DOCSLIB.ORG

Genetics of Migraine: Insights Into the Molecular Basis of Migraine Disorders

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genetics of Migraine: Insights Into the Molecular Basis of Migraine Disorders This may be the author’s version of a work that was submitted/accepted for publication in the following source: Sutherland, Heidi& Griffiths, Lyn (2017) Genetics of migraine: Insights into the molecular basis of migraine disor- ders. Headache, 57(4), pp. 537-569. This file was downloaded from: https://eprints.qut.edu.au/105633/ c Consult author(s) regarding copyright matters This work is covered by copyright. Unless the document is being made available under a Creative Commons Licence, you must assume that re-use is limited to personal use and that permission from the copyright owner must be obtained for all other uses. If the docu- ment is available under a Creative Commons License (or other specified license) then refer to the Licence for details of permitted re-use. It is a condition of access that users recog- nise and abide by the legal requirements associated with these rights. If you believe that this work infringes copyright please provide details by email to [email protected] Notice: Please note that this document may not be the Version of Record (i.e. published version) of the work. Author manuscript versions (as Sub- mitted for peer review or as Accepted for publication after peer review) can be identified by an absence of publisher branding and/or typeset appear- ance. If there is any doubt, please refer to the published source. https://doi.org/10.1111/head.13053 Genetics of Migraine: insights into the molecular basis of migraine disorders Heidi G. Sutherland, PhD and Lyn R. Griffiths, PhD Genomics Research Centre, Institute of Health and Biomedical Innovation, QUT, Musk Ave, Kelvin Grove, QLD 4059, Australia The authors declare no conflicts of interest. Acknowledgements: We wish to acknowledge the support of the Australian National Health and Medical Research Council and the Migraine Research Foundation, NY, USA for supporting our migraine genetic and diagnostic research. Key words: Migraine; genetics; hemiplegic migraine; genome-wide association study ABSTRACT Migraine is a complex, debilitating neurovascular disorder, typically characterised by recurring, incapacitating attacks of severe headache often accompanied by nausea and neurological disturbances. It has a strong genetic basis demonstrated by rare migraine disorders caused by mutations in single genes (monogenic), as well as familial clustering of common migraine which is associated with polymorphisms in many genes (polygenic). Hemiplegic migraine is a dominantly inherited, severe form of migraine with associated motor weakness. Family studies have found that mutations in three different ion channels genes, CACNA1A, ATP1A2 and SCN1A can be causal. Functional studies of these mutations has shown that they can result in defective regulation of glutamatergic neurotransmission and the excitatory/inhibitory balance in the brain, which lowers the threshold for cortical spreading depression, a wave of cortical depolarisation thought to be involved in headache initiation mechanisms. Other putative genes for monogenic migraine include KCKN18, PRRT2, and CSNK1D, which can also be involved with other disorders. There are a number of primarily vascular disorders caused by mutations in single genes, which are often accompanied by migraine symptoms. Mutations in NOTCH3 causes cerebral autosomal dominant arteriopathy with subcortical infarcts and leucoencephalopathy (CADASIL) a hereditary cerebrovascular disease that leads to ischemic strokes and dementia, but in which migraine is often present, sometimes long before the onset of other symptoms. Mutations in the TREX1 and COL4A1 also cause vascular disorders, but often feature migraine. With respect to common polygenic migraine, genome-wide association studies have now identified single nucleotide polymorphisms at 38 loci significantly associated with migraine risk. Functions assigned to the genes in proximity to these loci suggest that both neuronal and vascular pathways also contribute to the pathophysiology of common migraine. Further studies are required to fully understand these findings and translate them into treatment options for migraine patients. INTRODUCTION Migraine symptoms and diagnosis Migraine is a complex, debilitating neurovascular disorder, typically characterized by recurring, incapacitating attacks of moderate or severe headache for 1-3 days and often accompanied by autonomic dysfunction, nausea and sometimes aura symptoms. The disorder affects at least 12% of the general population, including young children, with a marked preponderance of females (~3:1 ratio) [1, 2]. In addition to individual suffering, migraine has severe social and economic impacts. Data from the recent Global Burden of Disease study (2013) ranks migraine as the most burdensome neurological disorder, and 6th highest cause of disability worldwide [3]. It ranks among the World Health Organisation top 12 of most disabling and undertreated disorders and is responsible for one of the highest socio-economic burdens of any brain ailment. It is often misdiagnosed because of lack of objective diagnostic tests and current treatments are not satisfactory or effective for everyone. Migraine presents with variable clinical phenotypes which can be heterogeneous in the population. Characteristic clinical features of migraine include throbbing head pain (usually unilateral), nausea, vomiting, photophobia, phonophobia and often severe, neurological disturbances [4]. It is currently clinically diagnosed based on the International Classification of Headache Disorders 3rd Edition (ICHD-III) [4] which formally classifies migraine into two main subtypes; Migraine without Aura (MO) and Migraine with Aura (MA). These have substantial symptomatic overlap, however MA sufferers also experience distinguishing neurological phenomena that precede the headache phase of an attack. The aura can encompass various neurological symptoms, often visual, such as scintillating shapes, hallucinations or black spots, but can also affect sensory, speech, motor, brainstem and retinal functions. Overall, MO and MA sufferers account for ~70% and 20-30% of migraineurs, respectively. ICHD-III also describes other migraine sub-types: chronic migraine is diagnosed in patients who experience frequent or almost continuous migraine symptoms, and is often linked with medication overuse; more than 50% of females suffering from MO report a menstrual association which has led to the further classification of menstrual migraine [5, 6]; and hemiplegic migraine (HM) is a rare severe form of MA that also features motor weakness. Pathophysiology of Migraine Activation of the trigeminovascular system The pathophysiology of migraine is only partially understood, but is believed to be caused by activation of the trigeminovascular system [7]. The headache phase of a migraine attack is thought to result from activation of nociceptors innervating the cranial blood vessels, which transmits a signal to the trigeminal bipolar neurons; this is further relayed to thalamic and cortical areas, producing the sensation of pain [8]. The signal from the perivascular neurons is transmitted by the vasoactive neuropeptides calcitonin gene-related peptide (CGRP), substance P (SP) and nitric oxide, resulting in a downstream cascade of events that leads to the release of vasoactive inflammatory mediators, inflammation in the meninges and sensitization of pain relevant brainstem regions [9]. Cortical Spreading Depression Trigeminal activation is a downstream event; how it is triggered is not well understood, but there is accumulating evidence that cortical spreading depression (CSD) is one route. CSD is a slowly propagating wave of neuronal and glial depolarisation accompanied by massive ion fluxes, that spreads across the brain cortex, and which is followed by a long-lasting suppression of neuronal activity [10, 11]. It coincides with, and is thought to underlie, the migraine aura [12, 13]. The onset of CSD has been demonstrated experimentally following noxious stimuli which lead to a build-up of glutamate in the neuronal environment, which then pathologically activates calcium and sodium channels, particularly the N-methyl-D- aspartate (NMDA) receptors [11]. Evidence from experimental animals suggests that CSD might not only cause migraine auras, but also play a pivotal role in headache initiation mechanisms [12-14]. CSD is associated with opening of Pannexin1 mega channels causing caspase-1 activation and HMGB1 release which initiates parenchymal inflammatory pathways and may provide the stimulus for sustained trigeminal activation [15]. Proof of a direct link between CSD and migraine in humans is still lacking, and the question of how CSD itself is triggered, and details of the downstream effects needs further investigation. Furthermore, the majority of migraine patients do not experience aura, so alternative triggers for trigeminovascular activation may also be important, such as cortical hyperexcitability or brain stem or hypothalamic dysfunction [16]. Clinical and neurophysiological studies have confirmed that individuals suffering from migraine display chronic hypersensitivity to sensory stimuli and or abnormal processing of sensory information [17-19]. Migraineurs exhibit cortical excitability [19, 20], which may make them more susceptible to CSD. Dissection of the genetics of migraine, particularly the severe monogenic forms, has added support to this and animal models have aided in understanding some of the mechanisms. Genetics of Migraine Migraine is a complex disorder with many factors contributing
Load more

Recommended publications
  • Supplementary Information for the Skeletal Muscle Molecular Clock Regulates Sarcomere Length Through Titin Splicing
    Supplementary Information for The skeletal muscle molecular clock regulates sarcomere length through titin splicing Lance A. Riley, Xiping Zhang, Joseph M. Mijares, David W. Hammers, , Hailey R. Olafson, Ping Du, Collin M. Douglas, Siegfried Labeit, Eric T. Wang, and Karyn A. Esser Karyn A. Esser Email: [email protected] This PDF file includes: Tables S1 to S7 1 Table S1. Antibodies and concentrations used in this study. Antibody Source Concentration Rb anti-sarcomeric α-actinin (EP2529Y) Abcam 1:1000 Rb anti-titin N2A Myomedix 1:250 Rb anti-titin Z1Z2 Myomedix 1:100 Rb anti-RBM20 Myomedix 1:500 Ms anti-γ-tubulin (T6557) Sigma 1:1000 Rt anti-HA High Affinity (11867423001) Roche 1:1000 Gt anti-rabbit Alexa Fluor 488 Thermo 1:500 Gt anti-rabbit Alexa Fluor 405 Thermo 1:500 Gt anti-rabbit Alexa Fluor 647 Thermo 1:500 Gt anti-rabbit IgG (H+L) HRP Sigma 1:10000 Gt anti-mouse IgG (H+L) HRP Sigma 1:10000 2 Table S2. RNA Integrity Values and number of reads sequenced for each sample used for RNAseq analysis. Sample Name RIN Read Number (Millions) M10 8.6 61.4 M11 8.3 58.6 M13 8.4 77.5 M15 8.9 69.3 M16 8.8 45.6 M17 8.7 59.8 3 Table S3. Primers used for plasmid generation and qRT-PCR. Sequence (5’ – 3’) Name GGGAGATCTTTAACAACATAGGAGCTGTGATTGGCTGT U7-BglII F AAACTGCAGCACAACGCGTTTCCTAGGAAACCA U7-PstI R GCTCTTTTAGAATTTTTGGAGCAGGTTTTCTGAC SDM U7smOpt F GTCAGAAAACCTGCTGGTTAAATTCTAAAAGAGC SDM U7smOpt R TTAGGGTGGGTGGATACGCCTCTGCAAAAGAATTTTTGGAGCAGGTTTTCTG Ttn-51-AS F TATCCACCCACCCTAAGTCCCTATCATAGCGGAAGTGCGTCTGTAG Ttn-51-AS R TAGGGTGCAAGGTACTCCTTAGAGTGAAAGAATTTTTGGAGCAGGTTT Ttn-89-AS F GTACCTTGCACCCTAAGTCCCTATCATAGCGGAAGTGCGTCTGTAG Ttn-89-AS R TGCATGCCCAGAAATGCCTGCT Rbm20 qPCR F AAAGGCCCTCGTTGGAATGGCT Rbm20 qPCR R CGAGTCCAGCGAGAGAAGG Rpl26 F GCAGTCTTTAATGAAAGCCGTG Rpl26 R CTAGGACGGAATCTGCTGTG Rbm20 Intron 1 F AACAGGGTGTCTGTCTGTCT Rbm20 Intron 1 R 4 Table S4.
    [Show full text]
  • Supplementary Table 2
    Supplementary Table 2. Differentially Expressed Genes following Sham treatment relative to Untreated Controls Fold Change Accession Name Symbol 3 h 12 h NM_013121 CD28 antigen Cd28 12.82 BG665360 FMS-like tyrosine kinase 1 Flt1 9.63 NM_012701 Adrenergic receptor, beta 1 Adrb1 8.24 0.46 U20796 Nuclear receptor subfamily 1, group D, member 2 Nr1d2 7.22 NM_017116 Calpain 2 Capn2 6.41 BE097282 Guanine nucleotide binding protein, alpha 12 Gna12 6.21 NM_053328 Basic helix-loop-helix domain containing, class B2 Bhlhb2 5.79 NM_053831 Guanylate cyclase 2f Gucy2f 5.71 AW251703 Tumor necrosis factor receptor superfamily, member 12a Tnfrsf12a 5.57 NM_021691 Twist homolog 2 (Drosophila) Twist2 5.42 NM_133550 Fc receptor, IgE, low affinity II, alpha polypeptide Fcer2a 4.93 NM_031120 Signal sequence receptor, gamma Ssr3 4.84 NM_053544 Secreted frizzled-related protein 4 Sfrp4 4.73 NM_053910 Pleckstrin homology, Sec7 and coiled/coil domains 1 Pscd1 4.69 BE113233 Suppressor of cytokine signaling 2 Socs2 4.68 NM_053949 Potassium voltage-gated channel, subfamily H (eag- Kcnh2 4.60 related), member 2 NM_017305 Glutamate cysteine ligase, modifier subunit Gclm 4.59 NM_017309 Protein phospatase 3, regulatory subunit B, alpha Ppp3r1 4.54 isoform,type 1 NM_012765 5-hydroxytryptamine (serotonin) receptor 2C Htr2c 4.46 NM_017218 V-erb-b2 erythroblastic leukemia viral oncogene homolog Erbb3 4.42 3 (avian) AW918369 Zinc finger protein 191 Zfp191 4.38 NM_031034 Guanine nucleotide binding protein, alpha 12 Gna12 4.38 NM_017020 Interleukin 6 receptor Il6r 4.37 AJ002942
    [Show full text]
  • Beyond Traditional Morphological Characterization of Lung
    Cancers 2020 S1 of S15 Beyond Traditional Morphological Characterization of Lung Neuroendocrine Neoplasms: In Silico Study of Next-Generation Sequencing Mutations Analysis across the Four World Health Organization Defined Groups Giovanni Centonze, Davide Biganzoli, Natalie Prinzi, Sara Pusceddu, Alessandro Mangogna, Elena Tamborini, Federica Perrone, Adele Busico, Vincenzo Lagano, Laura Cattaneo, Gabriella Sozzi, Luca Roz, Elia Biganzoli and Massimo Milione Table S1. Genes Frequently mutated in Typical Carcinoids (TCs). Mutation Original Entrez Gene Gene Rate % eukaryotic translation initiation factor 1A X-linked [Source: HGNC 4.84 EIF1AX 1964 EIF1AX Symbol; Acc: HGNC: 3250] AT-rich interaction domain 1A [Source: HGNC Symbol;Acc: HGNC: 4.71 ARID1A 8289 ARID1A 11110] LDL receptor related protein 1B [Source: HGNC Symbol; Acc: 4.35 LRP1B 53353 LRP1B HGNC: 6693] 3.53 NF1 4763 NF1 neurofibromin 1 [Source: HGNC Symbol;Acc: HGNC: 7765] DS cell adhesion molecule like 1 [Source: HGNC Symbol; Acc: 2.90 DSCAML1 57453 DSCAML1 HGNC: 14656] 2.90 DST 667 DST dystonin [Source: HGNC Symbol;Acc: HGNC: 1090] FA complementation group D2 [Source: HGNC Symbol; Acc: 2.90 FANCD2 2177 FANCD2 HGNC: 3585] piccolo presynaptic cytomatrix protein [Source: HGNC Symbol; Acc: 2.90 PCLO 27445 PCLO HGNC: 13406] erb-b2 receptor tyrosine kinase 2 [Source: HGNC Symbol; Acc: 2.44 ERBB2 2064 ERBB2 HGNC: 3430] BRCA1 associated protein 1 [Source: HGNC Symbol; Acc: HGNC: 2.35 BAP1 8314 BAP1 950] capicua transcriptional repressor [Source: HGNC Symbol; Acc: 2.35 CIC 23152 CIC HGNC:
    [Show full text]
  • Comprehensive Analysis of the Expression of Sodium/Potassium-Atpase Α Subunits and Prognosis of Ovarian Serous Cystadenocarcinoma
    Comprehensive Analysis of the Expression of Sodium/Potassium-ATPase α Subunits and Prognosis of Ovarian Serous Cystadenocarcinoma Wei Huang Tumor Hospital of Harbin Medical University Yongjian Zhang Tumor Hospital of Harbin Medical University Ye Xu Tumor Hospital of Harbin Medical University Shaoyou Yang Tumor Hospital of Harbin Medical University Bing Li Tumor Hospital of Harbin Medical University Lan Huang Tumor Hospital of Harbin Medical University Ge Lou ( [email protected] ) Tumor Hospital of Harbin Medical University https://orcid.org/0000-0001-6617-4482 Primary research Keywords: Adenosine triphosphate, ovary, cystadenocarcinoma, gynecology, gene expression Posted Date: June 22nd, 2020 DOI: https://doi.org/10.21203/rs.3.rs-23702/v2 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Version of Record: A version of this preprint was published on July 14th, 2020. See the published version at https://doi.org/10.1186/s12935-020-01414-5. Page 1/21 Abstract Background: Ovarian serous cystadenocarcinoma (OSC) is the most common and lethal gynecological cancer in women worldwide; however, biomarkers to diagnose and predict prognosis of OSC remain limited. Therefore, the present study aimed to investigate whether sodium/potassium adenosine triphosphate (Na+/K+-ATP)ase α-subunits (ATP1As) are helpful diagnostic and prognostic markers of OSC. Methods: Gene expression data (RNA-Seq) of 376 patients with OSC were downloaded from The Cancer Genome Atlas (TCGA) program database. Additional databases used in our analysis included the Gene Expression Omnibus, International Cancer Genome Consortium, Genotype–Tissue Expression, the Human Protein Atlas, cBioPortal for Cancer Genomics, and Cancer Cell Line Encyclopedia.
    [Show full text]
  • Supplementary Information Page
    Supplementary information page Criteria for inclusion of patient variants in the analysis 1 Figure e-1 Alignment of the four human Na,K-ATPase alpha subunits 2-3 Figure e-2 Conformation differences when Na+ or K+ ions are bound 4 Figure e-3 Color-coded conservation scores for ATP1A1 generated by ConSurf 5 Figure e-4 Milder and more severe ATP1A3 pathogenic variants in the P domain are similar 6 Figure e-5 ATP1A2 and ATP1A3 variants in the S domain are also similar 7 Table e-1 Variants in ATP1A1 with references 8 Table e-2 Variants in ATP1A2 with references 9-13 Table e-3 Variants in ATP1A3 with references 14-19 Table e-4 Variants excluded from the analysis with references 20-21 Criteria for inclusion of patient variants in the analysis All included variants were missense, except that deletions of single amino acids were included without prejudice because several were recurrent in ATP1A2 and ATP1A3. The few more complicated genetic variants, splice site variants, and premature stops were not considered. Variants were considered pathogenic if: 1) identical variants arose independently in two or more unrelated patients/families with similar symptoms; 2) variants caused alternative amino acid changes in a single codon, with symptoms on the spectrum; 3) variants occurred at the equivalent position in more than one paralog, with symptoms typical of that paralog; or 4) there was laboratory evidence of impairment of Na,K-ATPase activity or biosynthesis. Single-family variants not meeting those criteria were considered probably pathogenic if 1) variants were proven to be de novo with DNA from both parents, or 2) pedigree data showed segregation with only affected members of the family, and 3) were considered possibly pathogenic when there was minimal or ambiguous pedigree data.
    [Show full text]
  • Dynamics of a Protein Interaction Network Associated to the Aggregation of Polyq-Expanded Ataxin-1
    G C A T T A C G G C A T genes Article Dynamics of a Protein Interaction Network Associated to the Aggregation of polyQ-Expanded Ataxin-1 Aimilia-Christina Vagiona 1 , Miguel A. Andrade-Navarro 2 , Fotis Psomopoulos 3,4 and Spyros Petrakis 3,* 1 Department of Biology, Aristotle University of Thessaloniki, 54124 Thessaloniki, Greece; [email protected] 2 Faculty of Biology, Johannes Gutenberg University, Biozentrum I, Hans-Dieter-Hüsch-Weg 15, 55128 Mainz, Germany; [email protected] 3 Institute of Applied Biosciences/Centre for Research and Technology Hellas, 57001 Thessaloniki, Greece; [email protected] 4 Department of Molecular Medicine and Surgery, Karolinska Institutet, 17177 Stockholm, Sweden * Correspondence: [email protected]; Tel.: +30-2311-257-525 Received: 20 August 2020; Accepted: 23 September 2020; Published: 25 September 2020 Abstract: Background: Several experimental models of polyglutamine (polyQ) diseases have been previously developed that are useful for studying disease progression in the primarily affected central nervous system. However, there is a missing link between cellular and animal models that would indicate the molecular defects occurring in neurons and are responsible for the disease phenotype in vivo. Methods: Here, we used a computational approach to identify dysregulated pathways shared by an in vitro and an in vivo model of ATXN1(Q82) protein aggregation, the mutant protein that causes the neurodegenerative polyQ disease spinocerebellar ataxia type-1 (SCA1). Results: A set of common dysregulated pathways were identified, which were utilized to construct cerebellum-specific protein-protein interaction (PPI) networks at various time-points of protein aggregation. Analysis of a SCA1 network indicated important nodes which regulate its function and might represent potential pharmacological targets.
    [Show full text]
  • Migraine in the Era of Precision Medicine
    Focus on Toward Precision Medicine in Neurological Diseases Page 1 of 10 Migraine in the era of precision medicine Lv-Ming Zhang1, Zhao Dong2*, Sheng-Yuan Yu2* 1Department of Neurology, Aerospace Center Hospital/Aerospace Clinical Medical College Affiliated to Peking University, Beijing 100049, China; 2Department of Neurology, Chinese PLA General Hospital, Beijing 100853, China Contributions: (I) Conception and design: Z Dong, SY Yu; (II) Administrative support: None; (III) Provision of study materials or patients: None; (IV) Collection and assembly of data: None; (V) Data analysis and interpretation: None; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors. *These authors contributed equally to this work. Correspondence to: Prof. Zhao Dong. Department of Neurology, Chinese PLA General Hospital, Fuxing Road 28, Haidian District, Beijing 100853, China. Email: [email protected]; Prof. Shengyuan Yu. Department of Neurology, Chinese PLA General Hospital, Fuxing Road 28, Haidian District, Beijing 100853, China. Email: [email protected]. Abstract: Migraine is a common neurovascular disorder in the neurologic clinics whose mechanisms have been explored for several years. The aura has been considered to be attributed to cortical spreading depression (CSD) and dysfunction of the trigeminovascular system is the key factor that has been considered in the pathogenesis of migraine pain. Moreover, three genes (CACNA1A, ATP1A2, and SCN1A) have come from studies performed in individuals with familial hemiplegic migraine (FHM), a monogenic form of migraine with aura. Therapies targeting on the neuropeptids and genes may be helpful in the precision medicine of migraineurs. 5-hydroxytryptamine (5-HT) receptor agonists and calcitonin gene-related peptide (CGRP) receptor antagonists have demonstrated efficacy in the acute specific treatment of migraine attacks.
    [Show full text]
  • Kidney V-Atpase-Rich Cell Proteome Database
    A comprehensive list of the proteins that are expressed in V-ATPase-rich cells harvested from the kidneys based on the isolation by enzymatic digestion and fluorescence-activated cell sorting (FACS) from transgenic B1-EGFP mice, which express EGFP under the control of the promoter of the V-ATPase-B1 subunit. In these mice, type A and B intercalated cells and connecting segment principal cells of the kidney express EGFP. The protein identification was performed by LC-MS/MS using an LTQ tandem mass spectrometer (Thermo Fisher Scientific). For questions or comments please contact Sylvie Breton ([email protected]) or Mark A. Knepper ([email protected]).
    [Show full text]
  • Clinical and Genetic Overview of Paroxysmal Movement Disorders and Episodic Ataxias
    International Journal of Molecular Sciences Review Clinical and Genetic Overview of Paroxysmal Movement Disorders and Episodic Ataxias Giacomo Garone 1,2 , Alessandro Capuano 2 , Lorena Travaglini 3,4 , Federica Graziola 2,5 , Fabrizia Stregapede 4,6, Ginevra Zanni 3,4, Federico Vigevano 7, Enrico Bertini 3,4 and Francesco Nicita 3,4,* 1 University Hospital Pediatric Department, IRCCS Bambino Gesù Children’s Hospital, University of Rome Tor Vergata, 00165 Rome, Italy; [email protected] 2 Movement Disorders Clinic, Neurology Unit, Department of Neuroscience and Neurorehabilitation, IRCCS Bambino Gesù Children’s Hospital, 00146 Rome, Italy; [email protected] (A.C.); [email protected] (F.G.) 3 Unit of Neuromuscular and Neurodegenerative Diseases, Department of Neuroscience and Neurorehabilitation, IRCCS Bambino Gesù Children’s Hospital, 00146 Rome, Italy; [email protected] (L.T.); [email protected] (G.Z.); [email protected] (E.B.) 4 Laboratory of Molecular Medicine, IRCCS Bambino Gesù Children’s Hospital, 00146 Rome, Italy; [email protected] 5 Department of Neuroscience, University of Rome Tor Vergata, 00133 Rome, Italy 6 Department of Sciences, University of Roma Tre, 00146 Rome, Italy 7 Neurology Unit, Department of Neuroscience and Neurorehabilitation, IRCCS Bambino Gesù Children’s Hospital, 00165 Rome, Italy; [email protected] * Correspondence: [email protected]; Tel.: +0039-06-68592105 Received: 30 April 2020; Accepted: 13 May 2020; Published: 20 May 2020 Abstract: Paroxysmal movement disorders (PMDs) are rare neurological diseases typically manifesting with intermittent attacks of abnormal involuntary movements. Two main categories of PMDs are recognized based on the phenomenology: Paroxysmal dyskinesias (PxDs) are characterized by transient episodes hyperkinetic movement disorders, while attacks of cerebellar dysfunction are the hallmark of episodic ataxias (EAs).
    [Show full text]
  • Clinical and Genetic Analysis in Alternating Hemiplegia of Childhood: Ten New Patients from Southern Europe
    Journal of the Neurological Sciences 344 (2014) 37–42 Contents lists available at ScienceDirect Journal of the Neurological Sciences journal homepage: www.elsevier.com/locate/jns Clinical and genetic analysis in alternating hemiplegia of childhood: Ten new patients from Southern Europe Marta Vila-Pueyo a, Roser Pons b, Miquel Raspall-Chaure a, Anna Marcé-Grau a, Oriel Carreño c,d,e, Cèlia Sintas c,d,e, Bru Cormand c,d,e, Mercè Pineda-Marfà f, Alfons Macaya a,⁎ a Grup de Recerca en Neurologia Pediàtrica, Institut de Recerca Vall d'Hebron, Universitat Autònoma de Barcelona, Barcelona, Spain b First Department of Pediatrics, Agia Sofia Hospital, University of Athens, Athens, Greece c Departament de Genètica, Facultat de Biologia, Universitat de Barcelona, Spain d Institut de Biomedicina de la Universitat de Barcelona (IBUB), Barcelona, Spain e Center for Biomedical Network Research on Rare Diseases (CIBERER), Barcelona, Spain f Pediatric Neurology Department, Teknon Clinic, Barcelona, Spain article info abstract Article history: Alternating hemiplegia of childhood (AHC) is a rare neurodevelopmental disorder featuring attacks of hemiplegia Received 26 March 2014 and other paroxysmal and non-paroxysmal manifestations leading to progressive neurological impairment. De Received in revised form 4 June 2014 novo mutations in ATP1A3 have been identified in up to 80% of patients. AHC is also associated with rare muta- Accepted 9 June 2014 tions in other genes involved in episodic neurological disorders. Available online 17 June 2014 We sought to find mutations in ATP1A3, CACNA1A, ATP1A2, SCN1A and SLC2A1 in a cohort of ten unrelated patients Keywords: from Spain and Greece. fi fi fi Alternating hemiplegia of childhood All patients ful lled AHC diagnostic criteria.
    [Show full text]
  • Clinical Profile of Patients with ATP1A3 Mutations in Alternating
    Panagiotakaki et al. Orphanet Journal of Rare Diseases (2015) 10:123 DOI 10.1186/s13023-015-0335-5 RESEARCH Open Access Clinical profile of patients with ATP1A3 mutations in Alternating Hemiplegia of Childhood—a study of 155 patients Eleni Panagiotakaki1*, Elisa De Grandis2, Michela Stagnaro2, Erin L. Heinzen3,4, Carmen Fons5, Sanjay Sisodiya6, Boukje de Vries7, Christophe Goubau8, Sarah Weckhuysen9, David Kemlink10, Ingrid Scheffer11,12, Gaëtan Lesca13,14, Muriel Rabilloud15, Amna Klich15, Alia Ramirez-Camacho1,5, Adriana Ulate-Campos5, Jaume Campistol5, Melania Giannotta16, Marie-Laure Moutard17, Diane Doummar17, Cecile Hubsch-Bonneaud18, Fatima Jaffer6, Helen Cross19, Fiorella Gurrieri20, Danilo Tiziano20, Sona Nevsimalova10, Sophie Nicole21,22, Brian Neville19, Arn M. J. M. van den Maagdenberg7,23, Mohamad Mikati24, David B. Goldstein3,4, Rosaria Vavassori25, Alexis Arzimanoglou1,26, The Italian IBAHC Consortium, The French AHC Consortium and The International AHC Consortium Abstract Background: Mutations in the gene ATP1A3 have recently been identified to be prevalent in patients with alternating hemiplegia of childhood (AHC2). Based on a large series of patients with AHC, we set out to identify the spectrum of different mutations within the ATP1A3 gene and further establish any correlation with phenotype. Methods: Clinical data from an international cohort of 155 AHC patients (84 females, 71 males; between 3 months and 52 years) were gathered using a specifically formulated questionnaire and analysed relative to the mutational ATP1A3 gene data for each patient. Results: In total, 34 different ATP1A3 mutations were detected in 85 % (132/155) patients, seven of which were novel. In general, mutations were found to cluster into five different regions.
    [Show full text]
  • Adipose Gene Expression Profiles Reveal Novel Insights Into the Adaptation of Northern Eurasian Semi-Domestic Reindeer
    bioRxiv preprint doi: https://doi.org/10.1101/2021.04.17.440269; this version posted April 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Adipose gene expression profiles reveal novel insights into the 2 adaptation of northern Eurasian semi-domestic reindeer 3 (Rangifer tarandus) 4 Short title: Reindeer adipose transcriptome 5 6 Melak Weldenegodguad1, 2, Kisun Pokharel1¶, Laura Niiranen3¶, Päivi Soppela4, 7 Innokentyi Ammosov5, Mervi Honkatukia6, Heli Lindeberg7, Jaana Peippo1, 6, Tiina 8 Reilas1, Nuccio Mazzullo4, Kari A. Mäkelä3, Tommi Nyman8, Arja Tervahauta2, 9 Karl-Heinz Herzig9, 10,11, Florian Stammler4, Juha Kantanen1* 10 11 1 Natural Resources Institute Finland (Luke), Jokioinen, Finland 12 2 Department of Environmental and Biological Sciences, University of Eastern 13 Finland, Kuopio, Finland 14 3 Research Unit of Biomedicine, Faculty of Medicine, University of Oulu, Oulu, 15 Finland 16 4 Arctic Centre, University of Lapland, Rovaniemi, Finland 17 5 Board of Agricultural Office of Eveno-Bytantaj Region, Batagay-Alyta, The Sakha 18 Republic (Yakutia), Russia 19 6 NordGen—Nordic Genetic Resource Center, Ås, Norway 20 7 Natural Resources Institute Finland (Luke), Maaninka, Finland 21 8 Department of Ecosystems in the Barents Region, Norwegian Institute of 22 Bioeconomy Research, Svanvik, Norway 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.17.440269; this version posted April 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]