DOCSLIB.ORG

Obscurin, a Giant Sarcomeric Rho Guanine Nucleotide Exchange Factor Protein Involved in Sarcomere Assembly

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Obscurin, a Giant Sarcomeric Rho Guanine Nucleotide Exchange Factor Protein Involved in Sarcomere Assembly Published July 9, 2001 JCBArticle Obscurin, a giant sarcomeric Rho guanine nucleotide exchange factor protein involved in sarcomere assembly Paul Young,1 Elisabeth Ehler,2 and Mathias Gautel3 1European Molecular Biology Laboratory, Structural Biology Division, 69117 Heidelberg, Germany 2Institute of Cell Biology, Hönggerberg, CH-8093 Zürich, Switzerland 3Department of Physical Biochemistry, Max-Planck Institute for Molecular Physiology, 44202 Dortmund, Germany ertebrate-striated muscle is assumed to owe its re- scurin shows a modular architecture of tandem Ig domains markable order to the molecular ruler functions of reminiscent of the elastic region of titin. The COOH-terminal V the giant modular signaling proteins, titin and nebu- region of obscurin interacts via two specific Ig-like domains lin. It was believed that these two proteins represented with the NH2-terminal Z-disk region of titin. Both proteins unique results of protein evolution in vertebrate muscle. In coassemble during myofibrillogenesis. During the progres- this paper we report the identification of a third giant protein sion of myofibrillogenesis, all obscurin epitopes become de- from vertebrate muscle, obscurin, encoded on chromosome tectable at the M band. The presence of a calmodulin-binding Downloaded from -kD and is expressed specifically in IQ motif, and a Rho guanine nucleotide exchange factor do 800ف 1q42. Obscurin is skeletal and cardiac muscle. The complete cDNA sequence main in the COOH-terminal region suggest that obscurin is of obscurin reveals a modular architecture, consisting of involved in Ca2ϩ/calmodulin, as well as G protein–coupled Ͼ67 intracellular immunoglobulin (Ig)- or fibronectin-3–like signal transduction in the sarcomere. domains with multiple splice variants. A large region of ob- on May 24, 2017 Introduction Sarcomeres, the smallest contractile units of striated muscles, The process of myofibril assembly requires both spatial are assembled from thousands of protein subunits into the and temporal coordination of protein interactions with high largest and most regular macromolecular complex known. precision (Gautel et al., 1999). To achieve this long-range Sarcomeres are assembled during the embryonic differentia- coordination, two giant modular proteins, acting as molec- tion of heart and skeletal muscle, but also on a continuous ular scaffolds or blueprints, are found in vertebrate mus- basis during the physiological turnover of muscle. New sar- cle. Titin (Wang et al., 1979), also known as connectin, comeres are also formed at a high rate in hypertrophying (Maruyama, 1976) and nebulin provide specific attachment muscle: either as a result of exercise, increased pressure and sites for other proteins and thus specify their sarcomeric po- volume load of the heart, or pathological or hormonal stim- sitions (Trinick, 1996; Trinick and Tskhovrebova, 1999). ulation. The mechanisms which cooperate to regulate mus- Recently, it was shown that the deletion of titin leads to a to- cle-specific gene transcription are only beginning to emerge tal loss of myofibril assembly despite the persisting ex- (Chien, 2000). It remains largely unclear how signaling at pression of other sarcomeric proteins (Van der Ven et al., the molecular level within the sarcomere and the control of 2000). Apart from binding sites for other sarcomeric pro- assembly are coordinated. Therefore, identifying and charac- teins, these giant proteins contain potential signaling domains: terizing key elements of sarcomeric signal transduction and a COOH-terminal Src homology 3 (SH3)* domain in neb- their roles in the control of myofibrillogenesis are essential to ulin (Labeit and Kolmerer, 1995a), and multiple phosphor- elucidate basic mechanisms of the cell biology of muscle, ylation sites and a COOH-terminal catalytic protein kinase leading to a molecular understanding of associated diseases. domain in titin implicated in myofibril assembly (Mayans et al., 1998). These domains suggest that the molecular scaf- Address correspondence to Dr. Mathias Gautel, Max-Planck Institute for fold proteins of the myofibril receive and propagate signals Molecular Physiology, Department of Physical Biochemistry, Postfach from various pathways. 500 247, 44202 Dortmund, Germany. Tel.: (49) 231-133-2354. Fax: (49) 231-133-2399. E-mail: [email protected] *Abbreviations used in this paper: DH, dbl homology; E, embryo day Paul Young’s present address is Department of Neurobiology, Duke Uni- (gestation days); Fn, fibronectin; GEF, guanine nucleotide exchange fac- versity Medical Center, Durham, NC 27710. tor; PH, pleckstrin homology; PI3, phosphatidyl inositol 3; PiP, phos- Key words: obscurin; Rho GTPases; GEF proteins; myofibril; heart muscle phatidylinositol-phosphates; SH3, Src homology 3. The Rockefeller University Press, 0021-9525/2001/07/123/14 $5.00 The Journal of Cell Biology, Volume 154, Number 1, July 9, 2001 123–136 http://www.jcb.org/cgi/doi/10.1083/jcb.200102110 123 Published July 9, 2001 124 The Journal of Cell Biology | Volume 154, 2001 Nematodes contain two large muscle proteins, encoded Results kb ORF-20ف by the unc-22 and unc-89 genes in Caenorhabditis elegans. An obscurin cDNA sequence contains an The unc-22 product is twitchin, which is localized along We have identified obscurin as a novel titin interacting pro- the myosin filament and shows homology to titin (Benian tein in a yeast two hybrid screen (see below). Searches of the et al., 1989). Unc-89 has been implicated in the assembly EMBL and GenBank databases with this sequence retrieved of the sarcomeric M band (Benian et al., 1996); a mamma- no identical cDNA sequence, suggesting the identification lian homologue of unc-89 has not been identified to date. of a novel protein. We have named this protein obscurin, af- Titin, twitchin, and unc-89 are all at least partly associated ter the adjective obscure, defined in the New Oxford Dictio- with the myosin filament. These proteins share a similar nary as meaning: (a) difficult to see or make out, (b) not well molecular architecture, being largely composed of 100-resi- known, or (c) not easily understood. All three meanings are due domains of the intracellular Ig superfamily, and also appropriate to obscurin, which has not been identified pre- contain domains involved in signal transduction (Benian et viously and has proven difficult to characterize because of its al., 1989, 1996; Labeit et al., 1992; Heierhorst et al., complexity, large size, and relatively low abundance. 1994). Titin and twitchin contain a myosin light chain ki- Starting with the 750 bp of obscurin cDNA sequence from nase–like protein kinase domain which has been implicated positive yeast two hybrid clones, a lambda phage cardiac in the control of myofibril formation in titin (Mayans et al., cDNA library was screened in order to extend this sequence 1998), whereas unc-89 contains a G protein–activating in both directions. Multiple rounds of screening yielded a GDP/GTP exchange factor domain (GEF domain; Benian panel of 18 cDNA clones which can be assembled into a 20.4 et al., 1996). kb contig (Fig. 1 A). This cDNA encodes an ORF of 19,860 Among the giant proteins, the complex modular architecture bp. The ORF is preceded by an in-frame stop codon 27-bp of titin is probably the one best understood at the functional upstream of a putative start methionine. The sequence pre- level, and may therefore serve as a paradigm for the analysis of ceding this methionine codon fits to the Kozak sequence other large modular proteins. Apart from Ig-like domains, titin Downloaded from found around the start methionine of eukaryotic genes contains unique sequences which are involved in signal trans- (Kozak, 1989). The first domain starts nine amino acids after duction or interactions with other sarcomeric proteins (Gautel the putative start methionine. At the 3Ј end of the ORF there et al., 1999). Specific titin domains interact with myomesin, is an in-frame stop codon followed by 500 bp of predicted 3Ј myosin, myosin-binding protein C, ␣-actinin, and telethonin untranslated sequence which contains stop codons in all along the distance from M-line to Z-disk (Gautel et al., 1999; reading frames. No consensus polyadenylation signal was Gregorio et al., 1999; Trinick and Tskhovrebova, 1999; Sanger identified, although the 3Ј untranslated region shows perfect et al., 2000). These interactions specify the sarcomeric localiza- on May 24, 2017 homology to several entries from the EST database which tion of these other protein components and define the length were cloned using oligo dT primers. The ORF is predicted to of myosin filaments or the thickness of the Z-disk (Gautel et encode a 720-kD protein of 6,620 amino acids. One shorter al., 1999). In the I-band, titin is composed of Ig domains ar- splice variant was sequenced (termed obscurin-a1). Attempts ranged in tandem and a unique sequence, the so-called PEVK to further characterize alternative splice variants by reverse region (Labeit and Kolmerer, 1995b). These two secondary transcriptase PCR failed because of the low abundance of the structure elements act as serial springs and are responsible for obscurin message and the extreme homology over most of the passive elasticity of muscle (Gautel and Goulding, 1996; the tandem Ig-regions (see below). Linke et al., 1996), with the tandem Ig stretch being largely re- sponsible for extension at low forces and resisting stretch at higher forces (Trinick, 1996). Obscurin is a modular protein built from adhesion
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS
    Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen,
    [Show full text]
  • The TRAX, DISC1, and GSK3 Complex in Mental Disorders and Therapeutic Interventions Yu-Ting Weng1,2, Ting Chien1, I-I Kuan1 and Yijuang Chern1,2*
    Weng et al. Journal of Biomedical Science (2018) 25:71 https://doi.org/10.1186/s12929-018-0473-x REVIEW Open Access The TRAX, DISC1, and GSK3 complex in mental disorders and therapeutic interventions Yu-Ting Weng1,2, Ting Chien1, I-I Kuan1 and Yijuang Chern1,2* Abstract Psychiatric disorders (such as bipolar disorder, depression, and schizophrenia) affect the lives of millions of individuals worldwide. Despite the tremendous efforts devoted to various types of psychiatric studies and rapidly accumulating genetic information, the molecular mechanisms underlying psychiatric disorder development remain elusive. Among the genes that have been implicated in schizophrenia and other mental disorders, disrupted in schizophrenia 1 (DISC1) and glycogen synthase kinase 3 (GSK3) have been intensively investigated. DISC1 binds directly to GSK3 and modulates many cellular functions by negatively inhibiting GSK3 activity. The human DISC1 gene is located on chromosome 1 and is highly associated with schizophrenia and other mental disorders. A recent study demonstrated that a neighboring gene of DISC1, translin-associated factor X (TRAX), binds to the DISC1/GSK3β complex and at least partly mediates the actions of the DISC1/GSK3β complex. Previous studies also demonstrate that TRAX and most of its interacting proteins that have been identified so far are risk genes and/or markers of mental disorders. In the present review, we will focus on the emerging roles of TRAX and its interacting proteins (including DISC1 and GSK3β) in psychiatric disorders and the potential implications for developing therapeutic interventions. Keywords: TRAX, DISC1, GSK3β, Mental disorders, DNA damage, DNA repair, Oxidative stress, A2AR, PKA Background DNA repair) by interacting with various proteins [4–12].
    [Show full text]
  • Cyclin-Dependent Kinases and Their Role in Inflammation, Endothelial Cell Migration
    Cyclin-Dependent Kinases and their role in Inflammation, Endothelial Cell Migration and Autocrine Activity Dissertation Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Shruthi Ratnakar Shetty Graduate Program in Pharmaceutical Sciences The Ohio State University 2020 Dissertation Committee Dale Hoyt, Advisor Liva Rakotondraibe Moray Campbell Keli Hu Copyrighted by Shruthi Ratnakar Shetty 2020 Abstract Inflammation is the body’s response to infection or injury. Endothelial cells are among the different players involved in an inflammatory cascade. In response to an inflammatory stimuli such as bacterial lipopolysaccharide (LPS), endothelial cells get activated which is characterized by the production of important mediators, such as inducible nitric oxide synthase (iNOS) which, catalyzes the production of nitric oxide (NO) and reactive nitrogen species and cyclooxygenase-2 (COX-2) that catalyzes the production of prostaglandins. Though the production of these mediators is required for an inflammatory response, it is important that their levels are regulated. Continued production of iNOS results in increased accumulation of reactive nitrogen species (RNS) that might lead to cytotoxicity, whereas lack of/suppression results in endothelial and vascular dysfunction. On the other hand, severe cardiovascular, intestinal and renal side effects are observed with significant suppression of COX-2. Thus, studying factors that could regulate the levels of iNOS and COX-2 could provide useful insights for developing novel therapeutic targets. Regulation of protein levels involves control of protein induction or turnover. Since protein induction requires transcription, in this dissertation we studied the role of a promoter of transcription “Cyclin- dependent kinase 7 (CDK7)” in iNOS and COX-2 protein induction.
    [Show full text]
  • New Insights in RBM20 Cardiomyopathy
    Current Heart Failure Reports (2020) 17:234–246 https://doi.org/10.1007/s11897-020-00475-x TRANSLATIONAL RESEARCH IN HEART FAILURE (J BACKS & M VAN DEN HOOGENHOF, SECTION EDITORS) New Insights in RBM20 Cardiomyopathy D. Lennermann1,2 & J. Backs1,2 & M. M. G. van den Hoogenhof1,2 Published online: 13 August 2020 # The Author(s) 2020 Abstract Purpose of Review This review aims to give an update on recent findings related to the cardiac splicing factor RNA-binding motif protein 20 (RBM20) and RBM20 cardiomyopathy, a form of dilated cardiomyopathy caused by mutations in RBM20. Recent Findings While most research on RBM20 splicing targets has focused on titin (TTN), multiple studies over the last years have shown that other splicing targets of RBM20 including Ca2+/calmodulin-dependent kinase IIδ (CAMK2D) might be critically involved in the development of RBM20 cardiomyopathy. In this regard, loss of RBM20 causes an abnormal intracellular calcium handling, which may relate to the arrhythmogenic presentation of RBM20 cardiomyopathy. In addition, RBM20 presents clinically in a highly gender-specific manner, with male patients suffering from an earlier disease onset and a more severe disease progression. Summary Further research on RBM20, and treatment of RBM20 cardiomyopathy, will need to consider both the multitude and relative contribution of the different splicing targets and related pathways, as well as gender differences. Keywords RBM20 . Dilated cardiomyopathy . CaMKIIδ . Calcium handling . Gender differences . Titin Introduction (ARVC), where a small number of genes account for most of the genetic causes, DCM-causing mutations have been ob- Dilated cardiomyopathy (DCM), as defined by left ventricular served in a variety of genes of diverse ontology [2].
    [Show full text]
  • TITLE PAGE Oxidative Stress and Response to Thymidylate Synthase
    Downloaded from molpharm.aspetjournals.org at ASPET Journals on October 2, 2021 -Targeted -Targeted 1 , University of of , University SC K.W.B., South Columbia, (U.O., Carolina, This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Essential Role of Obscurin in Cardiac Myofibrillogenesis and Hypertrophic
    Histochem Cell Biol (2006) 125: 227–238 DOI 10.1007/s00418-005-0069-x ORIGINAL PAPER Andrei B. Borisov Æ Sarah B. Sutter Aikaterini Kontrogianni-Konstantopoulos Robert J. Bloch Æ Margaret V. Westfall Mark W. Russell Essential role of obscurin in cardiac myofibrillogenesis and hypertrophic response: evidence from small interfering RNA-mediated gene silencing Accepted: 2 August 2005 / Published online: 5 October 2005 Ó Springer-Verlag 2005 Abstract Obscurin is a recently identified giant multi- sarcomeric myosin labeling, and an occasional irregular domain muscle protein (800 kDa) whose structural periodicity of sarcomere spacing were typical of obscu- and regulatory functions remain to be defined. The goal rin siRNA-treated cells. These results suggest that ob- of this study was to examine the effect of obscurin gene scurin is indispensable for spatial positioning of silencing induced by RNA interference on the dynamics contractile proteins and for the structural integration of myofibrillogenesis and hypertrophic response to and stabilization of myofibrils, especially at the stage of phenylephrine in cultured rat cardiomyocytes. We found myosin filament incorporation and A-band assembly. that that the adenoviral transfection of short interfering This demonstrates a vital role for obscurin in myofib- RNA (siRNA) constructs targeting the first coding exon rillogenesis and hypertrophic growth. of obscurin sequence resulted in progressive depletion of cellular obscurin. Confocal microscopy demonstrated Keywords Obscurin Æ Cardiac myocytes Æ that downregulation of obscurin expression led to the Myofibrillogenesis Æ siRNA Æ a-Actinin Æ Myosin Æ impaired assembly of new myofibrillar clusters and Titin Æ Hypertrophy considerable aberrations of the normal structure of the contractile apparatus.
    [Show full text]
  • Abstract Title of Dissertation: Small Ankyrin-1 and Obscurin As a Model
    Small Ankyrin-1 and Obscurin as a Model for Ankyrin Binding Motifs Item Type dissertation Authors Willis, Chris Publication Date 2011 Abstract Small ankyrin-1 binds with high affinity to two regions within obscurin A. This interaction provides a molecular link between the sarcoplasmic reticulum and myofibrils in striated muscle. Here, I show that four hydrophobic residues within the hydro... Keywords ankyrin binding motifs; hydrophobic interactions; obscurin; protein-protein interaction; small ankyrin-1; Ankyrins; Hydrophobic and Hydrophilic Interactions Download date 03/10/2021 19:07:22 Item License https://creativecommons.org/licenses/by-nc-nd/4.0/ Link to Item http://hdl.handle.net/10713/683 Abstract Title of Dissertation: Small Ankyrin-1 and Obscurin as a Model for Ankyrin Binding Motifs Chris D. Willis, Doctor of Philosophy, 2011 Dissertation Directed by: Robert J. Bloch, Ph.D., Professor, Department of Physiology Small ankyrin-1 binds with high affinity to two regions within obscurin A. This interaction provides a molecular link between the sarcoplasmic reticulum and myofibrils in striated muscle. Here, I show that four hydrophobic residues within the hydrophobic “hotspot” of the ankyrin-like repeats of sAnk1 are involved in binding obscurin. Alanine scanning mutagenesis of each of the four residues inhibits binding to the high affinity binding site, Obsc6316-6345, whereas two of the mutations had no effect on binding to the lower affinity site, Obsc6231-6260. Mutagenesis identified three central residues within Obsc6316-6345 that are critical for binding sAnk1, but no single residue within Obsc6231-6260 that is essential. Instead, only a triple mutant of neighboring residues of Obsc6231-6260 decreases binding.
    [Show full text]
  • A Critical Role for Kalirin in NGF Signaling Through Trka
    MOLECULAR AND CELLULAR BIOLOGY, June 2005, p. 5106–5118 Vol. 25, No. 12 0270-7306/05/$08.00ϩ0 doi:10.1128/MCB.25.12.5106–5118.2005 Copyright © 2005, American Society for Microbiology. All Rights Reserved. Critical Role for Kalirin in Nerve Growth Factor Signaling through TrkA Kausik Chakrabarti,1 Rong Lin,1 Noraisha I. Schiller,1 Yanping Wang,1 David Koubi,2 Ying-Xin Fan,3 Brian B. Rudkin,2 Gibbes R. Johnson,3 and Martin R. Schiller1* University of Connecticut Health Center, Department of Neuroscience, 263 Farmington Ave., Farmington, Connecticut 06030-43011; Laboratoire de Biologie Moleculaire de la Cellule, UMR 5161 CNRS, INRA U1237, Ecole Normale Supe´rieure de Lyon, IFR 128 “BioSciences Lyon-Gerland,” 69364 Lyon cedex 07, France2; and Division of Therapeutic Proteins, Center for Drug Evaluation and Research, Food and Drug Administration, Bethesda, Maryland 208923 Received 30 June 2004/Returned for modification 16 September 2004/Accepted 10 March 2005 Kalirin is a multidomain guanine nucleotide exchange factor (GEF) that activates Rho proteins, inducing cytoskeletal rearrangement in neurons. Although much is known about the effects of Kalirin on Rho GTPases and neuronal morphology, little is known about the association of Kalirin with the receptor/signaling systems that affect neuronal morphology. Our experiments demonstrate that Kalirin binds to and colocalizes with the TrkA neurotrophin receptor in neurons. In PC12 cells, inhibition of Kalirin expression using antisense RNA decreased nerve growth factor (NGF)-induced TrkA autophosphorylation and process extension. Kalirin overexpression potentiated neurotrophin-stimulated TrkA autophosphorylation and neurite outgrowth in PC12 cells at a low concentration of NGF.
    [Show full text]
  • The Guanine Nucleotide Exchange Factor Kalirin-7 Is a Novel Synphilin-1 Interacting Protein and Modifies Synphilin-1 Aggregate Transport and Formation
    The Guanine Nucleotide Exchange Factor Kalirin-7 Is a Novel Synphilin-1 Interacting Protein and Modifies Synphilin-1 Aggregate Transport and Formation Yu-Chun Tsai, Olaf Riess, Anne S. Soehn., Huu Phuc Nguyen*. Department of Medical Genetics, University of Tuebingen, Tuebingen, Germany Abstract Synphilin-1 has been identified as an interaction partner of a-synuclein, a key protein in the pathogenesis of Parkinson disease (PD). To further explore novel binding partners of synphilin-1, a yeast two hybrid screening was performed and kalirin-7 was identified as a novel interactor. We then investigated the effect of kalirin-7 on synphilin-1 aggregate formation. Coexpression of kalirin-7 and synphilin-1 caused a dramatic relocation of synphilin-1 cytoplasmic small inclusions to a single prominent, perinuclear inclusion. These perinuclear inclusions were characterized as being aggresomes according to their colocalization with microtubule organization center markers, and their formation was microtubule-dependent. Furthermore, kalirin-7 increased the susceptibility of synphilin-1 inclusions to be degraded as demonstrated by live cell imaging and quantification of aggregates. However, the kalirin-7-mediated synphilin-1 aggresome response was not dependent on the GEF activity of kalirin-7 since various dominant negative small GTPases could not inhibit the formation of aggresomes. Interestingly, the aggresome response was blocked by HDAC6 catalytic mutants and the HDAC inhibitor trichostatin A (TSA). Moreover, kalirin-7 decreased the level of acetylated a-tubulin in response to TSA, which suggests an effect of kalirin-7 on HDAC6-mediated protein transportation and aggresome formation. In summary, this is the first report demonstrating that kalirin-7 leads to the recruitment of synphilin-1 into aggresomes in a HDAC6-dependent manner and also links kalirin-7 to microtubule dynamics.
    [Show full text]
  • Rho Guanine Nucleotide Exchange Factors: Regulators of Rho Gtpase Activity in Development and Disease
    Oncogene (2014) 33, 4021–4035 & 2014 Macmillan Publishers Limited All rights reserved 0950-9232/14 www.nature.com/onc REVIEW Rho guanine nucleotide exchange factors: regulators of Rho GTPase activity in development and disease DR Cook1, KL Rossman2,3 and CJ Der1,2,3 The aberrant activity of Ras homologous (Rho) family small GTPases (20 human members) has been implicated in cancer and other human diseases. However, in contrast to the direct mutational activation of Ras found in cancer and developmental disorders, Rho GTPases are activated most commonly in disease by indirect mechanisms. One prevalent mechanism involves aberrant Rho activation via the deregulated expression and/or activity of Rho family guanine nucleotide exchange factors (RhoGEFs). RhoGEFs promote formation of the active GTP-bound state of Rho GTPases. The largest family of RhoGEFs is comprised of the Dbl family RhoGEFs with 70 human members. The multitude of RhoGEFs that activate a single Rho GTPase reflects the very specific role of each RhoGEF in controlling distinct signaling mechanisms involved in Rho activation. In this review, we summarize the role of Dbl RhoGEFs in development and disease, with a focus on Ect2 (epithelial cell transforming squence 2), Tiam1 (T-cell lymphoma invasion and metastasis 1), Vav and P-Rex1/2 (PtdIns(3,4,5)P3 (phosphatidylinositol (3,4,5)-triphosphate)-dependent Rac exchanger). Oncogene (2014) 33, 4021–4035; doi:10.1038/onc.2013.362; published online 16 September 2013 Keywords: Rac1; RhoA; Cdc42; guanine nucleotide exchange factors; cancer;
    [Show full text]