Clinical and Genetic Overview of Paroxysmal Movement Disorders and Episodic Ataxias
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Detrusor Sphincter Dyssynergia: a Review of Physiology, Diagnosis, and Treatment Strategies
Review Article Detrusor sphincter dyssynergia: a review of physiology, diagnosis, and treatment strategies John T. Stoffel Department of Urology, University of Michigan, Ann Arbor, MI, USA Correspondence to: John T. Stoffel, MD. Department of Urology, University of Michigan, Ann Arbor, MI, USA. Email: [email protected]. Abstract: Detrusor sphincter dyssynergia (DSD) is the urodynamic description of bladder outlet obstruction from detrusor muscle contraction with concomitant involuntary urethral sphincter activation. DSD is associated with neurologic conditions such as spinal cord injury, multiple sclerosis, and spina bifida and some of these neurogenic bladder patients with DSD may be at risk for autonomic dysreflexia, recurrent urinary tract infections, or upper tract compromise if the condition is not followed and treated appropriately. It is diagnosed most commonly during the voiding phase of urodynamic studies using EMG recordings and voiding cystourethrograms, although urethral pressure monitoring could also potentially be used. DSD can be sub-classified as either continuous or intermittent, although adoption of this terminology is not widespread. There are few validated oral pharmacologic treatment options for this condition but transurethral botulinum toxin injection have shown temporary efficacy in reducing bladder outlet obstruction. Urinary sphincterotomy has also demonstrated reproducible long term benefits in several studies, but the morbidity associated with this procedure can be high. Keywords: Detrusor sphincter dyssynergia (DSD); neurogenic bladder; urodynamics; external urinary sphincter (EUS) Submitted Nov 30, 2015. Accepted for publication Jan 05, 2016. doi: 10.3978/j.issn.2223-4683.2016.01.08 View this article at: http://dx.doi.org/10.3978/j.issn.2223-4683.2016.01.08 Introduction Physiology The human bladder has two functions—to store and During storage of urine, afferent nerves carry information empty urine. -
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Physiology of Basal Ganglia Disorders: an Overview
LE JOURNAL CANADIEN DES SCIENCES NEUROLOGIQUES SILVERSIDES LECTURE Physiology of Basal Ganglia Disorders: An Overview Mark Hallett ABSTRACT: The pathophysiology of the movement disorders arising from basal ganglia disorders has been uncer tain, in part because of a lack of a good theory of how the basal ganglia contribute to normal voluntary movement. An hypothesis for basal ganglia function is proposed here based on recent advances in anatomy and physiology. Briefly, the model proposes that the purpose of the basal ganglia circuits is to select and inhibit specific motor synergies to carry out a desired action. The direct pathway is to select and the indirect pathway is to inhibit these synergies. The clinical and physiological features of Parkinson's disease, L-DOPA dyskinesias, Huntington's disease, dystonia and tic are reviewed. An explanation of these features is put forward based upon the model. RESUME: La physiologie des affections du noyau lenticulaire, du noyau caude, de I'avant-mur et du noyau amygdalien. La pathophysiologie des desordres du mouvement resultant d'affections du noyau lenticulaire, du noyau caude, de l'avant-mur et du noyau amygdalien est demeuree incertaine, en partie parce qu'il n'existe pas de bonne theorie expliquant le role de ces structures anatomiques dans le controle du mouvement volontaire normal. Nous proposons ici une hypothese sur leur fonction basee sur des progres recents en anatomie et en physiologie. En resume, le modele pro pose que leurs circuits ont pour fonction de selectionner et d'inhiber des synergies motrices specifiques pour ex£cuter Taction desiree. La voie directe est de selectionner et la voie indirecte est d'inhiber ces synergies. -
Acute Cerebellar Ataxia Associated with Intermittent ECG Pattern Similar to Wellens Syndrome and Transient Prominent QRS Anterior Forces
Acute cerebellar ataxia associated with intermittent ECG pattern similar to Wellens syndrome and transient prominent QRS anterior forces Andrés Ricardo Pérez-Riera, MD, PhD. Post-Graduates Advisor at Design of Studies and Scientific Writing Laboratory in the ABC Faculty of Medicine - ABC Foundation - Santo André – São Paulo – Brazil Raimundo Barbosa-Barros, MD. Specialist in Cardiology by the Brazilian Society of Cardiology (SBC) Specialist in Intensive Care by the Sociedade Brasileira de Terapia Intensiva Chief of the Coronary Center of the Hospital de Messejana Dr. Carlos Alberto Studart Gomes. Fortaleza - Brazil Adrian Baranchuk, MD FACC FRCPC Associate Professor of Medicine and Physiology - Cardiac Electrophysiology and Pacing - Director, EP Training Program - Kingston General Hospital - FAPC 3, 76 Stuart Street K7L 2V7, Kingston ON Queen's University - Canada Male patient, 56 years old, white, uncontrolled hypertension, was admitted to our emergency department (ED) with reports of sudden dizziness, headache of abrupt onset, nausea, vomiting and weakness in the lower limbs. Physical examination drew attention to the presence of manifestations suggestive of cerebellar syndrome: impaired coordination in the trunk or arms and legs, inability to coordinate balance, gait, extremity, uncontrolled or repetitive eye movements, (nystagmus), dyssynergia, dysmetria, dysdiadochokinesia, dysarthria (cerebellar ataxia). Normal myocardial necrosis markers and normal electrolytes ECO 1: anteroseptal-apical akinesis; LVEF = 30% ECO 2 (third day): -
Cramp Fasciculation Syndrome: a Peripheral Nerve Hyperexcitability Disorder Bhojo A
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by eCommons@AKU Pakistan Journal of Neurological Sciences (PJNS) Volume 9 | Issue 3 Article 7 7-2014 Cramp fasciculation syndrome: a peripheral nerve hyperexcitability disorder Bhojo A. Khealani Aga Khan University Hospital, Follow this and additional works at: http://ecommons.aku.edu/pjns Part of the Neurology Commons Recommended Citation Khealani, Bhojo A. (2014) "Cramp fasciculation syndrome: a peripheral nerve hyperexcitability disorder," Pakistan Journal of Neurological Sciences (PJNS): Vol. 9: Iss. 3, Article 7. Available at: http://ecommons.aku.edu/pjns/vol9/iss3/7 CASE REPORT CRAMP FASCICULATION SYNDROME: A PERIPHERAL NERVE HYPEREXCITABILITY DISORDER Bhojo A. Khealani Assistant professor, Neurology section, Aga khan University, Karachi Correspondence to: Bhojo A Khealani, Department of Medicine (Neurology), Aga Khan University, Karachi. Email: [email protected] Date of submission: June 28, 2014, Date of revision: August 5, 2014, Date of acceptance:September 1, 2014 ABSTRACT Cramp fasciculation syndrome is mildest among all the peripheral nerve hyperexcitability disorders, which typically presents with cramps, body ache and fasciculations. The diagnosis is based on clinical grounds supported by electrodi- agnostic study. We report a case of young male with two months’ history of body ache, rippling, movements over calves and other body parts, and occasional cramps. His metabolic workup was suggestive of impaired fasting glucose, radio- logic work up (chest X-ray and ultrasound abdomen) was normal, and electrodiagnostic study was significant for fascicu- lation and myokymic discharges. He was started on pregablin and analgesics. To the best of our knowledge this is report first of cramp fasciculation syndrome from Pakistan. -
Drug-Induced Movement Disorders
Expert Opinion on Drug Safety ISSN: 1474-0338 (Print) 1744-764X (Online) Journal homepage: https://www.tandfonline.com/loi/ieds20 Drug-induced movement disorders Dénes Zádori, Gábor Veres, Levente Szalárdy, Péter Klivényi & László Vécsei To cite this article: Dénes Zádori, Gábor Veres, Levente Szalárdy, Péter Klivényi & László Vécsei (2015) Drug-induced movement disorders, Expert Opinion on Drug Safety, 14:6, 877-890, DOI: 10.1517/14740338.2015.1032244 To link to this article: https://doi.org/10.1517/14740338.2015.1032244 Published online: 16 May 2015. Submit your article to this journal Article views: 544 View Crossmark data Citing articles: 4 View citing articles Full Terms & Conditions of access and use can be found at https://www.tandfonline.com/action/journalInformation?journalCode=ieds20 Review Drug-induced movement disorders Denes Za´dori, Ga´bor Veres, Levente Szala´rdy, Peter Klivenyi & † 1. Introduction La´szlo´ Vecsei † University of Szeged, Albert Szent-Gyorgyi€ Clinical Center, Department of Neurology, Faculty of 2. Methods Medicine, Szeged, Hungary 3. Drug-induced movement disorders Introduction: Drug-induced movement disorders (DIMDs) can be elicited by 4. Conclusions several kinds of pharmaceutical agents. The major groups of offending drugs include antidepressants, antipsychotics, antiepileptics, antimicrobials, antiar- 5. Expert opinion rhythmics, mood stabilisers and gastrointestinal drugs among others. Areas covered: This paper reviews literature covering each movement disor- der induced by commercially available pharmaceuticals. Considering the mag- nitude of the topic, only the most prominent examples of offending agents were reported in each paragraph paying a special attention to the brief description of the pathomechanism and therapeutic options if available. Expert opinion: As the treatment of some DIMDs is quite challenging, a pre- ventive approach is preferable. -
Dystonia and Chorea in Acquired Systemic Disorders
J Neurol Neurosurg Psychiatry: first published as 10.1136/jnnp.65.4.436 on 1 October 1998. Downloaded from 436 J Neurol Neurosurg Psychiatry 1998;65:436–445 NEUROLOGY AND MEDICINE Dystonia and chorea in acquired systemic disorders Jina L Janavs, Michael J AminoV Dystonia and chorea are uncommon abnormal Associated neurotransmitter abnormalities in- movements which can be seen in a wide array clude deficient striatal GABA-ergic function of disorders. One quarter of dystonias and and striatal cholinergic interneuron activity, essentially all choreas are symptomatic or and dopaminergic hyperactivity in the nigros- secondary, the underlying cause being an iden- triatal pathway. Dystonia has been correlated tifiable neurodegenerative disorder, hereditary with lesions of the contralateral putamen, metabolic defect, or acquired systemic medical external globus pallidus, posterior and poste- disorder. Dystonia and chorea associated with rior lateral thalamus, red nucleus, or subtha- neurodegenerative or heritable metabolic dis- lamic nucleus, or a combination of these struc- orders have been reviewed frequently.1 Here we tures. The result is decreased activity in the review the underlying pathogenesis of chorea pathways from the medial pallidus to the and dystonia in acquired general medical ventral anterior and ventrolateral thalamus, disorders (table 1), and discuss diagnostic and and from the substantia nigra reticulata to the therapeutic approaches. The most common brainstem, culminating in cortical disinhibi- aetiologies are hypoxia-ischaemia and tion. Altered sensory input from the periphery 2–4 may also produce cortical motor overactivity medications. Infections and autoimmune 8 and metabolic disorders are less frequent and dystonia in some cases. To date, the causes. Not uncommonly, a given systemic dis- changes found in striatal neurotransmitter order may induce more than one type of dyski- concentrations in dystonia include an increase nesia by more than one mechanism. -
Acute Flaccid Paralysis Syndrome Associated with West Nile Virus Infection --- Mississippi and Louisiana, July--August 2002
Acute Flaccid Paralysis Syndrome Associated with West Nile Virus Infection --- Mississippi and Louisiana, July--August 2002 Weekly September 20, 2002 / 51(37);825-828 Acute Flaccid Paralysis Syndrome Associated with West Nile Virus Infection --- Mississippi and Louisiana, July--August 2002 West Nile virus (WNV) infection can cause severe, potentially fatal neurologic illnesses including encephalitis and meningitis (1,2). Acute WNV infection also has been associated with acute flaccid paralysis (AFP) attributed to a peripheral demyelinating process (Guillain-Barré Syndrome [GBS]) (3), or to an anterior myelitis (4). However, the exact etiology of AFP has not been assessed thoroughly with electrophysiologic, laboratory, and neuroimaging data. This report describes six cases of WNV-associated AFP in which clinical and electrophysiologic findings suggest a pathologic process involving anterior horn cells and motor axons similar to that seen in acute poliomyelitis. Clinicians should evaluate patients with AFP for evidence of WNV infection and conduct tests to differentiate GBS from other causes of AFP. Case Reports Case 1. In July 2002, a previously healthy man aged 56 years from Mississippi was admitted to a local hospital with a 3-day history of fever, chills, vomiting, confusion, and acute painless weakness of the arms and legs. On physical examination, he had tremor and areflexic weakness in both arms and asymmetric weakness in the legs with hypoactive reflexes; sensation was intact. Laboratory abnormalities included a mildly elevated protein in the cerebrospinal fluid (CSF) (Table). An evolving stroke was diagnosed, and the patient was treated with anticoagulant therapy; subsequently, the illness was attributed to GBS, and intravenous immune globulin (IVIG) therapy was initiated. -
Tardive Dyskinesia
Tardive Dyskinesia Tardive Dyskinesia Checklist The checklist below can be used to help determine if you or someone you know may have signs associated with tardive dyskinesia and other movement disorders. Movement Description Observed? Rhythmic shaking of hands, jaw, head, or feet Yes Tremor A very rhythmic shaking at 3-6 beats per second usually indicates extrapyramidal symptoms or side effects (EPSE) of parkinsonism, even No if only visible in the tongue, jaw, hands, or legs. Sustained abnormal posture of neck or trunk Yes Dystonia Involuntary extension of the back or rotation of the neck over weeks or months is common in tardive dystonia. No Restless pacing, leg bouncing, or posture shifting Yes Akathisia Repetitive movements accompanied by a strong feeling of restlessness may indicate a medication side effect of akathisia. No Repeated stereotyped movements of the tongue, jaw, or lips Yes Examples include chewing movements, tongue darting, or lip pursing. TD is not rhythmic (i.e., not tremor). These mouth and tongue movements No are the most frequent signs of tardive dyskinesia. Tardive Writhing, twisting, dancing movements Yes Dyskinesia of fingers or toes Repetitive finger and toe movements are common in individuals with No tardive dyskinesia (and may appear to be similar to akathisia). Rocking, jerking, flexing, or thrusting of trunk or hips Yes Stereotyped movements of the trunk, hips, or pelvis may reflect tardive dyskinesia. No There are many kinds of abnormal movements in individuals receiving psychiatric medications and not all are because of drugs. If you answered “yes” to one or more of the items above, an evaluation by a psychiatrist or neurologist skilled in movement disorders may be warranted to determine the type of disorder and best treatment options. -
Cerebellar Ataxia
CEREBELLAR ATAXIA Dr. Waqar Saeed Ziauddin Medical University, Karachi, Pakistan What is Ataxia? ■ Derived from a Greek word, ‘A’ : not, ‘Taxis’ : orderly Ataxia is defined as an inability to maintain normal posture and smoothness of movement. Types of Ataxia ■ Cerebellar Ataxia ■ Sensory Ataxia ■ Vestibular Ataxia Cerebellar Ataxia Cerebrocerebellum Spinocerebellum Vestibulocerebellum Vermis Planning and Equilibrium balance Posture, limb and initiating and posture eye movements movements Limb position, touch and pressure sensation Limb ataxia, Eye movement dysdiadochokinesia, disorders, Truncal and gait Dysmetria dysarthria nystagmus, VOR, ataxia hypotonia postural and gait. Gait ataxia Types of Cerebellar Ataxia • Vascular Acute Ataxia • Medications and toxins • Infectious etiologies • Atypical Infectious agents • Autoimmune disorders • Primary or metastatic tumors Subacute Ataxia • Paraneoplastic cerebellar degeneration • Alcohol abuse and Vitamin deficiencies • Systemic disorders • Autosomal Dominant Chronic • Autosomal recessive Progressive • X linked ataxias • Mitochondrial • Sporadic neurodegenerative diseases Vascular Ataxia ▪ Benedikt Syndrome It is a rare form of posterior circulation stroke of the brain. A lesion within the tegmentum of the midbrain can produce Benedikt Syndrome. Disease is characterized by ipsilateral third nerve palsy with contralateral hemitremor. Superior cerebellar peduncle and/or red nucleus damage in Benedikt Syndrome can further lead in to contralateral cerebellar hemiataxia. ▪ Wallenberg Syndrome In -
Spinocerebellar Ataxia Type 29 Due to Mutations in ITPR1: a Case Series and Review of This Emerging Congenital Ataxia Jessica L
Zambonin et al. Orphanet Journal of Rare Diseases (2017) 12:121 DOI 10.1186/s13023-017-0672-7 RESEARCH Open Access Spinocerebellar ataxia type 29 due to mutations in ITPR1: a case series and review of this emerging congenital ataxia Jessica L. Zambonin1*, Allison Bellomo2, Hilla Ben-Pazi3, David B. Everman2, Lee M. Frazer2, Michael T. Geraghty4, Amy D. Harper5, Julie R. Jones2, Benjamin Kamien6, Kristin Kernohan1,4, Mary Kay Koenig7, Matthew Lines4, Elizabeth Emma Palmer8,9, Randal Richardson10, Reeval Segel11, Mark Tarnopolsky12, Jason R. Vanstone4, Melissa Gibbons13, Abigail Collins14, Brent L. Fogel15, Care4Rare Canada Consortium, Tracy Dudding-Byth16 and Kym M. Boycott1,4 Abstract Background: Spinocerebellar ataxia type 29 (SCA29) is an autosomal dominant, non-progressive cerebellar ataxia characterized by infantile-onset hypotonia, gross motor delay and cognitive impairment. Affected individuals exhibit cerebellar dysfunction and often have cerebellar atrophy on neuroimaging. Recently, missense mutations in ITPR1 were determined to be responsible. Results: Clinical information on 21 individuals from 15 unrelated families with ITPR1 mutations was retrospectively collected using standardized questionnaires, including 11 previously unreported singletons and 2 new patients from a previously reported family. We describe the genetic, clinical and neuroimaging features of these patients to further characterize the clinical features of this rare condition and assess for any genotype-phenotype correlation for this disorder. Our cohort consisted of 9 males and 12 females, with ages ranging from 28 months to 49 years. Disease course was non-progressive with infantile-onset hypotonia and delays in motor and speech development. Gait ataxia was present in all individuals and 10 (48%) were not ambulating independently between the ages of 3–12 years of age. -
Sodium Pumps Mediate Activity-Dependent Changes in Mammalian Motor Networks
906 • The Journal of Neuroscience, January 25, 2017 • 37(4):906–921 Systems/Circuits Sodium Pumps Mediate Activity-Dependent Changes in Mammalian Motor Networks X Laurence D. Picton, XFilipe Nascimento, XMatthew J. Broadhead, XKeith T. Sillar, and XGareth B. Miles School of Psychology and Neuroscience, University of St Andrews, St Andrews KY16 9JP, United Kingdom Ubiquitously expressed sodium pumps are best known for maintaining the ionic gradients and resting membrane potential required for generating action potentials. However, activity- and state-dependent changes in pump activity can also influence neuronal firing and regulate rhythmic network output. Here we demonstrate that changes in sodium pump activity regulate locomotor networks in the spinal cord of neonatal mice. The sodium pump inhibitor, ouabain, increased the frequency and decreased the amplitude of drug-induced locomotor bursting, effects that were dependent on the presence of the neuromodulator dopamine. Conversely, activating the pump with the sodium ionophore monensin decreased burst frequency. When more “natural” locomotor output was evoked using dorsal-root stimulation, ouabain increased burst frequency and extended locomotor episode duration, whereas monensin slowed and shortened episodes. Decreasing the time between dorsal-root stimulation, and therefore interepisode interval, also shortened and slowed activity, suggesting that pump activity encodes information about past network output and contributes to feedforward control of subsequent locomotor bouts. Using whole-cell patch-clamp recordings from spinal motoneurons and interneurons, we describe a long-duration (ϳ60 s), activity-dependent, TTX- and ouabain-sensitive, hyperpolarization (ϳ5 mV), which is mediated by spike-dependent increases in pump activity. The duration of this dynamic pump potential is enhanced by dopamine.