2016 AALAS National Meeting Charlotte, North Carolina

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Journal of the American Association for Laboratory Animal Science Vol 55, No 5 Copyright 2016 September 2016 by the American Association for Laboratory Animal Science Pages 606–710 Abstracts of Scientific Presentations 2016 AALAS National Meeting Charlotte, North Carolina Poster Sessions blood collection method called the “one man.” The rat is manually restrained and bled by one person. In preparation for this technique, P1 A Novel Vascular Button Connection Using Combined Tech- rats are handled daily. The increase in handling reduces the amount nologies while Allowing for Social Enrichment by Pair Housing of stress the animal will have while being restrained. To restrain the animal is held in a vertical position and is grasped under each axilla, AJ Hehman*1, A Zuvich1, KA Adams2, D Shuey1 using the thumb and middle finger. The pad of the forefinger is used to pull the head back. To aid in visualizing the jugular vein, the 1Toxicology, Incyte Corporation, Wilmington, DE; 2Laboratory thoracic portion of the rat’s chest is shaved and wiped with an Animal Resources, Incyte Corporation, Wilmington, DE alcohol. Once the vein is located, a 25g needle attached to a 1 or 3mL syringe is inserted into the vessel and a blood sample obtained. After Traditional practice has been to single-house vessel-cannulated the appropriate amount of blood is collected, the needle is removed rodents post surgically to protect exposed exteriorized catheters. A and digital pressure is applied. A sample size of up to 2mLs can be port/protective cap model is available that allows for pair and group obtained. The restraint of the animal (tightness of the skin and housing of cannulated animals and is compatible with a harness/ alignment of the neck) is critical when learning this technique; swivel automated blood sampling system. Our goal was to develop a however, it can be learned easily and because this technique does not vessel-cannulated surgical model that could be socially housed and require any specialized equipment it can easily be implemented. would be compatible with response movement caging. To do this, we Hematomas have been seen on occasion with this method. One other modified the automated blood sample connection to be compatible risk of this procedure is death. This is rarely seen but can occur if the with the available port/protective cap system. A sterile custom vessel is not occluded properly. While both methods produce the connector was designed in collaboration with an industry vendor. same quality of sample; the refinement made to the commonly used Animals were dual jugular cannulated using the available port/ jugular vein blood collection method reduces cost in supplies, protective metal cap to allow for pair or group housing. The newly personnel needed, and the amount of stress on the animal. designed custom connector was primed and attached to the port after removal of the protective metal cap. The modified connector allows P3 Table Restraint Method for Working with Awake Nonhuman the standard extension line from the response movement caging Primates system to easily connect for blood sample withdraws. Studies were * conducted using our standard inhouse study design for pharmacoki- AM Storm , A Vinar, H Eric netic studies with multilple blood sample collections out to 24 hours post dose. All dosing and blood sample collections were performed NIH Division of Veterinary Resources, SoBran, Inc, Bethesda, MD in accordance with an IACUC-approved animal use protocol. The end result is a connector that allows for dosing and timed collections The need to use physical restraint for hands-on procedures involving of high-quality blood samples using a response movement caging nonhuman primates (NHPs) is common throughout the laboratory automated blood sampling system. The modified connector further animal community. Historically, our organization has used chemical allows for enhancement to the welfare of the animals by providing restraint for the vast majority of these procedures. After experiencing social enrichment through pair and group housing without compro- issues related to drug tolerance, anesthesia-related physiologic mising the integrity of the surgical model. complications, and the initiation of protocols requiring multiple procedures per day or multiple procedures over a period of P2 A Unique Blood Collection Method in a Conscious Rat successive days, our organization began a search for a new method of restraint which could increase efficiency, reduce or eliminate the need AM Walters*1, M Hirashima1, K Tsuyama1, S Wakamatsu2 for anesthesia, and improve overall animal welfare. There is an abundance of information related to the various restraint devices and 1SNBL USA Ltd, Everett, WA; 2Shin Nippon Biomedical Laboratories, protocols in the literature. Some of the more common methods LTD (SNBL) Japan, Kagoshima , Japan include chair restraint with pole and collar and the use of squeeze cages. Our organization adopted the use of a lesser known restraint Pharmakokinetics and toxicokinetics are important components of device, the primate restraint table, in combination with cooperative drug discovery and development process. The removal of blood at behavioral training for a variety of hands-on procedures including multiple time points from an animal is required for these evaluations. blood collection and veterinary evaluations. Animals were trained to Blood sampling can be stressful for animals because of the handling, use this device by applying positive reinforcement and desensitiza- restraint, anaesthesia, or discomfort associated with a particular tion techniques allowing the NHPs to participate in research technique. The jugular vein is one of a few collection sites which can procedures while fully awake. This was accomplished by acclimat- be used for multiple blood collections in a conscious rat. Blood ing the NHP to the table, then progressing through a series of steps parameters, supplies, and number of personal required, along with to shape the desired behavior of cooperative restraint and limb stress of the animal were evaluated using 2 different jugular vein extension. Training success was measured by the number of fully puncture methods. The first method requires the use of a jugular acclimated animals to the restraint table prior to the initiation of board for the blood draw and requires minimally 2 people (bleeder medical and research procedures. The implementation of this and holder). The rat is restrained in an unnatural position, which can technique has reduced the labor involved with these procedures by cause stress. The ties used to hold the forepaws can cause damage to eliminating the time needed for anesthesia induction, monitoring the limbs and nerves in this area, causing lameness. Tilting the head and recovery, and the complications associated with the use of of the rats in the head cap can cause haemorrhage to the ears. The rat anesthesia. We recommend this restraint device for laboratories can also lose consciousness. This method is commonly used for serial interested in alternative restraint methods in their research and blood collections in rats. The second method evaluated is a unique medical procedures. 606 Abstracts of scientific papers 2016 AALAS National Meeting P4 Strategies to Increase Time Usage and Accessibility of Environ- P6 Optimization of in Vivo Blood Sampling for Pharmacokinetic mental Enrichment Provided to Socially Housed Primates to Studies Improve Animal Welfare and Wellbeing ST Ulufatu, CK McCaughey* CA Carrier* Safety Assessment, Genentech, San Francisco, CA Covance Research Products, Alice, TX Currently blood collection for preclinical mouse pharmacokinetic Group housing is the standard method for housing nonhuman studies has been refined from rotated retro-orbital (RO) eye bleeds to primates at our facility. Delivering enrichment to all social group a microsampling technique via the “whole blood” or “tail prick” members can be difficult due to the social hierarchies. Often the method. This technique in conjunction with an automated, miniatur- dominant animal will guard and chase off other group members when ized immunoassay platform is now primarily employed such that we enrichment is thrown in. While training can be done to combat some of may obtain a full serum-concentration time profile from each individ- this dominant behavior, we looked at other changes that could be ual mouse. By using this combination, we were able to produce a made to improve our environmental enrichment delivery methods to more robust data set than using the RO method and ELISA. The tail large groups of primates. Simple refinements in our methods were prick method involves warming the tail of a mouse and then using a tried to improve animals’ access to offered enrichment. The novel 27g needle which is injected into the tail vein and quickly taken out. strategies discussed here are piñatas, game feeders on timers, and Approximately 20ul of whole blood is collected from the tail vein via larger frozen forage blocks. Experience with primates reveals a hematocrit glass tube and spun down after 30 minutes of clotting. ingestible items encourage foraging and destructible items prove most The serum is collected by cutting the glass hematocrit and pipetting interesting. As a result, selected new strategies targeted these “likes.” at least 10ul of serum. The serum is then processed with an automat- The most successful enrichment strategies provided the group a longer ed, miniaturized immunoassay. Previous methods used staggered time of use, gave them something to do, and provided foraging RO blood collection which combines data across animals to produce opportunities. The longer it took to empty the item, the sooner the a full pharmacokinetic profile. The limiting factor with RO bleeding dominant animal moved on. This allowed other animals in the group a is the amount (~150ul) and frequency blood is able to be collected. chance to forage. The new methods also provided more accessibility to The microsampling technique offers us the opportunity to take a group-housed primates especially the lower ranking members who smaller amount of blood (~20ul) at every time-point from the same typically only had access to leftovers.
Recommended publications
  • Table S1. Primers Used for PCR Amplification

    Table S1. Primers Used for PCR Amplification

    Table S1. Primers used for PCR amplification Name Primer Sequence (5’-3’) Gene target Taxon target Reference First PCR round DGGE analysis FGPH19 TACGGCAARGGTGGNATHG nifH Diazotrophic (Simonet et al. 1991) POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) 799F AACMGGATTAGATACCCKG 16S rRNA Bacteria (Chelius and Triplett 2001) 1492R TACGGYTACCTTGTTACGACTT 16S rRNA Bacteria (Chelius and Triplett 2001) F203α CCGCATACGCCCTACGGGGGAAAGATTTAT 16S rRNA Alphaproteobacteria (Gomes et al. 2001) F948β CGCACAAGCGGTGGATGA 16S rRNA Betaproteobacteria (Gomes et al. 2001) F243HCG GGATGAGCCCGCGGCCTA 16S rRNA Actinobacteria (Heuer et al. 1997) BACF GGGAAACCGGGGCTAATACCGGAT 16S rRNA Firmicutes (Garbeva et al. 2003) Second PCR round DGGE analysis POLF-GC CGCCCGCCGCGCCCCGCGCCCGGCCCGCCCCCG nifH Diazotrophic (Poly et al. 2001) CCCCTGCGAYCCSAARGCBGACTC AQER GACGATGTAGATITCCTG nifH Diazotrophic (Poly et al. 2001) F968-GC CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGC 16S rRNA Bacteria (Heuer et al. 1999) ACGGGGGGAACGAAGAACCTTAC R1401 CGGTGTGTACAAGACCC 16S rRNA Bacteria (Heuer et al. 1997) qPCR analysis POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) POLF TGCGAYCCSAARGCBGACTC nifH Diazotrophic (Poly et al. 2001) 6S-27F AGAGTTTGATCCTGGCTCAG 16S rRNA Bacteria Bulgari et al., 2014 338R GCTGCCTCCCGTAGGAGT 16S rRNA Bacteria Bulgari et al., 2014 Table 2. Primers used for Ion Torrent pyrosequencing analysis. Primer Primer sequence (5´-3´) Reference 967F-PP CNACGCGAAGAACCTTANC (Jünemann et al. 2012) 967F-UC1 CAACGCGAAAAACCTTACC (Jünemann et al. 2012) 967F-UC2 CAACGCGCAGAACCTTACC (Jünemann et al. 2012) 967F-UC3 ATACGCGARGAACCTTACC (Jünemann et al. 2012) 967F-AQ CTAACCGANGAACCTYACC (Jünemann et al. 2012) 1046R CGACAGCCATGCANCACCT (Jünemann et al. 2012) 1046R-PP CGACAACCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ1 CGACGGCCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ2 CGACGACCATGCANCACCT (Jünemann et al. 2012) Table S3. Alpha diversity indices. Statistical analysis of the total endophytic and diazotrophic endophytic bacterial community associated with sweet sorghum cv.
  • Cystic Fibrosis Mice Develop Spontaneouschronic Bordetella

    Cystic Fibrosis Mice Develop Spontaneouschronic Bordetella

    ISSN 2470-3176 SciO p Forschene n HUB for Sc i e n t i f i c R e s e a r c h Journal of Infectious Pulmonary Diseases Research Article Volume: 3.2 Open Access Received date: 11 Oct 2017; Accepted date: 28 Cystic Fibrosis Mice Develop Spontaneous Oct 2017; Published date: 02 Nov 2017. Chronic Bordetella Airway Infections Citation: Darrah R, Bonfield T, LiPuma JJ, Litman P, Hodges CA, et al. (2017) Cystic Fibrosis Mice Darrah R1*, Bonfield T2, LiPuma JJ3, Litman P1, Hodges CA4, Jacono F5 and Develop Spontaneous Chronic Bordetella Airway Drumm M6 Infections. J Infect Pulm Dis 3(2): doi http://dx.doi. org/10.16966/2470-3176.128 1Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA 2Department of Pediatrics, Case Western Reserve University, Cleveland Ohio, USA Copyright: © 2017 Darrah R, et al. This is an 3Department of Pediatrics and Communicable Diseases, University of Michigan Medical School, Ann open-access article distributed under the terms Arbor, Michigan, USA of the Creative Commons Attribution License, 4Departments of Radiology, Biomedical Engineering, and Pediatrics, Case Western Reserve University, which permits unrestricted use, distribution, and Cleveland Ohio, USA reproduction in any medium, provided the original 5Department of Medicine, Case Western Reserve University, and Louis Stokes VA Cleveland Medical author and source are credited. Center, USA 6Departments of Pediatrics and Genetics Genome Sciences, Case Western Reserve University, Cleveland Ohio, USA *Corresponding author: Rebecca Darrah, Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA, Tel: 216-368-4911; E-mail: [email protected] Abstract Chronic pulmonary disease and infection is the primary cause of morbidity and mortality in people with cystic fibrosis (CF).
  • Bordetella Petrii Clinical Isolate Isolates of This Species Have Been Previously Reported from 4

    Bordetella Petrii Clinical Isolate Isolates of This Species Have Been Previously Reported from 4

    routine laboratory protocols. Initial susceptibility testing Bordetella petrii using disk diffusion indicated apparent susceptibility of the isolate to erythromycin, gentamicin, ceftriaxone, and Clinical Isolate piperacillin/tazobactam. The isolate was resistant to amox- icillin, co-amoxiclav, tetracycline, clindamycin, ciproflo- Norman K. Fry,* John Duncan,* Henry Malnick,* xacin, and metronidazole. After initial sensitivity results, a Marina Warner,* Andrew J. Smith,† 6-week course of oral clarithromycin (500 mg, 8 hourly) Margaret S. Jackson,† and Ashraf Ayoub† was begun. We describe the first clinical isolate of Bordetella petrii At follow-up appointments 3 months and 6 months from a patient with mandibular osteomyelitis. The only pre- after antimicrobial drug therapy ceased, clinical and radi- viously documented isolation of B. petrii occurred after the ographic findings were not unusual, and the infected area initial culture of a single strain from an environmental healed successfully. Despite the successful clinical out- source. come, the isolate was subsequently shown to be resistant to clarithromycin in vitro (Table). Improvement of the 67-year-old man visited an emergency dental clinic, osteomyelitis may also have been facilitated by the biopsy Awhere he complained of toothache in the lower right procedure, during which a sequestrum of bone was mandibular quadrant. Examination showed a root-filled removed. lower right canine tooth that was mobile and tender to per- The gram-negative bacillus (designated strain cussion. The tooth was extracted uneventfully under local GDH030510) was submitted to the Health Protection anesthesia. The patient returned after several days with Agency, Centre for Infections, London, for identification. pain at the extraction site. A localized alveolar osteitis was Preliminary tests results were consistent with those diagnosed, and local debridement measures were institut- described for members of the genus Bordetella.
  • Vitek®2 Id & Ast Cards

    Vitek®2 Id & Ast Cards

    ® VITEK 2 ID & AST CARDS Reliable • safe • rapid RESULTS YOU CAN TRUST FOCUS The VITEK 2 ADVANCED EXPERT SYSTEM™ software lets you focus your time where it is most required in ® the lab. The ADVANCED EXPERT SYSTEM™ validates VITEK 2 ID & AST CARDS ON WHAT every result and quickly identi es those truly needing a Microbiologist’s valuable time and attention. This allows the majority of results to be quickly and con dently reported to clinicians without need for MATTERS 2,8,11,13,15 review Rapid, Flexible, E cient EFFICIENCY THROUGH AUTOMATION VITEK 2 cards o er the shortest preparation time in the industry, considerably reducing labor Each self-contained, costs1,3,7,9,10,14. They also have the least contaminated waste, o ering up to 64% cost savings for disposal disposable test card compared to other systems6,10,12.The cards provide provides rapid and INNOVATIVE AND FLEXIBLE DESIGN increased standardization and automated, same-day accurate species- results helping clinicians to optimise antibiotic level identi cation or • Each card contains microwells with biochemicals or antimicrobials therapy sooner2,3. susceptibility results with • Ready and simple to use accurate MICs* based on • Pre-applied barcodes for maximum traceability • EUCAST and CLSI compliant AST formulations available Designed for VITEK 2 automated systems, VITEK 2 reference CLSI** and identi cation (ID) and susceptibility (AST) cards provide ISO *** MIC methods UP TO 50% FEWER PREPARATION STEPS THAN and EUCAST****, OTHER SYSTEMS,3,9,10: reliable and accurate results for clinically important US FDA*****, bacteria and yeasts1,2,4,5 or CLSI® breakpoint • Inoculation with a simple, standardised suspension of organism in saline interpretations1,3,4,5,7,8,10.
  • Which Organisms Are Used for Anti-Biofouling Studies

    Which Organisms Are Used for Anti-Biofouling Studies

    Table S1. Semi-systematic review raw data answering: Which organisms are used for anti-biofouling studies? Antifoulant Method Organism(s) Model Bacteria Type of Biofilm Source (Y if mentioned) Detection Method composite membranes E. coli ATCC25922 Y LIVE/DEAD baclight [1] stain S. aureus ATCC255923 composite membranes E. coli ATCC25922 Y colony counting [2] S. aureus RSKK 1009 graphene oxide Saccharomycetes colony counting [3] methyl p-hydroxybenzoate L. monocytogenes [4] potassium sorbate P. putida Y. enterocolitica A. hydrophila composite membranes E. coli Y FESEM [5] (unspecified/unique sample type) S. aureus (unspecified/unique sample type) K. pneumonia ATCC13883 P. aeruginosa BAA-1744 composite membranes E. coli Y SEM [6] (unspecified/unique sample type) S. aureus (unspecified/unique sample type) graphene oxide E. coli ATCC25922 Y colony counting [7] S. aureus ATCC9144 P. aeruginosa ATCCPAO1 composite membranes E. coli Y measuring flux [8] (unspecified/unique sample type) graphene oxide E. coli Y colony counting [9] (unspecified/unique SEM sample type) LIVE/DEAD baclight S. aureus stain (unspecified/unique sample type) modified membrane P. aeruginosa P60 Y DAPI [10] Bacillus sp. G-84 LIVE/DEAD baclight stain bacteriophages E. coli (K12) Y measuring flux [11] ATCC11303-B4 quorum quenching P. aeruginosa KCTC LIVE/DEAD baclight [12] 2513 stain modified membrane E. coli colony counting [13] (unspecified/unique colony counting sample type) measuring flux S. aureus (unspecified/unique sample type) modified membrane E. coli BW26437 Y measuring flux [14] graphene oxide Klebsiella colony counting [15] (unspecified/unique sample type) P. aeruginosa (unspecified/unique sample type) graphene oxide P. aeruginosa measuring flux [16] (unspecified/unique sample type) composite membranes E.
  • Table S5. the Information of the Bacteria Annotated in the Soil Community at Species Level

    Table S5. the Information of the Bacteria Annotated in the Soil Community at Species Level

    Table S5. The information of the bacteria annotated in the soil community at species level No. Phylum Class Order Family Genus Species The number of contigs Abundance(%) 1 Firmicutes Bacilli Bacillales Bacillaceae Bacillus Bacillus cereus 1749 5.145782459 2 Bacteroidetes Cytophagia Cytophagales Hymenobacteraceae Hymenobacter Hymenobacter sedentarius 1538 4.52499338 3 Gemmatimonadetes Gemmatimonadetes Gemmatimonadales Gemmatimonadaceae Gemmatirosa Gemmatirosa kalamazoonesis 1020 3.000970902 4 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas indica 797 2.344876284 5 Firmicutes Bacilli Lactobacillales Streptococcaceae Lactococcus Lactococcus piscium 542 1.594633558 6 Actinobacteria Thermoleophilia Solirubrobacterales Conexibacteraceae Conexibacter Conexibacter woesei 471 1.385742446 7 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas taxi 430 1.265115184 8 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas wittichii 388 1.141545794 9 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas sp. FARSPH 298 0.876754244 10 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sorangium cellulosum 260 0.764953367 11 Proteobacteria Deltaproteobacteria Myxococcales Polyangiaceae Sorangium Sphingomonas sp. Cra20 260 0.764953367 12 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas panacis 252 0.741416341
  • Insights Into the Pathogenicity of Burkholderia Pseudomallei

    Insights Into the Pathogenicity of Burkholderia Pseudomallei

    REVIEWS Melioidosis: insights into the pathogenicity of Burkholderia pseudomallei W. Joost Wiersinga*, Tom van der Poll*, Nicholas J. White‡§, Nicholas P. Day‡§ and Sharon J. Peacock‡§ Abstract | Burkholderia pseudomallei is a potential bioterror agent and the causative agent of melioidosis, a severe disease that is endemic in areas of Southeast Asia and Northern Australia. Infection is often associated with bacterial dissemination to distant sites, and there are many possible disease manifestations, with melioidosis septic shock being the most severe. Eradication of the organism following infection is difficult, with a slow fever-clearance time, the need for prolonged antibiotic therapy and a high rate of relapse if therapy is not completed. Mortality from melioidosis septic shock remains high despite appropriate antimicrobial therapy. Prevention of disease and a reduction in mortality and the rate of relapse are priority areas for future research efforts. Studying how the disease is acquired and the host–pathogen interactions involved will underpin these efforts; this review presents an overview of current knowledge in these areas, highlighting key topics for evaluation. Melioidosis is a serious disease caused by the aerobic, rifamycins, colistin and aminoglycosides), but is usually Gram-negative soil-dwelling bacillus Burkholderia pseu- susceptible to amoxicillin-clavulanate, chloramphenicol, domallei and is most common in Southeast Asia and doxycycline, trimethoprim-sulphamethoxazole, ureido- Northern Australia. Melioidosis is responsible for 20% of penicillins, ceftazidime and carbapenems2,4. Treatment all community-acquired septicaemias and 40% of sepsis- is required for 20 weeks and is divided into intravenous related mortality in northeast Thailand. Reported cases are and oral phases2,4. Initial intravenous therapy is given likely to represent ‘the tip of the iceberg’1,2, as confirmation for 10–14 days; ceftazidime or a carbapenem are the of disease depends on bacterial isolation, a technique that drugs of choice.
  • Identification of Bordetella Spp. in Respiratory Specimens From

    Identification of Bordetella Spp. in Respiratory Specimens From

    504 Clinical Microbiology and Infection, Volume 14 Number 5, May 2008 isolates of extended-spectrum-beta-lactamase-producing Original Submission: 27 October 2007; Revised Sub- Shigella sonnei. Ann Trop Med Parasitol 2007; 101: 511–517. mission: 5 December 2007; Accepted: 19 December 21. Rice LB. Controlling antibiotic resistance in the ICU: 2007 different bacteria, different strategies. Cleve Clin J Med 2003; 70: 793–800. Clin Microbiol Infect 2008; 14: 504–506 22. Boyd DA, Tyler S, Christianson S et al. Complete nucleo- 10.1111/j.1469-0691.2008.01968.x tide sequence of a 92-kilobase plasmid harbouring the CTX-M-15 extended spectrum b-lactamase involved in an outbreak in long-term-care facilities in Toronto, Canada. Cystic fibrosis (CF) is an autosomal recessive Antimicrob Agents Chemother 2004; 48: 3758–3764. disease, characterised by defective chloride ion channels that result in multi-organ dysfunction, most notably affecting the respiratory tract. The RESEARCH NOTE alteration in the pulmonary environment is asso- ciated with increased susceptibility to bacterial infection. Recent advances in bacterial taxonomy and improved microbial identification systems Identification of Bordetella spp. in have led to an increasing recognition of the respiratory specimens from individuals diversity of bacterial species involved in CF lung with cystic fibrosis infection. Many such species are opportunistic T. Spilker, A. A. Liwienski and J. J. LiPuma human pathogens, some of which are rarely found in other human infections [1]. Processing Department of Pediatrics and Communicable of CF respiratory cultures therefore employs Diseases, University of Michigan Medical selective media and focuses on detection of School, Ann Arbor, MI, USA uncommon human pathogens.
  • <I>MICROCYSTIS</I> BLOOMS

    <I>MICROCYSTIS</I> BLOOMS

    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 8-2018 MOLECULAR CHARACTERIZATION OF FACTORS CONSTRAINING THE SUCCESS AND TOXICITY OF MICROCYSTIS BLOOMS Lauren Elisabeth Krausfeldt University of Tennessee, [email protected] Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss Recommended Citation Krausfeldt, Lauren Elisabeth, "MOLECULAR CHARACTERIZATION OF FACTORS CONSTRAINING THE SUCCESS AND TOXICITY OF MICROCYSTIS BLOOMS. " PhD diss., University of Tennessee, 2018. https://trace.tennessee.edu/utk_graddiss/5030 This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a dissertation written by Lauren Elisabeth Krausfeldt entitled "MOLECULAR CHARACTERIZATION OF FACTORS CONSTRAINING THE SUCCESS AND TOXICITY OF MICROCYSTIS BLOOMS." I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Doctor of Philosophy, with a major in Microbiology. Steven W. Wilhelm, Major Professor We have read this dissertation and recommend its acceptance: Alison Buchan, Shawn R. Campagna, Karen G. Lloyd Accepted for the Council: Dixie L. Thompson Vice Provost and Dean of the Graduate School (Original signatures are on file with official studentecor r ds.) MOLECULAR CHARACTERIZATION OF FACTORS CONSTRAINING THE SUCCESS AND TOXICITY OF MICROCYSTIS BLOOMS A Dissertation Presented for the Doctor of Philosophy Degree The University of Tennessee, Knoxville Lauren Elisabeth Krausfeldt August 2018 Copyright © 2018 by Lauren E.
  • The Failure of the Three R's and the Future of Animal Experimentation

    The Failure of the Three R's and the Future of Animal Experimentation

    University of Chicago Legal Forum Volume 2006 | Issue 1 Article 7 Reduce, Refine, Replace: The aiF lure of the Three R's and the Future of Animal Experimentation Darian M. Ibrahim [email protected] Follow this and additional works at: http://chicagounbound.uchicago.edu/uclf Recommended Citation Ibrahim, Darian M. () "Reduce, Refine, Replace: The aiF lure of the Three R's and the Future of Animal Experimentation," University of Chicago Legal Forum: Vol. 2006: Iss. 1, Article 7. Available at: http://chicagounbound.uchicago.edu/uclf/vol2006/iss1/7 This Article is brought to you for free and open access by Chicago Unbound. It has been accepted for inclusion in University of Chicago Legal Forum by an authorized administrator of Chicago Unbound. For more information, please contact [email protected]. Reduce, Refine, Replace: The Failure of the Three R's and the Future of Animal Experimentation DarianM Ibrahimt The debate in animal ethics is defined by those who advocate the regulation of animal use and those who advocate its aboli- tion.' The animal welfare approach, which focuses on regulating animal use, maintains that humans have an obligation to treat animals "humanely" but may use them for human purposes.2 The animal rights approach, which focuses on abolishing animal use, argues that animals have inherent moral value that is inconsis- tent with us treating them as property.3 The animal welfare approach is the dominant model of ani- mal advocacy in the United States.4 Animal experimentation provides a fertile ground for testing this model because a unique confluence of factors make experimentation appear susceptible to meaningful regulation.
  • PDF For- Tries Reported Holding the Material in Only 1 Institute

    PDF For- Tries Reported Holding the Material in Only 1 Institute

    Peer-Reviewed Journal Tracking and Analyzing Disease Trends pages 2117–2292 EDITOR-IN-CHIEF D. Peter Drotman Associate Editors EDITORIAL BOARD Paul Arguin, Atlanta, Georgia, USA Dennis Alexander, Addlestone, Surrey, UK Charles Ben Beard, Ft. Collins, Colorado, USA Timothy Barrett, Atlanta, Georgia, USA Ermias Belay, Atlanta, Georgia, USA Barry J. Beaty, Ft. Collins, Colorado, USA David Bell, Atlanta, Georgia, USA Martin J. Blaser, New York, New York, USA Sharon Bloom, Atlanta, GA, USA Christopher Braden, Atlanta, Georgia, USA Mary Brandt, Atlanta, Georgia, USA Arturo Casadevall, New York, New York, USA Corrie Brown, Athens, Georgia, USA Kenneth C. Castro, Atlanta, Georgia, USA Michel Drancourt, Marseille, France Louisa Chapman, Atlanta, Georgia, USA Paul V. Effler, Perth, Australia Thomas Cleary, Houston, Texas, USA David Freedman, Birmingham, Alabama, USA Vincent Deubel, Shanghai, China Peter Gerner-Smidt, Atlanta, Georgia, USA Ed Eitzen, Washington, DC, USA Stephen Hadler, Atlanta, Georgia, USA Daniel Feikin, Baltimore, Maryland, USA Nina Marano, Nairobi, Kenya Anthony Fiore, Atlanta, Georgia, USA Martin I. Meltzer, Atlanta, Georgia, USA Isaac Chun-Hai Fung, Statesboro, Georgia, USA David Morens, Bethesda, Maryland, USA Kathleen Gensheimer, College Park, MD, USA J. Glenn Morris, Gainesville, Florida, USA Duane J. Gubler, Singapore Richard L. Guerrant, Charlottesville, Virginia, USA Patrice Nordmann, Fribourg, Switzerland Scott Halstead, Arlington, Virginia, USA Didier Raoult, Marseille, France Katrina Hedberg, Portland, Oregon, USA Pierre Rollin, Atlanta, Georgia, USA David L. Heymann, London, UK Frank Sorvillo, Los Angeles, California, USA Charles King, Cleveland, Ohio, USA David Walker, Galveston, Texas, USA Keith Klugman, Seattle, Washington, USA Senior Associate Editor, Emeritus Takeshi Kurata, Tokyo, Japan Brian W.J. Mahy, Bury St.
  • (Gekko Gecko LINNAEUS, 1758) Saliva on Angiogenesis

    (Gekko Gecko LINNAEUS, 1758) Saliva on Angiogenesis

    Jurnal Biologi Indonesia 13(2): 253-260 (2017) Effect of Tokay Gecko (Gekko gecko LINNAEUS, 1758) Saliva on Angiogenesis During Wound Healing Phase of Autotomized Tail in Common Sun Skink (Eutropis multifasciata KUHL, 1820) (Pengaruh Saliva Tokek (Gekko gecko, LINNEAUS 1758) Terhadap Angiogenesis Pada Fase Penyembuhan Luka Ekor Kadal Kebun (Eutropis multifasciata KUHL, 1820) Setelah Autotomi) Nurul Inayah1,2, Nyoman Puniawati Soesilo2 & Rarastoeti Pratiwi3 (1)Zoology Division, Research Center for Biology-Indonesian Institute of Sciences (LIPI) (2,3) Faculty of Biology, Gadjah Mada University Email: [email protected] Received: December 2016, Accepted: June 2017 ABSTRACT The purpose of this study was to investigate the effect of Tokay gecko saliva on morphology and angiogenesis response on the healing process of skink tail wound and also to characterize the protein profile of Gecko saliva. Twelve skinks were autotomized and wound surface of tail smeared by young gecko saliva, adult gecko saliva, and human’s saliva twice per day and control. The morphological changes of the wound surface were observed. The angiogenesis response was observed in vitro using Chorioallantois Membrane (CAM) of the ninth day's chick embryos. Protein profile of gecko saliva analyzed with SDS-PAGE. Generally, treated wound showed a better healing. Young gecko saliva able to stimulate angiogenesis in wound healing stage of sun skink tail after autotomy. Saliva protein of young and adult Gecko differences was not only in the size (or density) but also in the number of the bands. The young and adult Gecko revealed a striking consistency of protein patterns, indicating a profound physiological stability of the whole saliva.