DOCSLIB.ORG

Development of a PCR for Identification of Bordetella Hinzii Author(S): Karen B

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Development of a PCR for Identification of Bordetella Hinzii Author(S): Karen B Development of a PCR for Identification of Bordetella hinzii Author(s): Karen B. Register Source: Avian Diseases, 57(2):307-310. 2013. Published By: American Association of Avian Pathologists DOI: http://dx.doi.org/10.1637/10433-102212-ResNote.1 URL: http://www.bioone.org/doi/full/10.1637/10433-102212-ResNote.1 BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the biological, ecological, and environmental sciences. BioOne provides a sustainable online platform for over 170 journals and books published by nonprofit societies, associations, museums, institutions, and presses. Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance of BioOne’s Terms of Use, available at www.bioone.org/page/terms_of_use. Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercial inquiries or rights and permissions requests should be directed to the individual publisher as copyright holder. BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions, research libraries, and research funders in the common goal of maximizing access to critical research. AVIAN DISEASES 57:307–310, 2013 Research Note— Development of a PCR for Identification of Bordetella hinzii Karen B. RegisterA Ruminant Diseases and Immunology Research Unit, Agricultural Research Service, United States Department of Agriculture, National Animal Disease Center, 1920 Dayton Avenue, Ames, IA 50010 Received 31 October 2012; Accepted 7 February 2013; Published ahead of print 11 February 2013 SUMMARY. Bordetella hinzii infects primarily poultry and immunocompromised humans. It is closely related to the etiologic agent of turkey coryza, Bordetella avium. Distinguishing between B. avium and B. hinzii is difficult, and there is no method for identification of B. hinzii suitable for use by diagnostic laboratories. This report details the development of a B. hinzii–specific PCR targeting the ompA gene. Assay sensitivity is 100% based on analysis of 48 B. hinzii isolates from diverse geographic locations representing all known ribotypes. Evaluation of 71 isolates of B. avium and 20 other bacterial isolates from poultry, comprising gram-negative and gram-positive commensals and pathogens of nine genera, demonstrated an assay specificity of 100%. The ompA PCR is a rapid, reliable, and accurate method for identification of B. hinzii and provides a valuable new tool for veterinary diagnostic laboratories investigating poultry respiratory disease outbreaks. RESUMEN. Nota de Investigacio´n—Desarrollo de un me´todo de PCR para la identificacio´ndeBordetella hinzii. La Bordetella hinzii infecta principalmente a las aves de corral y a seres humanos inmunodeprimidos. Esta bacteria esta´ estrechamente relacionada con el agente etiolo´gico de la coriza de los pavos, Bordetella avium. La diferenciacio´n entre B. avium y B. hinzii es difı´cil, y no hay un me´todo para la identificacio´ndeB. hinzii que sea adecuado para su uso en los laboratorios de diagno´stico. Este informe detalla el desarrollo de un me´todo de PCR especı´fico para B. hinzii dirigida al gene ompA. La sensibilidad del ensayo fue del 100%, con base en el ana´lisis de 48 aislamientos de B. hinzii aislados de diferentes sitios geogra´ficos que representan a todos ribotipos conocidos. La evaluacio´n de los 71 aislamientos de B. avium y de otros 20 aislamientos bacterianos de aves comerciales, que incluye bacterias comensales y pato´genas, gram-negativas y positivas de nueve ge´neros, demostro´ que el me´todo tenı´a una especificidad del 100%. El me´todo de PCR basado en el gene ompA es un me´todo ra´pido, confiable y preciso para la identificacio´ndeB. hinzii y proporciona un nuevo y valioso instrumento para los laboratorios de diagno´stico veterinario que investigan brotes de enfermedades respiratorias en la avicultura. Key words: Bordetella hinzii, ompA, PCR Abbreviations: ATCC 5 American Type Culture Collection; NADC 5 National Animal Disease Center Bordetella hinzii infects primarily poultry and immunocompro- reference strains, and 37 strains whose characterization has been reported mised humans but it also has been isolated from rabbits (11) and previously (11,13,14). The 71 B. avium isolates tested include the type mice (5). Although initially thought to be nonpathogenic in poultry, strain, four reference strains, and 49 strains whose characterization has it was recently shown that some strains cause disease in turkey poults been reported previously (11,13,14). In addition to the ATCC type that is indistinguishable from the clinical presentation of turkey strain and one reference strain, 17 avian isolates of Bordetella bronchseptica were analyzed, including 11 described in prior publications coryza caused by Bordetella avium (9). Bordetella hinzii and B. avium (8,10,11,14,15). Bordetella isolates not included in previous reports are are closely related and share many genetic and phenotypic traits. well-characterized strains from a collection maintained at the National Only a few phenotypic tests can delineate these species, and results Animal Disease Center (NADC). All PvuII ribotypes known to occur may vary depending on inoculum size, culture conditions, and the in avian isolates (11) are represented within the group tested for each specific procedure used (1,2,6,7,16). Ribotyping and restriction Bordetella species. Bordetella hinzii and B. avium were cultivated for enzyme analysis reliably distinguish between B. avium and B. hinzii 18–36 hr at 37 C on 5% sheep’s blood agar. Although sheep’s blood (11,14), but these tests are not readily carried out in most diagnostic agar also supports the growth of B. bronchiseptica, cultures for this laboratories. There is currently no rapid method for identification of study were grown for 24–36 hr at 37 C on Bordet-Gengou agar B. hinzii suitable for use in a diagnostic setting. To address this need, supplemented with 10% sheep’s blood to be consistent with laboratory a highly sensitive and specific PCR targeting the ompA gene of B. research protocol. Other bacteria represent avian pathogens or normal hinzii was developed. flora of the turkey respiratory tract, the latter obtained by swabbing the upper third of the trachea of clinically healthy birds with BBL CultureSwabs (Becton Dickinson and Company, Sparks, MD). Swabs MATERIALS AND METHODS were streaked on the day of collection onto duplicate 5% sheep’s blood agar plates that were incubated at 37 C for 24–48 hr with or without Bacterial isolates and growth conditions. The host and geographic 5% CO2. A representative of every distinguishable colony type was origin of bacterial isolates included in this study are indicated in selected for identification. Isolates from tracheal swabs were evaluated Tables 1 and 2. Forty-nine isolates of B. hinzii were evaluated, including by Gram’s stain and identified using the MicroLog System (BioLog, the American Type Culture Collection (ATCC) type strain, four Inc., Hayward, CA). PCR. Boiled lysates prepared from a single colony as described previously (12) were used as template. Ten microliters of each PCR was ACorresponding author. E-mail: [email protected] analyzed by agarose gel electrophoresis in 3:1 NuSieve (Lonza Rockland, 307 308 K. B. Register Table 1. Bordetella spp. isolates included in this study. Table 2. Additional avian isolates included in this study. Organism Host Geographic origin n Organism Host Geographic origin n B. hinzii Human United States 3 Alcaligenes faecalis Turkey North Carolina 2 Human Switzerland 2 Escherichia coli Turkey Iowa 1 Human Spain 1 Chicken unknown 1 Turkey United States 1 Enterococcus gallinarum Turkey Iowa 1 Turkey Minnesota 7 Enterococcus columbae Turkey Iowa 1 Turkey Ohio 5 Enterococcus avium/faecalis Turkey Iowa 1 Turkey Iowa 4 Ornithobacterium rhinotracheale Turkey Minnesota 2 Turkey California 3 Pasteurella multocida Turkey West Virginia 1 Turkey New York 1 Turkey California 1 Chicken Australia 1 Pseudomonas aeruginosa Turkey Iowa 1 Chicken Belgium 1 Staphylococcus aureus Turkey Iowa 1 Turkey or chicken Ohio 12 Staphylococcus hyicus Turkey Iowa 1 Rabbit Hungary 1 Staphylococcus delphini Turkey Iowa 1 Mouse Missouri 1 Staphylococcus xylosis Turkey Iowa 1 Unknown Minnesota 5 Staphylococcus intermedius Turkey Iowa 1 B. avium Turkey North Carolina 1 Turkey Iowa 12 Turkey California 6 Turkey Minnesota 5 Turkey Ohio 1 AM748263–AM748265), representing ,540 bp of the 39 portion Wild turkey New Jersey 1 of the open reading frame, was used to design PCR primers to Turkey South Africa 3 amplify and sequence ,520 bp of the gene. An alignment of the Turkey Germany 1 Mallard New Jersey 7 sequences from PCR products obtained with a subset of the B. hinzii Canada goose New Jersey 1 isolates included in Table 1, representing different hosts and PvuII Saw-whet owl Virginia 1 ribotypes, revealed three sequence variants. A representative of each Unknown Ohio 15 ompA sequence variant was aligned with ompA gene sequences in Unknown Minnesota 2 GenBank from several additional Bordetella species to identify regions Unknown Iowa 7 Unknown North Carolina 3 Unknown Germany 5 B. bronchiseptica Turkey Ohio 4 Turkey Iowa 4 Turkey California 3 Turkey Minnesota 2 Turkey Wisconsin 1 Turkey United States 1 Turkey Germany 1 Turkey Unknown 1 Dog United States 1 Rabbit United States 1 Inc., Rockland, ME) containing a 1:10,000 dilution of GelRed (Phenix Research Products, Candler, NC). Chromosomal DNA purified using a commercially available kit (Promega, Madison, WI) was used to assess the limit of detection. Purified DNA was quantified with PicoGreen (Invitrogen, Carlsbad, CA). DNA sequencing. PCR products were purified with spin columns (QIAGEN, Valencia, CA) and sequenced directly at the NADC’s Genomics Unit using BigDyeH Terminator version 3.1 on a 3130 XL Genetic Analyzer sequencer (Applied Biosystems, Foster City, CA). Sequence data were analyzed using Vector NTI Suite software (Invitrogen). Final consensus sequences were derived from a minimum of three sequence reads with at least one from each strand.
Load more

Recommended publications
  • Table S1. Primers Used for PCR Amplification
    Table S1. Primers used for PCR amplification Name Primer Sequence (5’-3’) Gene target Taxon target Reference First PCR round DGGE analysis FGPH19 TACGGCAARGGTGGNATHG nifH Diazotrophic (Simonet et al. 1991) POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) 799F AACMGGATTAGATACCCKG 16S rRNA Bacteria (Chelius and Triplett 2001) 1492R TACGGYTACCTTGTTACGACTT 16S rRNA Bacteria (Chelius and Triplett 2001) F203α CCGCATACGCCCTACGGGGGAAAGATTTAT 16S rRNA Alphaproteobacteria (Gomes et al. 2001) F948β CGCACAAGCGGTGGATGA 16S rRNA Betaproteobacteria (Gomes et al. 2001) F243HCG GGATGAGCCCGCGGCCTA 16S rRNA Actinobacteria (Heuer et al. 1997) BACF GGGAAACCGGGGCTAATACCGGAT 16S rRNA Firmicutes (Garbeva et al. 2003) Second PCR round DGGE analysis POLF-GC CGCCCGCCGCGCCCCGCGCCCGGCCCGCCCCCG nifH Diazotrophic (Poly et al. 2001) CCCCTGCGAYCCSAARGCBGACTC AQER GACGATGTAGATITCCTG nifH Diazotrophic (Poly et al. 2001) F968-GC CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGC 16S rRNA Bacteria (Heuer et al. 1999) ACGGGGGGAACGAAGAACCTTAC R1401 CGGTGTGTACAAGACCC 16S rRNA Bacteria (Heuer et al. 1997) qPCR analysis POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) POLF TGCGAYCCSAARGCBGACTC nifH Diazotrophic (Poly et al. 2001) 6S-27F AGAGTTTGATCCTGGCTCAG 16S rRNA Bacteria Bulgari et al., 2014 338R GCTGCCTCCCGTAGGAGT 16S rRNA Bacteria Bulgari et al., 2014 Table 2. Primers used for Ion Torrent pyrosequencing analysis. Primer Primer sequence (5´-3´) Reference 967F-PP CNACGCGAAGAACCTTANC (Jünemann et al. 2012) 967F-UC1 CAACGCGAAAAACCTTACC (Jünemann et al. 2012) 967F-UC2 CAACGCGCAGAACCTTACC (Jünemann et al. 2012) 967F-UC3 ATACGCGARGAACCTTACC (Jünemann et al. 2012) 967F-AQ CTAACCGANGAACCTYACC (Jünemann et al. 2012) 1046R CGACAGCCATGCANCACCT (Jünemann et al. 2012) 1046R-PP CGACAACCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ1 CGACGGCCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ2 CGACGACCATGCANCACCT (Jünemann et al. 2012) Table S3. Alpha diversity indices. Statistical analysis of the total endophytic and diazotrophic endophytic bacterial community associated with sweet sorghum cv.
    [Show full text]
  • Cystic Fibrosis Mice Develop Spontaneouschronic Bordetella
    ISSN 2470-3176 SciO p Forschene n HUB for Sc i e n t i f i c R e s e a r c h Journal of Infectious Pulmonary Diseases Research Article Volume: 3.2 Open Access Received date: 11 Oct 2017; Accepted date: 28 Cystic Fibrosis Mice Develop Spontaneous Oct 2017; Published date: 02 Nov 2017. Chronic Bordetella Airway Infections Citation: Darrah R, Bonfield T, LiPuma JJ, Litman P, Hodges CA, et al. (2017) Cystic Fibrosis Mice Darrah R1*, Bonfield T2, LiPuma JJ3, Litman P1, Hodges CA4, Jacono F5 and Develop Spontaneous Chronic Bordetella Airway Drumm M6 Infections. J Infect Pulm Dis 3(2): doi http://dx.doi. org/10.16966/2470-3176.128 1Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA 2Department of Pediatrics, Case Western Reserve University, Cleveland Ohio, USA Copyright: © 2017 Darrah R, et al. This is an 3Department of Pediatrics and Communicable Diseases, University of Michigan Medical School, Ann open-access article distributed under the terms Arbor, Michigan, USA of the Creative Commons Attribution License, 4Departments of Radiology, Biomedical Engineering, and Pediatrics, Case Western Reserve University, which permits unrestricted use, distribution, and Cleveland Ohio, USA reproduction in any medium, provided the original 5Department of Medicine, Case Western Reserve University, and Louis Stokes VA Cleveland Medical author and source are credited. Center, USA 6Departments of Pediatrics and Genetics Genome Sciences, Case Western Reserve University, Cleveland Ohio, USA *Corresponding author: Rebecca Darrah, Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA, Tel: 216-368-4911; E-mail: [email protected] Abstract Chronic pulmonary disease and infection is the primary cause of morbidity and mortality in people with cystic fibrosis (CF).
    [Show full text]
  • Bordetella Petrii Clinical Isolate Isolates of This Species Have Been Previously Reported from 4
    routine laboratory protocols. Initial susceptibility testing Bordetella petrii using disk diffusion indicated apparent susceptibility of the isolate to erythromycin, gentamicin, ceftriaxone, and Clinical Isolate piperacillin/tazobactam. The isolate was resistant to amox- icillin, co-amoxiclav, tetracycline, clindamycin, ciproflo- Norman K. Fry,* John Duncan,* Henry Malnick,* xacin, and metronidazole. After initial sensitivity results, a Marina Warner,* Andrew J. Smith,† 6-week course of oral clarithromycin (500 mg, 8 hourly) Margaret S. Jackson,† and Ashraf Ayoub† was begun. We describe the first clinical isolate of Bordetella petrii At follow-up appointments 3 months and 6 months from a patient with mandibular osteomyelitis. The only pre- after antimicrobial drug therapy ceased, clinical and radi- viously documented isolation of B. petrii occurred after the ographic findings were not unusual, and the infected area initial culture of a single strain from an environmental healed successfully. Despite the successful clinical out- source. come, the isolate was subsequently shown to be resistant to clarithromycin in vitro (Table). Improvement of the 67-year-old man visited an emergency dental clinic, osteomyelitis may also have been facilitated by the biopsy Awhere he complained of toothache in the lower right procedure, during which a sequestrum of bone was mandibular quadrant. Examination showed a root-filled removed. lower right canine tooth that was mobile and tender to per- The gram-negative bacillus (designated strain cussion. The tooth was extracted uneventfully under local GDH030510) was submitted to the Health Protection anesthesia. The patient returned after several days with Agency, Centre for Infections, London, for identification. pain at the extraction site. A localized alveolar osteitis was Preliminary tests results were consistent with those diagnosed, and local debridement measures were institut- described for members of the genus Bordetella.
    [Show full text]
  • Vitek®2 Id & Ast Cards
    ® VITEK 2 ID & AST CARDS Reliable • safe • rapid RESULTS YOU CAN TRUST FOCUS The VITEK 2 ADVANCED EXPERT SYSTEM™ software lets you focus your time where it is most required in ® the lab. The ADVANCED EXPERT SYSTEM™ validates VITEK 2 ID & AST CARDS ON WHAT every result and quickly identi es those truly needing a Microbiologist’s valuable time and attention. This allows the majority of results to be quickly and con dently reported to clinicians without need for MATTERS 2,8,11,13,15 review Rapid, Flexible, E cient EFFICIENCY THROUGH AUTOMATION VITEK 2 cards o er the shortest preparation time in the industry, considerably reducing labor Each self-contained, costs1,3,7,9,10,14. They also have the least contaminated waste, o ering up to 64% cost savings for disposal disposable test card compared to other systems6,10,12.The cards provide provides rapid and INNOVATIVE AND FLEXIBLE DESIGN increased standardization and automated, same-day accurate species- results helping clinicians to optimise antibiotic level identi cation or • Each card contains microwells with biochemicals or antimicrobials therapy sooner2,3. susceptibility results with • Ready and simple to use accurate MICs* based on • Pre-applied barcodes for maximum traceability • EUCAST and CLSI compliant AST formulations available Designed for VITEK 2 automated systems, VITEK 2 reference CLSI** and identi cation (ID) and susceptibility (AST) cards provide ISO *** MIC methods UP TO 50% FEWER PREPARATION STEPS THAN and EUCAST****, OTHER SYSTEMS,3,9,10: reliable and accurate results for clinically important US FDA*****, bacteria and yeasts1,2,4,5 or CLSI® breakpoint • Inoculation with a simple, standardised suspension of organism in saline interpretations1,3,4,5,7,8,10.
    [Show full text]
  • Which Organisms Are Used for Anti-Biofouling Studies
    Table S1. Semi-systematic review raw data answering: Which organisms are used for anti-biofouling studies? Antifoulant Method Organism(s) Model Bacteria Type of Biofilm Source (Y if mentioned) Detection Method composite membranes E. coli ATCC25922 Y LIVE/DEAD baclight [1] stain S. aureus ATCC255923 composite membranes E. coli ATCC25922 Y colony counting [2] S. aureus RSKK 1009 graphene oxide Saccharomycetes colony counting [3] methyl p-hydroxybenzoate L. monocytogenes [4] potassium sorbate P. putida Y. enterocolitica A. hydrophila composite membranes E. coli Y FESEM [5] (unspecified/unique sample type) S. aureus (unspecified/unique sample type) K. pneumonia ATCC13883 P. aeruginosa BAA-1744 composite membranes E. coli Y SEM [6] (unspecified/unique sample type) S. aureus (unspecified/unique sample type) graphene oxide E. coli ATCC25922 Y colony counting [7] S. aureus ATCC9144 P. aeruginosa ATCCPAO1 composite membranes E. coli Y measuring flux [8] (unspecified/unique sample type) graphene oxide E. coli Y colony counting [9] (unspecified/unique SEM sample type) LIVE/DEAD baclight S. aureus stain (unspecified/unique sample type) modified membrane P. aeruginosa P60 Y DAPI [10] Bacillus sp. G-84 LIVE/DEAD baclight stain bacteriophages E. coli (K12) Y measuring flux [11] ATCC11303-B4 quorum quenching P. aeruginosa KCTC LIVE/DEAD baclight [12] 2513 stain modified membrane E. coli colony counting [13] (unspecified/unique colony counting sample type) measuring flux S. aureus (unspecified/unique sample type) modified membrane E. coli BW26437 Y measuring flux [14] graphene oxide Klebsiella colony counting [15] (unspecified/unique sample type) P. aeruginosa (unspecified/unique sample type) graphene oxide P. aeruginosa measuring flux [16] (unspecified/unique sample type) composite membranes E.
    [Show full text]
  • Table S5. the Information of the Bacteria Annotated in the Soil Community at Species Level
    Table S5. The information of the bacteria annotated in the soil community at species level No. Phylum Class Order Family Genus Species The number of contigs Abundance(%) 1 Firmicutes Bacilli Bacillales Bacillaceae Bacillus Bacillus cereus 1749 5.145782459 2 Bacteroidetes Cytophagia Cytophagales Hymenobacteraceae Hymenobacter Hymenobacter sedentarius 1538 4.52499338 3 Gemmatimonadetes Gemmatimonadetes Gemmatimonadales Gemmatimonadaceae Gemmatirosa Gemmatirosa kalamazoonesis 1020 3.000970902 4 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas indica 797 2.344876284 5 Firmicutes Bacilli Lactobacillales Streptococcaceae Lactococcus Lactococcus piscium 542 1.594633558 6 Actinobacteria Thermoleophilia Solirubrobacterales Conexibacteraceae Conexibacter Conexibacter woesei 471 1.385742446 7 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas taxi 430 1.265115184 8 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas wittichii 388 1.141545794 9 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas sp. FARSPH 298 0.876754244 10 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sorangium cellulosum 260 0.764953367 11 Proteobacteria Deltaproteobacteria Myxococcales Polyangiaceae Sorangium Sphingomonas sp. Cra20 260 0.764953367 12 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas panacis 252 0.741416341
    [Show full text]
  • Insights Into the Pathogenicity of Burkholderia Pseudomallei
    REVIEWS Melioidosis: insights into the pathogenicity of Burkholderia pseudomallei W. Joost Wiersinga*, Tom van der Poll*, Nicholas J. White‡§, Nicholas P. Day‡§ and Sharon J. Peacock‡§ Abstract | Burkholderia pseudomallei is a potential bioterror agent and the causative agent of melioidosis, a severe disease that is endemic in areas of Southeast Asia and Northern Australia. Infection is often associated with bacterial dissemination to distant sites, and there are many possible disease manifestations, with melioidosis septic shock being the most severe. Eradication of the organism following infection is difficult, with a slow fever-clearance time, the need for prolonged antibiotic therapy and a high rate of relapse if therapy is not completed. Mortality from melioidosis septic shock remains high despite appropriate antimicrobial therapy. Prevention of disease and a reduction in mortality and the rate of relapse are priority areas for future research efforts. Studying how the disease is acquired and the host–pathogen interactions involved will underpin these efforts; this review presents an overview of current knowledge in these areas, highlighting key topics for evaluation. Melioidosis is a serious disease caused by the aerobic, rifamycins, colistin and aminoglycosides), but is usually Gram-negative soil-dwelling bacillus Burkholderia pseu- susceptible to amoxicillin-clavulanate, chloramphenicol, domallei and is most common in Southeast Asia and doxycycline, trimethoprim-sulphamethoxazole, ureido- Northern Australia. Melioidosis is responsible for 20% of penicillins, ceftazidime and carbapenems2,4. Treatment all community-acquired septicaemias and 40% of sepsis- is required for 20 weeks and is divided into intravenous related mortality in northeast Thailand. Reported cases are and oral phases2,4. Initial intravenous therapy is given likely to represent ‘the tip of the iceberg’1,2, as confirmation for 10–14 days; ceftazidime or a carbapenem are the of disease depends on bacterial isolation, a technique that drugs of choice.
    [Show full text]
  • Identification of Bordetella Spp. in Respiratory Specimens From
    504 Clinical Microbiology and Infection, Volume 14 Number 5, May 2008 isolates of extended-spectrum-beta-lactamase-producing Original Submission: 27 October 2007; Revised Sub- Shigella sonnei. Ann Trop Med Parasitol 2007; 101: 511–517. mission: 5 December 2007; Accepted: 19 December 21. Rice LB. Controlling antibiotic resistance in the ICU: 2007 different bacteria, different strategies. Cleve Clin J Med 2003; 70: 793–800. Clin Microbiol Infect 2008; 14: 504–506 22. Boyd DA, Tyler S, Christianson S et al. Complete nucleo- 10.1111/j.1469-0691.2008.01968.x tide sequence of a 92-kilobase plasmid harbouring the CTX-M-15 extended spectrum b-lactamase involved in an outbreak in long-term-care facilities in Toronto, Canada. Cystic fibrosis (CF) is an autosomal recessive Antimicrob Agents Chemother 2004; 48: 3758–3764. disease, characterised by defective chloride ion channels that result in multi-organ dysfunction, most notably affecting the respiratory tract. The RESEARCH NOTE alteration in the pulmonary environment is asso- ciated with increased susceptibility to bacterial infection. Recent advances in bacterial taxonomy and improved microbial identification systems Identification of Bordetella spp. in have led to an increasing recognition of the respiratory specimens from individuals diversity of bacterial species involved in CF lung with cystic fibrosis infection. Many such species are opportunistic T. Spilker, A. A. Liwienski and J. J. LiPuma human pathogens, some of which are rarely found in other human infections [1]. Processing Department of Pediatrics and Communicable of CF respiratory cultures therefore employs Diseases, University of Michigan Medical selective media and focuses on detection of School, Ann Arbor, MI, USA uncommon human pathogens.
    [Show full text]
  • <I>MICROCYSTIS</I> BLOOMS
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 8-2018 MOLECULAR CHARACTERIZATION OF FACTORS CONSTRAINING THE SUCCESS AND TOXICITY OF MICROCYSTIS BLOOMS Lauren Elisabeth Krausfeldt University of Tennessee, [email protected] Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss Recommended Citation Krausfeldt, Lauren Elisabeth, "MOLECULAR CHARACTERIZATION OF FACTORS CONSTRAINING THE SUCCESS AND TOXICITY OF MICROCYSTIS BLOOMS. " PhD diss., University of Tennessee, 2018. https://trace.tennessee.edu/utk_graddiss/5030 This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a dissertation written by Lauren Elisabeth Krausfeldt entitled "MOLECULAR CHARACTERIZATION OF FACTORS CONSTRAINING THE SUCCESS AND TOXICITY OF MICROCYSTIS BLOOMS." I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Doctor of Philosophy, with a major in Microbiology. Steven W. Wilhelm, Major Professor We have read this dissertation and recommend its acceptance: Alison Buchan, Shawn R. Campagna, Karen G. Lloyd Accepted for the Council: Dixie L. Thompson Vice Provost and Dean of the Graduate School (Original signatures are on file with official studentecor r ds.) MOLECULAR CHARACTERIZATION OF FACTORS CONSTRAINING THE SUCCESS AND TOXICITY OF MICROCYSTIS BLOOMS A Dissertation Presented for the Doctor of Philosophy Degree The University of Tennessee, Knoxville Lauren Elisabeth Krausfeldt August 2018 Copyright © 2018 by Lauren E.
    [Show full text]
  • PDF For- Tries Reported Holding the Material in Only 1 Institute
    Peer-Reviewed Journal Tracking and Analyzing Disease Trends pages 2117–2292 EDITOR-IN-CHIEF D. Peter Drotman Associate Editors EDITORIAL BOARD Paul Arguin, Atlanta, Georgia, USA Dennis Alexander, Addlestone, Surrey, UK Charles Ben Beard, Ft. Collins, Colorado, USA Timothy Barrett, Atlanta, Georgia, USA Ermias Belay, Atlanta, Georgia, USA Barry J. Beaty, Ft. Collins, Colorado, USA David Bell, Atlanta, Georgia, USA Martin J. Blaser, New York, New York, USA Sharon Bloom, Atlanta, GA, USA Christopher Braden, Atlanta, Georgia, USA Mary Brandt, Atlanta, Georgia, USA Arturo Casadevall, New York, New York, USA Corrie Brown, Athens, Georgia, USA Kenneth C. Castro, Atlanta, Georgia, USA Michel Drancourt, Marseille, France Louisa Chapman, Atlanta, Georgia, USA Paul V. Effler, Perth, Australia Thomas Cleary, Houston, Texas, USA David Freedman, Birmingham, Alabama, USA Vincent Deubel, Shanghai, China Peter Gerner-Smidt, Atlanta, Georgia, USA Ed Eitzen, Washington, DC, USA Stephen Hadler, Atlanta, Georgia, USA Daniel Feikin, Baltimore, Maryland, USA Nina Marano, Nairobi, Kenya Anthony Fiore, Atlanta, Georgia, USA Martin I. Meltzer, Atlanta, Georgia, USA Isaac Chun-Hai Fung, Statesboro, Georgia, USA David Morens, Bethesda, Maryland, USA Kathleen Gensheimer, College Park, MD, USA J. Glenn Morris, Gainesville, Florida, USA Duane J. Gubler, Singapore Richard L. Guerrant, Charlottesville, Virginia, USA Patrice Nordmann, Fribourg, Switzerland Scott Halstead, Arlington, Virginia, USA Didier Raoult, Marseille, France Katrina Hedberg, Portland, Oregon, USA Pierre Rollin, Atlanta, Georgia, USA David L. Heymann, London, UK Frank Sorvillo, Los Angeles, California, USA Charles King, Cleveland, Ohio, USA David Walker, Galveston, Texas, USA Keith Klugman, Seattle, Washington, USA Senior Associate Editor, Emeritus Takeshi Kurata, Tokyo, Japan Brian W.J. Mahy, Bury St.
    [Show full text]
  • Final Report of the Work Done on Major Research Project
    Final Report of the work done on Major Research Project Granted by University Grant Commission, New Delhi [F.No.-43-472/2014 (SR), w.e.f. 01/07/2015] Studies on Bacterial Colonization and Prevention of Biofilms in Urinary Catheters SUBMITTED BY Dr. NIRAJ GHANWATE Principal Investigator and Assistant Professor Department Of Microbiology Sant Gadge Baba Amravati University Amravati, 444602 Acknowledgement The investigators gratefully acknowledge the University Grants Commission, New Delhi, for sanctioning this major research project and providing financial assistance. Investigators also record their sincere thanks to the Vice Chancellor of Sant Gadge Baba Amravati University, Dr. Murlidhar Chandekar for providing the infrastructural facilities and all the amenities for the conduct of the study. We also express our sincere thanks to the Registrar Dr. Ajay Deshmukh for his timely help and support. We are grateful to the Heads of the departments of Microbiology and Biotechnology for their co-operation rendered in the conduct of the study. The researchers express their sincere thanks to all the administrative staff of the university and the students involved in the project. Principle Investigator Co-investigator Dr. Niraj Ghanwate Dr. P V Thakare Asst. Professor Associate Professor. Dept of Microbiology Dept of Biotechnology S G B Amravati University S G B Amravati University Amravati. Amravati Table of Contents Sr. No. Contents Page no. 1 Introduction and 1-17 Aims and Objectives 2 Review of Literature 18-20 3 Material and Methods 21-45 4 Results and Discussion 46-183 5 Conclusions 184-187 6 Bibliography 189-205 UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No.
    [Show full text]
  • S41467-021-24668-7.Pdf
    ARTICLE https://doi.org/10.1038/s41467-021-24668-7 OPEN In vivo evolution of an emerging zoonotic bacterial pathogen in an immunocompromised human host ✉ A. Launay1, C.-J. Wu1, A. Dulanto Chiang 1, J.-H. Youn2, P. P. Khil1,2 & J. P. Dekker 1,2 Zoonotic transfer of animal pathogens to human hosts can generate novel agents, but the genetic events following such host jumps are not well studied. Here we characterize the mechanisms driving adaptive evolution of the emerging zoonotic pathogen Bordetella hinzii in β fi B. hinzii 1234567890():,; a patient with interleukin-12 receptor 1deciency. Genomic sequencing of 24 isolates cultured from blood and stool over 45 months revealed a clonal lineage that had undergone extensive within-host genetic and phenotypic diversification. Twenty of 24 iso- lates shared an E9G substitution in the DNA polymerase III ε-subunit active site, resulting in a proofreading deficiency. Within this proofreading-deficient clade, multiple lineages with mutations in DNA repair genes and altered mutational spectra emerged and dominated clinical cultures for more than 12 months. Multiple enzymes of the tricarboxylic acid cycle and gluconeogenesis pathways were repeatedly mutated, suggesting rapid metabolic adaptation to the human environment. Furthermore, an excess of G:C > T:A transversions suggested that oxidative stress shaped genetic diversification during adaptation. We propose that inacti- vation of DNA proofreading activity in combination with prolonged, but sub-lethal, oxidative attack resulting from the underlying host immunodeficiency facilitated rapid genomic adap- tation. These findings suggest a fundamental role for host immune phenotype in shaping pathogen evolution following zoonotic infection.
    [Show full text]