inhibited the development of HO, even when administered transiently following soft tissue injury.