At the Fulcrum in Health and Disease: Cdk5 and the Balancing Acts of Neuronal Structure and Physiology Kristina A
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
The TRAX, DISC1, and GSK3 Complex in Mental Disorders and Therapeutic Interventions Yu-Ting Weng1,2, Ting Chien1, I-I Kuan1 and Yijuang Chern1,2*
Weng et al. Journal of Biomedical Science (2018) 25:71 https://doi.org/10.1186/s12929-018-0473-x REVIEW Open Access The TRAX, DISC1, and GSK3 complex in mental disorders and therapeutic interventions Yu-Ting Weng1,2, Ting Chien1, I-I Kuan1 and Yijuang Chern1,2* Abstract Psychiatric disorders (such as bipolar disorder, depression, and schizophrenia) affect the lives of millions of individuals worldwide. Despite the tremendous efforts devoted to various types of psychiatric studies and rapidly accumulating genetic information, the molecular mechanisms underlying psychiatric disorder development remain elusive. Among the genes that have been implicated in schizophrenia and other mental disorders, disrupted in schizophrenia 1 (DISC1) and glycogen synthase kinase 3 (GSK3) have been intensively investigated. DISC1 binds directly to GSK3 and modulates many cellular functions by negatively inhibiting GSK3 activity. The human DISC1 gene is located on chromosome 1 and is highly associated with schizophrenia and other mental disorders. A recent study demonstrated that a neighboring gene of DISC1, translin-associated factor X (TRAX), binds to the DISC1/GSK3β complex and at least partly mediates the actions of the DISC1/GSK3β complex. Previous studies also demonstrate that TRAX and most of its interacting proteins that have been identified so far are risk genes and/or markers of mental disorders. In the present review, we will focus on the emerging roles of TRAX and its interacting proteins (including DISC1 and GSK3β) in psychiatric disorders and the potential implications for developing therapeutic interventions. Keywords: TRAX, DISC1, GSK3β, Mental disorders, DNA damage, DNA repair, Oxidative stress, A2AR, PKA Background DNA repair) by interacting with various proteins [4–12]. -
A Genome-Wide Library of MADM Mice for Single-Cell Genetic Mosaic Analysis
bioRxiv preprint doi: https://doi.org/10.1101/2020.06.05.136192; this version posted June 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Contreras et al., A Genome-wide Library of MADM Mice for Single-Cell Genetic Mosaic Analysis Ximena Contreras1, Amarbayasgalan Davaatseren1, Nicole Amberg1, Andi H. Hansen1, Johanna Sonntag1, Lill Andersen2, Tina Bernthaler2, Anna Heger1, Randy Johnson3, Lindsay A. Schwarz4,5, Liqun Luo4, Thomas Rülicke2 & Simon Hippenmeyer1,6,# 1 Institute of Science and Technology Austria, Am Campus 1, 3400 Klosterneuburg, Austria 2 Institute of Laboratory Animal Science, University of Veterinary Medicine Vienna, Vienna, Austria 3 Department of Biochemistry and Molecular Biology, University of Texas, Houston, TX 77030, USA 4 HHMI and Department of Biology, Stanford University, Stanford, CA 94305, USA 5 Present address: St. Jude Children’s Research Hospital, Memphis, TN 38105, USA 6 Lead contact #Correspondence and requests for materials should be addressed to S.H. ([email protected]) 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.06.05.136192; this version posted June 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Contreras et al., SUMMARY Mosaic Analysis with Double Markers (MADM) offers a unique approach to visualize and concomitantly manipulate genetically-defined cells in mice with single-cell resolution. -
Cyclin-Dependent Kinases and Their Role in Inflammation, Endothelial Cell Migration
Cyclin-Dependent Kinases and their role in Inflammation, Endothelial Cell Migration and Autocrine Activity Dissertation Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Shruthi Ratnakar Shetty Graduate Program in Pharmaceutical Sciences The Ohio State University 2020 Dissertation Committee Dale Hoyt, Advisor Liva Rakotondraibe Moray Campbell Keli Hu Copyrighted by Shruthi Ratnakar Shetty 2020 Abstract Inflammation is the body’s response to infection or injury. Endothelial cells are among the different players involved in an inflammatory cascade. In response to an inflammatory stimuli such as bacterial lipopolysaccharide (LPS), endothelial cells get activated which is characterized by the production of important mediators, such as inducible nitric oxide synthase (iNOS) which, catalyzes the production of nitric oxide (NO) and reactive nitrogen species and cyclooxygenase-2 (COX-2) that catalyzes the production of prostaglandins. Though the production of these mediators is required for an inflammatory response, it is important that their levels are regulated. Continued production of iNOS results in increased accumulation of reactive nitrogen species (RNS) that might lead to cytotoxicity, whereas lack of/suppression results in endothelial and vascular dysfunction. On the other hand, severe cardiovascular, intestinal and renal side effects are observed with significant suppression of COX-2. Thus, studying factors that could regulate the levels of iNOS and COX-2 could provide useful insights for developing novel therapeutic targets. Regulation of protein levels involves control of protein induction or turnover. Since protein induction requires transcription, in this dissertation we studied the role of a promoter of transcription “Cyclin- dependent kinase 7 (CDK7)” in iNOS and COX-2 protein induction. -
New Insights in RBM20 Cardiomyopathy
Current Heart Failure Reports (2020) 17:234–246 https://doi.org/10.1007/s11897-020-00475-x TRANSLATIONAL RESEARCH IN HEART FAILURE (J BACKS & M VAN DEN HOOGENHOF, SECTION EDITORS) New Insights in RBM20 Cardiomyopathy D. Lennermann1,2 & J. Backs1,2 & M. M. G. van den Hoogenhof1,2 Published online: 13 August 2020 # The Author(s) 2020 Abstract Purpose of Review This review aims to give an update on recent findings related to the cardiac splicing factor RNA-binding motif protein 20 (RBM20) and RBM20 cardiomyopathy, a form of dilated cardiomyopathy caused by mutations in RBM20. Recent Findings While most research on RBM20 splicing targets has focused on titin (TTN), multiple studies over the last years have shown that other splicing targets of RBM20 including Ca2+/calmodulin-dependent kinase IIδ (CAMK2D) might be critically involved in the development of RBM20 cardiomyopathy. In this regard, loss of RBM20 causes an abnormal intracellular calcium handling, which may relate to the arrhythmogenic presentation of RBM20 cardiomyopathy. In addition, RBM20 presents clinically in a highly gender-specific manner, with male patients suffering from an earlier disease onset and a more severe disease progression. Summary Further research on RBM20, and treatment of RBM20 cardiomyopathy, will need to consider both the multitude and relative contribution of the different splicing targets and related pathways, as well as gender differences. Keywords RBM20 . Dilated cardiomyopathy . CaMKIIδ . Calcium handling . Gender differences . Titin Introduction (ARVC), where a small number of genes account for most of the genetic causes, DCM-causing mutations have been ob- Dilated cardiomyopathy (DCM), as defined by left ventricular served in a variety of genes of diverse ontology [2]. -
TITLE PAGE Oxidative Stress and Response to Thymidylate Synthase
Downloaded from molpharm.aspetjournals.org at ASPET Journals on October 2, 2021 -Targeted -Targeted 1 , University of of , University SC K.W.B., South Columbia, (U.O., Carolina, This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. -
Genetic Mosaic Dissection of Lis1 and Ndel1 in Neuronal Migration
Neuron Article Genetic Mosaic Dissection of Lis1 and Ndel1 in Neuronal Migration Simon Hippenmeyer,1,* Yong Ha Youn,2 Hyang Mi Moon,2,3 Kazunari Miyamichi,1 Hui Zong,1,5 Anthony Wynshaw-Boris,2,4 and Liqun Luo1,* 1Howard Hughes Medical Institute and Department of Biology, Stanford University, Stanford, CA 94305, USA 2Department of Pediatrics and Institute for Human Genetics 3Biomedical Sciences Graduate Program 4Eli and Edythe Broad Center of Regeneration Medicine and Stem Cell Research University of California, San Francisco School of Medicine, San Francisco, CA 94143, USA 5Institute of Molecular Biology, University of Oregon, Eugene, OR 97403, USA *Correspondence: [email protected] (S.H.), [email protected] (L.L.) DOI 10.1016/j.neuron.2010.09.027 SUMMARY studied. Cortical layering occurs in an ‘‘inside-out’’ fashion whereby earlier born neurons occupy deep layers and succes- Coordinated migration of newly born neurons to their sively later born neurons settle in progressively upper layers (An- prospective target laminae is a prerequisite for neural gevine and Sidman, 1961; Rakic, 1974). Upon radial glia progen- circuit assembly in the developing brain. The evolu- itor cell (RGPC)-mediated neurogenesis, newborn migrating tionarily conserved LIS1/NDEL1 complex is essential cortical projection neurons are bipolar-shaped in the ventricular for neuronal migration in the mammalian cerebral zone (VZ) but then convert to a multipolar morphology within the cortex. The cytoplasmic nature of LIS1 and NDEL1 subventricular zone (SVZ) and migrate into the intermediate zone (IZ). A switch from the multipolar state back to a bipolar proteins suggest that they regulate neuronal migra- morphology precedes radial glia-guided locomotion of projec- tion cell autonomously. -
Activation of Aurora-A Is Essential for Neuronal Migration Via Modulation of Microtubule Organization
11050 • The Journal of Neuroscience, August 8, 2012 • 32(32):11050–11066 Cellular/Molecular Activation of Aurora-A Is Essential for Neuronal Migration via Modulation of Microtubule Organization Takako Takitoh,1 Kanako Kumamoto,1 Chen-Chi Wang,2,4 Makoto Sato,2,3,4 Shiori Toba,1 Anthony Wynshaw-Boris,5 and Shinji Hirotsune1 1Department of Genetic Disease Research, Osaka City University Graduate School of Medicine, Osaka 545-8585, Japan, 2Division of Cell Biology and Neuroscience, Department of Morphological and Physiological Sciences, Faculty of Medical Sciences, University of Fukui, 3Child Development Research Center, Graduate School of Medical Sciences, University of Fukui, 4Research and Education Program for Life Science, University of Fukui, Fukui 910-1193, Japan, and 5Department of Pediatrics and Institute for Human Genetics, University of California, San Francisco, School of Medicine, San Francisco, California 94143 Neuronal migration is a critical feature to ensure proper location and wiring of neurons during cortical development. Postmitotic neurons migrate from the ventricular zone into the cortical plate to establish neuronal lamina in an “inside-out” gradient of maturation. Here, we report that the mitotic kinase Aurora-A is critical for the regulation of microtubule organization during neuronal migration via an Aurora-A–NDEL1 pathway in the mouse. Suppression of Aurora-A activity by inhibitors or siRNA resulted in severe impairment of neuronal migration of granular neurons. In addition, in utero injection of the Aurora-A kinase-dead mutant provoked defective migra- tion of cortical neurons. Furthermore, we demonstrated that suppression of Aurora-A impaired microtubule modulation in migrating neurons. Interestingly, suppression of CDK5 by an inhibitor or siRNA reduced Aurora-A activity and NDEL1 phosphorylation by Aurora-A, which led to defective neuronal migration. -
Forschungsbericht Science Report
FORSCHUNGSBERICHT SCIENCE REPORT2017/2018 ST. ANNA KINDERKREBSFORSCHUNG ST. ANNA CHILDREN’S CANCER RESEARCH INSTITUTE TUMOR BIOLOGY Understanding tumor heterogeneity and relapse in neuroblastoma patients to allow adequate treatment options. MOLECULAR MICROBIOLOGY LCH BIOLOGY Clinically important Targeted resistant mutations in Philadelphia inhibition chromosome-positive leukemias. of the MAPK pathway leads to a STUDIES & STATISTICS rapid and sustained clinical response in severe multisystem LCH. Busulfan and melphalan is considered standard high-dose chemotherapy for high-risk neuroblastoma. GENETICS OF LEUKEMIAS A novel genetic MOLECULAR BIOLOGY OF SOLID TUMORS subtype of leukemia. Understanding mechanisms EPIGENOME-BASED PRECISION MEDICINE of tumor cell plasticity EPIGENETIC and its role in diversity in Ewing sarcoma metastasis. Ewing sarcoma. MORE SCIENCE REPORTS INSIDE >>> [ 06 ] Forschungsbericht St. Anna Kinderkrebsforschung | Science Report St. Anna Children’s Cancer Research Institute Inhalt Einleitung Vorwort des Institutsleiters 10 Vorwort des wissenschaftlichen Direktors 12 30 Jahre – unseren Spendern sei Dank! 14 Daten & Fakten Kompetitive Drittmittel 2018 20 Zuweisung der Geldmittel 2018 20 Finanzierung 2018 20 Nationen 21 Personelle Zusammensetzung 21 PatientInnenaufkommen im S2IRP 22 2-Jahres-Überlebensrate krebskranker Kinder 23 5-Jahres-Überlebensrate krebskranker Kinder 24 Forschungsnetzwerke 26 Inhalt Forschungsbericht I St. Anna Kinderkrebsforschung | Science Report St. Anna Cancer Research Institute [ 07 ] Science -
A Critical Role for Kalirin in NGF Signaling Through Trka
MOLECULAR AND CELLULAR BIOLOGY, June 2005, p. 5106–5118 Vol. 25, No. 12 0270-7306/05/$08.00ϩ0 doi:10.1128/MCB.25.12.5106–5118.2005 Copyright © 2005, American Society for Microbiology. All Rights Reserved. Critical Role for Kalirin in Nerve Growth Factor Signaling through TrkA Kausik Chakrabarti,1 Rong Lin,1 Noraisha I. Schiller,1 Yanping Wang,1 David Koubi,2 Ying-Xin Fan,3 Brian B. Rudkin,2 Gibbes R. Johnson,3 and Martin R. Schiller1* University of Connecticut Health Center, Department of Neuroscience, 263 Farmington Ave., Farmington, Connecticut 06030-43011; Laboratoire de Biologie Moleculaire de la Cellule, UMR 5161 CNRS, INRA U1237, Ecole Normale Supe´rieure de Lyon, IFR 128 “BioSciences Lyon-Gerland,” 69364 Lyon cedex 07, France2; and Division of Therapeutic Proteins, Center for Drug Evaluation and Research, Food and Drug Administration, Bethesda, Maryland 208923 Received 30 June 2004/Returned for modification 16 September 2004/Accepted 10 March 2005 Kalirin is a multidomain guanine nucleotide exchange factor (GEF) that activates Rho proteins, inducing cytoskeletal rearrangement in neurons. Although much is known about the effects of Kalirin on Rho GTPases and neuronal morphology, little is known about the association of Kalirin with the receptor/signaling systems that affect neuronal morphology. Our experiments demonstrate that Kalirin binds to and colocalizes with the TrkA neurotrophin receptor in neurons. In PC12 cells, inhibition of Kalirin expression using antisense RNA decreased nerve growth factor (NGF)-induced TrkA autophosphorylation and process extension. Kalirin overexpression potentiated neurotrophin-stimulated TrkA autophosphorylation and neurite outgrowth in PC12 cells at a low concentration of NGF. -
Lis1 and Ndel1 Influence the Timing of Nuclear Envelope Breakdown in Neural Stem Cells
University of South Carolina Scholar Commons Faculty Publications Biological Sciences, Department of 9-22-2008 Lis1 and Ndel1 Influence the Timing of Nuclear Envelope Breakdown in Neural Stem Cells Sachin Hebbar University of South Carolina - Columbia Mariano T. Mesngon University of South Carolina - Columbia Aimee M. Guillotte University of South Carolina - Columbia Bhavim Desai University of South Carolina - Columbia, [email protected] Ramses Ayala Mass General Institute for Neurodegenerative Disease See next page for additional authors Follow this and additional works at: https://scholarcommons.sc.edu/biol_facpub Part of the Biology Commons Publication Info The Journal of Cell Biology, Volume 182, Issue 6, 2008, pages 1063-1071. © 2008, the authors. Originally published in the Journal of Cell Biology by the Rockefeller University Press. This Article is brought to you by the Biological Sciences, Department of at Scholar Commons. It has been accepted for inclusion in Faculty Publications by an authorized administrator of Scholar Commons. For more information, please contact [email protected]. Author(s) Sachin Hebbar, Mariano T. Mesngon, Aimee M. Guillotte, Bhavim Desai, Ramses Ayala, and Deanna S. Smith This article is available at Scholar Commons: https://scholarcommons.sc.edu/biol_facpub/58 Published September 22, 2008 JCB: REPORT Lis1 and Ndel1 infl uence the timing of nuclear envelope breakdown in neural stem cells Sachin Hebbar , 1 Mariano T. Mesngon , 1 Aimee M. Guillotte , 1 Bhavim Desai , 1 Ramses Ayala , 2 and Deanna S. Smith 1 1 Department of Biological Sciences, University of South Carolina, Columbia, SC 29208 2 Neurology Department, Mass General Institute for Neurodegenerative Disease, Charlestown, MA 02120 is1 and Ndel1 are essential for animal development. -
Current Treatment of Juvenile Myelomonocytic Leukemia
Journal of Clinical Medicine Review Current Treatment of Juvenile Myelomonocytic Leukemia Christina Mayerhofer 1 , Charlotte M. Niemeyer 1,2 and Christian Flotho 1,2,* 1 Division of Pediatric Hematology and Oncology, Department of Pediatrics and Adolescent Medicine, Medical Center, Faculty of Medicine, University of Freiburg, 79106 Freiburg, Germany; [email protected] (C.M.); [email protected] (C.M.N.) 2 German Cancer Consortium (DKTK), 79106 Freiburg, Germany * Correspondence: christian.fl[email protected] Abstract: Juvenile myelomonocytic leukemia (JMML) is a rare pediatric leukemia characterized by mutations in five canonical RAS pathway genes. The diagnosis is made by typical clinical and hematological findings associated with a compatible mutation. Although this is sufficient for clinical decision-making in most JMML cases, more in-depth analysis can include DNA methylation class and panel sequencing analysis for secondary mutations. NRAS-initiated JMML is heterogeneous and adequate management ranges from watchful waiting to allogeneic hematopoietic stem cell transplan- tation (HSCT). Upfront azacitidine in KRAS patients can achieve long-term remissions without HSCT; if HSCT is required, a less toxic preparative regimen is recommended. Germline CBL patients often experience spontaneous resolution of the leukemia or exhibit stable mixed chimerism after HSCT. JMML driven by PTPN11 or NF1 is often rapidly progressive, requires swift HSCT and may benefit from pretransplant therapy with azacitidine. Because graft-versus-leukemia alloimmunity is central to cure high risk patients, the immunosuppressive regimen should be discontinued early after HSCT. Keywords: juvenile myelomonocytic leukemia; RAS signaling; hematopoietic stem cell transplantation; 5-azacitidine; myelodysplastic/myeloproliferative disorders; targeted therapy Citation: Mayerhofer, C.; Niemeyer, C.M.; Flotho, C.