ANTICANCER RESEARCH 35: 2577-2592 (2015) High-dose Ionizing Radiation Regulates Gene Expression Changes in the MCF7 Breast Cancer Cell Line VALENTINA BRAVATÀ1*, LUIGI MINAFRA1*, GIORGIO RUSSO1, GIUSI IRMA FORTE1, FRANCESCO P. CAMMARATA1, MARILENA RIPAMONTI1, CARLO CASARINO1, GIUSEPPA AUGELLO2, FRANCESCA COSTANTINI2, GIOVANNA BARBIERI2, CRISTINA MESSA1,4,5 and MARIA C. GILARDI1,3,5 1Institute of Bioimaging and Molecular Physiology, National Research Council (IBFM-CNR) -LATO, Cefalù (PA), Italy; 2Institute of Biomedicine and Molecular Immunology “Alberto Monroy”- National Research Council (IBIM-CNR), Palermo, Italy; 3Nuclear Medicine, San Raffaele Scientific Institute, Milan, Italy; 4Nuclear Medicine Center, San Gerardo Hospital, Monza, Italy; 5Department of Health Sciences, Tecnomed Foundation, University of Milano-Bicocca, Milan, Italy Abstract. Background: Intraoperative electron radiation during IOERT boost and exclusive treatments, respectively) therapy (IOERT) is a therapeutic technique which administers by cDNA microarrays. Real-Time Quantitative Reverse a single high dose of ionizing radiation immediately after Transcription PCR (qRT-PCR), immunofluorescence and surgical tumor removal. IOERT induces a strong stress immunoblot experiments were performed to validate response: both tumor and normal cells activating pro- and candidate IOERT biomarkers. We also conducted clonogenic antiproliferative cell signaling pathways. Following treatment, tests and cellular senescence assays to monitor for radiation- several genes and factors are differently modulated, induced effects. Results: The analyses highlighted a producing an imbalance in cell fate decision. However, the transcriptome dependent on the dose delivered and a number contribution of these genes and pathways in conferring of specific key genes that may be proposed as new markers of different cell radiosensitivity and radioresistance needs to be radiosensitivity. Cell and molecular traits observed in MCF7 further investigated, in particular after high-dose treatments. cells revealed a typical senescent phenotype associated with Despite the documented and great impact of IOERT in breast cell proliferation arrest after treatments with 9- and 23-Gy cancer care, and the trend for dose escalation, very limited doses. Conclusion: In this study, we report genes and cellular data are available regarding gene-expression profiles and cell networks activated following high-dose IOERT. The selected networks activated by IOERT or high-dose treatment. The aim validated genes were used to design two descriptive models of the study was to analyze the main pathways activated for each dose delivered. We believe that this study could following high radiation doses in order to select for potential contribute to the understanding over the complex mechanisms new biomarkers of radiosensitivity or radioresistance, as well which regulate cell radiosensitivity and radioresistance in as to identify therapeutic targets useful in cancer care. order to improve personalized radiotherapeutic treatment. Materials and Methods: We performed gene-expression profiling of the MCF7 human breast carcinoma cell line after Intraoperative radiation therapy is a therapeutic technique which treatment with 9- and 23-Gy doses (conventionally used consists of administering a single high dose of ionizing radiation (IR) immediately after surgical removal of tumor to destroy the residual cancer cells that may be left in the tumor site. Indeed, this typically represents a site at high risk for recurrence. The This article is freely accessible online. rationale for the use of this segmental radiation therapy in place of whole-breast irradiation is based on the finding that *These Authors contributed equally to this study. approximately 85% of local relapses are confined to the same quadrant of the breast from which the primary tumor was Correspondence to: Luigi Minafra, e-mail: [email protected]; excised (1-4). Interest in intraoperative radiation therapy for Valentina Bravatà, e-mail: [email protected] breast cancer (BC) has increased in the last few years thanks to Key Words: Intraoperative electron radiation therapy, IOERT, the development of the partial breast irradiation strategy with ionizing radiation, IR, MCF7 breast cancer cells, microarray. the aim of avoiding tumor recurrence. Intraoperative electron 0250-7005/2015 $2.00+.40 2577 ANTICANCER RESEARCH 35: 2577-2592 (2015) Table I. Primer sequences used for Real-Time Quantitative Reverse Transcription PCR analyses of MCF7 cells treated with 9 Gy and 23 Gy. Gene symbol Full name Forward primer 5'>3' Reverse primer 5'>3' Template size (base pairs) ADAMTS9 ADAM metallopeptidase with thrombospondin tcgctccactgttcactgtc ctgttgagggctctctctgg 297 type 1 motif, 9 ADRB1 Adrenoceptor beta 1 ctccttcttctgcgagctgt agcacttggggtcgttgtag 266 ADRB2 Adrenoceptor beta 2 ctgctatgccaatgagacctg gtcttgagggctttgtgctc 272 C2CD2 C2 calcium-dependent domain containing 2 ggccgttaatatccagcccaa aagacgtggatgttcctcacc 252 CACNB2 Calcium channel, voltage-dependent, beta 2 subunit tcctatggttcggcagactc ttaccaatcgccctatccacc 286 Cav1 Caveolin 1, caveolae protein, 22kDa tctctacaccgttcccatcc tccaaatgccgtcaaaactgtg 219 CDC25C Cell division cycle 25C tctggccaaggaaagctcag cgacagtaaggcagccact 207 CDC42 Cell division cycle 42 cttctttgctgctgcttcctg ctgagcatcaggcaactcaag 224 CDKN1A/p21 Cyclin-dependent kinase inhibitor 1 cggcttcatgccagctactt tcaccctgcccaaccttaga 245 FAM49B Family with sequence similarity 49, member B gggacttcccaggagaaaag cagaagggtctgatggaagc 243 FAS FAS cell surface death receptor tcagtacggagttggggaag caggccttccaagttctgag 207 Fos FBJ murine osteosarcoma viral oncogene homolog caacttcattcccacggtcac tcccttcggattctccttttct 259 FosB FBJ murine osteosarcoma viral oncogene homolog B aacccaccctcatctcttcc acccttcgcttctcctcttc 265 H2AFX H2A histone family, member X cgggcgtctgttctagtgttt agtgattcgcgtcttcttgttg 293 HIST1H4E Histone cluster 1, H4e acatccagggcattaccaagc agagtgcgtccctgtctctt 216 HIST2H2AB Histone cluster 2, H2ab gagtacctgaccgcggaaatt aaagagcctttggggtgaatga 268 HIST2H2AC Histone cluster 2, H2ac tgtctggtcgtggcaaacaag ctgttcagttcctcgtcgttg 286 HISTH1B Histone cluster 1, H1b gcattaagctgggcctcaaga gctcttcgccacctttttgac 273 HISTH4B Histone cluster 1, H4b gataacatccaaggcatcacca gaggccattggaagaaaactga 266 ITPR1 Inositol 1,4,5-trisphosphate receptor, type 1 gatcctggaggcagtaacca ggacatcctctcccgaattga 226 JUN JUN proto-oncogene ccacgcaagagaagaaggac gaaaagtcgcggtcactcact 280 JUNB JUN B proto-oncogene cggcagctacttttctggtc cacgtggttcatcttgtgcag 261 LEF-1 Lymphoid enhancer-binding factor 1 agcagactggtttgcagtgaat gatgacagttttgggcaaaggc 211 LMNB1 Lamin B1 ccttcttcccgtgtgacagt cctcccattggttgatcctg 224 MMP9 Matrix metallopeptidase 9 gagaccggtgagctggata tacacgcgagtgaaggtgag 236 MOAP1 Modulator of apoptosis 1 cgcctgtggtctggcatattt cctcctgaacatccttccaag 222 NFKB Nuclear factor of kappa light polypeptide gene cagctggatgtgtgactgga gtgggggaaaaatctccaaa 136 enhancer in B-cells inhibitor, alpha NR3C1 Nuclear receptor subfamily 3, group C, member 1 actggctgtcgcttctcaatc tgctgaactcttggggttctc 289 (glucocorticoid receptor) NR4A3 Nuclear receptor subfamily 4, group A, member 3 tccgctcctcctacactctc tccatggtcagcttggtgtag 200 PLK1 Polo-like kinase 1 tgccacctcagtgacatgct cagtgccgtcacgctctatg 265 SNAI1 SNAIL family zinc finger 1 gcgagctgcaggactctaat ggacagagtcccagatgagc 135 TGFB2 Transforming growth factor, beta 2 gaccccacatctcctgctaa taagctcaggaccctgctgt 268 TNF Tumor necrosis factor ctatctgggaggggtcttc ggttgagggtgtctgaagga 201 radiation therapy (IOERT), using an electron linear accelerator, radioresistance on cancer cells in order to improve RT effects. according to specific eligibility criteria may be: exclusive with Both X-rays, mainly used in conventional external beam RT, the provision of a single radiation dose of 21-23 Gy and high-energy electrons generated by linear accelerators corresponding to the administration of the entire sequence of a induce a strong cellular stress response, which leads to an conventional adjuvant radiotherapy (RT), or an anticipated boost imbalance in survival versus cell death decisions (7, 8). of 9-12 Gy, followed by conventional external RT to guarantee Increasing evidence is revealing that induction of cell death is a for optimal accuracy in dose delivery (5, 6). very complex mechanism accounting for the different Although preliminary results of partial breast irradiation with therapeutic effects of IR (9, 10). Indeed, cell fate in response to IOERT, either as an anticipated boost or as exclusive treatment, IR is controlled by multiple signals that determine whether pro- seem be promising in terms of local disease control, little or antiproliferative factors that normally function in equilibrium information has been collected about the biological basis of the will ultimately predominate in response to the stress. Different effects of IOERT, in particular those regarding molecular stress IR-induced genes activate complex linked intracellular networks mechanisms (3, 4). To date, several radiobiology research regulating several processes, such as cell-cycle progression, cell groups have focused their studies on understanding the survival and death, DNA repair and inflammation (11-13). molecular mechanisms that confer radiosensitivity or However, the contribution of these genes and the signaling 2578 Bravatà et al: Gene Expression Response of MCF7 Cells Following IOERT Treatment Table II. PubMatrix analysis of selected validated genes. This table shows the number