Final Report of the Work Done on Major Research Project

Final Report of the work done on Major Research Project

Granted by University Grant Commission, New Delhi [F.No.-43-472/2014 (SR), w.e.f. 01/07/2015]

Studies on Bacterial Colonization and

Prevention of Biofilms in Urinary

Catheters

SUBMITTED BY Dr. NIRAJ GHANWATE Principal Investigator and Assistant Professor Department Of Microbiology Sant Gadge Baba Amravati University Amravati, 444602

Acknowledgement

The investigators gratefully acknowledge the University Grants Commission, New Delhi, for sanctioning this major research project and providing financial assistance. Investigators also record their sincere thanks to the Vice Chancellor of Sant Gadge Baba Amravati University, Dr. Murlidhar Chandekar for providing the infrastructural facilities and all the amenities for the conduct of the study. We also express our sincere thanks to the Registrar Dr. Ajay Deshmukh for his timely help and support. We are grateful to the Heads of the departments of Microbiology and Biotechnology for their co-operation rendered in the conduct of the study. The researchers express their sincere thanks to all the administrative staff of the university and the students involved in the project.

Principle Investigator Co-investigator Dr. Niraj Ghanwate Dr. P V Thakare Asst. Professor Associate Professor. Dept of Microbiology Dept of Biotechnology S G B Amravati University S G B Amravati University Amravati. Amravati

Table of Contents

Sr. No. Contents Page no.

1 Introduction and 1-17 Aims and Objectives

2 Review of Literature 18-20

3 Material and Methods 21-45

4 Results and Discussion 46-183

5 Conclusions 184-187

6 Bibliography 189-205

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

1. Introduction 1.1. Nosocomial Infections 'Nosocomial' is referred as any disease acquired by the patient under medical care (Krishna-Prakash, 2014). It was described as "healthcare-associated infections" the infections caused by the prolonged hospital stay, a major risk factor for serious health issues leading to death (Bursaferro, Arnoldo, Cattani, Fabbro, Cookson, & Gallagher, 2015) and about 75% of the burden of these infections is present in developing countries (Obiero, Seale, & Berkley, 2015). Asymptomatic patients may be considered infected if these pathogens are found in the body fluids or at a sterile body site, such as blood or cerebrospinal fluid (Murray, Rosenthal, & Pfaller, Medical Microbiology, 2005). Infections that are acquired by hospital staff, visitors or other healthcare personnel may also be considered as nosocomial (Lolekha, Ratanaubol, & Manu, 1981). Hospital-acquired infections appeared before the origination of hospitals and became a health problem during the miraculous antibiotic era. Due to these infections, not only the costs but also the use of antibiotics increased with an extended hospitalization. This resulted in elevated morbidity and mortality. Studies conducted in different parts of the world show that in North America and Europe 5– 10% of all hospitalizations result in nosocomial infections, while Latin America, Sub- Saharan Africa, and Asia show more than 40% hospitalizations with nosocomial infections (World Health Organization Prevention of hospital-acquired infections: a practical guide., 2015). Any organisms can cause Nosocomial infections but some pathogens are particularly responsible for hospital-acquired infections. Different 13 types with 50 infection sites of nosocomial infections have been classified based on biological and clinical criteria by National Healthcare Safety Network with Center for Disease Control for surveillance. The most commonly included in the site are urinary tract infections, surgical and soft tissue infections, gastroenteritis, meningitis and respiratory infections (Raka, Zoutman, Mulliqi, Krasniqi, Dedushaj, & Raka, 2006) . A change regarding nosocomial infection sites can be easily detected with time due to the elevated use of cancer chemotherapy, advancement in organ transplantation, immunotherapy and invasive techniques for diagnostic and therapeutic purposes. The perfect example of this can be seen in the case of pneumonia as the prevalence of nosocomial pneumonia increased from 17% to 30% during five years (Duque, Ferreira, Cezario, & Filho, 2007). Nosocomial infections 1

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

mostly affect immunocompromised patients because of age and underlying diseases, or medical or surgical treatments. Because of aging of our population and increasingly aggressive medical and therapeutic interventions, including implanted foreign bodies, xenotransplantations and organ transplantations have created a cohort of, particularly vulnerable persons. Resulting, the highest infection rate in intensive care unit patients (Fridkin, Wekbel, & Weinstein, 1997).

1.2. Urinary tract infections Urinary infections are the most common nosocomial infection and 80% of infections are associated with the use of an indwelling bladder catheter (Mayon-White, 1988). The bacteria responsible for infection area rise from the gut flora, either normal or acquired in the hospital. CAUTI are associated with increased morbidity and mortality and are collectively the most common cause of secondary bloodstream infections. Risk factors for developing a CAUTI include prolonged catheterization, female gender, older age and diabetes (Chenoweth, Gould, & Saint, 2014). Urinary tract infections are caused by both Gram-negative and Gram-positive bacteria, as well as by certain fungi. The most common uropathogen for both uncomplicated and complicated urinary tract infection is uropathogenic Escherichia coli. For the agents involved in uncomplicated UTIs, UPEC is followed in prevalence by Klebsiella pneumoniae, Staphylococcus saprophyticus, Enterococcus faecalis, group B Streptococcus, Proteus mirabilis, Pseudomonas aeruginosa, Staphylococcus aureus and Candida spp. (Nielubowicz & Mobley, 2010) (Kline, Schwartz, Lewis, Hultgren, & Lewis, 2011) (Foxman, Urinary tract infection syndromes: occurrence, recurrence, bacteriology, risk factors, and disease burden., 2014). For complicated UTIs, the order of prevalence for causative agents, following UPEC as most common, is Enterococcus spp., Klebsiella pneumoniae, Candida spp., Staphylococcus aureus, P. mirabilis, Pseudomonas. aeruginosa (Fisher, Kavanagh, Sobel, Kauffman, & Newman, 2011) (Chen, Ko, & Hsueh, 2013). Uropathogens use different mechanisms for survival in response to stresses in the bladder such as starvation and immune responses. By forming biofilm and undergoing morphological changes, uropathogens can persist and cause recurrent infections (Horvath, 2011) (Danese, Pratt, Dove, & Kolter, 2000) (Kostakioti, Hadjifrangiskou, & Hultgren, 2013).

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

1.3. Urinary catheter When the patients are immunocompromised or bedridden the urinary catheter is used for the easy urine drainage in hospitals. This urinary catheter is a Foley catheter a thin, sterile tube that medical personnel insert into a patient's bladder to drain urine. This catheter can be left in place for many days and is also known as an indwelling catheter. Medical personnel insert a Foley catheter into the patient's urethra and thread it into the bladder. An inflatable balloon filled with sterile water at one end of the catheter holds the catheter in place in the patient's bladder. The urine in the patient's bladder drains through the thin, sterile tube of the Foley catheter into a disposable bag that is emptied when full. The procedure to insert a catheter is called catheterization.

Figure 1.1. Foley urinary catheters with labeled different section

Figure 1.2. Foleys urinary catheters

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Figure 1.3. Foley urinary Catheters with inflated balloon

Even with their immense benefits, there have been several complications that have been reported as a result of using catheters. Indwelling catheters have been noted to cause urinary tract infections. Symptoms of urinary tract infections include fever, bloody urine, headache, strong smelling urine, chills and burning in the genital area. Other complications include kidney damage, bladder stones, kidney infections and allergic reactions. When using a catheter, it is important to clean it regularly to avoid the risk of contracting a urinary tract infection. Complications due to frequent use of urinary catheters include infection, bladder spasms, catheter encrustations, and retained catheters. This is more so with long-term catheter usage. Even with sophisticated and improved nursing care, these issues still cause much debility and inconvenience to the patient. Catheter encrustations are frequently encountered and can be challenging to the attending urologist managing them. These can be classified as either intraluminal or extraluminal. The encrustations on the outside surface of the catheter can break away into the bladder, forming a bladder calculi and infections on catheter removal. A catheter and the encrustations are paramount in preventing further complications to the patient. Encrustation can impair deflation of the balloon and, therefore, make it impossible to remove the catheter.

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

1.3.1. History The earliest precursor to the present day Foley catheter is documented in 3000 B.C. It is believed that Egyptians used metal pipes to perform bladder catheterizations. As long year back, hollow reeds and pipes were used in cadavers to study the form and function of cardiac valves. The Foley catheter came into existence in the 1930s. Frederick E. B. Foley began to experiment with different catheters of the time and realized that urinary catheters would easily slip out of the bladder because there was no way to hold them in place. Foley experimented with different methods How a Foley catheter is inserted in to urinary tract of the male and female and securing the catheter until he came up with the idea of attaching a balloon-like device to the end of the catheter. The device would then be able to be placed and then inflated from the outside. By 1934, Foley catheters were on the market. As compare to other catheter the Foley catheter remains relatively unchanged in design today. The name comes from the designer, Frederic Foley, a surgeon who worked in Boston, Massachusetts in the 1930s. (Foley, 1937) Original design was acquire by C. R. Bard, Inc. of Murray Hill, New Jersey, who designed the first prototypes and named them in honor of the surgeon. The relative size of a Foley catheter is described using French units (F) (Foley, 1937). The most common sizes are 10 F to 28 F. 1 F is equivalent to 0.33 mm = .013" = 1/77" of diameter.

Foley catheters come in several types • Coude (French for elbowed) catheters have a 45° bend at the tip that facilitates easier passage through an enlarged prostate. • Councill tip catheters (Foley, 1937) have a small hole at the tip so they can be passed over a wire. • Three-way or triple lumen catheters have a third channel used to infuse sterile saline or another irrigating solution. These are used primarily after surgery on the bladder or prostate, to wash away blood and blood clots. Foley catheters are made of latex or silicone rubber. Silicone rubber catheters are believed to be superior to latex catheters, as silicone is more biocompatible, causes less cell death, less likely to become encrusted, and more resistant to bacterial 5

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR) colonization. The catheter can either have two or three outlets. In a two-way urinary catheter of Foley, one outlet acts a urine output and the other inflates the balloon. A three-way Foley catheter has the same function as a two-way catheter but uses the third outlet for bladder irrigation. Foley catheters are of different size from 12 fr to 30 fr (4 to 10 mm) in diameter, with the standard being 14 fr (4.6 mm). The balloon itself varies in size from 5 cc to 30 cc, depending on the needed use. The balloon can either be filled with sterile water or air. The catheter can also be attached to a drainage bag.There are three main types of catheters (Ennis, Wierbicky, & Nesathurai, 2015) (Panicker, DasGupta, & Batla, 2016) (Tailly & Denstedt, 2016) (https://medlineplus.gov/ency/article/003981.htm)

1.3.2. Indwelling urethral catheters (urethral or suprapubic catheters) An indwelling urinary catheter is one that is left in the bladder for a short time or a long time. An indwelling urinary catheter collects urine in to a drainage bag. The bag has a valve that can be opened to allow urine to flow out. Some of these bags can be secured to your leg. This allows you to wear the bag under your clothes. An indwelling urinary catheter has a balloon inflated on the end of it due to which the catheter cannot slide out of the bladder. When the catheter needs to be removed, the balloon is deflated.

1.3.3. External catheters (Condom catheters) Men can use condom catheters for incontinence. There is no tube placed inside the penis. Instead, of it condom-like device is placed over the penis. A tube leads from this device to a drainage bag. Condom catheter need to be changed every day.

1.3.4. Short-term catheters (Intermittent catheters) An intermittent catheter when only need to use a catheter sometimes or do not want to wear a bag. Insert the catheter to drain out the urine from bladder and then remove it. This can be done only once or several times a day.

1.3.5. Drainage bags A catheter is most often attached to a drainage bag. Keep the drainage bag lower than bladder so that urine does not flow back up into the bladder. Empty the drainage 6

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR) device when it is about one-half full and at bedtime. Always wash hands with soap and water before emptying the bag.

Figure 1.4. Urinary catheter kit

In an emergency department, indwelling urinary catheters are most frequently used to assist people who cannot urinate. (Holland, Sandhu, Ghufoor, & Frosh, 2001). Indications for using a catheter include providing relief when there is urinary retention, monitoring urine output for critically ill persons, and managing urination during surgery, and providing end-of-life care. (Holland, Sandhu, Ghufoor, & Frosh, 2001). Foley catheters are used on patients who are anesthetized or sedated for surgery or other medical care, incontinent, whose prostate is enlarged to the point that urine flow from the bladder is cut off, acute urinary retention, who are unable due to paralysis or physical injury to use either standard toilet facilities or urinals, urethral surgeries, ureterectomy, kidney disease whose urine output must be constantly and accurately measured, Before and after cesarean section, Before and after hysterectomy, genital injury, physical weakness and whose urine output must be constantly measured, fibromyalgia who cannot control their bladder

1.4. Adverse effects Urinary tract infections are some of the most common bacterial infections, affecting 150 million people each year worldwide. (Nielubowicz & Mobley, 2010) (Foxman, Urinary tract infection syndromes: occurrence, recurrence, bacteriology, risk factors,

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR) and disease burden., 2014) (Foxman, The epidemiology of urinary tract infection., 2010) . Clinically, UTIs are categorized as uncomplicated or complicated. Uncomplicated UTIs typically affect individuals who are otherwise healthy and have no structural or neurological urinary tract abnormalities (Hooton, 2012) (Nielubowicz & Mobley, 2010) these infections are differentiated into lower UTIs (cystitis) and upper UTIs (pyelonephritis) (Hannan, Totsika, Mansfield, Moore, Schembri, & Hultgren, 2012) (Hooton, 2012). Several risk factors are associated with cystitis, including female gender, a prior UTI, sexual activity, vaginal infection, diabetes, obesity and genetic susceptibility (Hannan, Totsika, Mansfield, Moore, Schembri, & Hultgren, 2012) (Foxman, 2014). Complicated urinary tract infections associated with factors that compromise the urinary tract or host defense, including urinary obstruction, urinary retention caused by neurological disease, immunosuppression, renal failure, renal transplantation, pregnancy and the presence of foreign bodies such as calculi, indwelling catheters or other drainage devices (Lichtenberger & Hooton, 2008) (Levison & Kaye, 2013). In the United States, 70–80% of complicated UTIs are attributable to indwelling catheters, accounting for 1 million cases per year. CAUTIs are associated with increased morbidity and mortality, and are collectively the most common cause of secondary bloodstream infections. Risk factors for developing a CAUTI include prolonged catheterization, female gender, older age and diabetes (Chenoweth, Gould, & Saint, 2014).

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Figure 1.5. Infection and resistance in urological practice. (Zowawi et al., 2015) Biofilms and morphological plasticity a | Antibiotic resistance mechanisms in Gram-negative bacteria. These include antibiotic hydrolysis by β-lactamase enzymes (including carbapenemases) or other antibiotic-modifying enzymes (for example, against aminoglycosides). Porin loss or mutation can reduce antibiotic permeability; increased expression or activity of efflux pumps can prevent an antibiotic reaching its target site; a modified drug target can stop antibiotics (for example, quinolones) binding to the active site; mutation in

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

lipopolysaccharide can render the bacteria resistant to the polymyxin group of antibiotics. b | UPEC pathogenesis. UPEC attaches to and invade uroepithelial cells and form intracellular bacterial communities. These aid evasion of the host immune system and provide some protection against antibiotic exposure. The formation of a quiescent reservoir within the transitional cell layer might contribute to relapsing or persistent infection. c | Biofilm formation enables the organism to avoid host defences, resist antibiotic therapy and provides a reservoir for ongoing infection if the catheter is not removed. d | Transrectal prostate biopsy allows direct transfer of bacteria from the rectum to the prostate, including a potential reservoir of resistance that can be enhanced by prior antibiotic exposure.

Figure 1.6. Pseudomonas aeruginosa in non-mucoid and mucoid phenotype

1.5. Catheter biofilms Prolonged urinary tract infections to the catheterized patient can facilitate the development of catheter biofilms. While indwelling Foley catheters are effective in relieving urinary retention and managing urinary incontinence, external bacteria have easy access to the bladder, and catheterization can often result in bacteriuria. The risk of urinary tract infection is related to the length of time the catheter is in place. Most patients catheterized for a week or less should escape infection, but for the many

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

elderly and disabled patients who are catheterized for several months or years, bacteriuria is inevitable. (Waren, 1991) (Kunin, 1997). Urinary tract infections in catheterized patients can occur in several ways. Organisms that colonize the periurethral skin can migrate into the bladder through the mucoid film that forms between the epithelial surface of the urethra and the catheter. Also, contamination of the urine in the drainage bag can allow organisms to access the bladder through the drainage tube and the catheter lumen. (Tambyah, 1999) (Stamm, 1991). The initial bacteria that cause the urinary tract infections are usually Staphylococcus epidermidis, Escherichia coli or Enterococcus faecalis. (Tambyah, 1999) (Matsukawa, 2005). As time goes by, other species appear in the residual bladder urine, including Pseudomonas aeruginosa, Proteus mirabilis, Providencia stuartii, Morganella morganii and Klebsiella pneumoniae. (Waren, 1991) (Clayton, 1982). The bacteria that present in the latter stages of urinary tract infection are difficult to eradicate with antibiotics while the catheter is in place. (Clayton, 1982) (Warren, 1982). As the infections are usually asymptomatic, and because of the danger of promoting antibiotic resistance, catheter-associated bacteriuria is generally not treated. (Saint & Chenoweth, 2003) (Trautner & Darouiche, 2004) (Tenke, 2008). In patients with long-term indwelling catheters, catheter changes are commonly scheduled at (Saint & Chenoweth, 2003) (Trautner & Darouiche, 2004) (Tenke, 2008) week intervals; contaminated urine can, therefore, be flowing through individual catheters for periods of 3 months at a time. Thus, catheters provide attractive sites for bacterial colonization: the biofilm bacteria thrive in their matrix gel and the gentle flow of warm nutritious urine. Enormous populations develop, and become visible to the naked eye as thick coatings. Biofilms containing 5 × 109 viable cells per centimeter can be found on long-term indwelling catheters removed from patients. (Ganderton, 1992). The biofilm populations, therefore, often outnumber those in the urine. A variety of bacterial species colonize catheters, and many of these biofilms can induce serious complications. (Saint & Chenoweth, 2003) (Ganderton, 1992) (Morris, 1999) (Liedl, 2001) (Ohkawa, 1990) (Macleod & Stickler, 2007). Biofilm forming bacterial species from a set of 106 catheters were commonly found, and are of single-species biofilms were observed, but most biofilms contained mixed bacterial communities containing up to five species. The most common species present in the mixed-population biofilms were E. faecalis, Pseudomonas aeruginosa, Escherichia 11

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

coli, and P. mirabilis. In patients who develop bacteriuria during short-term catheterization, bacterial colonization of the catheter does occur (Ohkawa, 1990). The biofilms formed are generally sparse, and because the catheter is removed within a few days, they cause few problems. By contrast, long-term catheters become colonized by extensive biofilms, which can have profound effects on the health of the patient. By far the most troublesome biofilms are those that become crystalline in nature (Getliffe & Mulhall, 1991) (Stickler & Zimakoff, 1994). These biofilms can form on the outer surface of the catheter around the balloon and catheter tip, and can cause trauma to the bladder and urethral epithelia. When deflation of the retention balloon, crystalline debris from the biofilm can be shed into the bladder and initiate stone formation. The main complication, however, is blockage in the flow of urine through the catheter that results from the buildup of the crystalline material on the luminal surfaces.

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Figure 1.7. Pathogenesis of urinary tract infections (Flores-Mireles, Walker, Caparon, & Hultgren, 2015) a| Uncomplicated urinary tract infections begin when uropathogens that reside in the gut contaminate the periurethral area (step 1) and are able to colonize the urethra. Subsequent migration to the bladder (step 2) and expression of pili and adhesins results in colonization and invasion of the superficial umbrella cells (step 3). Host inflammatory responses, including neutrophil infiltration (step 4), begin to clear extracellular bacteria. Some bacteria evade the immune system, either through host cell invasion or through morphological changes that result in resistance to neutrophils,

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR) and these bacteria undergo multiplication (step 5) and biofilm formation (step 6). These bacteria produce toxins and proteases that induce host cell damage (step 7), releasing essential nutrients that promote bacterial survival and ascension to the kidneys (step 8). Kidney colonization (step 9) results in bacterial toxin production and host tissue damage (step 10). If left untreated, UTIs can ultimately progress to bacteraemia if the pathogen crosses the tubular epithelial barrier in the kidneys (step 11). b| Uropathogens that cause complicated UTIs follow the same initial steps as those described for uncomplicated infections, including periurethral colonization (step 1), progression to the urethra and migration to the bladder (step 2). However, in order for the pathogens to cause infection, the bladder must be compromised. The most common cause of a compromised bladder is catheterization. Owing to the robust immune response induced by catheterization (step 3), fibrinogen accumulates on the catheter, providing an ideal environment for the attachment of uropathogens that express fibrinogen-binding proteins. Infection induces neutrophil infiltration (step 4), but after their initial attachment to the fibrinogen-coated catheters, the bacteria multiply (step 5), form biofilms (step 6), promote epithelial damage (step 7) and can seed infection of the kidneys (steps 8 and 9), where toxin production induces tissue damage (step 10). If left untreated, uropathogens that cause complicated UTIs can also progress to bacteraemia by crossing the tubular epithelial cell barrier (step 11). As a consequence, urine often leaks along the outside of the catheter and patients become incontinent, resulting in the increased need for nursing assistants. In addition, blockage of the catheter can lead to retention of urine in the bladder and vesicoureteric reflux of infected urine; if the blockage is not detected and if the catheter is not changed, patients can suffer episodes of pyelonephritis and septicemia. (Liedl, 2001) (Kunin, Careof urinary catheter in urinary tract infections: In Detection, Prevention and Management of urinary Tract Infections., 1987). About half the patients who undergo long-term catheterization will suffer the complication of catheter encrustation and blockage by bacterial biofilms at some time. (Cools & Van der Meer, 1986) (Getliffe & Mulhall, The encrustation of indwelling catheters., 1991). The welfare of many elderly and disabled patients is thus put at risk by the development of these biofilms, and considerable demands are made on the resources of the health-care service to manage the complications. An insight into the scale of the 14

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

problem was given by a prospective study of 467 patients in community care in the UK. Over a 6-month period, 506 emergency referrals were recorded for these patients, mostly to deal with catheter blockage. (Kohler-Ockmore & Feneley, 1996).

1.6. Crystalline biofilms The crystalline biofilm deposits on urinary catheters have a similar composition to infection-induced kidney and bladder stones. Struvite (magnesium ammonium phosphate) and a poorly crystalline form of apatite (a hydroxylated calcium phosphate, in which a variable proportion of the phosphate groups are replaced by carbonate) are the principle crystalline components. (Hedelin, 1984) (Cox & Hukins, 1989). Scanning electron microscopy has shown that large numbers of bacilli are associated with the crystals (Cox & Hukins, 1989). Culture techniques have confirmed the persistence of a range of bacteria. Notably, species capable of producing the enzyme urease are predominantly associated with crystallization (Stickler D. , 1993). Urease is, in fact, the driving force of crystallization: it hydrolyzes urea, leading to the formation of ammonium and carbonate ions and an increase in urinary pH. As the urine becomes alkaline, magnesium and calcium phosphate crystals are precipitated. Aggregates of this crystalline material accumulate in the urine and in the biofilm that develops on the catheter surfaces. The continued accumulation of crystalline bacterial biofilm blocks the flow of urine through the catheter (Morris, 1999) (McLean, 1996). Several species commonly found in catheter biofilms produce urease. In laboratory tests, urease can be detected in Pseudomonas aeruginosa, Klebsiella pneumonia and M. morganii, Proteus species, including P. mirabilis, some Providencia species and some strains of Staphylococcus aureus and coagulase-negative staphylococci. Of these species, P. mirabilis is most commonly isolated from the urine of patients suffering from recurrent catheter encrustation and blockage. Uropathogens colonize the bladder using a variety of virulence factors that therefore play critical roles in pathogenesis. These virulence factor include surface structural components, such as lipopolysaccharide, polysaccharide capsule, flagella, outer-membrane vesicles, pili, curli, non-pilusadhesins, outer-membrane proteins, as well as secreted toxins, secretion systems, including siderophore receptors (Klemm,

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Vejborg, & Hancock, 2010) (Werneburg, Henderson, Portnoy, Sarowar, Hultgren, & Li, 2015) (O'Brien, Hannan, Nielsen, & Hultgren, 2016).

Figure 1.8. Mechanisms of pathogenesis during catheter-associated urinary tract infections (Flores-Mireles, Walker, Caparon, & Hultgren, 2015). a| Catheter-associated urinary tract infections mediated by Proteus mirabilis depend on the expression of mannose-resistant Proteus-like (MR/P) pili for initial attachment, and for biofilm formation on the catheter and in the bladder. Subsequent urease production induces the formation of calcium crystals and magnesium ammonium phosphate precipitates in the urine through the hydrolysis of urea to carbon dioxide and ammonia, resulting in a high pH. The production of extracellular polymeric substances by bacteria attached to the catheter traps these crystals, allowing the

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR) formation of a crystalline biofilm, which protects the community from the host immune system and from antibiotics. In addition, these structures prevent proper urine drainage, resulting in reflux and promoting the progression to pyelonephritis, septicemia and shock. Finally, production of the bacterial toxins haemolysin (HpmA) and Proteus toxic agglutinin (Pta) is important for tissue destruction and bacterial dissemination to the kidneys. HpmA induces pore formation by inserting itself into the cell membrane and destabilizing the host cell, causing tissue damage, exfoliation and nutrient release. Pta punctures the host cell membrane, causing cytosol leakage and resulting in osmotic stress and depolymerization of actin filaments, thus compromising the structural integrity of the cell. The release of nutrients via these toxins also allows the bacteria to scavenge iron-using siderophores. b| Enterococcus faecalis pathogenesis during CAUTIs depends on catheter implantation, which results in bladder inflammation and causes fibrinogen release, deposition onto the catheter, and accumulation. E. faecalis takes advantage of the presence of fibrinogen and uses it as a food source through the production of proteases. E. faecalis also binds fibrinogen through the endocarditis- and biofilm- associated (Ebp) pilus, allowing the formation of biofilms that protect the bacteria against the immune system.

Therefore the present research aimed at developing strategies for prevention of biofilm in urinary catheters that could be easily employed for the prevention of CAUTI with the following objectives, i) Isolation and Identification of bacteria from urinary catheters of patients. ii) Detection of their ability to form biofilm and detection and sequencing of the genes responsible for it. iii) Evaluation of Minimum inhibitory concentration (MIC) and Minimum biofilm eradicating concentration (MBEC) to determine changes in the pattern of antibiotic sensitivity of uropathogens from the planktonic to the biofilm phase of growth. iv) In vitro examination of the ability of antibiofilm agent coated catheters to resist biofilm formation by uropathogens.

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

2. Review of Literature Table 2.1. Literature review of previous publication with details Year Author Institute/ University Country Study Title Instituto de Agrobiotecnología y SarA and not sigmaB is essential for Recursos Naturales and Dpto Valle et al. Spain biofilm development by Staphylococcus de Producción Agraria, aureus. Universidad Pública de Navarra-CSIC, Pamplona- 2003 Nursing, School of Nursing Managing recurrent urinary catheter & Midwifery, University of United Getliffe blockage: problems, promises, and Southampton, Highfield, Kingdom practicalities. Southampton Institute of Urology and Kalsi Nephrology, University UK Hospital-acquired urinary tract infection. College London Department of Medicine, Infectious Diseases Section, Trautner and Catheter-associated infections: Veterans Affairs Medical USA Darouiche pathogenesis affects prevention. Center, 2002 Holcombe 2004 Boulevard, Houston Department of Medicine Development and Characterization of an Andes et al. University of Wisconsin, Wisconsin In Vivo Central Venous Catheter Candida Madison, albicans Biofilm Model Departments of Medical Catheter associated urinary tract Microbiology/Parasitology infection: Aetiologic agents and Taiwo, and and Surgery,College of 2006 Nigeria antimicrobial susceptibility pattern in Aderounmu Health Sciences, Ladoke Ladoke Akintola university teaching Akintola University of hospital, Osogbo, Nigeria. Technology, Osogbo Division of Infectious Isolation and characterization of biofilm Tu Quoc et al. Diseases, University Hospital Switzerland formation-defective mutants of of Geneva Staphylococcus aureus. Division of Rhinology, 2007 Department of Evaluation of the in vivo efficacy of Otorhinolaryngology-Head Chiu etal. USA topical tobramycin against Pseudomonas and Neck Surgery, University sinonasal biofilms. of Pennsylvania, Philadelphia, PA, Cardiff School of Bacterial biofilms in patients with Stickler Biosciences, Cardiff UK. indwelling urinary catheters. University 2008 Veterans Affairs Ann Arbor Preventing hospital-acquired urinary tract Saint et al. Healthcare System, Ann USA infection in the United States: a national Arbor, Michigan study. Babylon University, College Isolation and characterization of Al-Hulu et al. of Medicine, Department of Iraq Raoultella ornithinolytica from Clinical 2009 Microbiology specimens in Hilla city Iraq Mount Sinai School of Healthcare-associated Infections: Doshi et al. USA Medicine, New York epidemiology, prevention, and therapy. Dept. of Microbiology, Microbiological Profile Of Nosocomial 2010 Shalini et al. Kasturba Medical College, Mangalore Infection In The Intensive Care Unit Manipal University Departments of Medical Biofilm forming bacteria isolated from Microbiology and urinary tract infection, relation to Abdallah et al. Egypt Immunology, Ain Shams catheterization and susceptibility to University, Cairo antibiotics Department of Microbiology, 2011 National University of Evaluation of different detection methods Afreenish et al. Pakistan Sciences and Technology, of biofilm formation in clinical isolates. Islamabad, Institute of Biochemical An in vitro urinary tract catheter system Dohnt et al. Engineering, Technische Germany to investigate biofilm development in Universität Braunschweig, catheter-associated urinary tract 18

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 2.1. Literature review of previous publication with details Year Author Institute/ University Country Study Title Braunschweig, infections.

Biofilms and Biocontamination of Characterization of bacterial biofilms Djeribi Materials Laboratory, Algeria formed on urinary catheters. Faculty of Science, Badji Mokhtar University, Annaba, Prevention of Biofilm formation in urinary catheter by coating Enzyme/ 2012 Department of Microbiology, Gentamycin/EDTA Ghanwate et al. Sant Gadge Baba Amravati India Biofilm eradication studies on University uropathogenic E. coli using ciprofloxacin and nitrofurantoin Isolation and identification of microbes Balasubramanian India from biofilm of urinary catheters and et al. antimicrobialsusceptibility evaluation. Department of Microbiology, Antibiotic resistance pattern among Jawaharlal Institute of common bacterial uropathogens with a Mandal et al. Postgraduate Medical India special reference to ciprofloxacin resistant Education & Research, Escherichia coli Puducherry, Microbiology Department, 2013 National Center for Radiation Antimicrobial resistance patterns of Bahashwan et al. Egypt Research and Technology, Proteus isolates from clinical specimens Nasr City, Cairo Laboratoire de Biologie Identification and quantification of Générale, Département de Essomba et al. Cameroun bacteria associated with indwelling Biologie Urinary catheterization

Propensity for biofilm formation by UCP-School of clinical isolates from urinary tract Alves et al. Biotechnology University in Portugal infections: developing a multifactorial Porto. predictive model to improve antibiotic therapy. ervicio de Gastroenterología, Hospital Universitario Dr Stenotrophomonas maltophilia in Mexico: Flores-Treviño et José Eleuterio González, Mexico. antimicrobial resistance, biofilm 2014 al. Universidad Autónoma de formation and clonal diversity. Nuevo León, Av. Francisco Biomaterials, Biofilm and Infection Control Research The In Vitro Susceptibility of Biofilm Group, School of Pharmacy, Forming Medical Device Related Laverty et al. UK Queens University of Belfast, Pathogens to Conventional Antibiotics Medical Biology Centre, Belfast Department of Sub MIC of antibiotics induced biofilm Pharmacognosy, College of Aka and Haji Iraq formation of Pseudomonas aeruginosa in Pharmacy, Hawler Medical the presence of Chlorhexidine. University, Erbil City, Pseudomonas aeruginosa isolates and Department of Pharmacy, their antimicrobial susceptibility pattern Bekele et al. College of Health Sciences, Ethiopia amongcatheterized patients at Jimma Jimma University, univerisyt teaching hospital, Jimma. 2015 Ethiopia Department of Microbiology, Prevention of Biofilm formation in Ghanwate et al. Sant Gadge Baba Amravati India urinary catheter by treatment with University Antibiofilm agents Faculty of Veterinary Bacterial infections in dogs with special Medicine and Animal reference to urinary tract infections, Ulrika et al. Science Uppsala surgical site infections and methicillin- Department of clinical resistant Staphylococcus sciences pseudintermedius 19

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 2.1. Literature review of previous publication with details Year Author Institute/ University Country Study Title Department of Surgery, Prevalence of pathogens and theis Koshariya Gandhi Medical college India antimicrobial susceptibility in catheter Madhya Pradesh associated urinary tract infection. Antibiotic sensitivity pattern of bacteria Department of Microbiology isolated from catheter associated urinary Dund et al. GMERS Medical College India tract infection in tertiary care and Hospital, Dharpur, Patan 2016 hospital,jamangar. Department of Microbiology, Importance of biofilm in medical science Ghanwate et al. Sant Gadge Baba Amravati India with special reference to uropathogens University Uropathogenic Escherichia coli (UPEC) Department of Life Sciences Infections: Virulence Factors, Bladder Trlizzie et al. and Systems Biology, Italy Responses, Antibiotic andNon-antibiotic University of Turin, Torino, antimicrobial strategies. Detection of Biofilm Forming Bacterial 2017 Communities from Urinary Catheter of Department of Microbiology, Patients with Change in Its Antibiotic Ghanwate et al. Sant Gadge Baba Amravati India Susceptibility Pattern and Triclosan University Effect from Different Hospitals of Amravati City Maharashtra, India

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

3. Materials and Methods: 3.1. Materials

Table 3.1. List of Required material in present study Sr. No. Requirements Media 1 Hichrome UTI Agar 2 Muller Hinton Agar 3 Muller Hinton Broth 4 Trypticase soya Broth 5 Brain Heart Infusion Broth 6 Sabouraud Dextrose Agar 7 Sabouraud Dextrose Broth 8 Nutrient Agar 9 Nutrient Broth Solutions 10 Ringers solution 11 Phosphate saline buffer 12 Saline solution 13 Glycerol 14 Foley urinary catheter sterile no. 26 15 Syringe 16 IV set 17 Artificial urine 18 96 well Tissue culture plate 19 HiDispoTM bag [HiMedia Laboratories Pvt. Ltd.] Antibiotics powder (HiMedia India) 20 Tobramycin 21 Chloramphenicol 22 Ceftazidime 23 Gentamycin 24 Ceftazidime 25 Ampicillin 26 Erythromycin 27 Ciprofloxacin Nanoparticles and Antimicrobial agents 28 Silver Nanoparticles (Sigma - Aldrich) 29 Copper Nanoparticles (Sigma - Aldrich) 30 Ceftazidime + Silver Nanoparticles (1:1) 31 Ceftazidime + Copper Nanoparticles (1:1) 32 Triclosan (HiMedia India) 33 Lysozyme 34 Garlic extract 35 Triclosan + Ceftazidime (1:1) Aromatic oils 37 Azadirachta indica oil (Neem oil) (Baidyanath, India) 38 Syzygium aromaticum oil (Clove oil) (Dabur, India) 39 Allium sativum oil (Garlic oil) (Herbal, India) 40 Cinnamomum verum oil (Cinnamon oil) (Herbal, India) 41 Phyllanthus emblica oil (Amla oil) (Dabur, India) 42 Neem oil + Garlic oil (1:1) 43 Ginger oil (Zingiber officinale)

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

3.2. Media contents All the culture media were prepared in laboratory as per manufacturer's instructions.

3.2.1. HiCrome UTI Agar M1353R HiMedia Laboratories Pvt. Ltd. HiCrome UTI Agar is a differential medium recommended for presumptive identification of microorganisms mainly causing urinary tract infections.

Table 3.2. Composition of HiCrome UTI Agar Sr. No. Ingredients Gms / Litre 1 Peptic digest of animal tissue 15.000 2 Chromogenic mixture 26.800 3 Agar 15.000 Final pH ( at 25°C) 6.8±0.2 Formula adjusted, standardized to suit performance parameters

3.2.2. Mueller Hinton Agar M173 HiMedia Laboratories Pvt. Ltd. Mueller Hinton Agar is used for determination of susceptibility of microorganisms to antimicrobial agents.

Table 3.3. Composition of Mueller Hinton Agar

Sr. No. Ingredients Gms / Litre Meat, infusion solids 1 2.000 from300g 2 Casein acid hydrolysate 17.500

3 Starch 1.500

4 Agar 17.000

Final pH ( at 25°C) 7.3±0.1 Formula adjusted, standardized to suit performance parameters Equivalent to Beef infusion from

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

3.2.3. Mueller Hinton Broth M391 HiMedia Laboratories Pvt. Ltd. Mueller Hinton Broth is recommended to determine the susceptibility of bacteria to sulphonamides by the tube dilution method. Also used for primary isolation of gonococci and meningococci.

Table 3.4. Composition of Mueller Hinton Broth

Sr. No. Ingredients Gms / Litre Beef, infusion from 300.000 1 17.500 Casein acid hydrolysate 2 Starch 1.500

Final pH ( at 25°C) 7.3±0.1 Formula adjusted, standardized to suit performance parameters Equivalent to Beef infusion from

3.2.4. Sabouraud Dextrose Agar M063 HiMedia Laboratories Pvt. Ltd. Sabouraud Dextrose Agar is used for the cultivation of yeasts, moulds and aciduric bacteria. Table 3.5. Composition of Sabouraud Dextrose Agar Gms / Sr. No. Ingredients Litre 1 Dextrose 40.000

2 Mycological, peptone 10.000

3 Agar 15.000

Final pH ( at 25°C) 5.6±0.2 Formula adjusted, standardized to suit performance parameters # - Equivalent to Beef infusion from

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

3.2.5. Sabouraud Dextrose Broth ME033 HiMedia Laboratories Pvt. Ltd. Sabouraud Dextrose Broth is used for cultivation of yeasts, moulds and acid uric microorganisms from pharmaceutical products in accordance with the microbial limit testing by harmonized methodology of EP

Table 3.6. Composition of Sabouraud Dextrose Broth Gms / Sr. No. Ingredients Litre Mixture of peptic digest of animal 10.000 1 tissue & pancreatic digest of casein (1:1) 20.000 2 Dextrose 5.6±0.2 pH after sterilization ( at 25°C) Formula adjusted, standardized to suit performance parameters

3.2.6. Brain Heart Infusion Broth M210 HiMedia Laboratories Pvt. Ltd. Brain Heart Infusion Broth is employed for the propagation of fastidious pathogenic cocci and other organisms associated with blood culture work and allied pathological investigations.

Table 3.7. Composition of Brain Heart Infusion Broth Sr. No Ingredients Gms / Litre 1 Calf brain, infusion from 200.000 2 Beef heart, infusion from 250.000 3 Protease peptone 10.000 4 Dextrose 2.000 5 Sodium chloride 5.000 6 Disodium phosphate 2.500 Final pH ( at 25°C) 7.4±0.2 Formula adjusted, standardized to suit performance parameters

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

3.2.7. Soybean Casein Digest Medium (Tryptone Soya Broth) M011 HiMedia Laboratories Pvt. Ltd. Soybean Casein Digest Medium is a general purpose medium used for cultivation of a wide variety of microorganisms and recommended for sterility testing of moulds and lower bacteria. Table 3.8. Composition of Soybean Casein Digest Medium Sr. No. Ingredients Gms / Litre 1 Pancreatic digest of casein 17.000 2 Papaic digest of soybean meal 3.000 3 Sodium chloride 5.000 4 Dextrose (Glucose) 2.500 Dipotassium hydrogen 5 2.500 phosphate Final pH ( at 25°C) 7.3±0.2 Formula adjusted, standardized to suit performance parameters

Table 3.9. Artificial urine Sr.No. Components Gms / Litre 1 Peptone 1 2 Yeast extract 0.005 3 Lactic acid 0.1 4 Citric acid 0.4 5 Sodium bicarbonate 2.1 6 Urea 10 7 Uric acid 0.07 8 Creatinine 0.8 9 Calcium chloride 2H2O 0.37 10 Sodium chloride 5.2 11 Iron II sulphate.7H2O 0.0012 12 Magnesium sulphate. 7H20 0.49 13 Sodium sulphate. 10H2O 3.2 14 Potassium dihydrogen phosphate 0.95 15 Di-potassium hydrogen phosphate 1.2 16 Ammonium chloride 1.3 17 Distilled water 1 L

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 3.10. Phosphate buffer Sr. No. Ingredients Gms / Litre 1 Sodium chloride 8.0 2 Potassium chloride 0.20 3 Potassium hydrogen phosphate 0.024 4 Disodium hydrogen phosphate 1.44 pH 7.3

Table 3.11. Quarter strength ringers solution Sr. No. Ingredients Gms / Litre 1 Sodium chloride 2.25 2 Potassium chloride 0.105 3 Calcium chloride hexahydrate 0.12 4 Sodium dihydrogen carbonate 0.05 Distilled water 1000 pH 7.0 ± 0.2

Table 3.12. Antibiotic HiMedia Laboratories Ltd. Disc Sr. No. Antibiotic disc Storage of disc potency 1 Amoxycillin 10mcg Store at 2 to 8°C 2 Cloxacillin 5mcg Store at -20° to 8°C 3 Erythromycin 15mcg Store at -20° to 8°C 4 Tetracycline 10mcg Store at -20° to 8°C 5 Penicillin 2 units Store at -20° to 8°C 6 Co- Trimoxazole 25mcg Store at 2 to 8°C 7 Penicillin-V 3mcg Store at -20° to 8°C 8 Cephalexin 30mcg Store at -20° to 8°C 9 Gentamicin 10mcg Store at -20° to 8°C 10 Chloramphenicol 30mcg Store at -20° to 8°C 11 Norfloxacin 10mcg Store at 2 to 8°C 12 Ciprofloxacin 5mcg Store at 2 to 8°C 13 Nalidixic Acid 30mcg Store at 2 to 8°C 14 Nitrofurantoin 300mcg Store at 2 to 8°C 15 Levofloxacin 5mcg Store at 2 to 8°C 16 Imipenem 10mcg Store at 2 to 8°C 17 Sparfloxacin 5mcg Store at 2 to 8°C 18 Meropenem 10mcg Store at 2 to 8°C

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 3.12. Antibiotic HiMedia Laboratories Ltd. Disc Sr. No. Antibiotic disc Storage of disc potency 19 Moxifloxacin 5mcg Store at 2 to 8°C 20 Ofloxacin 5mcg Store at 2 to 8°C 21 Tetracycline 10mcg Store at -20° to 8°C 22 Tobramycin 10mcg Store at -20° to 08°C 23 Amikacin 30mcg Store at -20° to 08°C 24 Linezolid 30mcg Store at -20° to 08°C 25 Gatifloxacin 5mcg Store at -20° to 08°C 26 Cefixime 5mcg Store at -20° to 08°C 27 Cefotaxime 30mcg Store at -20° to 08°C 28 Piperacillin 100mcg Store at -20° to 08°C 29 Cefpodoxime 10mcg Store at -20° to 08°C 30 Clindamycin 2mcg Store at -20° to 08°C 31 Ampicillin 10/10mcg Store at -20° to 08°C 32 Amoxyclav 20/10mcg Store at -20° to 08°C 33 Nitrofurantoin 300mcg Store at -20° to 08°C 34 Cefaclor 30mcg Store at -20° to 08°C 35 Cefaperazone 75mcg Store at -20° to 08°C 36 Cephoxitin 300mcg Store at -20° to 08°C 37 Ceftriaxone 30mcg Store at -20° to 08°C 38 Ceftazidime 30mcg Store at -20° to 08°C

Table 3.13. Preparation and storage of antibiotic solutions (stored solutions should contain ≥ 1000 mg/L) Antibiotic Powders Sr. Antibiotic Solvent Diluents 4°C -20°C -70°C Storage Supplier No. +4°C; protect GlaxoS Tobramycin 1 1 water water 1 week - from light and mithKl (sulphate) month moisture ine +4-25°C; Aventi Gentamicin 6 2 water water NR NR protect from s (sulphate) months moisture and light Pharma Saturate +4-25°C; d GlaxoS Ceftazidime 3 protect from 3 NaHCO water 1 day - mithKl (pentahydrate) months moisture and 3 ine solution light +4°C; protect Chlorampheni 4 Ethanol water - - from light and Sigma col moisture +4-25°C; Ciprofloxacin 3 3 protect from 5 (hydrochloride water water 2 weeks Bayer months months moisture and monohydrate) light

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 3.13. Preparation and storage of antibiotic solutions (stored solutions should contain ≥ 1000 mg/L) Antibiotic Powders +4°C; protect Abbott Erythromycin 6 Ethanol water 1 week - - from light and Labora (base) moisture tories Phospha +4°C; protect GlaxoS Ampicillin te buffer 30 7 water 7 days unstable from light and mithKl (trihydrate) (0.1 M, days pH6) moisture ine Nanoparticles and Antimicrobial agents 8 HiMed Triclosan DMSO water ia 9 Distille HiMed Lysozyme water d water ia 10 Silver Distille water Sigma Nanoparticles d water 11 Cupper Ammo water Sigma Nanoparticles nia NR = not recommended

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

3.3. Methodology 3.3.1. Study Area Urinary catheter samples of patients were collected from 10 different hospitals of Amravati city as given in the table below

Table 3.14. Hospitals of Amravati city Sr. Hospitals No. Agrawal Maternity & Nursing Home. Sainagar Road, Bhakti Dham Temple, 1 Amravati, Maharashtra - 444601. 2 Arihant Hospital, Nawathe Square, Amravati, 444605 Baheti Hospital. Ambapeth, Nr. Rajkamal Square, Amravati, Maharashtra - 3 444601. Dr. Barabde Hospital & Critical Care Unit. Camp Road, Amravati, 4 Maharashtra - 444601. Hitech Critical Care And Bonde Hospital. 48 - 3/4, Dastur Nagar Road, 5 Nanda Market Rajapeth, Amravati, Maharashtra - 444601. 6 Dufferin Hospital. Shrikrishn Peth, Amravati, 444601 7 Irwin hospital Amravati, Maharashtra 444606 Sai Multispeciality Hospital Vijay Colony Rd, Vivekanand Colony, 8 Amravati, Maharashtra 444606 Dr. Mundhada O. G. maltekadi road, Amravati - 444601 9 Maharashtra 10 Parshree hospital, Khaparde garden Amravati, 444602 Radiant Superspeciality Hospital, Sabnis Plot, Rukhmini Nagar, Near 11 Kalyan Nagar Chowk, Amravati, Maharashtra 444606 Yadgire Superspecialty Hospital. Vijay Colony, Congress Nagar Road, 12 Amravati, Maharashtra - 444604.

3.3.2. Method of removal of catheter Step I: Make sure all items are available • Pair of examination gloves (if replacing the catheter a pair of sterile or high- level disinfected gloves will be needed as well). • Empty, high-level disinfected or sterile syringe for removing the fluid from the catheter balloon. • Sponge forceps with gauze squares (2 x 2) or large cotton applicators.

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

• Plastic bag or leak-proof covered waste container for disposal of contaminated items. Step II: Have the patient wash the urethral area (women) or the head of the penis (men), or do it for them wearing a pair of clean examination gloves. Step III: Wash hands or use an antiseptic hand rub. Step IV: Put clean examination gloves on both hands. Step V: With the empty syringe, remove the water from the catheter balloon. Step VI: For women, separate and hold the labia apart with the no dominant hand; then clean the urethral area two times with an antiseptic solution using either cotton applicators or a sponge forceps with gauze squares and gently remove the catheter. Step VII: For men, push back the foreskin and hold the head of the penis with the non-dominant hand; then prep the head of the penis and the area around the catheter two times with an antiseptic solution, using cotton applicators or sponge forceps with gauze squares and gently remove the catheter.

3.3.3. Processing of urinary catheter samples collected from different patients Urinary catheters of patients were collected from different hospitals of Amravati city in sterilized HiDispoTM bag [HiMedia Laboratories Pvt. Ltd.] in aseptic condition as describe above. A label was attached to the outside of the HiDispoTM bag with patients name, duration, disease, and Hospital name and identification number prior to collection of the sample. The urinary catheter was immediately brought to the laboratory and was processed in aseptic conditions. The collected urinary catheters were washed with sterile distilled water and flushed with a saline solution then swabbed with 70% alcohol from an outer side of the catheter to remove planktonic bacteria. and finally, sectioned into five appropriate parts A, B, C, D and E from catheter tip, each part were suspended into test tubes containing sterile Ringer’s solution (10ml) separately. Sonication was performed for 5 minutes at 35 kHz in a transonic water bath to remove and disturb the colonizing biofilm and vortex mixture was used for 2 minutes.

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Section D

Section E

Section C Section A

Section B

Figure 3.1. Catheter with different section A, B, C, D and E

3.4. Isolation of uropathogens from urinary catheter using Quarter strength Ringers solution Resulting cell suspensions were cultured by taking a loopful of suspension on to Hi- chrome UTI agar plates [HiMedia Laboratories Pvt. Ltd.]. The plates after streaking were incubated at 37°C for 24h. After 24h incubation, the resulting colonies were identified by standard methods. All isolates were kept as stock cultures in a 5% glycerol solution (Macleod SM and Stickler DJ, 2007). The colored colonies were observed and identified on the basis of morphological, cultural & biochemical test. Some bacterial cultures that were could not be identified by conventional method were identified by VITEK automated identification method (Pincus, 2007).

3.5. Cultural test Hichrome UTI Agar Urinary tract infections are bacterial infections affecting parts of urinary tract. The common symptoms of urinary tract infection are urgency and frequency of micturition, with associated discomfort or pain. The common condition is cystitis, due to infection of the bladder with an uropathogenic bacterium, which most frequently is Escherichia coli, but sometimes Staphylococcus saprophyticus or especially in hospital-acquired infections, Klebsiella species, Proteus mirabilis, other coliforms, Pseudomonas aeruginosa or Enterococcus faecalis. HiCrome UTI Agar is formulated

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

on basis of work carried out by Pezzlo Wilkie et al, Friedman et al, Murray et al, Soriano and Ponte and Merlino et al. HiCrome UTI Agar (M1353R) is similar to M1353 with a slight difference in chromogenic mixture to improve the colour characteristic of media. These media are recommended for the detection of urinary tract pathogens where HiCrome UTI Agar has broader application as a general nutrient agar for isolation of various microorganisms. It facilitates and expedites the identification of some Gram negative bacteria and some Gram-positive bacteria on the basis of different contrasted colony colors produced by reactions of genus or species specific enzymes with two chromogenic substrates. The chromogenic substrates are specifically cleaved by enzymes produced by Enterococcus species, E.coli and coliforms. Presence of amino acids like phenylalanine and tryptophan from peptones helps for detection of tryptophan deaminase activity, indicating the presence of Proteus species, Morganella species and Providencia species. One of the chromogenic substrate is cleaved by ß-glucosidase possessed by Enterococci resulting in formation of blue colonies. E.coli produces pink colonies due to the enzyme ß-D- galactosidase that cleaves the other chromogenic substrate. Further confirmation of E. coli can be done by performing the indole test. Coliforms produce purple colored colonies due to cleavage of both the chromogenic substrate. Colonies of Proteus, Morganella and Providencia species appear brown because of tryptophan deaminase activity. Peptic digest of animal tissue or peptone special provides nitrogenous, carbonaceous compounds and other essential growth nutrients. This medium can be made selective by supplementation with antibiotics for detecting microorganisms associated with hospital borne infections. Reaction of 5.68% w/v aqueous solution at 25°C. pH: 6.8±0.2. Cultural characteristics observed after incubation at 35-37°C for 18-24 hours.

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 3.15. Culture character of pathogens on Hichrome UTI Agar Inoculum Organism Growth Recovery Color of colony (CFU) blue, small Enterococcus faecalis 50-100 luxuriant >=70%

Escherichia coli pink-purple 50-100 luxuriant >=70%

blue to purple, Klebsiella pneumoniae 50-100 luxuriant >=70% mucoid

Colorless ( greenish Pseudomonas aeruginosa 50-100 luxuriant >=70% pigment may be

observed)

light brown Proteus mirabilis 50-100 luxuriant >=70%

golden yellow Staphylococcus aureus 50-100 Luxuriant >=70%

3.6. Antibiotic susceptibility test 3.6.1. Preparation of antibiotic stock solutions Antibiotics were procured as powders in pure form from commercial sources, and not use inject-able solutions. Powders were accurately weighed and dissolved in the appropriate diluents to yield the required concentration, using sterile glassware. The stock can be aliquoted in 5 ml volumes and frozen at -20ºC or -60ºC. Stock solutions were prepared using the formula (1000/P) X V X C=W, where P = potency of the antibiotic base, V=volume in ml required, C=final concentration of solution and W=weight of the antimicrobial to be dissolved in V.

3.6.2. Preparation of dried filter paper discs Whatmann filter paper no. 1 is used to prepare discs approximately 6 mm in diameter, which are placed in a petri dish and sterilized in a hot air oven. The loop used for delivering the antibiotics is made of 20 gauge wire and has a diameter of 2 mm. This delivers 0.005 ml of antibiotics to each disc. 3.6.3. Storage of commercial antimicrobial discs Cartridges containing commercially prepared paper disks specifically for susceptibility testing are generally packaged to ensure appropriate anhydrous 33

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

conditions. These were refrigerated at 8°C or below, or freeze at -14°C or below, in a no frost-free freezer until needed. Sealed packages of disks that contain drugs from the ß-lactam class were stored frozen, except for a small working supply. The unopened disc containers were removed from the refrigerator or freezer one to two hours before use, so they may equilibrate to room temperature before opening.

3.6.4. Turbidity standard for inoculums preparation

To standardize the inoculums density for a susceptibility test, a BaSO4 turbidity standard, equivalent to a 0.5 McFarland standard or its optical equivalent (e.g., latex

particle suspension), were used. A BaSO4 0.5 McFarland standard was prepared. A

0.5-ml aliquot of 0.048 mol/L BaCl2 (1.175% w/v BaCl2. 2H2O) is added to 99.5 ml

of 0.18 mol/L H2SO4 (1% v/v) with constant stirring to maintain a suspension. The correct density of the turbidity standard was verified by using a spectrophotometer with a 1-cm light path and matched cuvette to determine the absorbance. The absorbance at 625 nm should be 0.008 to 0.10 for the 0.5 McFarland standards. The Barium Sulfate suspension was transferred in 4 to 6 ml aliquots into screw-cap tubes of the same size as those used in growing or diluting the bacterial inoculum. These tubes were tightly sealed and stored in the dark at room temperature. The barium sulfate turbidity standard was vigorously agitated on a mechanical vortex mixer before each use and inspected for a uniformly turbid appearance.

3.7. Disc diffusion methods 3.7.1. Inoculum Preparation Disk diffusion Antimicrobial susceptibility test is also referred to as the Kirby-Bauer method. To perform this test, three to five well isolated colonies after 18 to 24h of old culture was transferred to a tube containing Muller Hinton broth medium. Then the broth culture is incubated at 35°C until the turbidity of the culture meets the turbidity of a 0.5 McFarland turbidity standard. Inoculation of the MH agar plate was accomplished as described by the CLSI.

3.7.2. Inoculation of Test Plates Optimally, within 15 minutes after adjusting the turbidity of the inoculums suspension, a sterile cotton swab is dipped into the adjusted suspension. The swab is 34

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

rotated several times and pressed firmly on the inside wall of the tube above the fluid level. This removed excess inoculums from the swab. The dried surface of a Mueller- Hinton agar plate is inoculated by streaking the swab over the entire sterile agar surface. This procedure was repeated by streaking two more times, rotating the plate approximately 60° each time to ensure an even distribution of inoculums. As a final step, the rim of the agar is swabbed. The lid left ajar for 3 to 5 minutes, but no more than 15 minutes, to allow for any excess surface moisture to be absorbed before applying the drug impregnated disks.

3.7.3. Application of Discs to Inoculated Agar Plates The predetermined battery of antimicrobial discs was dispensed onto the surface of the inoculated agar plate. Each disc pressed down to ensure complete contact with the agar surface. No closer than 24 mm from center to center. No more than 12 discs placed on one 150 mm plate or more than 5 discs on a 100 mm plate. The plates are placed in an incubator set to 37°C within 15 minutes after the discs are applied.

3.7.4. Reading Plates and Interpreting Results After 16 to 18 hours of incubation, each plate was examined. The plate was satisfactorily inoculated, and the inoculums were correct, the resulting zones of inhibition were uniformly circular and there was a confluent lawn of growth. When individual colonies were apparent, the inoculums were too light and the test was repeated. The diameters of the zones of complete inhibition were measured, including the diameter of the disc. Zones were measured to the nearest whole millimeter, using a ruler, which is held on the back of the inverted Petri plate. The zone margin was taken as the area showing no obvious, visible growth that can be detected with the unaided eye. Faint growth of tiny colonies, which detected only with a magnifying lens at the edge of the zone of inhibited growth, was ignored. However, discrete colonies growing within a clear zone of inhibition were sub cultured, re-identified, and retested. The sizes of the zones of inhibition were interpreted by referring to table 3.18.

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 3.16. - Zone size interpretative chart (Based on Results obtained using Muller Hinton Agar) CLSI document M100-S23 (M02-A11) Concentration Sensitive Intermediate Resistant Sr.No. Antibiotics (in mcg) (mm) (mm ) ( mm) 1 Amoxycillin 10 ≥18 14-15 ≤13 2 Cloxacillin 5 ≥15 12-14 ≤11 3 Erythromycin 15 ≥23 14-22 ≤13 4 Tetracycline 30 ≥15 12-14 ≤11 5 Penicillin 2 units ≥15 12-14 ≤11 6 Co- Trimoxazole 25 ≥16 11-15 ≤10 7 Penicillin-V 3 ≥15 12-14 ≤11 8 Cephalexin 30 ≥15 12-14 ≤11 9 Gentamicin 10 ≥15 13-14 ≤12 10 Chloramphenicol 30 ≥18 13-17 ≤12 11 Norfloxacin 10 ≥17 13-16 ≤12 12 Ciprofloxacin 5 ≥21 16-20 ≤15 13 Nalidixic Acid 30 ≥19 14-18 ≤13 14 Nitrofurantoin 300 ≥17 15-16 ≤14 15 Levofloxacin 5 ≥19 16-18 ≤15 16 Imipenem 10 ≥19 16-18 ≤15 17 Sparfloxacin 5 ≥19 16-18 ≤15 18 Meropenem 10 ≥19 16-18 ≤15 19 Moxifloxacin 5 ≥24 21-23 ≤20 20 Ofloxacin 5 ≥18 13-15 ≤12 21 Tetracycline 10 ≥15 12-14 ≤11 22 Tobramycin 10 ≥15 13-14 ≤12 23 Amikacin 30 ≥17 15-16 ≤14 24 Linezolid 30 ≥23 21-22 ≤20 25 Gatifloxacin 5 ≥18 15-17 ≤14 26 Cefixime 5 ≥19 16-18 ≤15 27 Cefotaxime 30 ≥26 23-25 ≤22 28 Piperacillin 100 ≥21 15-20 ≤14 29 Cefpodoxime 10 ≥21 18-20 ≤17 30 Clindamycin 2 ≥21 15-20 ≤14 31 Ampicillin 10/10 ≥15 12-14 ≤11 32 Amoxyclav 20/10 ≥18 14-17 ≤13 33 Nitrofurantoin 300 ≥17 15-16 ≤14 34 Cefaclor 30 ≥18 15-17 ≤14 35 Cefaperazone 75 ≥21 16-20 ≤15 36 Cephoxitin 300 ≥18 15-17 ≤14 37 Ceftriaxone 30 ≥23 20-22 ≤19 38 Ceftazidime 30 ≥21 18-20 ≤17

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

3.8. Detection of biofilm formation by uropathogens by TCP method This quantitative test described by (Christensen, Simpson, & Younger, 1995) is considered the gold-standard method for biofilm detection.

3.8.1. Inoculums preparation Well isolated colonies of uropathogens from an 18-24h culture were inoculated in a tube containing 10mL of Trypticase soya broth with 1% glucose and incubated it at 37°C for the inoculums to an approximate cell density of 105 CFU/mL. The diluted sample was vortex for approximately 10 seconds to achieve a homogenous distribution of cells.

3.8.2. Inoculation and biofilm formation The standardized suspension was diluted in organism specific media to achieve an approximate cell density of 105 CFU/mL. The cultures were then diluted 1:100 with fresh medium. Individual wells of sterile 96 well flat bottom polystyrene tissue culture treated plates (Sigma-Aldrich, Costar, and USA) were filled with 200 μl of the diluted cultures. The control organisms were also incubated, diluted and added to tissue culture plate. Negative control wells contained inoculated sterile broth. The plates were incubated at 37°C for 48h.

3.8.3. Rinse dispersed cells from the biofilm After incubation, contents of each well were removed by gentle tapping. The wells were washed with 0.2 ml of phosphate buffer saline (pH 7.2) four times. This removed free floating bacteria. Biofilm formed by bacteria adherent to the wells were fixed by 2% sodium acetate and stained by crystal violet (0.1%). Excess stain was removed by using de-ionized water and plates were kept for drying. 3.8.4. Detection of Biofilm formation by micro ELISA auto reader Optical density of stained adherent biofilm was obtained by using micro ELISA auto reader (model 680, Biorad, UK) at wavelength 570 nm. The experiment was performed in triplicate and repeated three times. The interpretation of biofilm production was done according to the criteria of Stepanovic et al., (2007).

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 3.17. Interpretation of biofilm detection (Stepanovic et al., 2007). Mean OD value Adherence Biofilm formation

<0.120 Non Non/Weak

0.120-0.240 Moderate Moderate

>0.240 Strong Strong

3.9. Antibiotic and antimicrobial agents used to determine MIC and MBEC The MIC and MBEC of following selected antimicrobial agents was performed as these antimicrobial agents showed effective antimicrobial activity against isolated uropathogens.

3.9.1. Antibiotic stock solutions: general considerations Standard powder was obtained from the pharmaceutical company or a reputable supplier such as Sigma (Poole, Dorset, UK). Information was obtained from the supplier regarding expiry date, potency, solubility, stability as a powder and in solution, storage conditions and any relevant COSHH (Control of Substances Hazardous to Health) information.

3.9.2. Preparation of antibiotic stock solutions Suitable range of antibiotic concentrations was chosen for the organisms to be tested Stock solutions were prepared using the formula (1000/P) x V x C = W Where P = potency given by the manufacturer (μg/mg), V = volume required (mL), C = final concentration of solution (multiples of 1000) (mg/L), and W = weight of antibiotic in mg to be dissolved in volume V (mL). Solution were filter sterilized (0.2 µm pore size cellulose acetate filters; Sartorius AG, Goettingen, Germany); for preparation of further stock solutions, from the initial 10,000 mg/L 3.10. Determine the MIC of biofilm forming uropathogens by TCP Minimum inhibitory concentrations are defined as the lowest concentration of antimicrobial that will inhibit the visible growth of a micro-organism after overnight incubation; MICs are used by diagnostic laboratories, mainly to confirm resistance,

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

but most often as a research tool to determine the in-vitro activity of new antimicrobials, and to determine MIC breakpoints. Minimum inhibitory concentrations are considered the `gold standard’ for determining the susceptibility of organisms to antimicrobials and are therefore used to judge the performance of all other methods of susceptibility testing. MICs are used in diagnostic laboratories to confirm unusual resistance, to give a definitive answer when a borderline result is obtained by other methods of testing, or when disc diffusion methods are not appropriate, for The MIC is defined as the lowest concentration of a drug that will inhibit the visible growth of an organism after overnight incubation (this period is extended for organisms such as anaerobes, which require prolonged incubation for growth). Procedures: The MIC Assay was used to determine the break point of an antimicrobial agent against bacteria. Inoculum preparation: (As described earlier) Inoculation In a sterile 96 well Tissue culture plate 100 μl of test bacterial culture broth of 0.5 McFarland turbidly and 100ul of antimicrobial to be tested, different concentration of antimicrobial were added to each well. Blank and control well also set up. Incubated it at 37°C for 24h.

Detection of MIC After incubation presence of viable bacteria was determined by streak plate method on Muller-Hinton agar plates. Lowest concentration of antimicrobial agents at which there was no visible growth on Muller Hinton agar plate was considered as minimum inhibitory concentration. All steps carried out in a biological safety cabinet and aseptic technique on a bench top.

3.11. Determine the MBEC of biofilm forming uropathogens by TCP Procedures The MBEC was used to determine the efficacy of an antimicrobial agent against biofilm. The MBEC uses a 96-well plate with lid that allow for the adherence and

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

growth of biofilm. MBEC is a very time efficient and accurate method of testing antimicrobial agent efficacy against biofilm. Inoculums' preparation 0.5 McFarland standardized suspension. Dilute the standardized suspension in organism specific media to achieve an approximate cell density of 105 as explained before Inoculation and biofilm formation In sterile 96 well Tissue culture plate. Fresh Trypticase soya broth (100 μl) was added and blank and control well also set up. 1µL bacterial suspension was added into each well except blank and control and the mixture were diluted as 1:100. Incubated at 37°C for 48h. Rinse dispersed cells from the biofilm After 48h, decant the culture medium and rinse dispersed cells from the biofilm with phosphate buffer saline (pH 7.2) for four times to remove the planktonic bacteria from the well. Then different concentration of antimicrobial agents were added into each well and incubated at 37°C for 48h. Regrow of uropathogens After incubation again the plate was washed with phosphate buffer saline solution. 1% peptone water was added in each well and incubated at 37°C for 48h. So that the biofilm forming bacteria can regrow.

Detection of MBEC Presence of viable bacteria was determined by streak plate method on Muller-Hinton agar plates. Lowest concentration of antimicrobial agents at which bacteria failed to regrow within a biofilm considered as MBEC. All steps were carried out in a biological safety cabinet and aseptic technique on a bench top.

3.12. Coating techniques and setup of bladder model 3.12.1. The coating of urinary catheters with different antibiofilm and antimicrobial agents New Foley urinary catheters were taken, one was control (uncoated), and the other were coated with antibiofilm and antimicrobial agents coating of the catheter was performed by filling the catheter lumen with 1% sterile solution of the reagent tested. 40

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

The complete procedure was carried out aseptically and the filled catheters with antimicrobial agent were kept for 48h, after which the solutions were decanted and the coated catheters were used for further experiment.

3.12.2. Artificial urine preparation (Brooks & Keevil, 1997) The urine medium is based on the analyses of constituents of human urine given by Altman (1961). As far as possible, the mid-point values of the ranges given for each component have been used in the formulation of AUM (Artificial urine medium). The molar concentration of chlorine is a little high and that of urea a little low, corresponding to dilute urine. A daily urine volume of 21 was assumed. Bacteriological peptone was used in preference to the addition of individual amino acids for simplicity, as it contains a mixture of amino acids and short chain peptides. Yeast extract was included to account for the very small amounts of nucleic acids found in urine, and for trace elements. AUM was sterilized by passing through a 0.2µm nylon membrane filter, since autoclaving caused precipitation.

3.12.3. Coating agents to coat catheter 3.12.3.1. Antibiotics • Tobramycin (HiMedia India) • Chloramphenicol (HiMedia India) • Ceftazidime (HiMedia India)

3.12.3.2 Combination of nanoparticles with antibiotic

• Silver Nanoparticles (Sigma - Aldrich) • Copper Nanoparticles (Sigma - Aldrich) • Ceftazidime + Silver Nanoparticles (1:1) • Ceftazidime + Copper Nanoparticles (1:1)

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

3.12.3.3. Antiseptic agents

• Triclosan (HiMedia India) • Triclosan + Ceftazidime (1:1) Combination in Equal volume of both Triclosan solution and Ceftazidime antibiotic solution, 5mL of each shake it well on sonicator.

3.12.3.4. Natural herb oils

• Azadirachta indica oil (Neem oil) (Baidyanath, India) Neem oil of Baidyanath used as a coating agent • Syzygium aromaticum oil (Clove oil) (Dabur, India) Clove oil of Dabur used as a coating agent • Allium sativum oil (Garlic oil) (Herbal, India) Garlic oil of Herbal used as a coating agent • Cinnamomum verum oil (Cinnamon oil) (Herbal, India) Cinnamon oil of Herbal used as a coating agent • Phyllanthus emblica oil (Amla oil) (Dabur, India) Amla oil of Dabur used as a coating agent • Neem oil + Garlic oil (1:1) Combination of Neem oil of Baidyanath and Garlic oil of Herbal in equal volume used as a coating agent

3.12.4. Experimental set up and bladder model A continuous flow model system was set up as urinary bladder. For the complete experiment artificial urine were prepared and sterilized by membrane filter. Each bottle was filled with 1000mL of artificial urine. In the sterilized urine 1mL broth culture (0.5 Mc Farland turbidity) of strong biofilm forming Pseudomonas aeruginosa that were isolated from contaminated urinary catheter was added. The flow of inoculated urine was adjusted to 1mL/min for 24h. After 24h, 5cm section of catheter tip from the drainage end was cut aseptically. The cut catheter was flushed with phosphate buffer saline to remove planktonic bacteria and the biofilm formation was determined 42

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

3.12.5. Processing of coated Foley urinary catheters to determine the durability to prevent bacterial colonisation by using Quarter strength Ringers solution After establishing complete experimental set up the urine present in bottles which contain Pseudomonas culture was allowed to passes from coated catheter. After every 24h, 1to 2 cm tip of coated catheter cut aseptically and suspended in Quarter strength ringer solution (10 mL) in sterile test tube. After that sonication was carried for 5 min at 35 kHz in transonic water bath and vortex mixing for 2 min to remove and disrupt the colonizing biofilm. After sonication cells came to ringer solution. Loopful of suspension was spread over Hichrome UTI agar plate, incubated at 37˚C for 24h. The procedure was repeated every 24h till the growth appeared.

3.12.6. Scanning Electron Microscopy of treated Foley urinary catheter The section of treated and untreated catheter when detected with presence of uropathogen was, observed by scanning electron microscopy. The section was outsourced in aseptic condition to the National Chemical Laboratory Pune. Scanning electron microscopy images were obtained using FEI, QUANTA 200 3D scanning electron microscope operating at 15 kV using tungsten filaments as electron source.

3.13. Detection of genes responsible for biofilm formation by PCR (Fim H, Curli (csgD), EPS genes (psl1, psl2) 3.13.1. DNA Extraction Genomic DNA templates for PCR amplification were gained from overnight growth of bacterial isolates on Luria-Bertani agar (Hi Media, India). 1.5ml of culture broth was taken in eppendorf tube. And centrifugation was carried out. Supernatant was discarded. Bacterial cell pellet were brought at room temperature before use. Resuspend the cells in 700µl of cell lysis solution at room temperature. Incubated at room temperature for 5minute and spin at 10,000rpm for 10 minute. Collected 500µl of the supernatant in a fresh vial, avoid taking the pellet. Added 1ml of alcohol to 500µl of supernatant. Mixed by inverting the tube till white strand of DNA precipitated out were observed. Spin at 10,000rpm for 30 minute and discarded the supernatant or spool precipitated DNA with the help of a tip and transferred into a fresh vial. Added 0.5ml of 70% 43

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

alcohol to the DNA pellet and given a short spin at 10,000rpm for 10minute. Decant the alcohol solution taking care not to dislodge the pellet. Repeat this step once again. Add 100µl of precipitin solution and incubated for 5minute at 50-55°C to increase the solubility of genomic DNA. Spin at 6,000rpm for 2minute to remove insoluble material pipette out the supernatant into a fresh vial.

3.13.2. Amplification of virulence genes The isolates were screened for the presence of virulence genes by polymerase chain

reaction (PCR). The bacterial isolates were subjected to screening for the presence of the fimH, Csg D, Psl1, Psl2 gene by PCR. The nucleotide sequence of the primers and the annealing temperature for amplification of the fimH, Csg D, Psl1, Psl2 gene by PCR the primer sequence of gene shown in table

Table 3.18. Primer used in genetic studies Sr No Gene Description Primer sequence (5’-3’) Cycling conditions (Nam, Eui-Hwa, Sungjin, Chae, & Hwang, 2013) Denaturation Annealing Extension Cycles F-TTGAGAACGGATAAGCCGTGG Type 1 1 Fim H fimbriae 94° 58° 72° 35 R- GCAGTCACCTGCCCTCCGGTA (Brombacher, Baratto, Dorel, & Landini, 2006)

F- CCCGTACCGCGACATTG 2 Csg D Curli 94° 52° 72° 22 R- ACGTTCTTGATCCTCCATGGA (Murakami, et al., 2017)

F-CGCATCGACGGTATCTGGCTGCAA 3 Psl1 EPS 94° 60° 72° 25 R- TAGGGAAAAGGGAGACGGGAGG

(Murakami, et al., 2017)

F- GCATGCCGAAACCCTTCA 4 Psl2 EPS 94° 51° 72° 30 R- CGATACGCAGGAAGGTCTT

PCR were performed in a 30µl reaction mixture containing 1.5U of Taq DNA polymerase. 3µl of 10X reaction buffer 2µl of 2mM dNTP mixture. 10pmol of the forward and reverse primer and 4µl of DNA template. The PCR conditions were as per the table 3.20 for each gene different annealing temperature.

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 3.19. Polymerase Chain Reaction Conditions Sr. No. Components µl (1X) 1 Water 17.7 µl 2 10x PCR buffer 3.0 µl 3 2mM dNTPs 2.0 µl 4 Forward primer 1.5 µl 5 Reverse primer 1.5 µl 6 5U Taq DNA Polymerase 0.3 µl 7 DNA template 4.0 µl Total 30.0 µl

3.13.3. Qualitative analysis of DNA using agarose gel electrophoresis

Prepared 1% agarose gel, added 2.5µl of Gel loading buffer to freshly extracted DNA samples. Load the sample along with 10µl of control DNA on a 1% agarose gel. Use of the 100bp ladder on the electric supply at 100 volt for 30 min upto ¾ of the gel. Then it was viewed under gel documentation system (Alpha InnoTech, USA). The gel images were recorded in .tif format.

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

4. Results and Discussion

In present study total of 560 urinary catheter samples were collected aseptically in HiDispoTM bags from 12 different hospitals of Amravati city, Maharashtra, India. During the collection, patient’s history was recorded along with the duration of catheterization. The catheter samples were immediately transported to laboratory for further processing.

The processing of each samples was done in five different section as per methodology in five sections A, B, C, D and E. Total of 22 different species of uropathogens were isolated from the catheter samples. Total 2041 isolates were identified through conventional and automated VITEK identification processes. Antibiotic susceptibility test were done for all the isolated bacterial uropathogens against different antibiotics by disk diffusion method. All the isolates were checked for the biofilm forming ability and were classified on the basis of biofilm formation as strong, moderate, weak and non biofilm forming isolates. Those with biofilm forming ability were selected for further study. Minimum inhibitory concentration and Minimum biofilm eradicating concentration of biofilm forming isolates against selected antibiotic and nanoparticles was determined. Presence of fim H, EPS and curli genes for biofilm formation were also studied in the selected biofilm producing isolates

Preventive strategies against biofilm forming uropathogens was done by treating sterilized urinary catheter with antimicrobial and antibiofilm agents and checked the prolonged in durability by artificial bladder model set at laboratory. The identification of bacterial growth in urinary catheter section were studied as per methodology by artificial bladder model set up and presence of biofilm and uropathogens were observed by scanning electron microscopy.

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

4.1. Sample collection and processing

Table 4.1: Hospitals of Amravati city from where catheter samples were collected Sr.No. Hospital Frequency Percent 1 Agrawal Maternity Hospital 28 5.0 2 Arihant Hospital 12 2.1 3 Baheti Hospital 20 3.6 4 Barbde Hospital 12 2.1 5 Critical care 72 12.9 6 Dufferin Hospital 56 10.0 7 Irwin Hospital 72 12.8 8 Multispeciality Hospital 12 2.1 9 O.G.Mundada Hospital 68 12.1 10 Parshree Hospital 48 8.6 11 Radiant Superspeciality 155 27.6 Hospital 12 Yadgire Hospital 5 0.89 Total 560 100.0

Urinary catheter samples were collected from12 different hospital of Amravati city, Maharashtra, India. Total 560 urinary catheter samples were studied (Table 4.1). The maximum number of catheter samples were collected from Radiant Superspeciality hospital and critical care as patients with the different diseases and number of hospitalized patients were more.

Table 4.2.Urinary catheter samples collected as per disease of patients No .of Valid Sr.No. Disease Patients Percent 1 Caesarean delivery 164 29.3 2 Kidney stone 128 22.9 3 Post operated fistula 24 4.2 4 Poisoning 20 3.5 5 Acute renal failure 20 3.5 6 Urothroplasty 16 2.9 7 Cancer 16 2.9 8 Fistula 16 2.9 9 Heart failure 16 2.9 47

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

10 Dialysis 12 2.1 11 Paralysis 12 2.1 12 Alcoholic poisoning 8 1.4 13 Appendices 8 1.4 14 Chronic attack 8 1.4 15 Non – operated 8 1.4 16 Fever 8 1.4 17 Hysterectomy 8 1.4 18 Intracranial bleeding 8 1.4 19 Chronic Obstructive Pulmonary Disease 4 .7 20 Diabetic, Cardiac, Paralysis 4 .7 21 Hepatal Disease 4 .7 22 Hypertension with diabetes mellitus and Parkinson`s 4 .7 23 Inveticular bleeding 4 .7 24 Leg fracture operation 4 .7 25 Normal delivery 4 .7 26 Operated 4 .7 27 Perecutaneous Nephrolithotromy 4 .7 28 Acute chronic syndrome with anemia 4 .7 29 Severe anemia shock 4 .7 30 TRVP 4 .7 31 Tubectomy 4 .7 32 Uterus operation 4 .7 33 White fluid 4 .7

The samples were collected from various patients with different disease. Samples were collected from total 33 different types of diseased patient catheterized with urinary catheters (Table 4.2). More catheter samples were collected from patient with caesarean section. Out of total samples 164 samples were of the caesarean section. The second highest count was from patients with kidney stone i.e. 128 catheter samples. 24 samples were from patients with post operated fistula. 20 samples were from patients with poisoning and renal failure. 16 catheters each were collected from patients with urothroplasty, cancer, fistula and heart failure. 8 samples were from patients with alcoholic poisoning, 4 catheters each were collected from patient with appendietis, chronic attack, non operated, fever, hysterectomy and intracranial bleeding.

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.3. Gender wise distribution of patients Gender Frequency Percent Female 340 60.7 Male 220 39.3 Total 560 100.0

Figure 4.1. Gender wise distribution of contaminated and non contaminated catheters

Gender is one of the important factors to be considered in urinary catheters study as there are more catheterized females as compared to males. In the present study total 560 urinary catheter samples were collected from different hospitals of Amravati city (Table 4.1). The female catheterized samples were more as compared to male catheterized patients. 340 catheters samples were of female and 220 of male with different duration and age. In the present study total 560 catheter samples were processed in which 534 catheter samples were found to be contaminated and 36 catheter samples were with no growth of any uropathogen.

Females From 340 samples of female, 320 catheter samples were contaminated with different uropathogens and only 20 catheters were found with no growth.

Males 49

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Out of total 220 male samples studied, the contamination with uropathogens was in 204 and 16 samples were found with no growth.

Discussion

Urinary tract infections represent the most commonly acquired bacterial infection. These infections are prevalent in both outpatient and hospital populations and are responsible for an estimated seven million office visits, one million emergency room visits and 100,000 hospitalizations annually (Foxman, 2003). Urinary tract infections account for an estimated 25%-40% of nosocomial infections and represent the most common type of these infections (Bagshaw & Laupland, 2006)(Foxman, 2003)(Kalsi, Arya, Wilson, & Mundy, 2003) (Maki & Tambyah, 2001) (Wagenlehner & Naber, 2006). The annual healthcare costs of urinary tract infections are estimated at $1.6 billion per year (Foxman, 2003). The risk of developing a urinary tract infection increases significantly with the use of indwelling devices such as catheters and urethral stents/sphincters. Indwelling catheters are the primary contributing factor in the development of these infections. The use of catheters to manage urinary incontinence in nursing home and spinal cord injury patients makes these populations especially vulnerable to these infections. Remarkably, the risk of developing catheter-associated urinary tract infections increases by 5% with each day of catheterization and virtually all patients are colonized by day 30 (Maki & Tambyah, 2001). In the present study the catheter sample with duration of 30days or more were found with diverse micro flora with biofilm forming ability. The ratio of contamination was observed more in female catheterized samples around 60% as compared to male. Abdallah et al., in 2011 investigated that frequency of UTI was greater in women as compared to men as 66% of the patients were females and 34% were males principally owing to anatomic and physical factors (Abdallah, Elsayed, Mostafa, & El-gohary, 2011).

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Figure 4.2. Percentage of catheter contamination according to patients gender

The percentage of contaminated and non contaminated catheter sample were studied and it was found that approximately 93% catheterized samples were contaminated with different uropathogens.In case of females 94% of the samples were found to be contaminated with uropathogenic isolates and in male 92% of the samples were contaminated. The rate of contaminated catheters is more in female patients as compared to male (Figure 4.2)

Table 4.4. Age wise distribution of patients Age in Patients Total (%) years <20 8 1.43 <30 140 25.00 <40 120 21.43 <50 60 10.71 <60 72 12.86 <70 96 17.14 <80 36 6.43 <90 24 4.29 <100 4 0.71 Total 560 100

The catheter samples were of different patients with different age group ranging from less than 20 to 100. In which maximum urinary catheter samples was of the patients with age group of 20 to 40. Only 4 samples were of patients with age 90 to 100.

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.5. Data Showing Duration of catheterization (stay of patients in various hospitals) No. of Duration Percent Patients <1 day 20 3.6 <5 days 245 43.8 <10 days 139 24.8 <15 days 45 8.0 <20 days 36 6.4 <30 days 15 2.7 <40 days 60 10.7 Total 560 100 Duration of catheterization is one of the important factors to study the biofilm forming uropathogens isolated from urinary catheters of patients. In this study samples of different duration were collected from less than 1 day upto 40 days of catheterization. Longer the duration more number of bacterial and fungal load were observed. There were 60samples of duration between 30 to 40 days. Also 15 samples of duration 20 to 30 days and 36 samples of 15 to 20 days and 45 samples were of duration 10 to15 days. 20 samples were of less than 1 day. It was observed that the maximum samples collected were of less than 5days and 10 days (245 and 139 respectively) .

Figure 4.3. Percentage of duration of catheterization of patients

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Duration of catheterization is one of the major causes of catheter associated urinary tract infections. Total 560 samples were studied from which 43% of samples were of 1-5 days and 39% samples were of duration 20-30 days and 25% of samples were of duration 5-10days.

Table 4.6. Frequency of contamination according to duration of catheterization Duration Total Non Contaminated % % (days) samples contaminated 6-7hr 8 4 50% 4 50% 1 20 8 40% 12 60% 2 108 100 93% 8 7% 3 88 80 91% 8 9% 4 40 36 90% 4 10% 5 48 36 75% 12 25% 6 8 4 50% 4 50% 7 36 36 100% 0 0% 8 44 40 91% 4 9% 9 8 8 100% 0 0% 10 36 28 77% 8 23% 11 4 4 100% 0 0% 15 32 32 100% 0 0% 18 4 4 100% 0 0% 20 8 4 50% 4 50% 28 4 4 100% 0 0% 30 60 56 93% 4 7% 40 4 4 100% 0 0% Total 560 486 87% 72 13%

The entire urinary catheter with duration of 7days, 9days, 11days, 15days, 18days, 28days and 40days were found to be contaminated with diverse micro flora. Samples with duration of 2days, 3days, 4days, 8days and 30days were found with 90% of contamination

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.7. Total No. of uropathogens with percentage Sr.No. Uropathogens Total No. Percentage (%) 1 Pseudomonas aeruginosa 472 16.054 2 Candida albicans 316 10.748 3 Escherichia coli 304 10.34% 4 Acinetobacter baumannii 288 9.795 5 Pseudomonas alcaligenes 264 8.98% 6 Klebsiella pneumoniae 196 6.666 7 Sphingomonas paucimobilis 196 6.666 8 Dermacoccus nishinomiyaensis 188 6.394 9 Staphylococcus aureus 124 4.217 10 Enterococcus faecalis 120 4.081 Staphylococcus 11 88 2.993 pseudintermedius 12 Bordetella hinzii 56 1.904 13 Raoultella ornithinolytica 52 1.768 14 Staphylococcus haemolyticus 44 1.496 15 Proteus mirabilis 40 1.36 16 Stenotrophomonas maltophilia 40 1.36 17 Enterococcus faecium 36 1.224 18 Granulicatella elegans 36 1.224 19 Gemella bergeri 28 0.952 20 Granulicatella adiacens 20 0.68 21 Shigella group isolated 20 0.68 22 Proteus vulgaris 12 0.408 Total 2940

4.2. Isolation and Identification of uropathogens

In the present study, 22 different uropathogenic species were isolated from 560 urinary catheter samples of patients from different hospitals. In that 21 bacterial uropathogens were isolated and only 1 fungal strain was identified. These isolated uropathogens were studied and identified by conventional method and some of them were identified by automated identification by VITEK 2 compact.

The common bacterial pathogens isolated were Pseudomonas aeruginosa (16%), Escherichia coli (10%), Klebsiella pneumonia (6%), Staphylococcus aureus (4%), Enterococcus faecalis (4%), Pseudomonas alcaligenes (9%) Enterococcus faecium (1%) and Proteus mirabilis (1%). All these were identified by conventional method of cultural, morphological and biochemical test. Fungal species Candida albicans (10%) was identified by conventional method. All other bacterial uropathogens like Acinetobacter baumannii (9%), Gemella bergeri (1%), Bordetella 54

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR) hinzii (2%), Granulicatella elegans (1%), Granulicatella adiacens (0.6%), Dermacoccus nishinomiyaensis (6%), Raoultella ornithinolytica (1%), Stenotrophomonas maltophilia (1%), Proteus vulgaris (0.4%), Staphylococcus haemolyticus (1.4%), Staphylococcus pseudintermedius (3%), andShigella group (0.6%) were identified by VITEK 2 compact automated system from Poona hospital and research center Pune, Maharashtra, India.

The most prominent uropathogenic bacteria isolated was Pseudomonas aeruginosa and 472 strains were isolated from the different sections of the catheter samples. The second most isolated uropathogen was Candida albicans (316) which is the fungal species isolated highest in number. Escherichia coli was the third highest count observed during the study. It is main cause of urinary tract infection found in most of the study

Figure 4.4. Total number of uropathogens isolated

Discussion

The predominant pathogens in urinary tract infections identified by (Emori & Gaynes, 1993) was Escherichia coli (25%), followed by Enterococci (16%), Pseudomonas aeruginosa (11%), Klebsiella pneumoniae (8%), Candida albicans (8%), Enterobacter (5%), Proteus mirabilis (5%), and coagulase-negative Staphylococci (4%) (Figure 4.4). These pathogens are typically found in the lower intestinal tract

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

and can be introduced into the urinary tract via contaminated indwelling devices. In the present study Pseudomonas aeruginosa was found in highest count among all isolates around 16% and second highest count was of Candida albicans and Escherichia coli around 10%. In present study different parameters was studied based on catheter associated urinary tract infections. Similarly (Alqahtani, 2013) investigated that duration plays the important role in the catheter associated nosocomial infection. In the present study also it was observed that the longer the duration the more number of colonized uropathogens isolated.

Table 4.8. Number of catheters showing presence of single and multiple isolates No. of No. of sample uropathogens 0 74 1 161 2 147 3 119 4 31 5 16 6 12

In the present study it was found that some urinary catheter samples have single uropathogen species and some of them are having multiple species. Some urinary catheters were with no uropathogens. The highest number of specie isolated from the catheter samples were 6 from 12 samples. From 560 samples 161 catheter samples were found with single uropathogen from all the sections of urinary catheters. Also 2 and 3 number of isolated uropathogens were found in the total of 147 and 119 collected urinary catheter samples of patients respectively (table 4.8).

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Discussion

Balasubramanian et al., in 2012 reported thatbacterial species colonize indwelling catheters as biofilm induce complications in patients care. From the biofilm matrix seven species of microbes were isolated. The predominant bacteria seen in catheters were E.coli, (27%) P. mirabilis (20%) and S. epidermis (18%) (Balasubramanian, Chairman, Singh, & Alagumuthu, 2012). The biomass of microbes associated with the biofilm was estimated. The mean dry weight of biomass of bacteria associated with a catheter that was used for over a month time was in the range 2.5 to 0.04g - 3.1 to 0.6g.But they found to colonize the microtitre plate to attain a peak growth at 84h. P.mirabilis isolated from the biofilm was able to tolerate the antibiotics tetracycline, Penicillin, Kanamycin and Gentamycin at a dose level of 20g/ml. In the present study also Pseudomonas aeruginosa was found to be predominant with 16% of total isolates.

Essomba et al., in 2013 investigated 204 samples (urine and pieces of catheter tube whose outer surface was disinfected or not) and were collected from 68 patients having indwelling urinary catheters. 5 species of bacteria namely E. coli, Klebsiella sp., Proteus sp., Serratia sp. and S. saprophyticus were identified as urinary pathogenic, following International Standards on Urinalysis (Essomba, et al., 2013).

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.9. Identification of various uropathogens by cultural, morphology and biochemical test

legans Bacterial species coli E. P. alcaligenes E. faecalis D nishinomiy aensis K. pneumonia P. mirabilis A. baumannii G. bergeri B. hinzii G. e P. aeruginosa Con vent VITEK VITEK VITEK VITEK VITEK VITEK Conve Conve Conve Conve Identified iona 2 2 2 2 2 2 ntional ntional ntional ntional by l automa automa automa automa automa automa method method method method met ted ted ted ted ted ted hod Fluore Blue Colonies Pin scent to Greeni Cream Blue character k- greeni Blue, Bluish purple Light White, Blue sh on colore coloni pur sh small green , brown small large pigme Hichrome d es UTI Agar ple pigme mucoi nt nt d Gram -ve -ve +ve +ve -ve -ve -ve +ve -ve +ve -ve staining Rod Cocco Diploc Shape Rods Cocci Cocci Rods Rods Rods Cocci Rods s bacilli occus Motility M M NM NM NM M NM NM M NM M Var Capsule iabl NC NC NC C NC C NC NC NC NC e Spore Non sporing

Indole + ------

MR + - - - - + - - - - -

VP - - + - + ------

Citrate - - - - + + + - + - +

Oxidase - + - + - - - - + - +

Urease - - - - + + VR + - -

H2S - - - - - + - - - - -

Gas + - - - + + - - - - +

Nitrate + + + - + + - - - - + reduction

Coagulase ------

Catalase + + - + + + + - + - +

Glucose + - + - + + + - - - -

Lactose + - + - + - + - - - -

Mannitol + - + - + - - VR - - +

Sucrose VR - + - + - - - - + -

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Bacterial species aureusS. S. maltophilia S. haemolyticus vulgarisP. E. faecium S. paucimobilis R. ornithinolytic a S . pseudinterme dius adiacensG. Shigella group VITEK VITEK VITEK VITEK VITEK VITEK VITEK VITEK Convent Convent Identified 2 2 2 2 2 2 2 2 ional ional by automat automat automat automat automat automat automat automat method method ed ed ed ed ed ed ed ed Colonies character Golden Dark Yellow Light Blue, white Cream Golden White, on Yellow yellow bluish ish brown small large colored yellow small Hichrome , small UTI Agar Gram Gm+ve Gm-ve Gm+ve Gm-ve Gm+ve Gm-ve Gm-ve Gm+ve Gm+ve Gm-ve staining Shape Cocci Rods Cocci Rods Cocci Rods Rods Cocci cocci Rods Motility NM M NM M NM M NM NM NM NM Capsule NC NC NC NC NC NC NC NC NC NC

Spore Non - Sporing

Indole - - - + - - + - - -

Methyl- + - - + ------Red Vogus- + - - VR + - + - - - Proskauer

Citrate + VR - - - + - - - -

Oxidase - - - - - + - - - -

Urease + - - + - - + - - -

H2S - - - + ------

Gas ------

Nitrate + + - + - - + - - - reduction

Coagulase + ------+ - -

Catalase + + + + - - - + - -

Glucose + + + + + + + - + +

Lactose + + - - + - - - + -

Mannitol + - - - + + - - + -

Sucrose + - + + + + + + + -

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Sphingomonas paucimobilis Acinetobacter baumannii

Granulicatella elegans Granulicatella adiacens

Stenotrophomonas maltophilia Staphylococcus pseudintermedius

Enterococcus faecalis Klebsiella pneumonia

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Pseudomonas aeruginosa Escherichia coli

Highly biofilm forming Klebsiella Highly biofilm forming Acinetobacter pneumonia

Highly biofilm forming Escherichia coli different biofilm forming colonies of E. coli, Klebsiella and other bacterial pathogens

4.3. Single and mixed uropathogens isolated from urinary catheter 61

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.10. Number of various uropathogens isolated from total urinary catheter present as single and mixed species Uropathogens Total Mixed species Single species Escherichia coli 148 134 14 Pseudomonas aeruginosa 164 123 41 Pseudomonas alcaligenes 86 78 8 Stenotrophomonas maltophilia 20 20 0 Acinetobacter baumannii 75 67 8 Staphylococcus pseudintermedius 32 32 0 Sphingomonas paucimobilis 56 54 4 Klebsiella pneumoniae 88 84 4 Raoultella ornithinolytica 12 8 4 Granulicatella adiacens 8 8 0 Staphylococcus haemolyticus 20 16 4 Dermacoccus nishinomiyaensis 56 48 8 Shigella group isolated 11 11 0 Granulicatella elegans 19 12 7 Enterococcus faecalis 560 catheter urinary Total 44 44 0 Staphylococcus aureus 76 65 11 Proteus mirabilis 32 24 8 Bordetella hinzii 16 16 0 Gemella bergeri 12 8 4 Proteus vulgaris 8 8 0 Enterococcus faecium 20 20 0 Candida albicans 84 56 28

Total 22 different types of uropathogens were isolated from the different section of the all the 560 urinary catheters of patients. It was investigated that some of the catheter samples was contaminated with single organisms in all the section A, B, C, D and E and some catheter with multiple was found. Table 1.10 shows presence ofsingle species and multi species of uropathogens in the catheter samples. Escherichia coli was detected more from the catheter sample with multiple uropathogen Pseudomonas aeruginosa was also found highest in mixed species. Some uropathogens that were detected only in the multiple growth includes Enterococcus faecalis, Stenotrophomonas maltophilia, Enterococcus faecium, Staphylococcus pseudintermedius Proteus vulgaris, Granulicatella adiacens Shigella group Enterococcus faecalis. Highest number of Pseudomonas aeruginosa (41) were present as a single species contaminant among the catheters indicating that it predominates the growth of other organisms.

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

4.4. Uropathogens from different section of urinary catheter

Table 4.11.Occurrence of different uropathogens in different sections of the urinary catheter Sections Bacterial species Total A B C D E Pseudomonas aeruginosa 472 108 92 88 80 104 Escherichia coli 304 112 48 52 48 44 Candida albicans 316 68 64 56 56 72 Acinetobacter baumannii 288 64 56 52 60 56 Klebsiella pneumoniae 196 56 36 36 36 32 Pseudomonas alcaligenes 264 48 60 48 52 56 Sphingomonas paucimobilis 196 44 40 32 40 40 Staphylococcus aureus 124 36 20 20 20 28 Dermacoccus nishinomiyaensis 188 36 40 40 40 32 Staphylococcus pseudintermedius 88 24 12 28 12 12 Enterococcus faecalis 120 20 32 24 20 24 Enterococcus faecium 36 16 4 8 4 4 Gemella bergeri 28 12 4 4 4 4 Bordetella hinzii 56 12 16 12 8 8 Granulicatella elegans 36 12 8 4 0 12 Raoultella ornithinolytica 52 12 12 12 8 8 Proteus mirabilis 40 8 20 8 0 4 Stenotrophomonas maltophilia 40 8 4 0 12 16 Staphylococcus haemolyticus 44 4 4 8 12 16 Proteus vulgaris 12 0 0 0 8 4 Granulicatella adiacens 20 0 4 4 8 4 Shigella group isolated 20 0 0 0 12 8 Total 2940 700 576 536 540 588

Processing of urinary catheter samples was done section wise as explained in methodology. Different section were studied and observed for different uropathogens in each section. Total of 2940 uropathogens were isolated from different sections of all 560 urinary catheter samples of patients. Maximum uropathogens were isolated from section A of the catheter samplei.e. total of 700 and the second highest in the section E (Table 4.11).

4.4.1. Section A

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

This section of urinary catheter remain inside the bladder. Catheter section with drainage port inflatable balloon anchor device in bladder inserted in to urethra and in to urinary bladder. Approximately 8 cm from the tip of catheter was considered as section A. Among all the total isolated uropathogens 700 uropathogenic species were isolated from the section A of 560 urinary catheter samples. In which Escherichia coli was isolated highest in number. Total 112 Escherichia coli were isolated from A section of the catheter sample. The second most prominent uropathogen isolated from section A was Pseudomonas aeruginosa and 108 isolates were identified. Candidaspecies total from section A were 68. Different uropathogens were also reported in which Acinetobacter baumannii (64) highly antibiotic resistant pathogen from hospital environment, Klebsiella pneumonia (56), Pseudomonas alcaligenes (48) and Staphylococcus aureus (36) all are the normal flora of the nosocomial infections. Some rare uropathogens were also reported from the section A were Sphingomonas paucimobilis (44), Dermacoccus nishinomiyaensis (36), Staphylococcus pseudintermedius (24). Enterococcus faecalis (20) and Enterococcus faecium (16) is normal inhabitant of hospital acquired infections. some rare uropathogens Gemella bergeri, Bordetella hinzii, Granulicatella elegans and Raoultella ornithinolytica were isolated 12 each from the catheter. Proteus mirabilis and Stenotrophomonas maltophilia were in 8 number. Staphylococcus haemolyticus were 4 in number.

4.4.2. Section B Next to the section A up to 8 cm was considered as section B it is inside the body. In section B total 576 uropathogens were detected. Pseudomonas aeruginosa (92) was found highest in number. The second most identified uropathogen were Candida species (64). Pseudomonas alcaligenes (60) was observed third most prominent uropathogen in the section B. Also Acinetobacter (56) were found in the section B. Escherichia coliwere detected (48). The rare bacteria reported from section B was Sphingomonas paucimobilis (40) and Dermacoccus nishinomiyaensis (40). Klebsiella pneumonia (36), Staphylococcus aureus (20) Enterococcus faecalis (32) and Enterococcus faecium (4) were isolated. Other rare uropathogens were also reported like Staphylococcus pseudintermedius (12), Gemella bergeri (4), Bordetella hinzii (16), Granulicetella elegans (8), Raoultella ornithinolytica (12), Proteus mirabilis

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

(20) Stenotrophomonas maltophilia (4), Staphylococcus haemolyticus (4), Granulicetella adiacens (4).

4.4.3. Section C After section B very next 8 cm section was considered as section C. This section C is partly inside the body and partly outside. From all the 560 catheters samples of section C 536 uropathogens were isolated and identified. In this section Pseudomonas aeruginosa was found in larger number as 88 isolates of Pseudomonas aeruginosa was isolated from section C. The second most prominent uropathogen identified was Candida species (56). Escherichia coli and Acinetobacter baumannii 52 isolates of each species were isolated. Pseudomonas alcaligenes (48), Klebsiella pneumonia (36) and Staphylococcus aureus (20) were detected. The rare uropathogens isolated from this section were Dermacoccus nishinomiyaensis (40), Sphingomonas paucimobilis (32), Staphylococcus pseudintermedius (28), Enterococcus faecalis (24), Enterococcus faecium (8), Gemella bergeri (4), Bordetella hinzii (12), Granulicetella elegans (4), Raoultella ornithinolytica (12), Proteus mirabilis (8), Staphylococcus haemolyticus (8), Granulicatella adiacens (4). In this section Stenotrophomonas maltophilia, Proteus vulgaris and Shigella group were not observed

4.4.4. Section D This section D were considered next 8cm after the section C and it remain outside the body of catheterized patient.. In this section D the highest count of Pseudomonas aeruginosa found total of 80 isolates. the second highest count of Acinetobacter baumannii (60). Candida species (56) and Pseudomonas alcaligenes (52) were found. The isolated Escherichia coli from the section D were 48. Other common nosocomial uropathogens were found in which Klebsiella pneumonia (36), Staphylococcus aureus (20) and Enterococcus faecalis (20). The rare uropathogens reported were Sphingomonas paucimobilis (40), Dermacoccus nishinomiyaensis (40), Staphylococcus pseudintermedius(12), Enterococcus faecium (4), Gemella bergeri (4), Bordetella hinzii (8), Raoultella ornithinolytica (8) Stenotrophomonas maltophilia (12), Staphylococcus haemolyticus (12), Shigella group (12), Proteus vulgaris (8) and Granulicatella adiacens (8). Those uropathogens were not reported from section D were Proteus mirabilis and Granulicatella elegans. 65

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

4.4.5. Section E The Section E was the last section of urinary catheter has connected to the urine bag and it is present in the external environment. This section E has two openings. One were connected to urine bag to collected urine from the bladder and another one for filling the fluid to inflate the balloon. This section comes in contact with the hospital flora and it may be the reason for more contamination. In this section total 588 isolates were identified. Pseudomonas aeruginosa was highest in number as compare to other uropathogens. Total of 104 Pseudomonas aeruginosa species were isolated. The second contaminant in the section E was Candida species in 72 number. Acinetobacter baumannii and Pseudomonas alcaligenes were in equal count of 56 isolates. Escherichia coliwere total 44 in this section. Other common uropathogens isolated from section E were Klebsiella pneumonia (32), Staphylococcus aureus (28), Enterococcus faecalis (24) and Shigella group (8). Rare uropathogens from the same section were Sphingomonas paucimobilis (40), Dermacoccus nishinomiyaensis (32), Staphylococcus pseudintermedius (12), Enterococcus faecium (4), Gemella bergeri (4), Bordetella hinzii (8), Granulicatella elegans (12), Raoultella ornithinolytica (8), Proteus mirabilis (4), Stenotrophomonas maltophilia (16), Staphylococcus haemolyticus (16), Proteus vulgaris (4) and Granulicatella adiacens (4).

In all the section A, B, C, D and E of the urinary catheters Pseudomonas aeruginosa was found as the most prominent uropathogen. In the section A highest count of Escherichia coli was found which may be endogenous as the section A is inside the bladder of the catheterized patients. So there maybe possibility that the highest count of E. coli from the section A was of patients flora or from inside the body. The Escherichia coli count in section E is the least as compare to all other sections.

In section B, C, D and E the highest count of Pseudomonas aeruginosa was identified. Section E were attached to the drainage bag in contact with the hospital environment. The hospital flora is with tremendous number of pathogens and Pseudomonas species one of the superbug present and continuously comes in contact with the section which is attached to the drainage bag. So this may be the reason of more count in section E. Also the Pseudomonas is highly motile bacterium so there was presence of Pseudomonas aeruginosa more frequently in section E to D, D to C

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

and C to B. Very less in section A as compare to other sections. Proteus vulgaris and Shigella group were isolated only from section E and section D. Granulicatella adiacens were isolated from all other sections except section A. Only Candida species were isolated from fungal group in all uropathogens and highest in section E.

The present study is first of its kind that is carried out section wise to detect the contamination of indwelling urinary catheter. This can detect the route of contamination of the catheter whether it is endogenous or exogenous. So different sections were done of the catheters and were studied separately. During the study varieties of uropathogens were isolated and diversity in each section were observed. Many of the uropathogens were reported as superbug and this may be the deadly cause of catheter associated infection. Total of 22 different type uropathogenic species was isolated from which some are not reported from urinary catheters before. This study reported many new uropathogens from the different sections of urinary catheter samples.

Figure 4.12. Urinary catheter samples of catheterized patients

Figure 4.13. Sections A, B, C, D and E of urinary catheter sample of patient suspended in ringer solution 67

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Figure 4.14.Section wise occurrence of uropathogens

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

4.5. Antibiotic susceptibility of all the uropathogens isolated was performed by disc diffusion method and its MAR Index was calculated.

Table 4.12. Antibiotic susceptibility of Escherichia coli isolates Antibiotic R % S % I % Amoxycillin 143 47% 88 29% 73 24% Cloxacillin 212 70% 12 4% 80 26% Erythromycin 22 7% 263 87% 19 6% Tetracycline 148 49% 73 24% 83 27% Penicillin 169 56% 58 19% 77 25% Co- Trimoxazole 125 41% 128 42% 51 17% Penicillin-V 238 78% 35 12% 31 10% Gentamycin 17 6% 270 89% 17 6% Chloramphenicol 19 6% 270 89% 15 5% Norfloxacin 199 65% 64 21% 41 13% Ciprofloxacin 16 5% 279 92% 9 3% Nalidixic Acid 201 66% 48 16% 55 18% Nitrofurantoin 200 66% 55 18% 49 16% Levofloxacin 209 69% 46 15% 49 16% Imipenem 143 47% 81 27% 80 26% Sparfloxacin 232 76% 40 13% 32 11% Meropenem 70 23% 196 64% 38 13% Moxifloxacin 206 68% 60 20% 38 13% Ofloxacin 222 73% 45 15% 37 12% Tobramycin 30 10% 234 77% 40 13% Amikacin 233 77% 40 13% 31 10% Linezolid 0 0% 0 0% 0 0% Gatifloxacin 77 25% 169 56% 58 19% Cefotaxime 119 39% 142 47% 42 14% Piperacillin 178 59% 90 30% 36 12% Cefixime 227 75% 42 14% 35 12% Cefpodoxime 233 77% 47 15% 24 8% Clindamycin 0 0% 0 0% 0 0% Ampicillin 37 12% 216 71% 51 17% Amoxyclav 101 33% 145 48% 59 19% Cefuroxim 250 82% 9 3% 45 15% Cephadroxil 237 78% 44 14% 23 8% Nitrofurantoin 166 55% 90 30% 48 16% Cefaclor 241 79% 45 15% 18 6% Cefaperazone 250 82% 50 16% 4 1% Cephoxitin 214 70% 46 15% 44 14% Ceftriaxone 216 71% 48 16% 40 13% Cephalexin 213 70% 34 11% 57 19% Ceftazidime 20 7% 260 86% 24 8% Source Primary data: ANOVA p-value <0.05 sig. R = Resistance, , S = Sensitive, I = Intermediate

The table 4.12 shows the antibiotic susceptibility test of E.coli isolates for different antibiotics. Percent sensitivity percent resistance and percent intermediate sensitivity

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

of E. coli species was determined. The highest sensitivity of E.coli isolates was detected towards ciprofloxacin (92%) and least to Cefuroxim and Cloxacillin (3% and 4%). High resistance of E.coliisolates wasdetected forPenicillin-V, Amikacin, Cefpodoxime, Cefuroxim, Cephadroxil, Cefaclor and Cefaperazone. Furthermore, One-way ANOVA analysis indicated that the difference in the antibiotic susceptibility was observed among the 304 Escherichia coli isolates against the 39 different antibiotics which were tested was statistically significant (p <0.05).

Figure 4.15. Antibiotic susceptibility of total E. coli isolates to different antibiotics

Table 4.13. MAR indices of Escherichia coli MAR index Number n=304 (Percent) 0 1 0% 0.1 2 1% 0.2 2 1% 0.3 22 7% 0.4 48 16% 0.5 85 28% 0.6 70 23% 0.7 59 19% 0.8 11 4% 0.9 3 1% 1 1 0% Total 304 100%

The MAR index of each bacterial uropathogens was determined and MAR index of 304 Escherichia coli isolates was calculated. It was observed that only 1% of E. coli strains has MAR index below 0.2 and maximum strains of Escherichia coli were with MAR index above 0.2. 28% of Escherichia coli isolates were observed with MAR index 0.5. MAR index more than 0.2 indicating its existence in antibiotic stress. This

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR) indicate high level of antibiotic resistance among E. coli isolated from indwelling urinary catheters.

Discussion

The second most prominent uropathogen isolated in the present study was E. coli with different antibiotic susceptibility pattern. Antibiotic susceptibility profile of Escherichia coli from urinary catheter was also studied by Koshariya et al., in 2015 and found it resistant to amoxicillin (58.7%), amoxicillin clavulanic acid (6.3%), ticarcillin (61.4%), cephalothi (66.8%), cefuroxime (77.6%), cefixime (83.6%), cefotaxime (99.8%), ceftazidime (99%), nalidixic acid (91.9%), norfloxacin (96.6%), ofloxacin (96.3%), ciprofloxacin (98.3%), cotrimoxazole (78.2%), fosfomycin (99.1%) and gentamicin, ampicillin 45.9%, co-amoxiclav (21.3%),cefadroxil (24.6%), nitrofurantoin (40.2%) , fosfomycin (15.6%) (Koshariya, Songra, Namdeo, Chaudhary, Agarwal, & Rai, 2015).

Table 4.14. Antibiotic susceptibility of Enterococcus faecalis isolates Antibiotic R % S % I % Amoxycillin 22 18% 94 78% 4 3% Cloxacillin 65 54% 45 38% 10 8% Erythromycin 14 12% 94 78% 12 10% Tetracycline 50 42% 64 53% 6 5% Penicillin 57 48% 52 43% 11 9% Co- Trimoxazole 64 53% 46 38% 10 8% Penicillin-V 59 49% 53 44% 8 7% Gentamycin 8 7% 111 93% 1 1% Chloramphenicol 24 20% 82 68% 14 12% Norfloxacin 59 49% 51 43% 10 8% Ciprofloxacin 38 32% 77 64% 5 4% Nalidixic Acid 47 39% 68 57% 5 4% Nitrofurantoin 50 42% 59 49% 11 9% Levofloxacin 58 48% 54 45% 8 7% Imipenem 54 45% 55 46% 11 9% Sparfloxacin 47 39% 71 59% 2 2% Meropenem 57 48% 51 43% 13 11% Moxifloxacin 51 43% 52 43% 17 14% Ofloxacin 69 58% 51 43% 0 0% Tobramycin 16 13% 99 83% 5 4% Amikacin 40 33% 60 50% 20 17% Linezolid 29 24% 84 70% 7 6% Gatifloxacin 33 28% 71 59% 16 13% Cefotaxime 89 74% 28 23% 3 3% Piperacillin 99 83% 20 17% 1 1% Cefixime 10 8% 108 90% 2 2%

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.14. Antibiotic susceptibility of Enterococcus faecalis isolates Antibiotic R % S % I % Cefpodoxime 74 62% 46 38% 0 0% Clindamycin 40 33% 76 63% 4 3% Ampicillin 61 51% 58 48% 1 1% Amoxyclav 47 39% 71 59% 2 2% Cefuroxim 61 51% 45 38% 14 12% Cephadroxil 70 58% 29 24% 21 18% Nitrofurantoin 59 49% 31 26% 30 25% Cefaclor 77 64% 31 26% 12 10% Cefaperazone 64 53% 45 38% 11 9% Cephoxitin 80 67% 28 23% 12 10% Ceftriaxone 45 38% 35 29% 40 33% Cephalexin 59 49% 47 39% 14 12% Ceftazidime 50 42% 52 43% 18 15% Source Primary data: ANOVA p-value <0.05 sig. R = Resistance, , S = Sensitive, I = Intermediate

The table 4.14 shows the antibiotic susceptibility test of Enterococcus faecalis isolates for against different antibiotics. Percent sensitivity percent resistance and percent intermediate, sensitivity of E. faecalis species was determined. Highest sensitivity of Enterococcus faecalis isolates was detected towards gentamycin (93%) and least towards piperacillin (17%). High resistance of Enterococcus faecalis isolate was detected for piperacillin (83%) followed by cefoxitin (67%), Cefaclor (64%), Cefpodoxime (62%), Cephadroxil (58%), Oflaxine (58%), Cloxacillin (54%), Co- Trimoxazole (53%), Cefaperazone (53%), Ampicillin (51%), Cefuroxim (51%).Furthermore, One-way ANOVA analysis indicated that the difference in the antibiotic susceptibility which was observed among the 120 Enterococcus faecalis isolates against the 39 different antibiotics which were tested was statistically significant (p <0.05).

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Figure 4.16. Antibiotic susceptibility of total E. faecalis isolates to different antibiotics

Table 4.15. MAR indices of Enterococcus faecalis MAR index Number n=120 (Percent) 0 0 0% 0.1 1 1% 0.2 13 11% 0.3 26 22% 0.4 15 13% 0.5 11 9% 0.6 24 20% 0.7 26 22% 0.8 4 3% 0.9 0 0% 1 0 0% Total 120 100%

The MAR index of each bacterial uropathogens was determined and MAR index of 120 Enterococcus faecalis isolates was calculated. It was observed that only 1% of Enterococcus faecalis strains has MAR index below 0.2 and maximum strain of Enterococcus faecalis are with MAR index above 0.2. The 22% of Enterococcus faecalis isolates were observed with MAR index 0.3 and 0.7. It showed that MAR index more than 0.2 indicating its existence in antibiotic stress. This indicates high level of resistance of E. faecalis to antibiotics.

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Discussion

In present study E. faecalis was isolated from the catheter sample of patients and susceptibility profile was studied and found that it was highly sensitive Gentamycin. E. faecalis is resistant to many commonly usedantimicrobial agents (aminoglycosides, aztreonam, cephalosporins, clindamycin, the semisynthetic penicillinsnafcillin and oxacillin, and trimethoprim sulfamethoxazole). Resistance to vancomycin in E. faecalis is becoming more common. (Amyes, 2007) (Courvalin, 2006) Treatment options for vancomycin-resistant E. faecalisinclude nitrofurantoin (in the case of uncomplicated UTIs) (Zhanel, Hoban, & Karlowsky, 2001) linezolid, and daptomycin, although ampicillin is preferred if the bacteria are susceptible. (Arias, Contreras, & Murray, 2010).

Table 4.16.Antibiotic susceptibility of Pseudomonas alcaligenes isolates Antibiotic R % S % I % Amoxycillin 260 98% 0 0% 4 2% Cloxacillin 246 93% 5 2% 13 5% Erythromycin 12 5% 241 91% 11 4% Tetracycline 222 84% 23 9% 19 7% Penicillin 228 86% 17 6% 19 7% Co- Trimoxazole 220 83% 24 9% 20 8% Penicillin-V 209 79% 36 14% 19 7% Gentamycin 20 8% 233 88% 11 4% Chloramphenicol 7 3% 241 91% 16 6% Norfloxacin 221 84% 21 8% 22 8% Ciprofloxacin 11 4% 237 90% 16 6% Nalidixic Acid 203 77% 33 13% 28 11% Nitrofurantoin 206 78% 44 17% 14 5% Levofloxacin 163 62% 78 30% 23 9% Imipenem 153 58% 88 33% 23 9% Sparfloxacin 149 56% 56 21% 59 22% Meropenem 168 64% 80 30% 16 6% Moxifloxacin 197 75% 38 14% 29 11% Ofloxacin 175 66% 29 11% 61 23% Tobramycin 27 10% 216 82% 21 8% Amikacin 190 72% 44 17% 30 11% Linezolid 0 0% 0 0% 0 0% Gatifloxacin 136 52% 86 33% 42 16% Cefotaxime 179 68% 33 13% 52 20% Piperacillin 171 65% 24 9% 69 26% Cefixime 199 75% 30 11% 35 13%

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.16.Antibiotic susceptibility of Pseudomonas alcaligenes isolates Antibiotic R % S % I % Cefpodoxime 191 72% 27 10% 46 17% Clindamycin 0 0% 0 0% 0 0% Ampicillin 129 49% 95 36% 40 15% Amoxyclav 92 35% 147 56% 25 9% Cefuroxim 199 75% 37 14% 28 11% Cephadroxil 206 78% 45 17% 13 5% Nitrofurantoin 162 61% 90 34% 12 5% Cefaclor 158 60% 81 31% 25 9% Cefaperazone 152 58% 83 31% 29 11% Cephoxitin 172 65% 77 29% 15 6% Ceftriaxone 191 72% 58 22% 16 6% Cephalexin 177 67% 43 16% 44 17% Ceftazidime 210 80% 32 12% 22 8% Source Primary data: ANOVA p-value <0.05 sig. R = Resistance, , S = Sensitive, I = Intermediate

The table 4.16 shows the antibiotic susceptibility test of P. alcaligenes isolated for different antibiotics. Percent sensitivity percent resistance and percent intermediate, sensitivity of P. alcaligenes species was determined. P. alcaligenes is highly sensitive to a very few antibiotics like Erythromycin, Chloramphenicol, Ciprofloxacin, Gentamycin and tobramycin. It is highly resistant to all other antibiotics tested. Furthermore, One-way ANOVA analysis indicated that the difference in the antibiotic susceptibility which was observed among the 264 Pseudomonas alcaligenes isolates against the 39 different antibiotics which were tested was statistically significant (p <0.05).

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Figure 4.17. Antibiotic susceptibility of total P. alcaligenes isolates to different antibiotics

Table 4.17.MAR indices of Pseudomonas alcaligenes MAR index Number n=264 (Percent) 0 0 0% 0.1 0 0% 0.2 6 2% 0.3 26 10% 0.4 14 5% 0.5 8 3% 0.6 44 17% 0.7 111 42% 0.8 51 19% 0.9 4 2% 1 0 0% Total 264 100%

The MAR index of each bacterial uropathogens was determine. MAR index of 264 Pseudomonas alcaligenes was calculated. It was observed that non of Pseudomonas alcaligenes strains has MAR index below 0.2. The 42% of Pseudomonas alcaligenes isolates was observed with MAR index 0.7. This indicates that all the isolates of P. alcaligenes showed resistance to all antibiotics tested.

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.18. Antibiotic susceptibility of Dermacoccus nishinomiyaensis isolates Antibiotic R % S % I % Amoxycillin 105 56% 48 26% 35 19% Cloxacillin 112 60% 35 19% 41 22% Erythromycin 26 14% 155 82% 7 4% Tetracycline 100 53% 82 44% 6 3% Penicillin 128 68% 21 11% 39 21% Co- Trimoxazole 103 55% 45 24% 40 21% Penicillin-V 89 47% 69 37% 30 16% Gentamycin 30 16% 157 84% 1 1% Chloramphenicol 38 20% 128 68% 22 12% Norfloxacin 115 61% 58 31% 15 8% Ciprofloxacin 38 20% 146 78% 4 2% Nalidixic Acid 87 46% 78 41% 23 12% Nitrofurantoin 108 57% 69 37% 11 6% Levofloxacin 126 67% 55 29% 7 4% Imipenem 101 54% 79 42% 8 4% Sparfloxacin 123 65% 53 28% 12 6% Meropenem 114 61% 57 30% 17 9% Moxifloxacin 120 64% 56 30% 12 6% Ofloxacin 112 60% 48 26% 28 15% Tobramycin 44 23% 129 69% 15 8% Amikacin 45 24% 130 69% 13 7% Linezolid 120 64% 52 28% 16 9% Gatifloxacin 96 51% 69 37% 23 12% Cefotaxime 124 66% 43 23% 21 11% Piperacillin 119 63% 60 32% 9 5% Cefixime 102 54% 63 34% 23 12% Cefpodoxime 112 60% 64 34% 12 6% Clindamycin 107 57% 65 35% 16 9% Ampicillin 111 59% 57 30% 20 11% Amoxyclav 41 22% 142 76% 5 3% Cefuroxim 95 51% 63 34% 30 16% Cephadroxil 128 68% 14 7% 46 24% Nitrofurantoin 94 50% 28 15% 66 35% Cefaclor 122 65% 27 14% 39 21% Cefaperazone 135 72% 26 14% 27 14% Cephoxitin 144 77% 35 19% 9 5% Ceftriaxone 177 94% 7 4% 4 2% Cephalexin 88 47% 81 43% 19 10% Ceftazidime 8 4% 178 95% 2 1% Source Primary data: ANOVA p-value <0.05 sig. R = Resistance, , S = Sensitive, I = Intermediate

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

The table 4.18 shows the antibiotic susceptibility test of D. nishinomiyaensis isolates for different antibiotics. Percent sensitivity percent resistance and percent intermediate of D. nishinomiyaensis species was determined. D. nishinomiyaensis showed higher resistance of 94% to the antibiotic Ceftriaxone. Highest sensitivity was detected for ceftazidime (95%), followed by 84% for gentamycin and 82% erythromycin. Furthermore, One-way ANOVA analysis indicated that the difference in the antibiotic susceptibility which was observed among the 188 D. nishinomiyaensis isolates against the 39 different antibiotics which were tested was statistically significant (p <0.05).

Figure 4.18. Antibiotic susceptibility of total D. nishinomiyaensis isolates to different antibiotics

Table 4.19.MAR indices of Dermacoccus nishinomiyaensis MAR index Number n=188 (Percent) 0 0 0% 0.1 0 0% 0.2 5 3% 0.3 25 13% 0.4 33 18% 0.5 18 10% 0.6 29 15% 0.7 47 25% 0.8 26 14% 0.9 5 3% 1 0 0% Total 188 100%

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table shows the MAR index of each bacterial uropathogens was determined MAR index of 188 D. nishinomiyaensis was calculated. It was observed that non of D. nishinomiyaensis strains has MAR index below 0.2. The 25% of D. nishinomiyaensis isolates was observed with MAR index 0.7. The MAR index ranged between 0.2 to 0.9 indicating resistance and existence in antibiotic stress.

Discussion

In present study Dermacoccus nishinomiyaensis rare bacterial uropathogens was isolated from the urinary catheter. Dermacoccus nishinomiyaensishad high resistance to antibiotics except Ceftazidime, Gentamycin and Erythromycin. In the same way Shah et al., in 2015 studied Post hysterectomy wound infection by Dermacoccus nishinomiyaensis case reports of a 28 years old patient whose caesarean section was done and she developed Post partum hemorrhage (Shah, Ostwal, Jadhav, & Shaikh, 2015).

Table 4.20. Antibiotic susceptibility of Klebsiella pneumonia isolates Antibiotic R % S % I % Amoxycillin 63 32% 112 57% 21 11% Cloxacillin 81 41% 101 52% 14 7% Erythromycin 28 14% 164 84% 4 2% Tetracycline 46 23% 139 71% 11 6% Penicillin 43 22% 33 17% 120 61% Co- Trimoxazole 79 40% 92 47% 25 13% Penicillin-V 101 52% 95 48% 0 0% Gentamycin 16 8% 167 85% 13 7% Chloramphenicol 29 15% 162 83% 5 3% Norfloxacin 92 47% 35 18% 69 35% Ciprofloxacin 36 18% 150 77% 10 5% Nalidixic Acid 92 47% 93 47% 11 6% Nitrofurantoin 85 43% 62 32% 49 25% Levofloxacin 96 49% 83 42% 17 9% Imipenem 98 50% 79 40% 19 10% Sparfloxacin 88 45% 87 44% 21 11% Meropenem 88 45% 65 33% 43 22% Moxifloxacin 48 24% 47 24% 101 52% Ofloxacin 62 32% 102 52% 32 16% Tobramycin 33 17% 151 77% 12 6% Amikacin 117 60% 72 37% 7 4% Linezolid 0 0% 0 0% 0 0% Gatifloxacin 103 53% 79 40% 14 7% Cefotaxime 85 43% 59 30% 52 27% Piperacillin 87 44% 82 42% 27 14% 79

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.20. Antibiotic susceptibility of Klebsiella pneumonia isolates Antibiotic R % S % I % Cefixime 90 46% 91 46% 15 8% Cefpodoxime 104 53% 73 37% 19 10% Clindamycin 0 0% 0 0% 0 0% Ampicillin 27 14% 167 85% 2 1% Amoxyclav 58 30% 59 30% 79 40% Cefuroxim 104 53% 77 39% 15 8% Cephadroxil 99 51% 74 38% 23 12% Nitrofurantoin 83 42% 52 27% 62 32% Cefaclor 79 40% 68 35% 49 25% Cefaperazone 89 45% 70 36% 37 19% Cephoxitin 71 36% 53 27% 72 37% Ceftriaxone 63 32% 48 24% 85 43% Cephalexin 92 47% 89 45% 15 8% Ceftazidime 34 17% 157 80% 5 3% Source Primary data: ANOVA p-value <0.05 sig. R = Resistance, , S = Sensitive, I = Intermediate The table 4.20. shows the antibiotic susceptibility test of Klebsiella pneumonia isolated for different antibiotics. Percent sensitivity percent resistance and percent intermediate sensitivity of Klebsiella pneumonia species was determined. Highest sensitivity of K. pneumonia isolates was detected towards Gentamycin (85%), Ampicillin (85%), and Chloramphenicol (83%). Highest resistance was detected for Amikacin (60%), Cefpodoxime (53%) and Penicillin-V (52%). Furthermore, One- way ANOVA analysis indicated that the difference in the antibiotic susceptibility which was observed among the 196 Klebsiella pneumonia isolates against the 39 different antibiotics which were tested was statistically significant (p <0.05).

Figure 4.19. Antibiotic susceptibility of total K. pneumoniae isolates to different antibiotics

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.21. MAR indices of Klebsiella pneumoniae MAR index Number n=196 (Percent) 0 0 0% 0.1 5 3% 0.2 28 14% 0.3 46 23% 0.4 39 20% 0.5 39 20% 0.6 30 15% 0.7 9 5% 0.8 0 0% 0.9 0 0% 1 0 0% Total 196 100%

The MAR index of each bacterial uropathogens was determine. MAR index of 196 Klebsiella pneumoniae was calculated. It was observed that only 3% of Klebsiella pneumoniae strains has MAR index below 0.2. The 20% of Klebsiella pneumoniae isolates was observed with MAR index 0.4 and 0.5. The MAR index ranged between 0.2 to 0.9 indicating resistance and existence in antibiotic stress.

Table 4.22. Antibiotic susceptibility of Proteus mirabilis isolates Antibiotic R % S % I % Amoxycillin 10 25% 3 8% 27 68% Cloxacillin 20 50% 10 25% 10 25% Erythromycin 6 15% 32 80% 2 5% Tetracycline 12 30% 9 23% 19 48% Penicillin 17 43% 10 25% 13 33% Co- Trimoxazole 9 23% 12 30% 19 48% Penicillin-V 9 23% 8 20% 23 58% Gentamycin 8 20% 22 55% 10 25% Chloramphenicol 2 5% 35 88% 3 8% Norfloxacin 22 55% 13 33% 5 13% Ciprofloxacin 0 0% 31 78% 9 23% Nalidixic Acid 9 23% 10 25% 21 53% Nitrofurantoin 10 25% 10 25% 20 50% Levofloxacin 16 40% 11 28% 13 33% Imipenem 9 23% 13 33% 18 45% Sparfloxacin 9 23% 14 35% 17 43% Meropenem 11 28% 17 43% 12 30% Moxifloxacin 15 38% 14 35% 11 28% Ofloxacin 10 25% 7 18% 23 58% Tobramycin 9 23% 24 60% 7 18% Amikacin 10 25% 16 40% 14 35% Linezolid 0 0% 0 0% 0 0% Gatifloxacin 22 55% 14 35% 4 10% 81

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.22. Antibiotic susceptibility of Proteus mirabilis isolates Antibiotic R % S % I % Cefotaxime 16 40% 10 25% 14 35% Piperacillin 24 60% 7 18% 9 23% Cefixime 17 43% 12 30% 11 28% Cefpodoxime 7 18% 14 35% 19 48% Clindamycin 0 0% 0 0% 0 0% Ampicillin/Sulbactam 1 3% 31 78% 8 20% Amoxyclav 17 43% 13 33% 10 25% Cefuroxim 16 40% 8 20% 16 40% Cephadroxil 15 38% 16 40% 9 23% Nitrofurantoin 15 38% 9 23% 16 40% Cefaclor 19 48% 13 33% 8 20% Cefaperazone 18 45% 10 25% 12 30% Cephoxitin 16 40% 10 25% 14 35% Ceftriaxone 21 53% 10 25% 8 20% Cephalexin 15 38% 12 30% 13 33% Ceftazidime 6 15% 30 75% 4 10% Source Primary data: ANOVA p-value <0.05 sig. R = Resistance, S = Sensitive, I = Intermediate P=0.4 not significant

The table 4.22. shows the antibiotic susceptibility test of Proteus mirabilis isolates for different antibiotics. Percent sensitivity percent resistance and percent intermediate sensitivity of Proteus mirabilis species was determined. Highest sensitivity of Proteus mirabilis isolates was detected towards Chloramphenicol (88%) and Erythromycin (80%). Highest resistance was detected for piperacillin (60%), Gatifloxacin (55%) and Cloxacillin (50%). Furthermore, One-way ANOVA analysis indicated that the difference in the antibiotic susceptibility which was observed among the 40 Proteus mirabilis isolates against the 39 different antibiotics which were tested was statistically significant (p <0.05).

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Figure 4.20. Antibiotic susceptibility of total Proteus mirabilis isolates to different antibiotics

Table 4.23.MAR indices of Proteus mirabilis MAR index Number n=40 (Percent) 0 0 0% 0.1 0 0% 0.2 8 20% 0.3 9 23% 0.4 17 43% 0.5 4 10% 0.6 2 5% 0.7 0 0% 0.8 0 0% 0.9 0 0% 1 0 0% Total 40 100%

Table shows the MAR index of each bacterial uropathogens was determined MAR index of 40 Proteus mirabilis was calculated. It was observed that non of Proteus mirabilis strains has MAR index below 0.2. The 43% of Proteus mirabilis isolates was observed with MAR index 0.4. The MAR index ranged between 0.2 to 0.9 indicating resistance and existence in antibiotic stress.

Discussion

In the present study Proteus mirabilis isolated from the catheter samples of the patients were found with different antibiogram. Bahashwan and Shafey, in 2013 investigated 6840 clinical samples collected from King Fahd Hospital at Medina, Kingdom of Saudi Arabia . Samples were screened for Proteus spp. It was found that 83

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Proteus spp. represented about 3% of all positive samples isolated from different clinical sources. Males were found to be more vulnerable than females in acquiring Proteus infections. Greatest number of Proteus spp. isolates from clinical specimens was isolated from wound and sputum swabs specimens representing about 88% of all clinical specimens. Antimicrobial sensitivity tests revealed that imipenem antibiotic was the most effective antibiotic against Proteus spp. with 91% of antimicrobial sensitivity and amikacin with 61% (Bahashwan & Shafey, Antimicrobial resistance patterns of Proteus isolates from clinical specimens., 2013).

Table 4.24. Antibiotic susceptibility of Acinetobacter baumannii isolates Antibiotic R % S % I % Amoxycillin 74 26% 46 16% 168 58% Cloxacillin 142 49% 41 14% 105 36% Erythromycin 131 45% 42 15% 115 40% Tetracycline 71 25% 57 20% 160 56% Penicillin 50 17% 43 15% 194 67% Co- Trimoxazole 68 24% 46 16% 174 60% Penicillin-V 74 26% 47 16% 167 58% Gentamycin 82 28% 123 43% 83 29% Chloramphenicol 52 18% 61 21% 175 61% Norfloxacin 81 28% 55 19% 152 53% Ciprofloxacin 58 20% 36 13% 194 67% Nalidixic Acid 64 22% 34 12% 190 66% Nitrofurantoin 63 22% 42 15% 183 64% Levofloxacin 71 25% 34 12% 183 64% Imipenem 53 18% 34 12% 201 70% Sparfloxacin 54 19% 42 15% 192 67% Meropenem 73 25% 44 15% 171 59% Moxifloxacin 66 23% 39 14% 183 64% Ofloxacin 69 24% 50 17% 168 58% Tobramycin 74 26% 37 13% 177 61% Amikacin 91 32% 53 18% 144 50% Linezolid 0 0% 0 0% 0 0% Gatifloxacin 78 27% 48 17% 162 56% Cefotaxime 54 19% 43 15% 191 66% Piperacillin 48 17% 29 10% 211 73% Cefixime 56 19% 27 9% 205 71% Cefpodoxime 78 27% 37 13% 173 60% Clindamycin 0 0% 0 0% 0 0% Ampicillin 69 24% 54 19% 165 57% Amoxyclav 56 19% 35 12% 197 68% Cefuroxim 61 21% 34 12% 192 67% Cephadroxil 61 21% 26 9% 201 70%

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.24. Antibiotic susceptibility of Acinetobacter baumannii isolates Antibiotic R % S % I % Nitrofurantoin 64 22% 32 11% 192 67% Cefaclor 61 21% 36 13% 191 66% Cefaperazone 61 21% 26 9% 201 70% Cephoxitin 57 20% 35 12% 196 68% Ceftriaxone 81 28% 39 14% 168 58% Cephalexin 111 39% 132 46% 45 16% Ceftazidime 56 19% 140 49% 92 32% Source Primary data: ANOVA p-value <0.05 sig. R = Resistance, , S = Sensitive, I = Intermediate

The table 4.24. shows the antibiotic susceptibility test of Acinetobacter baumannii isolates for different antibiotics. Percent sensitivity percent resistance and percent intermediate sensitivity of Acinetobacter baumannii species was determined. The highest sensitivity of Acinetobacter baumannii isolates was detected only towards Ceftazidime (49%) and Cephalexin (46%). The highest resistance was detected for Cloxacillin (49%). Acinetobacter baumannii was observed with intermediated antibiogram to most of the antibiotics. Furthermore, One-way ANOVA analysis indicated that the difference in the antibiotic susceptibility which was observed among the 288 Acinetobacter baumannii isolates against the 39 different antibiotics which were tested was statistically significant (p <0.05).

Figure 4.21. Antibiotic susceptibility of total A. baumannii isolates to different antibiotics

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.25.MAR indices of Acinetobacter baumannii MAR index Number n=288 (Percent) 0 1 0% 0.1 49 17% 0.2 69 24% 0.3 83 29% 0.4 47 16% 0.5 29 10% 0.6 8 3% 0.7 2 1% 0.8 0 0% 0.9 0 0% 1 0 0% Total 288 100%

The MAR index of each bacterial uropathogens was determined MAR index of 288 Acinetobacter baumannii was calculated. It was observed that 17% of Acinetobacter baumannii strains has MAR index below 0.2. The 29% of Acinetobacter baumannii isolates was observed with MAR index 0.3. The MAR index ranged between 0.2 to 0.9 indicating resistance and existence in antibiotic stress.

Discussion

In present study Acinetobacter baumanniiwas found to be fourth highest andhighly resistant to antibiotic except Ceftazidime. The Dutch microbiologist Beijerinck first isolated the organism in 1911 from soil using minimal media enriched with calcium acetate. Acinetobacter baumannii is a Gram-negative bacillus that is aerobic, pleomorphic and non-motile. An opportunistic pathogen, A. baumannii has a high incidence among immune compromised individuals, particularly those who have experienced a prolonged (90 day) hospital stay (Montefour et al., 2008). Commonly associated with aquatic environments, (Turton et al., 2006) it has been shown to colonize the skin as well as being isolated in high numbers from the respiratory and oropharynx secretions of infected individuals.(Sebeny et al., 2008). In recent years, it has been designated as a “red alert” human pathogen, generating alarm among the medical fraternity, arising largely from its extensive antibiotic resistance spectrum (Cerqueira et al., 2011). This phenomenon of multidrug-resistant (MDR) pathogens has increasingly become a cause for serious concern with regard to both nosocomial and community-acquired infections (Peleg et al., 2008). Indeed, the World Health

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Organization (WHO) has recently identified antimicrobial resistance as one of the three most important problems facing human health (Bassetti et al., 2011). While in the 1970s A. baumannii is thought to have been sensitive to most antibiotics, today the pathogen appears to exhibit extensive resistance to most first-line antibiotics ( Fournier et al.,2006), (Sandhu, Dahiya, & Sayal, 2016). Acinetobacter contributes to increased morbidity and mortality with its strong propensity to colonize and disseminate among humans and environmental sources coupled with its ability to develop resistance to antimicrobial agents. Clinical isolates of Acinetobacter recovered from routine samples of inpatients were analyzed retrospectively along with their antibiogram to evaluate in vitro activity of Doxycycline. Multiple antibiotic resistance index was calculated and interpreted. Out of 93 isolates of Acinetobacter species recovered, predominant were from urine 47(50.54%) and blood 27(29.03%) samples. MDR isolates were 57(61. 29%).Overall antimicrobial susceptibility pattern revealed best spectrum of activity with Imipenem (75.27%), Meropenem (68.82%) and Doxycycline (68.82%) whereas in MDR isolates Doxycycline exhibited highest sensitivity (66.67%) followed by Imipenem (61.40%) and Meropenem (52.63%). MAR indexes for different isolates revealed 71 (76.34%) with MAR index greater than 0.2 and 22 (23.66%) less than 0.2. However, three isolates had shown MAR index of 01 (i.e. resistant to all the antimicrobials tested), out of which two were recovered from intensive care unit and one from general surgery ward. Twenty-six MDR patterns were observed with nine antimicrobials tested. Resistance to COT, CIP, GEN, AK, A/S,CPM, IMP, MRP (R8) was most frequently observed pattern in 8(14.04%) of MDR isolates. Doxycycline has exhibited efficacy against MDR Acinetobacter, which can be considered as an alternative therapy to down regulate selective pressure on carbapenems. To confront the immediate threat of Acinetobacter infections, a workingantibiotic strategy should be addressed and stringent infection control practices are needed to prevent the spread of multi drug resistant isolates in the hospital. Maryam et al., in 2012 investigated 130 patients with culture positive for Acinetobacter spp. Microbiologic and specific demographic data were extracted from patient’s laboratory and archive file. The data were analyzed by using SPSS16 statistical software and chi-square and Mann-Whitney test. The prevalence of infection with Acinetobacter spp. separately by years was: 21.5, 30.8 and 47.7% in 1386, 1387 and 1388, respectively. 100% isolates were resistance to Carbnicillin, 87

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Piperacillin, Cefotaxime and Cephalotin, 99.2% to Ciprofloxacin, Cotrimoxazole and Chloramphenicol, 97.7% to Imipenem, 95.4% to Tetracycline and 91.5% to Gentamicin. Highest percentage sensitivity was to Amikacin14.6%. Nosocomial infections with Acinetobacter spp. during the three years, was a growing trend and all isolates were MDR and the highest susceptibility was to Amikacin (Maryam, Mohammadreza, Ali, & Mahdieh, 2012).It seems that the incorrect diagnosis, use of antibiotics for viral infections, inappropriate doses and time of antibiotic therapy, inappropriate formulation and low quality of some of antibiotics, are the most important cause of MDR. The proper use of antibiotics to prevent MDR bacterial nosocomial infections is recommended.

There is indirect evidence to suggest that biofilms were involved in urinary or bloodstream infections caused by Acinetobacter baumanniiin a study conducted by Rodriguez-Bano et al., in 2008. Biofilm formation was investigated in 92 strains using a microtiter plate assay. 63% of isolates formed biofilm. All catheter related urinary or bloodstream infections, and the sole case of cerebral shunt-related meningitis were caused by biofilm-forming strains (Rodríguez-Baño, et al., 2008).

Table 4.26. Antibiotic susceptibility of Gemella bergeri isolates Antibiotic R % S % I % Amoxycillin 3 11% 3 11% 22 79% Cloxacillin 15 54% 0 0% 13 46% Erythromycin 3 11% 9 32% 16 57% Tetracycline 15 54% 1 4% 12 43% Penicillin 19 68% 2 7% 7 25% Co- Trimoxazole 23 82% 1 4% 4 14% Penicillin-V 24 86% 1 4% 3 11% Gentamycin 10 36% 16 57% 2 7% Chloramphenicol 6 21% 20 71% 2 7% Norfloxacin 14 50% 4 14% 10 36% Ciprofloxacin 2 7% 19 68% 7 25% Nalidixic Acid 9 32% 3 11% 16 57% Nitrofurantoin 17 61% 4 14% 7 25% Levofloxacin 22 79% 4 14% 2 7% Imipenem 11 39% 2 7% 15 54% Sparfloxacin 9 32% 6 21% 13 46% Meropenem 2 7% 2 7% 24 86% Moxifloxacin 5 18% 5 18% 18 64% Ofloxacin 9 32% 6 21% 13 46% Tobramycin 5 18% 5 18% 18 64% 88

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Amikacin 6 21% 4 14% 18 64% Linezolid 9 32% 11 39% 8 29% Gatifloxacin 8 29% 1 4% 19 68% Cefotaxime 16 57% 7 25% 5 18% Piperacillin 16 57% 4 14% 8 29% Cefixime 4 14% 17 61% 7 25% Cefpodoxime 6 21% 11 39% 11 39% Clindamycin 13 46% 7 25% 8 29% Ampicillin/Sulbactam 6 21% 2 7% 20 71% Amoxyclav 13 46% 4 14% 11 39% Cefuroxim 16 57% 0 0% 12 43% Cephadroxil 14 50% 1 4% 13 46% Nitrofurantoin 19 68% 0 0% 9 32% Cefaclor 13 46% 0 0% 15 54% Cefaperazone 17 61% 1 4% 10 36% Cephoxitin 19 68% 2 7% 7 25% Ceftriaxone 20 71% 1 4% 7 25% Cephalexin 13 46% 3 11% 12 43% Ceftazidime 6 21% 17 61% 5 18% Source Primary data: ANOVA p-value <0.05 sig. R = Resistance, , S = Sensitive, I = Intermediate

The table 4.26. shows the antibiotic susceptibility test of Gemella bergeri isolates of different antibiotics. Percent sensitivity percent resistance and percent intermediate sensitivity of Gemella bergeri species was determined. The highest sensitivity of Gemella bergeri isolates was detected towards Chloramphenicol (71%) and Ciprofloxacin (68%). Highest resistance was detected towards Penicillin-V (86%), Co-trimoxazole (82%) and Levofloxacin (79%). Furthermore, One-way ANOVA analysis indicated that the difference in the antibiotic susceptibility which was observed among the 28 Gemella bergeri isolates against the 39 different antibiotics which were tested was statistically significant (p <0.05).

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Figure 4.22. Antibiotic susceptibility of total Gemella bergeri isolates to different antibiotics

Table 4.27.MAR indices of Gemella bergeri MAR index Number n=28 (Percent) 0 0 0% 0.1 0 0% 0.2 0 0% 0.3 1 4% 0.4 11 39% 0.5 11 39% 0.6 5 18% 0.7 0 0% 0.8 0 0% 0.9 0 0% 1 0 0% Total 28 100%

The MAR index of each bacterial uropathogens was determined. MAR index of 28 Gemella bergeri was calculated. It was observed that non of Gemella bergeri strains has MAR index below 0.2. The 39% of Gemella bergeri isolates was observed with MAR index 0.4 and 0.5. MAR index of G. bergeri ranged between 0.3 to 0.6 indicating resistance and existence in antibiotic stress.

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.28. Antibiotic susceptibility of Bordetella hinzii isolates Antibiotic R % S % I % Amoxycillin 22 39% 13 23% 21 38% Cloxacillin 37 66% 7 13% 12 21% Erythromycin 22 39% 27 48% 7 13% Tetracycline 9 16% 8 14% 39 70% Penicillin 27 48% 7 13% 21 38% Co- Trimoxazole 22 39% 3 5% 31 55% Penicillin-V 31 55% 6 11% 19 34% Gentamycin 9 16% 12 21% 35 63% Chloramphenicol 22 39% 16 29% 18 32% Norfloxacin 37 66% 3 5% 16 29% Ciprofloxacin 33 59% 12 21% 11 20% Nalidixic Acid 18 32% 9 16% 29 52% Nitrofurantoin 22 39% 10 18% 24 43% Levofloxacin 17 30% 12 21% 27 48% Imipenem 24 43% 12 21% 20 36% Sparfloxacin 27 48% 6 11% 23 41% Meropenem 16 29% 15 27% 25 45% Moxifloxacin 16 29% 14 25% 26 46% Ofloxacin 12 21% 7 13% 36 64% Tobramycin 30 54% 12 21% 14 25% Amikacin 10 18% 13 23% 33 59% Linezolid 0 0% 0 0% 0 0% Gatifloxacin 21 38% 6 11% 29 52% Cefotaxime 29 52% 6 11% 21 38% Piperacillin 21 38% 10 18% 25 45% Cefixime 22 39% 10 18% 24 43% Cefpodoxime 20 36% 5 9% 31 55% Clindamycin 0 0% 0 0% 0 0% Ampicillin 7 13% 13 23% 36 64% Amoxyclav 21 38% 17 30% 18 32% Cefuroxim 17 30% 9 16% 30 54% Cephadroxil 18 32% 8 14% 29 52% Nitrofurantoin 22 39% 7 13% 27 48% Cefaclor 25 45% 9 16% 22 39% Cefaperazone 23 41% 7 13% 26 46% Cephoxitin 26 46% 7 13% 23 41% Ceftriaxone 26 46% 3 5% 27 48% Cephalexin 39 70% 12 21% 5 9% Ceftazidime 15 27% 25 45% 16 29% Source Primary data: ANOVA p-value <0.05 sig. R = Resistance, , S = Sensitive, I = Intermediate

The table 4.28. shows the antibiotic susceptibility test of Bordetella hinzii isolates of different antibiotics. Percent sensitivity percent resistance and percent intermediate of 91

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Bordetella hinziispecies was determined. B. hinzii found with intermediate antibiogram pattern against most of the antibiotics. The highest sensitivity of B. hinzii isolates was detected towards Erythromycin (48%) and Ceftazidime (45%). Highest resistance was detected towards Cephalexin (70%) Furthermore, One-way ANOVA analysis indicated that the difference in the antibiotic susceptibility which was observed among the 56 Bordetella hinzii isolates against the 39 different antibiotics which were tested was statistically significant (p <0.05).

Figure 4.23. Antibiotic susceptibility of total Bordetella hinzii isolates to different antibiotics

Table 4.29. MAR indices of Bordetella hinzii MAR index Number n=56 (Percent) 0 0 0% 0.1 0 0% 0.2 4 7% 0.3 8 14% 0.4 21 38% 0.5 16 29% 0.6 7 13% 0.7 0 0% 0.8 0 0% 0.9 0 0% 1 0 0% Total 56 100%

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.29. shows the MAR index of each bacterial uropathogens was determined.MAR index of 56 Bordetella hinzii was calculated. It was observed that non of Bordetella hinzii strains has MAR index below 0.2. The 38% of Bordetella hinzii isolates was observed with MAR index 0.4. MAR index of B. hinzii ranged between 0.2 to 0.6 indicating resistance and existence in antibiotic stress.

Discussion

Bacteria of the genus Bordetella are Gram-negative, rod-shaped organisms that cause respiratory tract diseases in humans and animals. In 1995, Bordetella hinzii was isolated from poultry and 2 patients in the United States and France (Vandamme, Hommez, Vancanneyt, Hoste, & Cookson, 1995) . In the present study Bordetella hinzii was isolated from the urinary catheter samples of the patients. This is one of the rare uropathogen isolated from the catheter sample and antibiotic susceptibility of the pathogen was studied.

This pathogen colonizes the respiratory tract of poultry and is closely related to B. avium, which is a commensal species in poultry. However, information on the etiologic role, hosts, and transmission routes of B. hinzii is incomplete because infections in human who did not have any close contact with poultry have been reported, mainly in immunocompromised patients. They obtained a single isolate of B. hinzii from blood agar culture during screening for bacterial zoonotic diseases in blood samples of rodents in Southeast Asia during the Ceropath project. B. hinzii is a causative agent of respiratory tract illnesses in birds and has been described as an emerging and opportunistic pathogen in immunocompromised patients; and in patients with AIDS, cystic fibrosis, and fatal septicemia (Vandamme, Hommez, Vancanneyt, Hoste, & Cookson, 1995), (Kattar, Chavez, Limaye, Rassoulian-Barrett, Yarfitz, & Carlson, 2000), (Arvand, Feldhues, Mieth, Kraus, & Vandamme, 2004), (Fry, Duncan, Edwards, Tilley, Chitnayis, & Harman, 2007)(Funke, Hess, von Graevenitz, & Vandamme, 1996). However, the source of transmission is not clear. Transmission routes and reservoirs of B. hinzii infection are ambiguous. B. hinzii infection has also been reported in rabbits and laboratory mice in Hungary and Japan (Register, Register, Sacco, & Nordholm, 2003)(Hayashimoto, Morita, Yasuda, Ishida, Kameda, & Takakura, 2012) (Hayashimoto, Yasuda, Goto, Takakura, & Itoh, 2008)

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

(Hayashimoto, Yasuda, Goto, Takakura, & Itoh, Study of a Bordetella hinzii isolate from a laboratory mouse. , 2008)

Table 4.30. Antibiotic susceptibility of Granulicatella elegans isolates Antibiotic R % S % I % Amoxycillin 11 31% 7 19% 18 50% Cloxacillin 18 50% 4 11% 14 39% Erythromycin 16 44% 17 47% 3 8% Tetracycline 10 28% 11 31% 15 42% Penicillin 6 17% 8 22% 22 61% Co- Trimoxazole 9 25% 5 14% 22 61% Penicillin-V 13 36% 5 14% 18 50% Gentamycin 4 11% 15 42% 17 47% Chloramphenicol 2 6% 12 33% 22 61% Norfloxacin 7 19% 4 11% 25 69% Ciprofloxacin 6 17% 12 33% 18 50% Nalidixic Acid 18 50% 1 3% 17 47% Nitrofurantoin 9 25% 10 28% 17 47% Levofloxacin 10 28% 2 6% 24 67% Imipenem 9 25% 8 22% 19 53% Sparfloxacin 10 28% 6 17% 20 56% Meropenem 15 42% 8 22% 13 36% Moxifloxacin 13 36% 4 11% 19 53% Ofloxacin 5 14% 17 47% 14 39% Tobramycin 3 8% 14 39% 19 53% Amikacin 20 56% 6 17% 10 28% Linezolid 7 19% 9 25% 20 56% Gatifloxacin 4 11% 9 25% 23 64% Cefotaxime 15 42% 11 31% 10 28% Piperacillin 27 75% 1 3% 8 22% Cefixime 11 31% 11 31% 14 39% Cefpodoxime 14 39% 4 11% 18 50% Clindamycin 16 44% 7 19% 13 36% Ampicillin/Sulbactam 10 28% 6 17% 20 56% Amoxyclav 13 36% 6 17% 17 47% Cefuroxim 11 31% 4 11% 21 58% Cephadroxil 10 28% 6 17% 20 56% Nitrofurantoin 18 50% 1 3% 17 47% Cefaclor 20 56% 5 14% 11 31% Cefaperazone 14 39% 6 17% 16 44% Cephoxitin 20 56% 1 3% 15 42% Ceftriaxone 15 42% 3 8% 18 50% Cephalexin 19 53% 0 0% 17 47% Ceftazidime 12 33% 23 64% 1 3% Source Primary data: ANOVA p-value <0.05 sig. R = Resistance, S = Sensitive, I = Intermediate 94

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

The table 4.30. shows the antibiotic susceptibility test of G. elegans isolates of different antibiotics. Percent sensitivity percent resistance and percent intermediate sensitivity of Granulicatella elegansspecies was determined. The highest sensitivity of G. elegans isolates was detected towards only Ceftazidime (64%). Highest resistance was detected towards Piperacillin (75%).Furthermore, One-way ANOVA analysis indicated that the difference in the antibiotic susceptibility which was observed among the 36 Granulicatella elegans isolates against the 39 different antibiotics which were tested was statistically significant (p <0.05).

Figure 4.24.Antibiotic susceptibility of total G. elegans isolates to different antibiotics

Table 4.31. MAR indices of Granulicatella elegans MAR index Number n=36 (Percent) 0 0 0% 0.1 1 3% 0.2 11 31% 0.3 8 22% 0.4 0 0% 0.5 4 11% 0.6 10 28% 0.7 2 6% 0.8 0 0% 0.9 0 0% 1 0 0% Total 36 100%

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

MAR index of each bacterial uropathogens was determined and MAR index of 36 Granulicatella elegans was calculated. It was observed that only 3% of Granulicatella elegans strains had MAR index below 0.2. The 28% of Granulicatella elegans isolates was observed with MAR index 0.6. The MAR index ranged between 0.2 to 0.7 indicating resistance and existence in antibiotic stress.

Discussion

Granulicatella elegansis a genus of Gram positive bacteria of the family Carnobacteriaceae, found growing in satellite colonies around other bacteria. Many are penicillin resistant. They are found as normal flora in the upper respiratory, urogenital, and gastrointestinal tracts, and have been implicated in some cases of bacterial endocarditis. (Bizzaro, Callan, Farrel, Dembry, & Gallagher, 2011). During the present study Granulicatella elegans was isolated from urinary catheter samples and antibiotic susceptibility test was done. Granulicatella elegans found with moderately resistance. (Collins & Lawson, The genus Abiotrophia is not monophyletic is not monophyletic Nov., 2000). Stated that infections by Granulicatella most commonly occur in patients with underlying cardiac disease, febrile neutropenia or chemotherapy associated mucositis and neutropenia. Higher rates of orointestinal colonization by Granulicatella and subsequent mucositis may predispose for bacteremia in such patients (Senn, Entenza, & Greub, 2006). Shivappa et al., 2014 describe the case of a ten months old child with acute pyogenic meningitis with septicemia with parenteral diarrhea caused by Granulicatella elegans. (Shivappa, Kulkarni, Manjula, & Oral, 2014)

Table 4.32. Antibiotic susceptibility of Pseudomonas aeruginosa isolates Antibiotic R % S % I % Amoxycillin 174 37% 25 5% 273 58% Cloxacillin 187 40% 21 4% 264 56% Erythromycin 113 24% 74 16% 285 60% Tetracycline 94 20% 46 10% 332 70% Penicillin 78 17% 12 3% 382 81% Co- Trimoxazole 102 22% 26 6% 344 73% Penicillin-V 53 11% 108 23% 311 66% Gentamycin 80 17% 94 20% 298 63% Chloramphenicol 79 17% 91 19% 302 64% Norfloxacin 150 32% 35 7% 287 61% Ciprofloxacin 113 24% 21 4% 338 72% 96

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.32. Antibiotic susceptibility of Pseudomonas aeruginosa isolates Antibiotic R % S % I % Nalidixic Acid 138 29% 28 6% 306 65% Nitrofurantoin 150 32% 46 10% 276 58% Levofloxacin 122 26% 55 12% 292 62% Imipenem 89 19% 27 6% 357 76% Sparfloxacin 91 19% 35 7% 346 73% Meropenem 88 19% 30 6% 354 75% Moxifloxacin 101 21% 33 7% 338 72% Ofloxacin 110 23% 35 7% 327 69% Tobramycin 127 27% 60 13% 285 60% Amikacin 121 26% 60 13% 291 62% Linezolid 0 0% 0 0% 0 0% Gatifloxacin 102 22% 91 19% 279 59% Cefotaxime 84 18% 48 10% 340 72% Piperacillin 101 21% 46 10% 325 69% Cefixime 239 51% 27 6% 206 44% Cefpodoxime 109 23% 79 17% 284 60% Clindamycin 0 0% 0 0% 0 0% Ampicillin 107 23% 41 9% 325 69% Amoxyclav 89 19% 51 11% 330 70% Cefuroxim 76 16% 32 7% 364 77% Cephadroxil 84 18% 21 4% 367 78% Nitrofurantoin 80 17% 39 8% 353 75% Cefaclor 145 31% 22 5% 305 65% Cefaperazone 88 19% 43 9% 340 72% Cephoxitin 60 13% 27 6% 385 82% Ceftriaxone 83 18% 38 8% 350 74% Cephalexin 125 26% 60 13% 287 61% Ceftazidime 90 19% 114 24% 268 57% Source Primary data: ANOVA p-value <0.05 sig. R = Resistance, , S = Sensitive, I = Intermediate

The table 4.32. shows the antibiotic susceptibility test of P. aeruginosa isolates to different antibiotics. Percent sensitivity, percent resistance and percent intermediate sensitivity of Pseudomonas aeruginosa species was determined. P. aeruginosa was intermediate sensitive and resistance to almost all the antibiotic tested. Highest sensitivity of P. aeruginosa isolates was detected towards ceftazidime 24% only. Furthermore, one-way ANOVA analysis indicated that the difference in the antibiotic susceptibility which was observed among the 472 Pseudomonas aeruginosa isolates against the 39 different antibiotics which were tested was statistically significant (p <0.05).

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Figure 4.25. Antibiotic susceptibility of total P. aeruginosa isolates to different antibiotics

Table 4.33. MAR indices of Pseudomonas aeruginosa MAR index Number n=472 (Percent) 0 1 0% 0.1 30 6% 0.2 188 40% 0.3 156 33% 0.4 70 15% 0.5 25 5% 0.6 2 0% 0.7 0 0% 0.8 0 0% 0.9 0 0% 1 0 0% Total 472 100%

MAR index of each bacterial uropathogens was determined. MAR index of 472 P. aeruginosa was calculated. It was observed that only 6% of P. aeruginosa strains has MAR index below 0.2. The 40% of P. aeruginosa isolates was observed with MAR index 0.2. The MAR index ranged between 0.2 to 0.5 indicating the resistance and existence in antibiotic stress.

Discussion

In the present investigation P. aeruginosa was found to be the most predominant uropathogen from the urinary catheter sample of patient with high resistance to antibiotics. Similar study on the susceptibility profile for Pseudomonas aeruginosa was performed by Sivaraj et al., in 2011 The various antibiotics was tested against 50

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

isolates recovered from clinical isolates. Among the three aminoglycosides, amikacin showed 72% susceptibility, nitilmycin showed 60% susceptibility and gentamycin showed 52% susceptibility. Among the quinolones group ciprofloxacin showed 64% sensitivity, ceftriaxide and cephalosporin showed 64% sensitivity. Imipenem was found to be most effective antibiotic which showed 82% susceptibility(Sivaraj, Murugesan, Muthuyelu, Purusothaman, & Ilambarasan, 2011). P. aeruginosa is a predominant cause of opportunistic nosocomial infections also , accounting for 10% of hospital-acquired infections, with case fatality due to bacteremia as high as 50% (Richards et al., 1999; Hancock and Speert 2000). In addition, its high intrinsic resistance to antibiotics, its remarkable ability to develop resistance during antimicrobial treatment, and its preferred biofilm-mode of growth considerably complicates therapies aimed at eradicating both acute and chronic P. aeruginosa infections (Hancock and Speert 2000; Mah and O’Toole 2001; Donlan and Costerton 2002; Hoffman et al.. 2005). Due to their clinical importance, P. aeruginosa biofilms are one of the best-studied single-species biofilms. Over the years, certain themes regarding P. aeruginosa biofilms have emerged and been considered dogmatic. However, new advances in the field challenge many of the original findings. This has been the case with regard to the role of motility in P. aeruginosa biofilm formation, antimicrobial resistance strategies in biofilms, and the composition of the biofilm matrix. Biofilms formed by Pseudomonas aeruginosa have long been recognized as a challenge in clinical settings. Cystic fibrosis, endocarditis, device-related infections, and ventilator-associated pneumonia are some of the diseases that are considerably complicated by the formation of bacterial biofilms, which are resistant to most current antimicrobial therapies. Due to intense research efforts, our understanding of the molecular events involved in P. aeruginosa biofilm formation, maintenance, and antimicrobial resistance has advanced significantly. Over the years, several dogmas regarding these multicellular structures have emerged.

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.34. Antibiotic susceptibility of Staphylococcus aureus isolates Antibiotic R % S % I % Amoxycillin 28 23% 11 9% 85 69% Cloxacillin 26 21% 17 14% 81 65% Erythromycin 19 15% 20 16% 85 69% Tetracycline 37 30% 12 10% 75 60% Penicillin 18 15% 23 19% 83 67% Co- Trimoxazole 19 15% 16 13% 89 72% Penicillin-V 25 20% 19 15% 80 65% Gentamycin 19 15% 19 15% 86 69% Chloramphenicol 20 16% 12 10% 92 74% Norfloxacin 32 26% 14 11% 78 63% Ciprofloxacin 24 19% 11 9% 89 72% Nalidixic Acid 19 15% 14 11% 91 73% Nitrofurantoin 23 19% 10 8% 91 73% Levofloxacin 21 17% 14 11% 89 72% Imipenem 25 20% 7 6% 92 74% Sparfloxacin 18 15% 19 15% 87 70% Meropenem 34 27% 9 7% 81 65% Moxifloxacin 25 20% 10 8% 89 72% Ofloxacin 24 19% 10 8% 90 73% Tobramycin 27 22% 15 12% 82 66% Amikacin 23 19% 16 13% 85 69% Linezolid 17 14% 13 10% 94 76% Gatifloxacin 26 21% 14 11% 84 68% Cefotaxime 26 21% 18 15% 80 65% Piperacillin 56 45% 0 0% 68 55% Cefixime 35 28% 11 9% 77 62% Cefpodoxime 24 19% 6 5% 94 76% Clindamycin 21 17% 21 17% 82 66% Ampicillin/Sulbactam 24 19% 10 8% 90 73% Amoxyclav 29 23% 17 14% 78 63% Cefuroxim 26 21% 10 8% 88 71% Cephadroxil 24 19% 8 6% 92 74% Nitrofurantoin 22 18% 15 12% 87 70% Cefaclor 20 16% 10 8% 94 76% Cefaperazone 22 18% 14 11% 88 71% Cephoxitin 32 26% 5 4% 87 70% Ceftriaxone 39 31% 8 6% 77 62% Cephalexin 46 37% 12 10% 66 53% Ceftazidime 26 21% 9 7% 89 72% Source Primary data: ANOVA p-value <0.05 sig. R = Resistance, , S = Sensitive, I = Intermediate

The table 4.34. shows the antibiotic susceptibility test of Staphylococcus aureusisolates to different antibiotics. Percent sensitivity, percent resistance and 100

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR) percent intermediate sensitivity of Staphylococcus aureus species was determined. The sensitivity of S. aureus to the antibiotics tested was very low and the highest sensitivity detected towards Clindamycin only 17%. Highest resistance towards Piperacillin 45%. Furthermore, One-way ANOVA analysis indicated that the difference in the antibiotic susceptibility which was observed among the 124 Staphylococcus aureus isolates against the 39 different antibiotics which were tested was statistically significant (p <0.05).

Figure 4.26. Antibiotic susceptibility of total S. aureus isolates to different antibiotics

Table 4.35.MAR indices of Staphylococcus aureus MAR index Number n=124 (Percent) 0 2 2% 0.1 17 14% 0.2 42 34% 0.3 34 27% 0.4 18 15% 0.5 9 7% 0.6 2 2% 0.7 0 0% 0.8 0 0% 0.9 0 0% 1 0 0% Total 124 100%

101

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

The MAR index of each bacterial uropathogens was determined. MAR index of 124 Staphylococcus aureus was calculated. It was observed that 16% of Staphylococcus aureus strains has MAR index below 0.2. The 34% of S. aureus isolates was observed with MAR index 0.2. The MAR index range between 0.2 to 0.9 indicating resistance and existence in antibiotic stress.

Discussion

In present study Staphylococcus aureus was isolated from the urinary catheter samples of the patients with different antibiotic susceptibility profile and found that it is only sensitive to Clindamycin and resistant to all other antibiotic tested. Qu et al., in 2010 reported that most Staphylococcus spp. were resistant to penicillin G (100%), gentamicin (83%), and oxacillin (92%), and remained susceptible to vancomycin (100%), ciprofloxacin (100%) and rifampicin (79%)(Qu, Daley, Istivan, Garland, & Deighton, 2010), but in present study the isolated S. aureus were resistant to these antibiotic.

Table 4.36. Antibiotic susceptibility of Stenotrophomonas maltophilia isolates Antibiotic R % S % I % Amoxycillin 1 3% 8 20% 31 78% Cloxacillin 7 18% 4 10% 29 73% Erythromycin 0 0% 23 58% 17 43% Tetracycline 8 20% 2 5% 30 75% Penicillin 15 38% 2 5% 23 58% Co- Trimoxazole 11 28% 0 0% 29 73% Penicillin-V 9 23% 0 0% 31 78% Gentamycin 1 3% 15 38% 24 60% Chloramphenicol 0 0% 20 50% 20 50% Norfloxacin 21 53% 0 0% 19 48% Ciprofloxacin 2 5% 5 13% 33 83% Nalidixic Acid 15 38% 0 0% 25 63% Nitrofurantoin 6 15% 4 10% 30 75% Levofloxacin 17 43% 0 0% 23 58% Imipenem 3 8% 1 3% 36 90% Sparfloxacin 13 33% 0 0% 27 68% Meropenem 2 5% 7 18% 31 78% Moxifloxacin 12 30% 0 0% 28 70% Ofloxacin 14 35% 1 3% 25 63% Tobramycin 0 0% 26 65% 14 35% Amikacin 13 33% 7 18% 20 50% Linezolid 0 0% 0 0% 0 0% 102

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.36. Antibiotic susceptibility of Stenotrophomonas maltophilia isolates Antibiotic R % S % I % Gatifloxacin 7 18% 5 13% 28 70% Cefotaxime 0 0% 18 45% 22 55% Piperacillin 23 58% 0 0% 17 43% Cefixime 11 28% 1 3% 28 70% Cefpodoxime 11 28% 3 8% 26 65% Clindamycin 0 0% 0 0% 0 0% Ampicillin/Sulbactam 22 55% 1 3% 17 43% Amoxyclav 5 13% 9 23% 26 65% Cefuroxim 22 55% 0 0% 18 45% Cephadroxil 4 10% 7 18% 29 73% Nitrofurantoin 15 38% 0 0% 25 63% Cefaclor 16 40% 4 10% 20 50% Cefaperazone 11 28% 1 3% 28 70% Cephoxitin 8 20% 4 10% 28 70% Ceftriaxone 7 18% 2 5% 31 78% Cephalexin 20 50% 0 0% 20 50% Ceftazidime 0 0% 35 88% 5 13% Source Primary data: ANOVA p-value <0.05 sig. R = Resistance , S = Sensitive, I = Intermediate

The table 4.36. shows the antibiotic susceptibility test of S. maltophilia isolates to different antibiotics. Percent sensitivity, percent resistance and percent intermediate sensitivity of Stenotrophomonas maltophiliaspecies was determined. The highest sensitivity of S. maltophilia isolates was detected towards ceftazidime (88%). Highest resistance was detected towards Piperacillin (58%). Furthermore, One-way ANOVA analysis indicated that the difference in the antibiotic susceptibility which was observed among the 40 Stenotrophomonas maltophilia isolates against the 39 different antibiotics which were tested was statistically significant (p <0.05).

103

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Figure 4.27. Antibiotic susceptibility of total S. maltophilia isolates to different antibiotics

Table 4.37. MAR indices of Stenotrophomonas maltophilia MAR index Number n=40 (Percent) 0 0 0% 0.1 0 0% 0.2 11 28% 0.3 25 63% 0.4 4 10% 0.5 0 0% 0.6 0 0% 0.7 0 0% 0.8 0 0% 0.9 0 0% 1 0 0% Total 40 100%

MAR index of each bacterial uropathogens was determined. MAR index of 40 Stenotrophomonas maltophilia was calculated. It was observed that non of Stenotrophomonas maltophilia strains has MAR index below 0.2. The 63% of S. maltophilia isolates was observed with MAR index 0.3. The MAR index range between 0.2 to 0.9 indicating resistance and existence in antibiotic stress.

104

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Discussion

S. maltophilia can lead to nosocomial infections. Stenotrophomonas infections have been associated with high morbidity and mortality in severely immunocompromised and debilitated individuals. Risk factors associated with Stenotrophomonas infection include HIV infection, malignancy, cystic fibrosis, neutropenia, mechanical ventilation, central venous catheters, recent surgery, trauma, prolonged hospitalization, intensive care unit admission and broad-spectrum antibiotic use. (Chang, Ya Ting, Chum, Chen, & Hsueh, 2015)(Kwa, Low, Lim, Leow, Kurup, & Tam, 2008)(Falagas, Kastoris, Vouloumanou, Rafaildis, Kapaskelis, & Dimopoulos, 2009)(Paez & Costa, 2008) During the present study Stenotrophomonas maltophilia was isolated from the urinary catheter sample of patient with different diseases and duration. (Falagas, Kastoris, Vouloumanou, & Dimopoulos, 2009) in their review stated that, in human medicine, it is considered to be an uncommon pathogen in immune-competent individuals. Immunocompromised patients (patients with cancer, cystic fibrosis, chronic obstructive pulmonary disease, patients treated with steroids or immunosupressors) are more susceptible to S. maltophilia infection (Denton & Kerr, Microbial and clinical aspects of infection associated with Stenotrophomonas maltophilia., 1998) (Spicuzza, Sciuto, Vitaliti, DiDio, Leonardi, & La Rosa, 2009). The significance of Stenotrophomonas as an important nosocomial pathogen has risen over the last two decades. S. maltophilia can cause bacteraemia, endocarditis, pneumonia, meningitis, infections of bones and joints, urinary tract, soft tissues, and wounds. The bacterium is intrinsically resistant to β-lactams and is often resistant to other antimicrobials as well (Falagas, Kastoris, Vouloumanou, & Dimopoulos, Community acquired Stenotrophomonas maltophilia: a systematic review. , 2009). In veterinary medicine S. maltophilia is considered to be a coloniser. In domestic animals, there are only a few reports dealing explicitly with S. maltophilia infection. These have detailed the isolation of the bacterium from the airways of patients with chronic respiratory disease (Albini, Abril, Franchini, Hussy, & Filipoussis, 2009)(Winther, Anderson, Baptiste, Aalbak, & Guardabassi, 2010). A study was conducted by Trevino et al., in 2014among the 106 isolates obtained from patients whose age and gender were known, the age range was, 1–96 years (mean 39.8 years). In addition, the majority of patients were men (65.1 %). 105

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Based on CLSI interpretive criteria, isolates were highly resistant to imipenem (100%), meropenem (92.4 %), ampicillin (88.2 %),aztreonam (88.2 %), gentamicin (78.2%) and tobramycin (75.6%). Interestingly, we detected 32.8% resistance for TMP-SMX. Majority of the isolates were multidrug resistant (96.7 %, 115/119)(Trevino, Ferman, Otero, & Gonzalez, 2014). Similar results were observed in the present study and it was observed that they were highly sensitive to Ceftazidime Table 4.38. Antibiotic susceptibility of Staphylococcus haemolyticus isolates Antibiotic R % S % I % Amoxycillin 17 39% 15 34% 12 27% Cloxacillin 20 45% 3 7% 21 48% Erythromycin 6 14% 4 9% 34 77% Tetracycline 9 20% 11 25% 24 55% Penicillin 8 18% 14 32% 22 50% Co- Trimoxazole 20 45% 10 23% 14 32% Penicillin-V 9 20% 3 7% 32 73% Gentamycin 2 5% 24 55% 18 41% Chloramphenicol 8 18% 22 50% 14 32% Norfloxacin 20 45% 0 0% 24 55% Ciprofloxacin 12 27% 16 36% 16 36% Nalidixic Acid 20 45% 10 23% 14 32% Nitrofurantoin 12 27% 7 16% 25 57% Levofloxacin 7 16% 8 18% 29 66% Imipenem 15 34% 6 14% 23 52% Sparfloxacin 8 18% 9 20% 27 61% Meropenem 15 34% 7 16% 22 50% Moxifloxacin 16 36% 5 11% 23 52% Ofloxacin 6 14% 11 25% 27 61% Tobramycin 13 30% 21 48% 10 23% Amikacin 23 52% 8 18% 13 30% Linezolid 22 50% 8 18% 14 32% Gatifloxacin 19 43% 4 9% 21 48% Cefotaxime 16 36% 7 16% 21 48% Piperacillin 26 59% 3 7% 15 34% Cefixime 4 9% 22 50% 18 41% Cefpodoxime 21 48% 10 23% 13 30% Clindamycin 13 30% 8 18% 23 52% Ampicillin 14 32% 6 14% 24 55% Amoxyclav 17 39% 7 16% 20 45% Cefuroxim 21 48% 2 5% 21 48% Cephadroxil 15 34% 7 16% 22 50% Nitrofurantoin 19 43% 5 11% 20 45% Cefaclor 16 36% 3 7% 25 57%

106

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.38. Antibiotic susceptibility of Staphylococcus haemolyticus isolates Antibiotic R % S % I % Cefaperazone 16 36% 4 9% 24 55% Cephoxitin 13 30% 5 11% 26 59% Ceftriaxone 24 55% 3 7% 17 39% Cephalexin 5 11% 24 55% 15 34% Ceftazidime 3 7% 18 41% 23 52% Source Primary data: ANOVA p-value <0.05 sig. R = Resistance , S = Sensitive, I = Intermediate

The table 4.38. shows the antibiotic susceptibility test of S. haemolyticus isolates to different antibiotics. Percent sensitivity, percent resistance and percent intermediate sensitivity of Staphylococcus haemolyticus species was determined. Highest sensitivity of S. haemolyticus isolates was detected towards Gentamycin (55%) and Cephalexin (55%), least towards Cefuroxim (5%). Highest resistance of S. haemolyticus was detected against Piperacillin (59%). Furthermore, One-way ANOVA analysis indicated that the difference in the antibiotic susceptibility which was observed among the 44 S. haemolyticus isolates against the 39 different antibiotics which were tested was statistically significant (p <0.05).

Figure 4.28. Antibiotic susceptibility of total S. haemolyticus isolates to different antibiotics

107

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.39.MAR indices of Staphylococcus haemolyticus MAR index Number n=44 (Percent) 0 0 0% 0.1 0 0% 0.2 2 5% 0.3 13 30% 0.4 25 57% 0.5 4 9% 0.6 0 0% 0.7 0 0% 0.8 0 0% 0.9 0 0% 1 0 0% Total 44 100%

Table shows the MAR index of each bacterial uropathogens was determined MAR index of 44S. haemolyticus was calculated. It was observed that non of S. haemolyticus strains has MAR index below 0.2. The 55% of S. haemolyticus isolates was observed with MAR index 0.4. The MAR index range between 0.2 to 0.9 indicating resistance and existence in antibiotic stress.

Table 4.40. Antibiotic susceptibility of Proteus vulgaris isolates Antibiotic R % S % I % Amoxycillin 3 25% 8 67% 1 8% Cloxacillin 4 33% 1 8% 7 58% Erythromycin 2 17% 10 83% 0 0% Tetracycline 4 33% 8 67% 0 0% Penicillin 5 42% 6 50% 1 8% Co- Trimoxazole 6 50% 4 33% 2 17% Penicillin-V 4 33% 0 0% 8 67% Gentamycin 0 0% 8 67% 4 33% Chloramphenicol 0 0% 9 75% 3 25% Norfloxacin 2 17% 2 17% 8 67% Ciprofloxacin 2 17% 8 67% 2 17% Nalidixic Acid 3 25% 1 8% 8 67% Nitrofurantoin 2 17% 0 0% 10 83% Levofloxacin 2 17% 2 17% 8 67% Imipenem 1 8% 3 25% 8 67% Sparfloxacin 2 17% 1 8% 9 75% Meropenem 1 8% 1 8% 10 83% Moxifloxacin 3 25% 0 0% 9 75% Ofloxacin 0 0% 3 25% 9 75% Tobramycin 0 0% 4 33% 8 67% Amikacin 0 0% 1 8% 11 92% Linezolid 0 0% 0 0% 0 0%

108

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.40. Antibiotic susceptibility of Proteus vulgaris isolates Antibiotic R % S % I % Gatifloxacin 2 17% 3 25% 7 58% Cefotaxime 1 8% 1 8% 10 83% Piperacillin 4 33% 4 33% 4 33% Cefixime 1 8% 7 58% 4 33% Cefpodoxime 2 17% 6 50% 4 33% Clindamycin 0 0% 0 0% 0 0% Ampicillin/Sulbactam 0 0% 4 33% 8 67% Amoxyclav 4 33% 0 0% 8 67% Cefuroxim 3 25% 1 8% 8 67% Cephadroxil 2 17% 0 0% 10 83% Nitrofurantoin 1 8% 1 8% 10 83% Cefaclor 2 17% 1 8% 9 75% Cefaperazone 1 8% 1 8% 10 83% Cephoxitin 4 33% 0 0% 8 67% Ceftriaxone 1 8% 1 8% 10 83% Cephalexin 3 25% 0 0% 9 75% 100 Ceftazidime 0 0% 12 0 0% % Source Primary data: ANOVA p-value <0.05 sig. R = Resistance, , S = Sensitive, I = Intermediate

The table 4.40. shows the antibiotic susceptibility test of P. vulgaris isolates todifferent antibiotics. Percent sensitivity, percent resistance and percent intermediate sensitivity of Proteus vulgarisspecies was determined. All the isolates of Proteus vulgariswere sensitive to Ceftazidime (100%). Highest resistance was towards Co- Trimoxazole (50%). Furthermore, one-way ANOVA analysis indicated that the difference in the antibiotic susceptibility which was observed among the 264 Proteus vulgaris isolates against the 39 different antibiotics which were tested was statistically significant (p <0.05).

109

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Figure 4.29. Antibiotic susceptibility of total Proteus vulgaris isolates to different antibiotics

Table 4.41. MAR indices of Proteus vulgaris MAR index Number n=264 (Percent) 0 0 0% 0.1 2 17% 0.2 6 50% 0.3 3 25% 0.4 1 8% 0.5 0 0% 0.6 0 0% 0.7 0 0% 0.8 0 0% 0.9 0 0% 1 0 0% Total 12 100%

Table shows the MAR index of each bacterial uropathogens was determined. MAR index of 264 Proteus vulgaris was calculated. It was observed that 17% of Proteus vulgaris strains has MAR index below 0.2. The 50% of Proteus vulgaris isolates was observed with MAR index 0.2. The MAR index ranged between0.2 to 0.9 indicating resistance and existence in antibiotic stress.

110

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.42. Antibiotic susceptibility Enterococcus faecium isolates Antibiotic R % S % I % Amoxycillin 18 50% 5 14% 13 36% Cloxacillin 20 56% 1 3% 15 42% Erythromycin 1 3% 12 33% 23 64% Tetracycline 21 58% 4 11% 11 31% Penicillin 13 36% 7 19% 16 44% Co- Trimoxazole 11 31% 1 3% 24 67% Penicillin-V 9 25% 2 6% 25 69% Gentamycin 7 19% 13 36% 16 44% Chloramphenicol 0 0% 17 47% 19 53% Norfloxacin 16 44% 5 14% 15 42% Ciprofloxacin 3 8% 11 31% 22 61% Nalidixic Acid 14 39% 1 3% 21 58% Nitrofurantoin 12 33% 2 6% 22 61% Levofloxacin 11 31% 6 17% 19 53% Imipenem 9 25% 4 11% 23 64% Sparfloxacin 20 56% 5 14% 11 31% Meropenem 17 47% 2 6% 17 47% Moxifloxacin 15 42% 6 17% 15 42% Ofloxacin 16 44% 4 11% 16 44% Tobramycin 1 3% 15 42% 20 56% Amikacin 13 36% 0 0% 23 64% Linezolid 10 28% 3 8% 23 64% Gatifloxacin 13 36% 3 8% 20 56% Cefotaxime 2 6% 13 36% 21 58% Piperacillin 24 67% 0 0% 12 33% Cefixime 7 19% 4 11% 25 69% Cefpodoxime 7 19% 1 3% 28 78% Clindamycin 7 19% 3 8% 26 72% Ampicillin/Sulbactam 18 50% 2 6% 16 44% Amoxyclav 10 28% 0 0% 26 72% Cefuroxim 15 42% 2 6% 19 53% Cephadroxil 14 39% 0 0% 22 61% Nitrofurantoin 14 39% 3 8% 19 53% Cefaclor 16 44% 0 0% 20 56% Cefaperazone 21 58% 2 6% 13 36% Cephoxitin 18 50% 2 6% 16 44% Ceftriaxone 20 56% 0 0% 16 44% Cephalexin 13 36% 0 0% 23 64% Ceftazidime 3 8% 10 28% 23 64% Source Primary data: ANOVA p-value <0.05 sig. R = Resistance, , S = Sensitive, I = Intermediate

The table 4.42. shows the antibiotic susceptibility test of Enterococcus faecium isolates to different antibiotics. Percent sensitivity, percent resistance and percent 111

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR) intermediate sensitivity of Enterococcus faecium species was determined. The Highest sensitivity of E. faecium isolates was detected towards Chloramphenicol (47%). Highest resistance of E. faecium was detected against Piperacillin (67%). Furthermore, One-way ANOVA analysis indicated that the difference in the antibiotic susceptibility which was observed among the 36 Enterococcus faecium isolates against the 39 different antibiotics which were tested was statistically significant (p <0.05).

Figure 4.30. Antibiotic susceptibility of total E. faecium isolates to different antibiotics

Table 4.43. MAR indices of Enterococcus faecium MAR index Number n=36 (Percent) 0 0 0% 0.1 0 0% 0.2 2 6% 0.3 11 31% 0.4 12 33% 0.5 10 28% 0.6 0 0% 0.7 1 3% 0.8 0 0% 0.9 0 0% 1 0 0% Total 36 100%

112

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.43. shows the MAR index of each bacterial uropathogens. MAR index of 36 E. faecium was calculated. It was observed that none of Enterococcus faecium strains has MAR index below 0.2. The 33% of Enterococcus faecium isolates was observed with MAR index 0.4. The MAR index reanged between 0.2 to 0.9 indicating resistance and existence in antibiotic stress.

Discussion

Mengeloglu et al., in 2011, evaluate the differences between the antibiotic susceptibilities of the isolates of these two species isolated from various clinical specimens. In their study, 68 Enterococci strains (40 E. faecalis and 28 E. faecium) were identified at species level and the susceptibilities were performed by using Micro Scan Walk Away system. High rates of resistance to ciprofloxacin, rifampicin and erythromycin were observed. The resistance rate against Erythromycin was found the highest (Mengeloglu, Cakir, & Terzi, 2011). In the present study Enterococcus faecium was found to be highly resistance to almost all the antibiotics tested.

Table 4.44. Antibiotic susceptibility of Sphingomonas paucimobilis isolates Antibiotic R % S % I % Amoxycillin 71 36% 38 19% 87 44% Cloxacillin 95 48% 5 3% 96 49% Erythromycin 46 23% 78 40% 72 37% Tetracycline 30 15% 30 15% 136 69% Penicillin 27 14% 24 12% 145 74% Co- Trimoxazole 30 15% 24 12% 142 72% Penicillin-V 32 16% 21 11% 143 73% Gentamycin 32 16% 85 43% 79 40% Chloramphenicol 35 18% 65 33% 95 48% Norfloxacin 38 19% 29 15% 129 66% Ciprofloxacin 28 14% 29 15% 139 71% Nalidixic Acid 27 14% 32 16% 137 70% Nitrofurantoin 31 16% 22 11% 143 73% Levofloxacin 73 37% 27 14% 96 49% Imipenem 37 19% 23 12% 136 69% Sparfloxacin 32 16% 29 15% 135 69% Meropenem 29 15% 21 11% 146 74% Moxifloxacin 35 18% 27 14% 134 68% Ofloxacin 43 22% 11 6% 142 72% Tobramycin 29 15% 112 57% 55 28% Amikacin 46 23% 23 12% 127 65% Linezolid 33 17% 24 12% 139 71%

113

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.44. Antibiotic susceptibility of Sphingomonas paucimobilis isolates Antibiotic R % S % I % Gatifloxacin 38 19% 21 11% 137 70% Cefotaxime 46 23% 24 12% 126 64% Piperacillin 119 61% 6 3% 71 36% Cefixime 39 20% 28 14% 129 66% Cefpodoxime 39 20% 18 9% 139 71% Clindamycin 66 34% 19 10% 111 57% Ampicillin/Sulbactam 38 19% 31 16% 127 65% Amoxyclav 35 18% 34 17% 127 65% Cefuroxim 86 44% 9 5% 101 52% Cephadroxil 48 24% 14 7% 134 68% Nitrofurantoin 37 19% 19 10% 140 71% Cefaclor 105 54% 5 3% 86 44% Cefaperazone 41 21% 32 16% 123 63% Cephoxitin 35 18% 17 9% 144 73% Ceftriaxone 41 21% 20 10% 135 69% Cephalexin 103 53% 13 7% 80 41% Ceftazidime 29 15% 86 44% 81 41% Source Primary data: ANOVA p-value <0.05 sig. R = Resistance, , S = Sensitive, I = Intermediate

The table 4.44. shows the antibiotic susceptibility test of Sphingomonas paucimobilis isolates to different antibiotics. Percent sensitivity percent, resistance and percent intermediate sensitivity of Sphingomonas paucimobilis species was determined. The highest sensitivity of S. paucimobilis isolates was detected towards Tobramycin (57%). Highest resistance of Sphingomonas paucimobilis was detected towards Cefaclor (54%). Furthermore, One-way ANOVA analysis indicated that the difference in the antibiotic susceptibility which was observed among the 196 Sphingomonas paucimobilis isolates against the 39 different antibiotics which were tested was statistically significant (p <0.05).

114

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Figure 4.31. Antibiotic susceptibility of total S. paucimobilis isolates to different antibiotics

Table 4.45. MAR indices of Sphingomonas paucimobilis MAR index Number n=196 (Percent) 0 0 0% 0.1 21 11% 0.2 62 32% 0.3 53 27% 0.4 35 18% 0.5 19 10% 0.6 6 3% 0.7 0 0% 0.8 0 0% 0.9 0 0% 1 0 0% Total 196 100% Table 4.45. shows the MAR index of S. paucimobilis. MAR index of 196 S. paucimobilis was calculated. It was observed that only 11% of S. paucimobilis strains has MAR index below 0.2. The 32% of S. paucimobilis isolates was observed with MAR index 0.2. The MAR index ranged between 0.2 to 0.9 indicating resistance and existence in antibiotic stress.

Discussion

During the study Sphingomonas paucimobilis was isolated from the urinary catheter samples of patients. Sphingomonas paucimobilis is an aerobic Gram negative soil bacillus that has a single polar flagellum with slow motility. It has been implicated in various types of clinical infection. (Ryan & Adley, 2010). Infections in the immune compromised host continue to be a special topic of interest with the isolation of 115

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

uncommon etiological agents. Sphingomonas paucimobilis is regarded as a rare opportunistic human pathogen. This organism is widely distributed in the natural environment (especially water and soil). It has been implicated in nosocomial outbreak of bacteremia, catheter-related sepsis, meningitis, peritonitis, cutaneous infections, visceral abscesses, urinary tract infections, adenitis, and endopthalmitis. (Peel, Davis, Amstrong, Wilson, & Holmes, 1979)(Slotnick, Hall, & Sacks, 1979)(Southern & Kutscher, 1981), (Hajiroussou, Holmes, & Bullas, 1979)(Glupczynscky, Hansen, & Dratwa, 1984) (Bourigault, Daniel, & Jordain, 2007). It has also been recovered from nebulizers, respirators, dialysis, IV fluids and other medical equipments and has been documented to cause infection in the immune compromised host. They are thus known to exist as hospital environmental contaminants. Quinolones or the aminoglycosides (either alone or in combination with a b-lactam agent) are the antibiotics of choice in the treatment of infections caused by this organism. Reports exist with B-lactamase production too and treatment may safely be guided by the antibiotic susceptibility studies of the respective isolates. Also it was reported that Sphingomonas paucimobilis causes uncomplicated urinary tract infection in the renal transplant recipient patient. (Perola, Nousiainen, & Soumalainen, 2002)(Salazar, Martino, Sureda, Brunet, Subir'a, & Domingo-Albo's, 1995)(Kilic, Senses, Kurekci, Aydogan, Sener, & Kismet, 2007).

Table 4.46. Antibiotic susceptibility of Raoultella ornithinolytica isolates Antibiotic R % S % I % Amoxycillin 0 0% 12 23% 40 77% Cloxacillin 32 62% 12 23% 8 15% Erythromycin 18 35% 10 19% 24 46% Tetracycline 5 10% 14 27% 33 63% Penicillin 23 44% 17 33% 12 23% Co- Trimoxazole 19 37% 10 19% 23 44% Penicillin-V 25 48% 11 21% 16 31% Gentamycin 5 10% 29 56% 18 35% Chloramphenicol 3 6% 35 67% 14 27% Norfloxacin 27 52% 3 6% 22 42% Ciprofloxacin 18 35% 15 29% 19 37% Nalidixic Acid 25 48% 11 21% 16 31% Nitrofurantoin 20 38% 11 21% 21 40% Levofloxacin 17 33% 19 37% 16 31% Imipenem 19 37% 15 29% 18 35% Sparfloxacin 23 44% 14 27% 15 29% 116

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.46. Antibiotic susceptibility of Raoultella ornithinolytica isolates Antibiotic R % S % I % Meropenem 27 52% 13 25% 12 23% Moxifloxacin 20 38% 11 21% 21 40% Ofloxacin 23 44% 13 25% 16 31% Tobramycin 5 10% 23 44% 24 46% Amikacin 22 42% 16 31% 14 27% Linezolid 0 0% 0 0% 0 0% Gatifloxacin 23 44% 11 21% 18 35% Cefotaxime 24 46% 16 31% 12 23% Piperacillin 22 42% 9 17% 21 40% Cefixime 13 25% 22 42% 17 33% Cefpodoxime 23 44% 12 23% 17 33% Clindamycin 0 0% 0 0% 0 0% Ampicillin/Sulbactam 25 48% 15 29% 12 23% Amoxyclav 18 35% 11 21% 23 44% Cefuroxim 20 38% 11 21% 21 40% Cephadroxil 19 37% 13 25% 20 38% Nitrofurantoin 26 50% 9 17% 17 33% Cefaclor 23 44% 13 25% 16 31% Cefaperazone 21 40% 16 31% 15 29% Cephoxitin 25 48% 12 23% 15 29% Ceftriaxone 20 38% 9 17% 23 44% Cephalexin 28 54% 11 21% 13 25% Ceftazidime 16 31% 19 37% 17 33% Source Primary data: ANOVA p-value <0.05 sig. R = Resistance, , S = Sensitive, I = Intermediate

The table 4.46. shows the antibiotic susceptibility test of Raoultella ornithinolytica isolates to different antibiotics. Percent sensitivity, percent resistance and percent intermediate sensitivity of Raoultella ornithinolyticaspecies was determined. The highest sensitivity of R. ornithinolytica isolates was detected towards Chloramphenicol (67%). Highest resistance of Raoultella ornithinolytica was detected towards Cloxacillin (62%). Furthermore, One-way ANOVA analysis indicated that the difference in the antibiotic susceptibility which was observed among the 52 Raoultella ornithinolytica isolates against the 39 different antibiotics which were tested was statistically significant (p <0.05).

117

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Figure 4.32. Antibiotic susceptibility of total R. ornithinolytica isolates to different antibiotics

Table 4.47. MAR indices of Raoultella ornithinolytica MAR index Number n=52 (Percent) 0 0 0% 0.1 0 0% 0.2 2 4% 0.3 12 23% 0.4 20 38% 0.5 14 27% 0.6 4 8% 0.7 0 0% 0.8 0 0% 0.9 0 0% 1 0 0% Total 52 100%

MAR index of 52 strains of R. ornithinolytica was calculated. It was observed that non of R. ornithinolytica strains has MAR index below 0.2 The 38% of R. ornithinolytica isolates was observed with MAR index 0.4. The MAR index ranged between 0.2 to 0.9 indicating resistance and existence in antibiotic stress.

Discussion

In Present study Raoultella ornithinolytica was isolated from catheterized patient suffering from kidney stone. The genus Raoultella (formerly Klebsiella) is a member of the family Enterobacteriacae. Originally, Raoultella spp. though to occur solely in aquatic, botanic, and soil environments and has been never been isolated from clinical specimens (Bagley et al., 1978; Sakazaki et al., 1989). Recent studies showed that

118

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Raoultella isolated from clinical specimens has many virulence factors such as capsule, colonization factors antigens (CFA/I and CFA/III), production of siderophore, histamine and bacteriocin (Podschun et al., 1993; Podschun et al., 1998; Kanki et al., 2007). It was also found that Raoultella species strains were resistant to azteornam, nitrofurantoin, penicillins, and gentamicin but suscebtiple to piperacillin, imipenem, and ciprofloxacin.

Table 4.48. Antibiotic susceptibility of Staphylococcus pseudintermedius isolates Antibiotic R % S % I % Amoxycillin 20 23% 26 30% 42 48% Cloxacillin 47 53% 30 34% 11 13% Erythromycin 17 19% 68 77% 3 3% Tetracycline 30 34% 30 34% 28 32% Penicillin 29 33% 31 35% 28 32% Co- Trimoxazole 26 30% 32 36% 30 34% Penicillin-V 35 40% 22 25% 31 35% Gentamycin 17 19% 47 53% 24 27% Chloramphenicol 23 26% 49 56% 16 18% Norfloxacin 37 42% 34 39% 17 19% Ciprofloxacin 35 40% 23 26% 30 34% Nalidixic Acid 27 31% 18 20% 43 49% Nitrofurantoin 31 35% 29 33% 28 32% Levofloxacin 31 35% 27 31% 30 34% Imipenem 34 39% 22 25% 32 36% Sparfloxacin 32 36% 17 19% 39 44% Meropenem 40 45% 20 23% 28 32% Moxifloxacin 29 33% 26 30% 33 38% Ofloxacin 38 43% 22 25% 28 32% Tobramycin 19 22% 62 70% 7 8% Amikacin 42 48% 26 30% 20 23% Linezolid 50 57% 15 17% 23 26% Gatifloxacin 45 51% 18 20% 25 28% Cefotaxime 40 45% 20 23% 28 32% Piperacillin 49 56% 15 17% 24 27% Cefixime 18 20% 55 63% 15 17% Cefpodoxime 52 59% 30 34% 6 7% Clindamycin 33 38% 49 56% 6 7% Ampicillin 25 28% 50 57% 13 15% Amoxyclav 57 65% 25 28% 6 7% Cefuroxim 42 48% 33 38% 13 15% Cephadroxil 59 67% 12 14% 17 19% Nitrofurantoin 57 65% 19 22% 12 14% Cefaclor 24 27% 47 53% 17 19%

119

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.48. Antibiotic susceptibility of Staphylococcus pseudintermedius isolates Antibiotic R % S % I % Cefaperazone 44 50% 29 33% 15 17% Cephoxitin 46 52% 28 32% 14 16% Ceftriaxone 36 41% 38 43% 14 16% Cephalexin 44 50% 30 34% 14 16% Ceftazidime 12 14% 47 53% 29 33% Source Primary data: ANOVA p-value <0.05 sig. R = Resistance, , S = Sensitive, I = Intermediate

The table 4.48. shows the antibiotic susceptibility test of S. pseudintermedius isolates to different antibiotics. Percent sensitivity, percent resistance and percent intermediate sensitivity of Staphylococcus pseudintermedius species was determined. The highest sensitivity of S. pseudintermedius was detected towards Erythromycin (77%). Highest resistance was detected towards Cephadroxil (67%).Furthermore, One-way ANOVA analysis indicated that the difference in the antibiotic susceptibility which was observed among the 88 Staphylococcus pseudintermedius isolates against the 39 different antibiotics which were tested was statistically significant (p <0.05).

Figure 4.33. Antibiotic susceptibility of total S. pseudintermedius isolates to different antibiotics

120

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.49. MAR indices of Staphylococcus pseudintermedius MAR index Number n=88 (Percent) 0 0 0% 0.1 0 0% 0.2 4 5% 0.3 18 20% 0.4 23 26% 0.5 18 20% 0.6 20 23% 0.7 5 6% 0.8 0 0% 0.9 0 0% 1 0 0% Total 88 100%

The MAR index of each bacterial uropathogens was determined. MAR index of 88 Staphylococcus pseudintermedius was calculated. It was observed that none of the Staphylococcus pseudintermedius strains has MAR index below 0.2 The 26% of Staphylococcus pseudintermedius isolates was observed with MAR index 0.4. The MAR index ranged between 0.2 to 0.9 indicating resistance and existence in antibiotic stress.

Discussion

In present study Staphylococcus pseudintermedius was isolated from catheterized patient suffering from kidney stone of duration seven days in hospital. (Sasaki, Kikuchi, Tanaka, Takahashi, Kamata, & Hiramatsu, 2007) (Bannoehr, et al., 2007)(Devriese, et al., 2005) Staphylococcus pseudintermedius is a skin and mucous membrane commensal as well as the most important staphylococcal pathogen in dogs. It has also been labelled the overall most frequently bacterial pathogen isolated from clinical pathogen in skin- and ear infections (Bannoehr & Guardabassi, 2012) (Devriese, et al., 2005)(May, Hnilica, Frank, Jones, & Bernis, 2005), and canine dermatitis is one of the most common reasons for antimicrobial treatment in dogs, as well as for dog owners seeking veterinary care for their animal. Staphylococcus pseudintermedius is also recognized as an important pathogen in various soft tissue infections (Bannoehr & Guardabassi, 2012)(May, Hnilica, Frank, Jones, & Bernis, 2005)(Morris, Rook, Shofer, & Rankin, 2006). 121

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.50. Antibiotic susceptibility of Granulicatella adiacens isolates Antibiotic R % S % I % Amoxycillin 2 10% 10 50% 8 40% Cloxacillin 13 65% 6 30% 1 5% Erythromycin 0 0% 19 95% 1 5% Tetracycline 10 50% 6 30% 4 20% Penicillin 13 65% 2 10% 5 25% Co- Trimoxazole 5 25% 8 40% 7 35% Penicillin-V 13 65% 2 10% 5 25% Gentamycin 0 0% 15 75% 5 25% Chloramphenicol 0 0% 16 80% 4 20% Norfloxacin 14 70% 4 20% 2 10% Ciprofloxacin 1 5% 15 75% 4 20% Nalidixic Acid 3 15% 4 20% 13 65% Nitrofurantoin 11 55% 4 20% 5 25% Levofloxacin 11 55% 4 20% 5 25% Imipenem 13 65% 7 35% 0 0% Sparfloxacin 8 40% 9 45% 3 15% Meropenem 5 25% 9 45% 6 30% Moxifloxacin 16 80% 3 15% 1 5% Ofloxacin 3 15% 5 25% 12 60% Tobramycin 1 5% 16 80% 3 15% Amikacin 3 15% 14 70% 3 15% Linezolid 7 35% 7 35% 6 30% Gatifloxacin 0 0% 7 35% 13 65% Cefotaxime 12 60% 6 30% 2 10% Piperacillin 8 40% 1 5% 11 55% Cefixime 0 0% 19 95% 1 5% Cefpodoxime 8 40% 3 15% 9 45% Clindamycin 2 10% 1 5% 17 85% Ampicillin 0 0% 18 90% 2 10% Amoxyclav 8 40% 5 25% 7 35% Cefuroxim 17 85% 2 10% 1 5% Cephadroxil 10 50% 2 10% 8 40% Nitrofurantoin 13 65% 4 20% 3 15% Cefaclor 7 35% 9 45% 4 20% Cefaperazone 8 40% 6 30% 6 30% Cephoxitin 9 45% 6 30% 5 25% Ceftriaxone 13 65% 3 15% 4 20% Cephalexin 13 65% 6 30% 1 5% Ceftazidime 0 0% 16 80% 4 20% Source Primary data: ANOVA p-value <0.05 sig. R = Resistance, , S = Sensitive, I = Intermediate

122

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

The table 4.50. shows the antibiotic susceptibility test of G. adiacens isolates to different antibiotics. Percent sensitivity, percent resistance and percent intermediate sensitivity of Granulicatella adiacensspecies was determined. The highest sensitivity of G. adiacens was detected towards Erythromycin (95%) and Cefixime (95%). Highest resistance towards Cefuroxim (85%). Furthermore, One-way ANOVA analysis indicated that the difference in the antibiotic susceptibility which was observed among the 20 Granulicatella adiacens isolates against the 39 different antibiotics which were tested was statistically significant (p <0.05).

Figure 4.34. Antibiotic susceptibility of total G. adiacens isolates to different antibiotics

Table 4.51. MAR indices of Granulicatella adiacens MAR index Number n=20 (Percent) 0 0 0% 0.1 0 0% 0.2 0 0% 0.3 4 20% 0.4 8 40% 0.5 8 40% 0.6 0 0% 0.7 0 0% 0.8 0 0% 0.9 0 0% 1 0 0% Total 20 100%

123

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

The MAR index of each bacterial uropathogens was determined. MAR index of 20 G. adiacens was calculated. It was observed that no G. adiacens strains has MAR index below 0.2. The 40% of G. adiacens isolates was observed with MAR index 04 and 0.5. The MAR index ranged between 0.2 to 0.9 indicating resistance and existence in antibiotic stress.

Discussion

According to Unni et al., Granulicatella adiacens, a recently nomenclatured bacterium, was considered as one of the nutritionally variant streptococci and is a mouth commensal. It is redesignated as a streptococcus like bacterium since it differs from streptococci. A case was reported a case of infective endocarditis caused by this fastidious and unusual bacteria in a 63-year-old man with rheumatic valvular heart disease. G. adiacens was isolated from four of his blood culture samples, which was sensitive to beta lactams, moderately sensitive to gentamicin and resistant to erythromycin and co-trimoxazole. Patient recovered completely on treatment with high dose of ampicillin and gentamicin for 28 days (T, K, & Unni, 2013). But in present study Granulicatella adiascens was isolated from catheterized patient and antibiotic sensitivity pattern was studied with highly sensitive to erythromycin. Granulicatella adiacensis facultative anaerobic Gram positive coccus. It is catalase negative, Oxidase negative (Collins & Lawson, The genus Abiotrophia is not monophyletic Nov., 2000). G. adiacens colonies can grow as satellite colonies around other bacteria, such as Staphylococcus aureus. (George, 1974). They are the normal flora of oral cavity and are considered to be agents of endocarditic involving both native and prosthetic valves (Vandana et al., 2010). Nutritionally variant Streptococci are the etiological agents of infective endocarditis in 5%-6% of cases. The two genera that are categorized under nutritionally variant Streptococci are Granulicatella and Abiotrophia. Earlier it was reported as case due to Granulicatella adiacens with no pre-existing abnormalities. An early recovery of the organism from blood cultures facilitated successful treatment with combination antimicrobial therapy ( Lin and Hsu, 2007).

124

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.52. Antibiotic susceptibility of Shigella group isolated isolates Antibiotic R % S % I % Amoxycillin 3 15% 5 25% 12 60% Cloxacillin 3 15% 10 50% 7 35% Erythromycin 3 15% 16 80% 1 5% Tetracycline 3 15% 7 35% 10 50% Penicillin 10 50% 9 45% 1 5% Co- Trimoxazole 8 40% 11 55% 1 5% Penicillin-V 10 50% 4 20% 6 30% Gentamycin 1 5% 13 65% 2 10% Chloramphenicol 0 0% 12 60% 8 40% Norfloxacin 4 20% 11 55% 5 25% Ciprofloxacin 1 5% 17 85% 2 10% Nalidixic Acid 5 25% 9 45% 6 30% Nitrofurantoin 2 10% 6 30% 12 60% Levofloxacin 7 35% 6 30% 7 35% Imipenem 9 45% 3 15% 8 40% Sparfloxacin 12 60% 7 35% 1 5% Meropenem 9 45% 3 15% 8 40% Moxifloxacin 8 40% 8 40% 4 20% Ofloxacin 7 35% 6 30% 7 35% Tobramycin 6 30% 7 35% 6 30% Amikacin 5 25% 6 30% 9 45% Linezolid 0 0% 0 0% 0 0% Gatifloxacin 7 35% 10 50% 3 15% Cefotaxime 7 35% 6 30% 7 35% Piperacillin 8 40% 5 25% 7 35% Cefixime 6 30% 8 40% 6 30% Cefpodoxime 11 55% 5 25% 4 20% Clindamycin 0 0% 0 0% 0 0% Ampicillin 3 15% 14 70% 3 15% Amoxyclav 8 40% 9 45% 3 15% Cefuroxim 10 50% 9 45% 1 5% Cephadroxil 7 35% 9 45% 4 20% Nitrofurantoin 10 50% 7 35% 3 15% Cefaclor 11 55% 4 20% 5 25% Cefaperazone 8 40% 6 30% 6 30% Cephoxitin 11 55% 5 25% 4 20% Ceftriaxone 14 70% 4 20% 2 10% Cephalexin 11 55% 7 35% 2 10% Ceftazidime 2 10% 13 65% 5 25% Source Primary data: ANOVA p-value <0.05 sig. R = Resistance, , S = Sensitive, I = Intermediate

125

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

The table 4.52. shows the antibiotic susceptibility test of Shigella group isolates to different antibiotics. Percent sensitivity, percent resistance and percent intermediate sensitivity of Shigella group species was determined. The highest sensitivity of Shigella group isolates was detected towards Ciprofloxacin. The highest resistance of Shigella group isolates was detected for Ceftriaxone (70%). Furthermore, One-way ANOVA analysis indicated that the difference in the antibiotic susceptibility which was observed among the 20 Shigella group isolates against the 39 different antibiotics which were tested was statistically significant (p <0.05).

Figure 4.35. Antibiotic susceptibility of total Shigella isolates to different antibiotics

Table 4.53. MAR indices of Shigella group isolated MAR index Number n=20 (Percent) 0 0 0% 0.1 0 0% 0.2 1 5% 0.3 7 35% 0.4 8 40% 0.5 4 20% 0.6 0 0% 0.7 0 0% 0.8 0 0% 0.9 0 0% 1 0 0% Total 20 100%

126

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

The MAR index of each bacterial uropathogens was determine. MAR index of 20 Shigella group was calculated. It was observed that only no isolates of Shigella strains has MAR index below 0.2. The 40% of Shigella isolates was observed with MAR index 0.4. The MAR index range between 0.2 to 0.9 indicating resistance and existence in antibiotic stress

Discussion

(Chowdhury & Parial, 2015) studied that Urinary tract infection is a common clinical condition worldwide, but the pattern of antimicrobial resistance varies in different regions. In the study by (Olafsson, Kristinsson, & Sigurdosson, 2000) infection frequency of Enterobacter spp., Pseudomonas spp., Yersinia enterocolitica were found to be very few. The similarities and differences in the type and distribution of uropathogens may result from different environmental conditions and host factors, and also from some practices such as healthcare and education programmers, socioeconomic standards and hygiene practices in each country. The most effective antimicrobial agents in the present study were ciprofloxacin, chloramphenicol, gentamycin, erythromycin, ceftazidime, tetracycline, tobramycin, amoxicillin and piperacillin. It has been reported that amikacin is the most effective antibiotic against E. coli (Schaeffer, Rajan, Cao, Anderson, & Pruden, 2001). The widespread use, more often the misuse, of antimicrobial drugs has led to a general rise in the emergence of resistant bacteria. Again, MAR index of a bacterial species greater than 0.2 implies that the strain originated from an environment where several antibiotics had been used (Ehinmidu, 2003). In their study, they found strains which were resistant to most of the antimicrobial agent’s treatment for UTI. In the present investigation also the MAR index was more than 0.2 indicating that the isolates were from the hospital environment and under antibiotic stress. Treatment of CAUTI with antibiotics is typically only useful in patients with appropriate symptoms or signs. The presence of pyuria or malodorous urine alone should not be regarded as a reason for treatment. A large study of bloodstream infection in catheterized individuals showed that 34% of patients did not receive appropriate empirical therapy within the first 24 h after the blood cultures were collected (Bursle, 2015). In present study, although P. aeruginosa was the most common organism isolated accounted for 16% of cases, E. coli 10% and A.

127

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

baumannii were responsible for 9% of cases (Bursle, 2015). Empirical therapy comprising piperacillin–tazobactam or ampicillin plus gentamicin might therefore be appropriate in many circumstances, until therapy can be targeted according to antibiotic susceptibilities. However, such decisions should always be directed by knowledge of local resistance rates high prevalence of aminoglycoside resistance in Enterobacteriaceae or P. aeruginosa, for instance, will influence the choice of empirical therapy. As is the case with CAUTI, antibiotic overuse is common in the context of hospital-acquired, non-catheter-associated UTI. In the vast majority of circumstances, asymptomatic bacteriuria does not require antibiotic therapy. In an innovative approach to this problem, Leis and colleagues (Leis, 2014) suppressed results on urine cultures from hospitalized, non catheterized patients, instead asking clinicians to call the microbiology laboratory for the results if UTI was suspected. They found that 89% of urine samples from hospitalized patients failed to meet the CDC criteria for UTI and, compared with baseline, suppression of results dropped initiation of antibiotic therapy from 48% of occasions to just 12%, with no untoward effects. Similar study was also done by (Taiwa & Aderounmu, 2006) Klebsiella spp were the commonest pathogen isolated with 46 (36.6%), followed by Pseudomonas spp 34 (27.0%), Escherichia coli 26 (20.6%), Staphylococcus aureus 12 (9.5%), Proteus mirabilis 4 (3.2%), Candida albicans 4 (3.2%) and coagulase negative staphylococci 2 (1.6%). The in vitro antibiotic susceptibility pattern of the Gram negative organisms showed high resistance to commonly used antibiotics such as ampicillin (100%), gentamicin (90.9%), tetracycline (89.1%), cotrimoxazole (87.3%), cefuroxime (81.1%), nalidixic acid (87.3%), nitrofurantoin (67.3%),colistin (63.7%), perfloxacin (65.5%) and ciprofloxacin (56.4%). (Djeribi, Jouenne, & Menaa, 2012) studied the formation of biofilms on the inner surface of urinary catheters using microbiological culture techniques, with the direct contact of catheter pieces with blood agar. The bacterial species on the surface were characterized by scanning electron microscopy, and the kinetic profile of biofilm formation on a silicone substrate for an imipenem-resistant Acinetobacter baumannii bacterium was evaluated with a crystal violet staining assay. The bacterial species that constituted these biofilms were identified as a variety of gram negative bacilli, with a predominance of strains belonging to Pseudomonas aeruginosa. The other isolated strains belonged to A. baumannii and Klebsiella ornithinolytica. Kinetic profiling of biofilm formation 128

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

identified the transient behavior of A. baumannii between its biofilm and planktonic state. This strain was highly resistant to all of the antibiotics tested except colistin. Scanning electron microscopy images showed that the identified isolated species formed a dense and interconnected network of cellular multilayers formed from either a single cell or from different species that were surrounded and enveloped by a protective matrix.(Warren, Tenney, Hoopes, Muncie, & Anthony, 1982) studied in their article “A Prospective Microbiologic Study of Bacteriuria in Patients with Chronic Indwelling Urethral Catheters.” studied that of 605 consecutive weekly urine specimens from 20 chronically catheterized patients, 980/0 contained bacteria at high concentrations and 77% were polymicrobial. The mean interval between new episodes of bacteriuria was 1.8 weeks. Most species of bacteria caused five to seven new episodes of bacteriuria per 100weeks of catheterization. Even though access to the catheter lumen was similar, the duration of bacteriuric episodes varied greatly by species. Of the episodes of bacteriuria caused by nonenterococcal Gram-positive cocci, >75% lasted less than one week. Mean durations of episodes of bacteriuria due to Escherichia coli, Proteus mirabilis, and Pseudomonas aeruginosa were four to six weeks, whereas those due to Providencia stuartii averaged 10 weeks and ranged up to 36 weeks. Thus, the very high prevalence of bacteriuria- virtually 100% was a result of a high incidence caused by many different species combined with the prolonged residence of some Gram-negative bacilli in the catheter and urinary tract (Abdallah, Elsayed, Mostafa, & El-gohary, 2011) studied that the most common causative organism of UTI was E. coli (31%) followed by Klebsiella (15%), Staphylococcus, Coagulase negative Staphylococci CoNS, Enterococcus (11.7%) each, Proteus (3.8%), Pseudomonas (6.7%), and the least common cause being Enterobacter (3.8%).

But by keeping the emerging antimicrobial resistance in mind, it is strongly recommended that the antibiotic therapy should only be commenced after the culture and sensitivity report from the microbiology laboratory. This would not only help in the sensible use of antibiotics but also would restrain the spreading of antimicrobial resistant strains in the community as well as in the hospital.

129

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Figure 4.36. Antibiotic susceptibility test of isolated uropathogens by disc diffusion method

130

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

1.6. Biofilm formation by isolated uropathogens

Bacterial urinary tract infections represent the most common type of nosocomial infection. In many cases, the ability of bacteria to both establish and maintain these infections is directly related to biofilm formation on indwelling devices or within the urinary tract itself. Table 4.54. Biofilm formation by isolated uropathogens Bacterial species Total Strong Moderate Weak Non Pseudomonas aeruginosa 472 72 232 44 124 Candida albicans 316 24 52 72 168 Escherichia coli 304 28 84 48 144 Acinetobacter baumannii 288 84 108 76 20 Pseudomonas alcaligenes 264 76 136 12 40 Sphingomonas paucimobilis 196 64 20 20 96 Klebsiella pneumonia 196 28 76 44 48 Dermacoccus nishinomiyaensis 188 60 48 4 76 Staphylococcus aureus 124 24 24 20 56 Enterococcus faecalis 120 32 32 32 24 Staphylococcus pseudintermedius 88 20 28 4 36 Bordetella hinzii 56 20 24 8 4 Raoultella ornithinolytica 52 0 20 4 32 Staphylococcus haemolyticus 44 0 20 12 12 Proteus mirabilis 40 8 20 8 4 Stenotrophomonas maltophilia 40 8 16 4 12 Enterococcus faecium 36 12 16 0 0 Granulicatella elegans 36 20 4 0 12 Gemella bergeri 28 24 4 0 0 Granulicatella adiacens 20 0 0 4 16 Shigella group 20 0 4 8 8 Proteus vulgaris 12 0 4 0 8 Total 2940 604 972 424 940

The isolated uropathogens were studied for biofilm forming ability by tissue culture plate method as explained in methodology (Table 1.54). All the isolated uropathogens showed different biofilm formation viz: strong, moderate, weak and non biofilm formation. Pseudomonas aeruginosa was foundto be more prominent in moderate biofilm forming group. Candida species were mostly weak and non biofilm formers. The rare uropathogen Granulicatella adiacens was weak and non biofilm forming.

131

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

4.6.1. Strong biofilm formation

The isolated uropathogens with optical density on ELISA reader more than 0.240 was considered as strong biofilm forming. In the present study out of total isolated uropathogens 604 isolates were found to be strong biofilm forming. Acinetobacter baumannii was found highest in number among strong biofilm forming as total 84 isolates out of 288 isolates showed optical density above 0.240. Pseudomonas species was more strong biofilm formingPseudomonas alcaligenes (76) isolates and Pseudomonas aeruginosa (72) isolates were strong biofilm formers. Sphingomonas paucimobilis (64) and Dermacoccus nishinomiyaensis (60) both rare species showed strong biofilm formation. Enterococcus faecalis was also found to be strong biofilm forming with 32 number of isolates. Escherichia coli and Klebsiella pneumonia the common uropathogens isolated from the catheter samples and also reported as normal inhabitant of nosocomial infection both were strong biofilm former of 28 isolates of each. Fungal species isolated during the study i. e Candida species found 24 isolates with strong biofilm formation and 24 isolates each of Staphylococcus aureus and Gemella bergeri were strong biofilm forming. Rare uropathogens Staphylococcus pseudintermedius, Bordetella hinzii and Granulicatella elegans, 20 isolates of each showed strong biofilm forming ability. Enterococcus faecium (12), Proteus mirabilis (8) and Stenotrophomonas maltophilia (8) were strong biofilm forming. The uropathogens which were not having strong biofilm forming ability were Granulicatella adiacens, Proteus vulgaris, Raoultella ornithinolytica and Staphylococcus haemolyticus.

4.6.2. Moderate biofilm formation

The uropathogens having optical density 0.120-0.240 were considered as moderate biofilm forming. In the present study highest number of moderate biofilm forming uropathogens were isolated. Total of 972 uropathogens isolated were moderate biofilm forming. Pseudomonas aeruginosa and Pseudomonas alcaligenes were more in number with 232 and 136 isolates respectively. Acinetobacter baumannii108 isolates were moderate biofilm forming. The number of Escherichia coli were 84 which were moderate biofilm producer and Klebsiella pneumoniawere 76. Candida species, 56 isolates were moderate biofilm forming. The common uropathogens with moderate biofilm forming ability were Enterococcus faecalis (32), Staphylococcus

132

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR) aureus (24), Proteus mirabilis (20), Enterococcus faecium (16), Shigella group (4), Proteus vulgaris (4). Rare uropathogens isolated with moderate biofilm forming ability were Dermacoccus nishinomiyaensis (48), Staphylococcus pseudintermedius (28), Bordetella hinzii (24), Sphingomonas paucimobilis (20), Raoultella ornithinolytica (20), Staphylococcus haemolyticus (20), Stenotrophomonas maltophilia (16), Granulicatella elegans (4), and Gemella bergeri (4). Granulicatella adiacens did not show any moderate biofilm formation.

4.6.3. Weak biofilm formation

The uropathogens having the optical density less than 0.120 were considered as weak biofilm forming. Out of total isolated strains 424 isolates were weak biofilm forming. Acinetobacter baumannii (76) and Candida species (72) were found to be more in number Escherichia coli (48), Pseudomonas aeruginosa and Klebsiella pneumonia 44 isolates, Enterococcus faecalis (32), Staphylococcus aureus (20), Pseudomonas alcaligenes (12), Proteus mirabilis and Shigella 8 isolates each had weak biofilm forming ability. The rare uropathogens having weak biofilm forming ability was Sphingomonas paucimobilis (20), Staphylococcus haemolyticus (12), Bordetella hinzii (8), Dermacoccus nishinomiyaensis (4), Staphylococcus pseudintermedius (4), Raoultella ornithinolytica (4), and Stenotrophomonas maltophilia (4), Granulicatella adiacens (4).

4.6.4. Non biofilm

The uropathogens not showing any biofilm formation were 940. Candida species isolated were highest in number (168) with no biofilm formation. Escherichia coli 144 isolates were non biofilm forming. Number of Pseudomonas aeruginosa species which was non biofilm producer was 124. Other common uropathogens isolated in the present study which were non biofilm forming includes Staphylococcus aureus (56), Pseudomonas alcaligenes (40), Enterococcus faecalis (24), , Proteus mirabilis (4), Acinetobacter baumannii (20), Shigella group (8) and Proteus vulgaris (8). Among the rare isolates studied,Sphingomonas paucimobilis (96), Dermacoccus nishinomiyaensis (76), Raoultella ornithinolytica (32), Staphylococcus pseudintermedius (36), Granulicatella adiacens (16), Bordetella hinzii (4),

133

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Staphylococcus haemolyticus, Stenotrophomonas maltophilia(12) and Gemella bergeri (12) were non biofilm forming.

Figure 4.37. Biofilm formation by isolated uropathogens

Above graph (Fig 4.37) depicts the biofilm formation pattern of each type of isolate. As observed in the graph Pseudomonas aeruginosa is highest in number among all isolates with more number of isolates showing moderate biofilm formation (in green), Candida albicans and Escherichia coli are the second common isolates among which almost 50% of isolates were non biofilm forming. Among Acinetobacter baumannii and Pseudomonas alcaligenes most of the isolates were moderate biofilm forming. Sphingomonas paucimobilis shows more strong biofilm formation while Klebsiella pneumonia shows more moderate biofilm formation. Other isolates shows more isolates with strong formation of biofilm.

Table 4.55. Total uropathogens isolated with biofilm formation Total No. of Non Biofilm Biofilm forming isolates Isolates forming isolates 2000 (68%) Strong Moderate Weak 2940 940 (32%) 604 972 424 (30%) (48%) (22%)

134

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

In the present study total 2940 uropathogens were isolated from all the five section A, B, C, D and E of total 560 catheter samples collected and processed in the study. All the uropathogens were studied for biofilm formation by tissue culture plate method and depending up on optical density were classified as strong, moderate, weak and non biofilm forming. Out of total isolates 2000 isolates were biofilm producer and 940 isolates were non biofilm producers. It was observed that from total biofilm positive isolates, 604 isolates were strong biofilm forming, 972 isolates were moderate biofilm forming and the 424 isolates were weak biofilm former.

Table 4.56.Section wise isolation of uropathogens in percentage (%) Bacterial species % Section A %Section B %Section C %Section D %Section E Escherichia coli 36.84 15.78 17.10 15.78 14.47 Pseudomonas alcaligenes 18.18 22.72 18.18 19.69 21.21 Enterococcus faecalis 16.66 26.66 20 16.66 20 Dermacoccus 19.14 21.27 21.27 21.27 17.02 nishinomiyaensis Klebsiella pneumoniae 28.57 18.36 18.36 18.36 16.32 Proteus mirabilis 20 50 20 0 10 Acinetobacter baumannii 22.22 19.44 18.05 20.83 19.44 Gemella bergeri 42.85 14.28 14.28 14.28 14.28 Bordetella hinzii 21.42 28.57 21.42 14.28 14.28 Granulicatella elegans 33.33 22.22 11.11 0 33.33 Candida albicans 21.51 20.25 17.72 17.72 22.78 Pseudomonas aeruginosa 22.88 19.49 18.64 16.94 22.03 Staphylococcus aureus 29.03 16.12 16.12 16.12 22.58 Stenotrophomonas 20 10 0 30 40 maltophilia Staphylococcus 9.09 9.09 18.18 27.27 36.36 haemolyticus Proteus vulgaris 0 0 0 66.66 33.33 Enterococcus faecium 44.44 11.11 22.22 11.11 11.11 Sphingomonas 22.44 20.40 16.32 20.40 20.40 paucimobilis Raoultella ornithinolytica 23.07 23.07 23.07 15.38 15.38 Staphylococcus 27.27 13.63 31.81 13.63 13.63 pseudintermedius Granulicatella adiacens 0 20 20 40 20 Shigella group isolated 0 0 0 60 40

The percentage of occurrence of uropathogens in different section were determined and it was observed that the Escherichia coli wasthe highest in section A approximately 37%.From section E, 14% Escherichia coli was isolatedthis shows that

135

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

the bacterial contamination is more in section A as compared to other sections. Thus this E. coli may be endogenous as it comes from section A and this section remain inside the bladder of the patient. The perennial region is contaminated with Escherichia coli from the faeces. While inserting the catheter these may get transferred in to the urinary bladder. Pseudomonas alcaligenes was isolated in a greater incident from section E around 21% and less in section A. Section A contain 18% Pseudomonas alcaligenes. Pseudomonas species are normal inhabitants of the hospital environment. In the present study, Pseudomonas species were more isolated from the section E. Section E is more in contact with hospital environment and connected to the drainage bag.

Depending on which section of the catheter gets contaminated first, suggest the route of entry of that pathogen in the catheter. In case of the section A there may be possibility of contamination from the patient's own flora i.e. endogenous infection. In present study, different uropathogens were prominently isolated more from section A of the urinary catheter.

Uropathogens isolated from the section E were more as compared to section A andit includes Pseudomonas alcaligenes, Enterococcus faecalis, Candida albicans, Stenotrophomonas maltophilia, Staphylococcus haemolyticus, Proteus vulgaris, Granulicatella adiacens, Shigella group. Organisms isolated from section E of the catheter may be exogenous source of contamination from the hospital environment as this section was more exposed to the surroundings.

Table 4.57 - Biofilm formation by isolated uropathogens Bacterial species Total Strong % Moderate % Weak % Non % Pseudomonas 472 72 15 232 49 44 9 124 26 aeruginosa Candida albicans 316 24 7.5 52 16.4 72 22.7 168 53 Escherichia coli 304 28 9 84 27.6 48 15.7 144 47 Acinetobacter 288 84 29 108 37.5 76 26 20 6.9 baumannii Pseudomonas 264 76 28.7 136 51.5 12 4.5 40 15 alcaligenes Sphingomonas 196 64 32.6 20 10 20 10 96 48.9 paucimobilis Klebsiella 196 28 14 76 38.7 44 22.4 48 24.4 pneumonia Dermacoccus 188 60 31.9 48 25.5 4 2 76 40.4 136

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR) nishinomiyaensis Staphylococcus 124 24 19 24 19 20 16 56 45 aureus Enterococcus 120 32 26.6 32 26.6 32 26.6 25 20.8 faecalis Staphylococcus 88 20 22.7 28 31.8 4 4. 36 40 pseudintermedius Bordetella hinzii 56 20 35 24 42.8 8 14 4 7 Raoultella 52 0 0 20 38.4 4 7.6 32 61.5 ornithinolytica S. haemolyticus 44 0 0 20 45.4 12 27 12 27 Proteus mirabilis 40 8 20 20 50 8 20 4 10 Stenotrophomonas 40 8 20 16 40 4 10 12 30 maltophilia Enterococcus 36 12 33 16 44.4 0 0 0 0 faecium Granulicatella 36 20 55.5 4 11 0 0 12 33 elegans Gemella bergeri 28 24 85.7 4 14 0 0 0 0 Granulicatella 20 0 0 0 0 4 20 16 80 adiacens Shigella group 20 0 0 4 20 8 40 8 40 Proteus vulgaris 12 0 0 4 33.33 0 0 8 66.6

Uropathogens isolated from the urinary catheter had different biofilm forming ability. Pseudomonas aeruginosa isolates (49%) were moderate biofilm forming and 15% strong biofilm forming. The Candida species isolated were around 53% non biofilm forming and only 16% were moderate biofilm forming. Escherichia coli isolated from catheter samples were 47% non biofilm forming and 27% moderate biofilm forming. From the total isolates of Acinetobacter baumannii 29% were with strong biofilm and 38% were moderate biofilm forming.Pseudomonas alcaligenes were high biofilm producer in which 28% of them were strong biofilm and 51% were moderate biofilm forming. Sphingomonas paucimobilis rare bacterium found were 32% strong biofilm forming and 49% non biofilm forming. Klebsiella pneumonia was found with 38% moderate biofilm forming. Dermacoccus nishinomiyaensis was 40% non biofilm forming. Out of all isolates of S. aureus 45% were non biofilm forming. Enterococcus faecalis were equally strong, moderate and weak biofilm forming species of 26% each and remaining were non biofilm forming. Staphylococcus pseudintermedius were mostly moderate biofilm forming around 32%. 42% of total Bordetella species were moderate biofilm forming. Raoultella ornithinolytica 61% non biofilm forming and

137

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

38% were moderate biofilm forming. Staphylococcus haemolyticus was 45% moderate biofilm forming. Proteus mirabilis 50% were moderate biofilm forming. Stenotrophomonas maltophiliaare 40% moderate and 30% non biofilm forming. Enterococcus faecium 33% were strong and 44% were moderate biofilm forming. Granulicatella elegans 55% were strong biofilm forming.Gemella bergeri 85% of total were strong biofilm forming Granulicatella adiacens, Shigella group and Proteus vulgaris did not report any strong biofilm formation. These uropathogens isolated were non biofilm forming 80%, 40%, 66% respectively.

Thus it was found that the highest count of Gemella bergeri were reported asstrong biofilm forming uropathogen. Staphylococcus haemolyticus were reported as highest percentage in moderate biofilm forming uropathogens. 40% of Shigella group were weak biofilm forming from all Shigella species and 66% of Proteus vulgaris species were non biofilm.

Figure 4.38. Biofilm formation of uropathogens by tissue culture plate method

138

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

4.7. Minimum Inhibitory Concentration and Minimum Biofilm Eradicating Concentration of antibiotics against catheter isolates

Traditionally the minimum inhibition concentration of antibiotics that is ineffective in preventing growth of particular organism will also be clinically ineffective (Langston 1999) has been used as the gold standard for determination of antimicrobial sensitivities (Costrtone et al, 1995; Prescott et al, 1985). Evidence however indicates that biofilm associated organism that is sensitive in vitroto an antimicrobial may not be sensitive in vivo, meaning the MIC value for particular antibiotic is not always predictive of clinical efficacy. Nevertheless the MIC assay remains the only way that potential effective antimicrobial agent are selected in most microbiology laboratories.

Considering that biofilm formation is one of the major virulence factor involved in pathogens causing catheter associated urinary tract infection should not rely on MIC determination alone. The minimum biofilm eradicating concentration assay could provide a quick and reliable methodology to access the susceptibility of pathogens growing in a biofilm to antibiotics.

Table 4.58. MIC ( µg/mL) of various antimicrobial agents against the isolated uropathogens Cu Amp Uropathogen AgN Triclo Lysoz Garlic Tobra Gentam Chloramp Erythro Ciproflox Ceftazid Np hicili s ps san yme exract mycin ycin henicol mycin acin ime s n 102 P.aeruginosa 16 32 1024 1024 512 1024 256 64 128 32 32 4 P. alcaligenes 64 64 512 512 256 1024 512 128 256 64 64 512 S. 102 32 32 1024 256 256 64 64 256 16 32 128 maltophilia 4 102 A.baumannii 16 1 512 256 512 128 32 128 32 64 256 4 S.pseudinter medius 512 16 1 1024 128 256 256 32 64 16 64 512 S.paucimobil is 512 32 1 1024 128 32 32 32 128 64 512 256 K.pneumonia e 64 16 16 512 512 512 128 16 256 16 32 512 R.ornithinoly tica 256 32 1 256 512 64 256 64 64 32 512 512 G.adiacens 256 16 16 1024 64 128 128 64 128 32 64 512 E.coli 512 8 0.5 512 256 256 128 32 128 32 256 256 S.haemolytic us 32 32 4 1024 256 256 256 16 128 16 64 256 D.nishinomiy aensis 128 32 8 512 128 512 128 32 256 32 128 256 Shigella group 16 8 8 1024 64 64 32 8 128 16 16 512 G.elegans 256 16 1 512 64 128 64 32 256 16 32 512 E. faecalis 32 4 16 1024 128 128 64 16 64 32 16 128 S.aureus 32 1 16 256 256 512 128 16 32 32 8 256

139

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

P.mirabilis 64 8 16 512 256 128 128 32 32 64 16 256 B.hinzii 32 16 16 512 128 64 64 32 64 16 16 128 G.bergeri 256 8 1 256 128 128 32 16 32 1 32 128 P.vulgaris 64 16 32 256 128 64 64 64 64 64 32 128 E. faecium 128 32 8 256 128 128 32 16 16 32 32 64

Table 4.58 shows minimum inhibitory concentration of all the isolated biofilm forming bacterial uropathogens against 12 different antimicrobial agents. The antimicrobial agents include nanoparticles, antibiotics, plant extract and chemical agents having different range of inhibitory concentration against each biofilm forming uropathogen studied. In the present study triclosan was found as effective antimicrobial agent.

The lowest concentration required for the inhibition was 0.5µg/mL of triclosan against most common uropathogen Escherichia coli. The highest concentration reached up to 1024µg/mL against high biofilm forming Pseudomonas aeruginosa. The lowest MIC value of Silver nanoparticleswas 16µg/mL against Pseudomonasaeruginosa and Shigella, highest concentration was 1024 µg/mL against Stenotrophomonas maltophilia andAcinetobacter baumannii.Copper nanoparticles 1µg/mL against Staphylococcus aureus and highest concentration 64 µg/mL against Pseudomonas alcaligenes. The MIC range of Lysozyme between 256- 1024 µg/mL against uropathogens. Also the lowest MIC of Garlic extract 64 µg/mL against Granulicatella adiacens and Shigella, highest concentration was 512 µg/mL against Pseudomonas aeruginosa, Klebsiella pneumonia, Raoultella ornithinolytica.

The lowest MIC of Tobramycin was 32 µg/mL against Sphingomonas paucimobilis and highest concentration was 1024 µg/mL against Pseudomonas aeruginosa and Pseudomonas alcaligenes. Gentamycinwith lowest MIC 32 µg/mL against Sphingomonas paucimobilis, Shigella, Gemella bergeri, Enterococcus faecium andhighest concentration of 512 µg/mL against Pseudomonas alcaligenes. The lowest MIC of Chloramphenicol was 8µg/mL against Shigella andhighest 128 µg/mLagainst Pseudomonas alcaligenes. MIC of Erythromycin ranged between 16- 256 µg/mL and for Ciprofloxacin between 1-64 µg/mL. The lowest concentration of Ceftazidime 8 µg/mL against Staphylococcus aureus andhighest concentration 512 140

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

µg/mL against Sphingomonas paucimobilis, Raoultella ornithinolytica. Ampicillin MIC ranged between 64-1024 µg/mL against isolated uropathogens.

Figure 4.39. MIC of antimicrobial agents against the biofilm forming uropathogens

Figure 4.39 depicts Pseudomonas species as the isolates with highest MIC values for all antimicrobials tested. Among the antimicrobial agents tested, triclosan was most effective with less MIC for almost all the isolates except Pseudomonas species. Copper nanoparticles and silver nanoparticles were also equally effective with less MIC values.

141

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.59. MBEC (µg/mL) of different antimicrobial agents against isolated uropathogens Chlora Uropathog Triclos Lysozy Garlice Tobra Genta Erythro Ciprofl Ceftazi Amphi AgNps CuNps mpheni ens an me xract mycin mycin mycin oxacin dime cilin col S.pseudint 32768 512 8 16384 8192 32768 16384 512 8192 512 16384 65536 ermedius K.pneumo 8192 512 1024 32768 32768 32768 8192 2048 8192 512 4096 65536 niae S. paucimobil 16384 2048 8 32768 8192 4096 4096 2048 8192 2048 65536 32768 is E.coli 16384 256 16 32768 4096 32768 32768 2048 8192 2048 8192 32768 G. 32768 512 2048 65536 2048 8192 4096 2048 8192 4096 8192 32768 adiascens S. haemolytic 2048 1024 128 32768 8192 32768 32768 1024 8192 512 2048 32768 us S. aureus 1024 16 512 16384 8192 65536 8192 512 4096 512 512 32768 Shigella group 512 128 512 16384 4096 32768 512 512 8192 512 512 65536 isolated G.bergeri 32768 256 16 32768 4096 8192 2048 1024 2048 8 1024 8192 P. 4096 128 512 16384 8192 8192 8192 4096 2048 1024 1024 16384 mirabilis P.vulgaris 4096 512 1024 32768 4096 2048 1024 4096 8192 2048 1024 8192 E. facalies 2048 64 1024 32768 8192 8192 2048 1024 4096 256 512 8192 B.hinzii 512 512 512 32768 8192 2048 2048 4096 2048 256 512 8192 E. faecium 8192 1024 256 8192 4096 16384 1024 1024 1024 512 1024 4096

Table 4.59 shows minimum biofilm eradicating concentration of all the biofilm forming bacterial uropathogens against 12 different antimicrobial agents same as used to determine the MIC. Different range of biofilm eradication concentration against each uropathogen was determined. Triclosan was found as effective antimicrobial agent as compared to other antimicrobial agents tested. The lowest concentration of triclosan required for thebiofilm eradication was 4µg/mL against Acinetobacter baumannii. The highest concentration reached up to 262144µg/mL of triclosan for the eradication of biofilm forming Pseudomonas aeruginosa. Copper nanoparticles and ciprofloxacin antibiotic also found with effective activity against biofilm forming uropathogens. Silver nanoparticles lowest MIC was 512µg/mL against P. aeruginosa and highest 262144 µg/mL against Acinetobacter baumannii, Stenotrophomonas maltophilia. The lowest MIC of Copper nanoparticles was16µg/mL against Staphylococcus aureus andhighest 8192 µg/mL against S. maltophilia. For lysozyme Lowest MIC was at 8192 µg/mL against Enterococcus faecium and highest was 131072 µg/mL against Pseudomonas aeruginosa. Garlic extract lowest MIC was 2048 µg/mL against Granulicatella adiacens highest 65536 against Raoultella ornithinolytica. TobramycinMIC values ranged between 2048- 262144 µg/mLand 142

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

highest against Pseudomonas aeruginosa. The MIC of Gentamycin between 512- 65536 µg/mL. Chloramphenicol with Lowest MIC 512 µg/mL against Shigella and highest 8192 µg/mL against Pseudomonas aeruginosa Pseudomonas alcaligenes and Raoultella ornithinolytica. The lowest MIC of erythromycin was 1024 µg/mL against Enterococcus faecium andhighest 65536 µg/mL against Pseudomonas alcaligenes. Ciprofloxacin lowest MIC was 8µg/mL bergeri andhighest 8192 µg/mL against Pseudomonas aeruginosa. Ceftazidime MIC values between 512-131072 µg/mL and highest concentration required against Raoultella ornithinolytica. Ampicillin Lowest MIC 4096 µg/mL against Enterococcus faecium and highest 131072 µg/mL.

Figure 4.40. MBEC of antimicrobial agents against the biofilm forming uropathogens

143

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Figure 4.41. Minimum Inhibitory Concentration and Minimum Biofilm Eradicating Concentration detection by Tissue Culture Plate Method

144

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Figure 4.42. Muller-Hinton agar plates showing Minimum Inhibitory Concentration and Minimum Biofilm Eradicating concentration of antimicrobial agents

145

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.60. Comparative MIC and MBEC of different antimicrobial agents against isolated uropathogens AgNps CuNps Triclosan Lysozyme Garlic Extract Tobramycin Uropathogens MIC MBEC MIC MBEC MIC MBEC MIC MBEC MIC MBEC MIC MBEC E.coli 512 16384 8 256 0.5 16 512 32768 256 4096 256 32768 26214 13107 P.aeruginosa 16 512 32 1024 1024 1024 512 16384 1024 262144 4 2 P. alcaligenes 64 4096 64 2048 512 65536 512 65536 256 16384 1024 131072 S. aureus 32 1024 1 16 16 512 256 16384 256 8192 512 65536 E. faecalis 32 2048 4 64 16 1024 1024 32768 128 8192 128 8192 S.maltophilia 1024 262144 32 8192 32 512 1024 65536 256 8192 256 8192 D.nishinomiyaensis 128 8192 32 2048 8 512 512 32768 128 8192 512 32768 S.haemolyticus 32 2048 32 1024 4 128 1024 32768 256 8192 256 32768 K. pneumonia 64 8192 16 512 16 1024 512 32768 512 32768 512 32768 P.vulgaris 64 4096 16 512 32 1024 256 32768 128 4096 64 2048 P mirabilis 64 4096 8 128 16 512 512 16384 256 8192 128 8192 E.faecium 128 8192 32 1024 8 256 256 8192 128 4096 128 16384 A. baumannii 1024 262144 16 512 1 4 512 32768 256 16384 512 32768 S. paucimobilis 512 16384 32 2048 1 8 1024 32768 128 8192 32 4096 G.bergeri 256 32768 8 256 1 16 256 32768 128 4096 128 8192 R.ornithinolytica 256 8192 32 2048 1 8 256 32768 512 65536 64 2048 B.hinzii 32 512 16 512 16 512 512 32768 128 8192 64 2048 S.pseudintermedius 512 32768 16 512 1 8 1024 16384 128 8192 256 32768 G.elegans 256 32768 16 512 1 8 512 32768 64 8192 128 8192 G.adiascens 256 32768 16 512 16 2048 1024 65536 64 2048 128 8192 Shigella group 16 512 8 128 8 512 1024 16384 64 4096 64 32768

Table 4.60. Comparative MIC and MBEC of different antimicrobial agents against isolated uropathogens Chloramphenic Gentamycin Erythromycin Ciprofloxacin Ceftazidime Amphicilin ol Uropathogens MBE MIC MBEC MIC MBEC MIC MIC MBEC MIC MBEC MIC MBEC C E.coli 128 32768 32 2048 128 8192 32 2048 256 8192 256 32768 P.aeruginosa 256 32768 64 8192 128 8192 32 2048 32 8192 1024 131072 P. alcaligenes 512 65536 128 8192 256 65536 64 8192 64 8192 512 131072 S. aureus 128 8192 16 512 32 4096 32 512 8 512 256 32768 E.faecalis 64 2048 16 1024 64 4096 32 256 16 512 128 8192 S.maltophilia 64 2048 64 2048 256 32768 16 256 32 4096 128 32768 D. nishinomiyaensis 128 32768 32 2048 256 16384 32 512 128 8192 256 131072 S.haemolyticus 256 32768 16 1024 128 8192 16 512 64 2048 256 32768 K. pneumonia 128 8192 16 2048 256 8192 16 512 32 4096 512 65536 P.vulgaris 64 1024 64 4096 64 8192 64 2048 32 1024 128 8192 P mirabilis 128 8192 32 4096 32 2048 64 1024 16 1024 256 16384 E.faecium 32 1024 16 1024 16 1024 32 512 32 1024 64 4096 A. baumannii 128 32768 32 2048 128 32768 32 4096 64 16384 256 32768 S. paucimobilis 32 4096 32 2048 128 8192 64 2048 512 65536 256 32768 G.bergeri 32 2048 16 1024 32 2048 1 8 32 1024 128 8192 13107 256 16384 64 8192 64 2048 32 2048 512 512 131072 R.ornithinolytica 2 B.hinzii 64 2048 32 4096 64 2048 16 256 16 512 128 8192 S.pseudintermedius 256 16384 32 512 64 8192 16 512 64 16384 512 65536 G.elegans 64 16384 32 512 256 32768 16 1024 32 4096 512 131072 G.adiascens 128 4096 64 2048 128 8192 32 4096 64 8192 512 32768 Shigella group 32 512 8 512 128 8192 16 512 16 512 512 65536

146

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

The table 4.60 shows the comparative MIC and MBEC values of all the antimicrobial agents against each biofilm forming uropathogens.

4.7.1. Silver nanoparticles

Table 4.61. Comparison between MIC and MBEC of silver nanoparticles against different uropathogens MIC MBEC Greater Name of Uropathogens (µg/mL) (µg/mL) than Stenotrophomonas maltophilia 1024 262144 356 Acinetobacter baumannii complex 1024 262144 256 Escherichia coli 512 16384 32 Staphylococcus pseudintermedius 512 32768 64 Sphingomonas paucimobilis 512 16384 32 Gemella bergeri 256 32768 128 Raoultella ornithinolytica 256 8192 32 Granulicatella elegans 256 32768 128 Granulicatella adiacens 256 32768 128 Dermacoccus nishinomiyaensis 128 8192 64 Enterococcus faecium 128 8192 64 Klebsiella pneumoniae 64 8192 128 Proteus vulgaris 64 4096 64 Proteus mirabilis 64 4096 64 Pseudomonas alcaligenes 64 4096 64 Staphylococcus aureus 32 1024 32 Enterococcus faecalis 32 2048 32 Staphylococcus haemolyticus 32 2048 64 Bordetella hinzii 32 512 16 Pseudomonas aeruginosa 16 512 32 Shigella group isolated 16 512 32

The table 4.61 shows the minimum inhibitory concentration and minimum biofilm eradicating concentration of silver nanoparticles against all the isolated biofilm forming bacterial uropathogens. The lowest MIC concentration of silver nanoparticles was 16µg/mL against Pseudomonas aeruginosa and Shigella group and the highest concentration required for MIC was 1024 against Stenotrophomonas maltophilia and Acinetobacter baumannii. The lowest concentration for the MBEC of silver nanoparticles were 512µg/mL required against Bordetella hinzii, Pseudomonas aeruginosa and Shigella group. The highest concentration required for the MBEC of silver nanoparticles was 242144µg/mL against biofilm forming Stenotrophomonas

147

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

maltophilia and Acinetobacter baumannii. In present study the comparison of the required concentration of silver nanoparticles for MBEC against uropathogens was more than MIC concentration. MBEC of all the uropathogenswas 32-356 folds greater than MIC. Means Minimum Biofilm Eradicating Concentration of silver nanoparticles showed 32-356 times greater to isolated uropathogens than its Minimum inhibitory concentration

Figure 4.44. MIC and MBECof Silver nanoparticles against the biofilm forming uropathogens

Figure 4.44 shows very high concentration of silver nanoparticles for inhibition of biofilm forming Stenotrophomonas maltophilia and Acinetobacter baumannii indicating the complexity of its biofilm.

4.7.2. Copper nanoparticles

Table 4.62.Comparison between MIC and MBEC of copper nanoparticles against different uropathogens Name of Uropathogens MIC (µg/mL) MBEC (µg/mL) Greater than Stenotrophomonas maltophilia 32 8192 256 Pseudomonas alcaligenes 64 2048 32 Dermacoccus nishinomiyaensis 32 2048 64 Raoultella ornithinolytica 32 2048 64 Sphingomonas paucimobilis 32 2048 64 Staphylococcus haemolyticus 32 1024 32 Pseudomonas aeruginosa 32 1024 32 Enterococcus faecium 32 1024 32 148

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.62.Comparison between MIC and MBEC of copper nanoparticles against different uropathogens Name of Uropathogens MIC (µg/mL) MBEC (µg/mL) Greater than Bordetella hinzii 16 512 32 Staphylococcus pseudintermedius 16 512 32 Granulicatella elegans 16 512 32 Granulicatella adiacens 16 512 32 Acinetobacter baumannii 16 512 32 Klebsiella pneumoniae 16 512 32 Proteus vulgaris 16 512 32 Gemella bergeri 8 256 32 Escherichia coli 8 256 32 Proteus mirabilis 8 128 16 Shigella group isolated 8 128 16 Enterococcus faecalis 4 64 16 Staphylococcus aureus 1 16 16

Table 4.62 shows the minimum inhibitory concentration and minimum biofilm eradicating concentration of copper nanoparticles against all the isolated biofilm forming bacterial uropathogens. The lowest MIC concentration of copper nanoparticles was 1 µg/mL against Staphylococcus aureus and the highest concentration required for MIC was 64 µg/mL against Stenotrophomonas maltophilia. The lowest concentration for the MBEC of copper nanoparticles were 16µg/mL required against Staphylococcus aureus. The highest concentration required for the MBEC of copper nanoparticles was 8192µg/mL against biofilm forming Stenotrophomonas maltophilia. In present study the comparison of the required concentration of copper nanoparticles for MBEC against uropathogens was more than MIC concentration. MBEC of all the uropathogens was 16-256 folds greater than MIC. Means Minimum Biofilm Eradicating Concentration of copper nanoparticles was 16-256 times greater than its Minimum inhibitory concentration.

149

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Figure 4.45. MIC and MBEC of Copper nanoparticles against biofilm forming uropathogens Figure 4.45 shows that Stenotrophomonas maltophilia biofilm required the highest amount of copper nanoparticles for eradication. It was 256 times higher than MIC 4.7.3. Triclosan

Table 4.63. Comparison between MIC and MBEC of triclosan against different uropathogens Name of uropathogens MIC(µg/mL) MBEC(µg/mL) Greater than Pseudomonas aeruginosa 1024 262144 256 Pseudomonas alcaligenes 512 65536 128 Granulicatella adiacens 16 2048 128 Proteus vulgaris 32 1024 32 Klebsiella pneumoniae 16 1024 64 Enterococcus faecalis 16 1024 64 Staphylococcus aureus 16 512 16 Proteus mirabilis 16 512 32 Stenotrophomonas maltophilia 32 512 16 Dermacoccus nishinomiyaensis 8 512 64 Bordetella hinzii 16 512 32 Shigella group isolated 8 512 64 Enterococcus faecium 8 256 32 Staphylococcus haemolyticus 4 128 32 Gemella bergeri 1 16 16 Escherichia coli 0.5 16 32 Sphingomonas paucimobilis 1 8 8 Raoultella ornithinolytica 1 8 8 Staphylococcus 1 8 8 pseudintermedius Granulicatella elegans 1 8 8 Acinetobacter baumannii 1 4 4 150

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

The table 4.63 shows the minimum inhibitory concentration and minimum biofilm eradicating concentration of triclosan against all the isolated biofilm forming bacterial uropathogens. The lowest MIC concentration of triclosan was 0.5 µg/mL against Staphylococcus aureus and the highest concentration required for MIC was 1024 µg/mL against P. aeruginosa. The lowest concentration for the MBEC of triclosan were 4µg/mL required against Acinetobacter baumannii. The highest concentration required for the MBEC of triclosan was 262144µg/mL against biofilm forming Stenotrophomonas maltophilia. In present study the comparison of the required concentration of triclosan for MBEC against uropathogens was more than MIC concentration. MBEC of all the uropathogens was 4-256 folds greater than MIC. Means Minimum Biofilm Eradicating Concentration of triclosan showed 4-256 times greater to isolated uropathogens than its Minimum inhibitory concentration.

Figure 4.46. MIC and MBEC of triclosan against biofilm forming uropathogens

Figure 4.46 shows high efficacy of triclosan against almost all the isolates, except Pseudomonas species

4.7.4. Lysozyme

Table 4.64. Comparison between MIC and MBEC of lysozyme against different uropathogens Name of uropathogens MIC(µg/mL) MBEC(µg/mL) Greater than Pseudomonas aeruginosa 1024 131072 128 Granulicatella adiacens 1024 65536 64 Pseudomonas alcaligenes 512 65536 128 Stenotrophomonas 1024 65536 64 maltophilia 151

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Granulicatella elegans 512 32768 64 Escherichia coli 512 32768 64 Dermacoccus 512 32768 64 nishinomiyaensis Staphylococcus haemolyticus 1024 32768 32 Enterococcus faecalis 1024 32768 32 Klebsiella pneumoniae 512 32768 64 Proteus vulgaris 256 32768 128 Acinetobacter baumannii 512 32768 64 Sphingomonas paucimobilis 1024 32768 32 Gemella bergeri 256 32768 128 Raoultella ornithinolytica 256 32768 128 Bordetella hinzii 512 32768 64 Staphylococcus 1024 16384 16 pseudintermedius Staphylococcus aureus 256 16384 64 Proteus mirabilis 512 16384 32 Shigella group isolated 1024 16384 16 Enterococcus faecium 256 8192 32

The table 4.64 shows the minimum inhibitory concentration and minimum biofilm eradicating concentration of lysozyme against all the isolated biofilm forming bacterial uropathogens. The lowest MIC concentration of lysozyme was 256 µg/mL and the highest concentration required for MIC was 1024 µg/mL. The lowest concentration for the MBEC of lysozyme were 8192 µg/mL required against Enterococcus faecium. The highest concentration required for the MBEC of lysozyme was 131072µg/mL against biofilm forming Pseudomonas aeruginosa. In present study the comparison of the required concentration of lysozyme for MBEC against uropathogens was more than MIC concentration. MBEC of all the uropathogens was 16-128 folds greater than MIC. Means Minimum Biofilm Eradicating Concentration of lysozyme showed 16-128 times greater to isolated uropathogens than its Minimum inhibitory concentration.

152

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Figure 4.47. MIC and MBEC of Lysozyme against the biofilm forming uropathogens

From figure 4.47 it is observed that Pseudomonas aeruginosa is the most resistant isolates to lysozyme with MBEC 128 times more than MIC.

4.7.5. Garlic extract

Table 4.65.Comparison between MIC and MBEC of garlic extract against different uropathogens Name of Uropathogens MIC(µg/mL) MBEC(µg/mL) Greater than Raoultella ornithinolytica 512 65536 128 Klebsiella pneumoniae 512 32768 64 Pseudomonas aeruginosa 512 16384 32 Pseudomonas alcaligenes 256 16384 64 Acinetobacter baumannii 256 16384 64 Staphylococcus aureus 256 8192 32 Enterococcus faecalis 128 8192 64 Stenotrophomonas maltophilia 256 8192 32 Dermacoccus 128 8192 64 nishinomiyaensis Staphylococcus haemolyticus 256 8192 32 Proteus mirabilis 256 8192 32 Sphingomonas paucimobilis 128 8192 64 Bordetella hinzii 128 8192 64 Staphylococcus 128 8192 64 pseudintermedius Granulicatella elegans 64 8192 128 Enterococcus faecium 128 4096 32 Proteus vulgaris 128 4096 32 Gemella bergeri 128 4096 32 Escherichia coli 256 4096 16 Shigella group isolated 64 4096 64 Granulicatella adiacens 64 2048 32

153

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.65 shows the minimum inhibitory concentration and minimum biofilm eradicating concentration of garlic extract against all the isolated biofilm forming bacterial uropathogens. The lowest MIC concentration of garlic extract was 64 µg/mL and the highest concentration required for MIC was 512 µg/mL. The lowest concentration for the MBEC of garlic extract were 2048 µg/mL required against Granulicatella adiacens. The highest concentration required for the MBEC of garlic extract was 65536 µg/mL against biofilm forming Raoultella ornithinolytica. In present study the comparison of the required concentration of garlic extract for MBEC against uropathogens was more than MIC concentration. MBEC of all the uropathogens was 16-128 folds greater than MIC. Means Minimum Biofilm Eradicating Concentration of garlic extract showed 16-128 times greater than its Minimum inhibitory concentration.

Figure 4.48. MIC and MBEC of Garlic extract against the biofilm forming uropathogens

Affectivity of garlic extract was less towards Klebsiella pneumonia, Pseudomonas species and Acinetobacter baumannii as compared to other isolates (figure 4.48)

4.7.6. Tobramycin

Table 4.50..Comparison between MIC and MBEC of Tobramycin against different uropathogens Name of uropathogens MIC(µg/mL) MBEC(µg/mL) Greater than Pseudomonas aeruginosa 1024 262144 256 Pseudomonas alcaligenes 1024 131072 128 Staphylococcus aureus 512 65536 128 Dermacoccus nishinomiyaensis 512 32768 64 Staphylococcus haemolyticus 256 32768 128 154

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Klebsiella pneumoniae 512 32768 64 Shigella group isolated 64 32768 512 Escherichia coli 256 32768 128 Staphylococcus 256 32768 128 pseudintermedius Acinetobacter baumannii 512 32768 64 Enterococcus faecium 128 16384 128 Enterococcus faecalis 128 8192 64 Stenotrophomonas maltophilia 256 8192 32 Gemella bergeri 128 8192 64 Granulicatella elegans 128 8192 64 Granulicatella adiacens 128 8192 64 Proteus mirabilis 128 8192 64 Sphingomonas paucimobilis 32 4096 128 Raoultella ornithinolytica 64 2048 32 Bordetella hinzii 64 2048 32 Proteus vulgaris 64 2048 32

Table 4.50 shows the minimum inhibitory concentration and minimum biofilm eradicating concentration of tobramycin against all the isolated biofilm forming bacterial uropathogens. The lowest MIC concentration of Tobramycin was 64 µg/mL and the highest concentration required for MIC was 1024 µg/mL. The lowest concentration for the MBEC of tobramycin were 2048 µg/mL. The highest concentration required for the MBEC of tobramycin was 262144µg/mL against biofilm forming Pseudomonas aeruginosa only. In present study the comparison of the required concentration of Tobramycin for MBEC against uropathogens was more than MIC concentration. MBEC of all the uropathogens was 32-512 folds greater than MIC. Means Minimum Biofilm Eradicating Concentration of tobramycin showed 32- 512 times greater than its Minimum inhibitory concentration.

155

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Figure 4.49. MIC and MBEC of Tobramycin against the biofilm forming uropathogens

Pseudomonas species were not affected by tobramycin even at concentration of 26214µg/mL for biofilm eradication (fig 4.49).

4.7.7. Gentamycin

Table 4.66. Comparison between MIC and MBEC of gentamycin against different uropathogens Name of uropathogens MIC(µg/mL) MBEC(µg/mL) Greater than Pseudomonas alcaligenes 512 65536 128 Escherichia coli 128 32768 256 Pseudomonas aeruginosa 256 32768 128 Dermacoccus nishinomiyaensis 128 32768 256 Staphylococcus haemolyticus 256 32768 64 Acinetobacter baumannii 128 32768 256 Raoultella ornithinolytica 256 16384 64 Staphylococcus pseudintermedius 256 16384 64 Granulicatella elegans 64 16384 256 Staphylococcus aureus 128 8192 64 Klebsiella pneumoniae 128 8192 64 Proteus mirabilis 128 8192 64 Granulicatella adiacens 128 4096 32 Sphingomonas paucimobilis 32 4096 128 Enterococcus faecalis 64 2048 32 Stenotrophomonas maltophilia 64 2048 32 Gemella bergeri 32 2048 64 Bordetella hinzii 64 2048 32 Proteus vulgaris 64 1024 16 Enterococcus faecium 32 1024 32 Shigella group isolated 32 512 16

156

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.66 shows the minimum inhibitory concentration and minimum biofilm eradicating concentration of gentamycin against all the isolated biofilm forming bacterial uropathogens. The lowest MIC concentration of gentamycin was 32µg/mL against Sphingomonas paucimobilis and the highest concentration required for MIC was 512 µg/mL against Pseudomonas alcaligenes. The lowest concentration for the MBEC of gentamycin were 512 µg/mL required against Shigella group. The highest concentration required for the MBEC of gentamycin was 65536 µg/mL against biofilm forming Pseudomonas alcaligenes. In present study the comparison of the required concentration of gentamycin for MBEC against uropathogens was more than MIC concentration. MBEC of all the uropathogens was 16-256 folds greater than MIC. Means Minimum Biofilm Eradicating Concentration of gentamycin showed 16- 256 times greater than its Minimum inhibitory concentration.

Figure 4.50. MIC and MBEC of Gentamycin against the biofilm forming uropathogens

In figure 4.50 Pseudomonas aeruginosashowed the highest MBEC values for gentamycin.

157

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

4.7.8. Chloramphenicol

Table 4.67.Comparison between MIC and MBEC of chloramphenicol against different uropathogens Greater Name of uropathogens MIC(µg/mL) MBEC(µg/mL) than Raoultella ornithinolytica 64 8192 128 Pseudomonas aeruginosa 64 8192 128 Pseudomonas alcaligenes 128 8192 64 Bordetella hinzii 32 4096 128 Proteus vulgaris 64 4096 64 Proteus mirabilis 32 4096 128 Escherichia coli 32 2048 64 Granulicatella adiacens 64 2048 32 Stenotrophomonas maltophilia 64 2048 32 Dermacoccus nishinomiyaensis 32 2048 64 Sphingomonas paucimobilis 32 2048 64 Klebsiella pneumoniae 16 2048 128 Acinetobacter baumannii 32 2048 64 Enterococcus faecium 16 1024 64 Gemella bergeri 16 1024 64 Enterococcus faecalis 16 1024 64 Staphylococcus haemolyticus 16 1024 256 Staphylococcus pseudintermedius 32 512 16 Granulicatella elegans 32 512 16 Shigella group isolated 8 512 64 Staphylococcus aureus 16 512 32

Table 4.67 shows the minimum inhibitory concentration and minimum biofilm eradicating concentration of chloramphenicolagainst all the isolated biofilm forming bacterial uropathogens. The lowest MIC concentration of chloramphenicol was 8 µg/mL against Shigella group and the highest concentration required for MIC was 128 µg/mL against Pseudomonas alcaligenes. The lowest concentration for the MBEC of chloramphenicol were 512µg/mL. The highest concentration required for the MBEC of chloramphenicol was 8192µg/mL. In present study the comparison of the required concentration of chloramphenicol for MBEC against uropathogens was more than MIC concentration. MBEC of all the uropathogens was 32-256 folds greater than MIC. Means Minimum Biofilm Eradicating Concentration of chloramphenicolshowed 32-256 times greater than its Minimum inhibitory concentration.

158

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Figure 4.51. MIC and MBEC of Chloramphenicol against the biofilm forming uropathogens

In figure 4.51 it is observed that chloramphenicol is most effective against Staphylococcus aureus and least effective against Raoultella ornithinolytica and Pseudomonas species.

4.7.9. Erythromycin

Table 4.68. Comparison between MIC and MBEC of erythromycin against different uropathogens Greater Name of uropathogens MIC(µg/mL) MBEC(µg/mL) than Pseudomonas alcaligenes 256 65536 256 Stenotrophomonas maltophilia 256 32768 128 Granulicatella elegans 256 32768 128 Acinetobacter baumannii 128 32768 256 Dermacoccus nishinomiyaensis 256 16384 64 Escherichia coli 128 8192 64 Pseudomonas aeruginosa 128 8192 64 Granulicatella adiacens 128 8192 64 Shigella group isolated 128 8192 64 Staphylococcus haemolyticus 128 8192 64 Klebsiella pneumoniae 256 8192 32 Proteus vulgaris 64 8192 128 Staphylococcus pseudintermedius 64 8192 128 Sphingomonas paucimobilis 128 8192 64 Staphylococcus aureus 32 4096 128 Enterococcus faecalis 64 4096 64 Gemella bergeri 32 2048 64 Raoultella ornithinolytica 64 2048 32 Bordetella hinzii 64 2048 32 Proteus mirabilis 32 2048 64 Enterococcus faecium 16 1024 64 159

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.68 shows the minimum inhibitory concentration and minimum biofilm eradicating concentration of erythromycinagainst all the isolated biofilm forming bacterial uropathogens. The lowest MIC concentration of erythromycinwas 16 µg/mL and the highest concentration required for MIC was 256 µg/mL. The lowest concentration for the MBEC of erythromycin were 1048 µg/mL required against Enterococcus faecium. The highest concentration required for the MBEC of erythromycin was 65536 µg/mL against biofilm forming Pseudomonas alcaligenes. In present study the comparison of the required concentration of erythromycin for MBEC against uropathogens was more than MIC concentration. MBEC of all the uropathogens was 32-256 folds greater than MIC. Means Minimum Biofilm Eradicating Concentration of erythromycin showed 32-256 times greater than its Minimum inhibitory concentration.

Figure 4.52. MIC and MBEC of Erythromycin against the biofilm forming uropathogens

Erythromycin was least effective against Pseudomonas alcaligenes with MBEC of 65536µg/mL (fig 4.52).

4.7.10. Ciprofloxacin

Table 4.69.Comparison between MIC and MBEC of ciprofloxacin against different uropathogens Greater Name of uropathogens MIC(µg/mL) MBEC(µg/mL) than Pseudomonas alcaligenes 64 8192 128 Granulicatella adiacens 32 4096 128 Acinetobacter baumannii 32 4096 128 Proteus vulgaris 64 2048 32 160

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Escherichia coli 32 2048 64 Pseudomonas aeruginosa 32 2048 64 Sphingomonas paucimobilis 64 2048 32 Raoultella ornithinolytica 32 2048 64 Proteus mirabilis 64 1024 16 Granulicatella elegans 16 1024 64 Staphylococcus aureus 32 512 16 Shigella group isolated 16 512 32 Staphylococcus 16 512 32 pseudintermedius Dermacoccus 32 512 16 nishinomiyaensis Staphylococcus haemolyticus 16 512 32 Klebsiella pneumoniae 16 512 32 Enterococcus faecium 32 512 16 Enterococcus faecalis 32 256 16 Bordetella hinzii 16 256 16 Stenotrophomonas 16 256 16 maltophilia Gemella bergeri 1 8 8

Table 4.69 shows the minimum inhibitory concentration and minimum biofilm eradicating concentration of ciprofloxacin against all the isolated biofilm forming bacterial uropathogens. The lowest MIC concentration of ciprofloxacin was 1µg/mL against Gemella bergeri and the highest concentration required for MIC was 64 µg/mL. The lowest concentration for the MBEC of ciprofloxacin were 8 µg/mL required against Gemella bergeri. The highest concentration required for the MBEC of ciprofloxacin was 8192µg/mL against biofilm forming Pseudomonas alcaligenes. In present study the comparison of the required concentration of ciprofloxacin for MBEC against uropathogens was more than MIC concentration. MBEC of all the uropathogens was 8-128 folds greater than MIC. Means Minimum Biofilm Eradicating Concentration of ciprofloxacin showed 8-128 times greater than its Minimum inhibitory concentration.

161

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Figure 4.53. MIC and MBEC of Ciprofloxacin against the biofilm forming uropathogens

4.7.11. Ceftazidime

Table 4.70. Comparison between MIC and MBEC of ceftazidime against different uropathogens Name of uropathogens MIC(µg/mL) MBEC(µg/mL) Greater than Raoultella ornithinolytica 512 131072 256 Sphingomonas paucimobilis 512 65536 128 Escherichia coli 256 8192 32 Dermacoccus nishinomiyaensis 128 8192 64 Staphylococcus 64 16384 256 pseudintermedius Pseudomonas alcaligenes 64 8192 128 Granulicatella adiacens 64 8192 128 Staphylococcus haemolyticus 64 2048 32 Acinetobacter baumannii 64 16384 256 Gemella bergeri 32 1024 32 Pseudomonas aeruginosa 32 8192 256 Granulicatella elegans 32 4096 128 Stenotrophomonas maltophilia 32 4096 128 Klebsiella pneumoniae 32 4096 128 Proteus vulgaris 32 1024 32 Enterococcus faecium 32 1024 32 Enterococcus faecalis 16 512 32 Bordetella hinzii 16 512 32 Proteus mirabilis 16 1024 64 Shigella group isolated 16 512 32 Staphylococcus aureus 8 512 64

162

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Table 4.70 shows the minimum inhibitory concentration and minimum biofilm eradicating concentration of ceftazidime against all the isolated biofilm forming bacterial uropathogens. The lowest MIC concentration of ceftazidime was 8µg/mL and the highest concentration required for MIC was 512 µg/mL. The lowest concentration for the MBEC of ceftazidime 512 µg/mL required. The highest concentration required for the MBEC of garlic extract was 131072 µg/mL against biofilm forming Raoultella ornithinolytica. In present study the comparison of the required concentration of ceftazidime for MBEC against uropathogens was more than MIC concentration. MBEC of all the uropathogens was 32-256 folds greater than MIC. Means Minimum Biofilm Eradicating Concentration of ceftazidime showed 32-256 times greater than its Minimum inhibitory concentration.

Figure 4.54. MIC and MBEC of Ceftazidime against the biofilm forming uropathogens

4.7.12. Ampicillin

Table 4.71.Comparison between MIC and MBEC of ampicillin against different uropathogens Greater Name of uropathogens MIC(µg/mL) MBEC(µg/mL) than Pseudomonas aeruginosa 1024 131072 128 Pseudomonas alcaligenes 512 131072 256 Granulicatella elegans 512 131072 256 Raoultella ornithinolytica 512 131072 256 Dermacoccus nishinomiyaensis 256 131072 256 Staphylococcus 512 65536 128 pseudintermedius Shigella group isolated 512 65536 128 Klebsiella pneumoniae 512 65536 128

163

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Granulicatella adiacens 512 32768 64 Staphylococcus aureus 256 32768 128 Acinetobacter baumannii 256 32768 128 Sphingomonas paucimobilis 256 32768 128 Stenotrophomonas maltophilia 128 32768 256 Staphylococcus haemolyticus 256 32768 128 Escherichia coli 256 32768 128 Proteus mirabilis 256 16384 64 Gemella bergeri 128 8192 64 Proteus vulgaris 128 8192 64 Bordetella hinzii 128 8192 64 Enterococcus faecalis 128 8192 64 Enterococcus faecium 64 4096 64

Table 4.71 shows the minimum inhibitory concentration and minimum biofilm eradicating concentration of ampicillin against all the isolated biofilm forming bacterial uropathogens. The lowest MIC concentration of ampicillin was 64 µg/mL and the highest concentration required for MIC was 1024 µg/mL. The lowest concentration for the MBEC of ampicillin were 4096 µg/mL required against Enterococcus faecium. The highest concentration required for the MBEC of ampicillin was 131072µg/mL. In present study the comparison of the required concentration of ampicillin for MBEC against uropathogens was more than MIC concentration. MBEC of all the uropathogens was 64-256 folds greater than MIC. Means Minimum Biofilm Eradicating Concentration of ampicillin showed 64-256 times greater than its Minimum inhibitory concentration.

Figure 4.55. MIC and MBEC of Ampicillin against the biofilm forming uropathogens 164

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Discussion

The MIC has been used as a gold standard for determination of antimicrobial sensitivities for animal and human pathogenic bacteria. It is recognized that an antibiotic that is ineffective in preventing growth of a particular organism using the MIC assay will also be clinically ineffective. However, an organism that is sensitive in vitro may not be effective in vivo. For many veterinary bacterial diseases the MIC value for a particular antibiotic is not predictive of clinical efficacy. Nevertheless, up to this time, the MIC assay remains the best way to select potentially effective antimicrobial agents (Olson, Ceri, Mork, Buret, & Read, 2002).

The minimum inhibitory concentration values of antimicrobial agents used in present study against biofilm forming bacterial isolates was investigated particularly from lowest concentration of 1 µg/mL upto highest concentration 1024 µg/mL. The minimum biofilm eradicating concentration values of antimicrobial agents used in present study against biofilm forming Gram-positive and Gram-negative bacteria isolates particularly from lowest concentration of 4 µg/mL upto highest concentration 262144 µg/mL Ghanwate N.A. (2012). evaluated MIC and MBEC to determine changes in the pattern of antibiotic sensitivity of uropathogenic E.coli from planktonic to the biofilm phase of growth. They determined MIC by using Hi-comb MIC strip.

Ceri et al., studied effect of frequently used veterinary wound antimicrobials for their efficacy in killing mature in vitro Staphylococcus aureus biofilms and inhibiting planktonic cells. The MBEC assay as a tool for antibiotic susceptibility testing was also assessed and found that S. aureus biofilm lacked sensitivity to tetracycline and the tetracycline base wound spray. Often the MIC concentration of antibiotic, which by definition is efficacious against the planktonic cells, was not effective against biofilm cultures of same organisms. The biofilm often require from 10 to 1000 fold the concentration of antibiotics to be eradicated as compared to planktonic bacteria (Ceri, Olson, Read, Morck, Burett, & Read, 2001). In present study different chemical agents, plant extract and nanoparticles were investigated and found that concentration required was 4-356 folds greater for MBEC as compared to MIC.

165

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Minimum inhibitory concentration and minimum biofilm eliminating concentration results were compared to determine changes in the pattern of antibiotic sensitivity of Gram-negative bacilli from the planktonic to the biofilm phase of the growth. The antibiotic sensitivities of planktonic organisms tested by the MIC assays were significantly higher than the antibiotic sensitivities of the same organisms in their biofilm states as tested by the MBEC assays. The MIC and MBEC assays were conducted on stored isolates obtained from patients presenting with peritoneal dialysis related gram negative peritonitis with Escherichia coli or Pseudomonas. (Sepandj, Ceri, Gibb, Read, & Olson, 2003)(Ghanwate N. A., 2012) in the study on biofilm eradication on uropathogenic E.coli using Ciprofloxacin and Nitrofurantoin and found that the MBEC of the antibiotics was more than 10 folds higher than its MIC.

In present investigation and the graphical representation of comparison between MIC and MBEC of the entire antimicrobial agents particularly for both Gram-positive and Gram-negative organisms was performed. The figures clearly showed that higher concentration of antimicrobial agents were required for biofilm eradication than planktonic phase of bacteria. MBEC was found to be much higher than MIC of same antimicrobial agents for same organisms. MBEC was found to be

4-356 folds higher than MIC values. Sandoe et al., in 2006 studied MBIC90 of 3 Ampicillin, Linezolid and Vancomycin were 10 times greater than MIC90, at least

twice the MBC90, and well above serum levels that were achievable or sustainable patients. (Sandoe, Waaome, West, & Heritage, 2006).

Abdallah et al., in 2011 studied MIC for biofilm forming bacteria. The most frequently isolated micro-organisms were Escherichia coli (31.7%) followed by Klebsiella (15%); Staphylococcus aureus; coagulase negative Staphylococcus (CoNS); Enterococcus (11.7%); Proteus (10%); Pseudomonas (6.7%) and the least common was Enterobacter (1.7%)(Abdallah, Elsayed, Mostafa, & El-gohary, 2011). During the present study similar bacteria was isolated from the urinary catheter samples and their MIC and MBEC was studied.

(Laverty, Alkawareek, & Gilmore, 2014) studied “The In Vitro Susceptibility of Biofilm Forming Medical Device Related Pathogens to Conventional Antibiotics.” they determinedMIC, MBC, and MBEC for vancomycin, rifampicin, trimethoprim,

166

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR) gentamicin, and ciprofloxacin against the biofilm forming bacteria Staphylococcus epidermidis, Staphylococcus aureus, Methicillin Resistant Staphylococcus aureus, Pseudomonas aeruginosa, and Escherichia coli. MICs and MBCs were determined via broth microdilution in 96-well plates. MBECs were studied using the Calgary Biofilm Device. Values obtained were used to investigate the kill kinetics of conventional antimicrobials against a range of planktonic and biofilm microorganisms over a period of 24 hours. Planktonic kill kinetics were determined at 4xMIC and biofilm kill kineticsat relative MBECs. Susceptibility of microorganisms varied depending on antibiotic selected and phenotypic form of bacteria.Gram-positive planktonic isolates were extremely susceptible to vancomycin (highest MBC: 7.81mg L−1: methicillin sensitive andresistant S. aureus) but no MBEC value was obtained against all Biofilm pathogens tested (up to 1000 mg L−1). The MBEC assay could provide a quick and reliable methodology to assess the susceptibility of organisms growing in a biofilms to antibiotics. The reliability of in vitro MBEC assay for antimicrobial susceptibility against bacterial biofilms in the anticipation that the MBEC would be more reliable for clinical effective antimicrobials. Thus from this study it becomes clear that to eradicate or eliminate bacteria from biofilm, very high concentration of antibiotic is required. The reason behind those antibiotics could not penetrate through biofilm because of extracellular polymeric matrix continuously produced by bacteria within biofilm.

4.8. Control strategies to prevent biofilm formation in urinary catheters

Table 4.72. Inhibition of biofilm formation by treated catheter with respective agents Coating agents and Control Days Triclosan 24 Ceftazidime + Copper nanoparticles 23 Copper nanoparticles 21 Ceftazidime 19 Clove oil 17 Neem oil 16 Triclosan + Ceftazidime 14 Silver nanoparticles 13 Chloramphenicol 12 Neem oil + Garlic oil 12 Tobramycin 11

167

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Ceftazidime + Silver nanoparticles 9 Cinnamon oil 9 Garlic oil 8 Amla oil 7 Control 3

The sterilized newly Foley urinary catheters were used for the coating with different antibiofilm, antimicrobial agents to prolong the durability and prevent biofilm formation in the urinary catheter. 15 different antibiofilm agents were used to coat urinary catheters to increase the durability and was studied for bacterial contamination by artificial bladder model setup as explained in methodology. As the highest count of biofilm forming Pseudomonas species was isolated from the samples of catheterized patients so the durability were checked against these Pseudomonas species by introducing the culture in bladder model in artificial urine as explained. Each day catheter section were studied for the presence of Pseudomonas species by the standard procedure as explained before. During the study it was found the that coated catheter resist more against bacterial attachment then uncoated catheter. In uncoated catheter (control) the biofilm formation by Pseudomonas aeruginosa was observed in 3 days. Other treated catheters were found to resist attachment for several days as shown in the above table 1.78.

Triclosan

The catheter samples coated with 1% solution of triclosan as per procedure showed the growth in the catheter section on 25th day. Thus the bacterial attachment was prolonged for 24 days in the treated catheter as compared to 3 days in untreated catheter.

Ceftazidime + Copper nanoparticles

The coating of urinary catheter with combination of ceftazidime and cupper nanoparticles showed excellent results and prevented biofilm formation up to 23 days. The presence of bacteria with biofilm was observed on 24th day.

168

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Copper nanoparticles

1% solution of copper nanoparticles alone in ammonia. Prolonged the durability of the catheters and prevented biofilm for 21 days.

Ceftazidime

The fourth most effective antibiotic and antibiofilm agent studied was ceftazidime. With 1% solution of ceftazidime the catheter sample was coated and observed the increased durability for up to 19 days

Clove oil

Coating of the sterilized catheter with pure clove oil was observed with effective results and prolong the bacterial attachment for up to 17 days.

Neem oil

Neem oil was also very effective antibiofilm agent and it prevented the bacterial biofilm for up to 16 days.

Triclosan + Ceftazidime

Coating of catheter with the combination of triclosan and ceftazidime antibiotic prevents bacterial biofilm up to 14 days

Silver nanoparticles

Coating of urinary catheter with 1% silver nanoparticles increased the durability and prevented bacterial biofilm till 13 days of catheterization.

Chloramphenicol

Coating with 1% of chloramphenicol antibiotic to the urinary catheter prolonged bacterial contamination till 12 days.

Neem oil + Garlic oil

Coating of the catheter with the combination of Neem oil and garlic oil were also studied (and it was found that the durability increased up to 12 days.

169

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Tobramycin

Coating of catheter with 1% Tobramycin antibiotic solution prevent the bacterial biofilm for up to 11days.

Ceftazidime + Silver nanoparticles

The combination of antibiotic ceftazidime and silver nanoparticles coating applied to the urinary catheter increased the durability for upto 9 days of catheterization.

Cinnamon oil

Coating of urinary catheter with Cinnamon oil prevented the bacterial biofilm for up to 9 days.

Garlic oil

Coating of urinary catheter with garlic oil prevented the bacterial biofilm for upto 8 days from the day of catheterization.

Amla oil

Coating of sterilized catheter with amla oil prevented the growth of bacterial biofilm forup to 7 days.

Control

Control catheter without any coating agent was observed with the growth of contamination of bacterial biofilm in 3 days of catheterization.

The section of contaminated catheter with bacterial biofilm were checked with scanning electron microscopy for the presence of uropathogens embedded in biofilm.

170

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Figure 4.56. Inhibition of biofilm formation by treated catheter with respective coating agents

Figure no. 4.56 shows that the highest inhibition of biofilm was observed with triclosan, ceftazidime+ CuNps and Copper nanoparticles. It prolonged the attachment for 24, 21 and 19 days respectively.Amla oil was least effective with activity for just 7 days. In control/ uncoated catheter growth was observed in just within 3 days.

171

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

172

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Figure 4.57. Processing of coated catheter sample A-Treated Foley urinary catheter with antimicrobial agents B-Section of urinary catheter for the presence of uropathogens C-Growth of Pseudomonas aeruginosa after 24 days in urinary catheter treated with Triclosan D-Section of the inner lumen of catheter for detection of uropathogens by scanning electron microscopy E-Urinary catheter treated with different antimicrobial agents for presence of uropathogens F-Patients used catheter and treated catheter.

A B

173

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Figure 4.59. A to C -SEM images of lumen surface of urinary catheter treated with triclosan absence of thick EPS and bacterial cells can be seen.

D E

F G

174

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

I J

Figure 4.58. D to J : SEM of lumen surface of used urinary catheter. Thick EPS matrix along with attached bacteria can be observed (SAIF IIT Powai).

K L

175

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Figure 4.60. K to M : SEM images of effect of clove oil treatment on the catheter. There is absence of bacteria.

N O

Figure 4.61. N and O : SEM images of catheter coated with tobramycin with no EPS and bacterial cells

Q P

Figure 4.62. P and Q : SEM image of catheter lumen treated with neem oil shows smooth surface with no bacterial attachment or EPS formation

176

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Figure 4.63. R : Coating of catheter lumen with ceftazidime +CuNps shows no EPS Discussion

In the present study, prevention of biofilm formation in the urinary catheter lumen by coating with antimicrobial agents was investigated. Pseudomonas aeruginosa was used asthe test organism for studying phenomena of biofilm formation. This bacterium has become a model organism for studying biofilm and quorum sensing (Davies, Parsek, Pearson, Iglewski, Costerton, & Greenberg, 1998).Urinary tract infections are among the most common type of nosocomial (hospital acquired) infections, accounting for 40% of all infections in hospitals per year (Burke & Zavasky, 1999). UTI’s are a leading cause of Gram negative sepsis in hospitalized patients and are the origin for about half of all nosocomial infections caused by urinary catheters (Forbes, Sahm, & Weissfelf, 2007).

The most important and simple strategy to reduce the rate of urinary tract infection is by the attention of an adequate hand hygiene and aseptic technique (MacDonald, Dinah, Mackenzie, & Wilson, 2004)(Pittet, et al., 2010) (Raad, et al., 1994). While for short peripheral catheters good hand hygiene before catheter insertion or maintenance combined with proper aseptic technique during catheter manipulation is of major importance, the level of barrier precautions needed to prevent infection during insertion. Good hand hygiene comprises the use of either a waterless, alcohol based product or an antibacterial soap and water with adequate rinsing (Pittet, et al., 2010) . The type of catheter material used is also of importance regarding the risk for subsequent infections. Several studies showed that Tefl or polyurethane catheters are associated with fewer infectious complications than catheters made of Polyvinyl Chloride (PVC) or Polyethylene. Steel needles have the 177

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

same rate of infectious complications as do Teflon catheters. However, their use is frequently complicated by infiltration of IV fluids into the subcutaneous tissues (Tully, Friedland, Baldini, & Goldmann, 1981).

Ghanwate et al., in 2012investigated microbial contamination of indwelling urinary catheters. Biofilm forming ability of the isolates was determined by tissue culture plate method. Prevention of biofilm formation in the urinary catheter by Pseudomonas aeruginosa was also determined by coating the catheter with some enzymes, gentamycin and EDTA. It was found that 64% of the urinary catheters get contaminated during the course of catheterization. Of the total 6 isolates, biofilm formation was seen in 100% Pseudomonas aeruginosa and E. coli, 90% in Enterococci, 80% in Klebsiella and 66% in S. aureus. It was noted that the biofilm production by Pseudomonas was prolonged by 7 days in amylase, 8 days in protease, 6 days in lysozyme, 7days in gentamycin and 5 days in EDTA treated catheter (Ghanwate, Thakare, Bhise, Dhanke, & Apotikar, 2012). But the microorganisms may develop resistance to antibiotics like other Gram negative bacteria hence coating of antibiotics to urinary catheter may not be much effective. Chemical agents, nanoparticles and plant extract show great antibacterial properties observed that untreated catheter get contaminated only in 3 days and it was interestingly noted that treated catheter prevent biofilm of Pseudomonasfor up to 24days.

Early studies documented that a catheter removed from a patient with recalcitrant urosepsis, who failed antibiotic therapy, contained a thick biofilm adherent to the catheter (Nickel, Gristina, & Costerton, Electron microscopic study of an infected Foley catheter., 1985). This work was followed up by additional studies that documented extensive biofilm formation on urinary catheters by scanning electron microscopy (Ohkawa, Sugata, Sawaki, Nakashima, Fuse, & Hisazumi, 1990), which primarily included studies of catheters from patients that failed antibiotic therapy (Nickel, Downey, & Costerton, Ultrastructural study of microbiologic colonization of urinary catheters., 1989). A variety of Gram-negative bacteria were colonizing the catheters including P. aeruginosa , Enterococcus faecalis , E. coli and P. mirabilis , and these same organisms were isolated from infected urine (Nickel, Downey, & Costerton, Ultrastructural study of microbiologic colonization of urinary catheters., 1989). Interestingly, this early study revealed the association of crystalline 178

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR) deposits with P. mirabilis biofilms and laid the groundwork for a large number of subsequent studies that revealed the relationship between urease production and crystalline biofilms on catheters.In the present study a variety of biofilm forming uropathogens wasinvestigated under the scanningelectron micrograph of catheter samples of untreated catheter of patients with embedded in matrix in large amount. The treated catheter samples prevented the growth of Pseudomonas aeruginosa biofilm for longer time as compared to untreated catheter samples. Also it was observed that the biofilm forming intensity was less in the treated catheter as compared to control.

4.9. Detection of fimH, Psl1, Psl2, and CsgD genes in isolated uropathogens The catheter isolates were investigated for the presence of certain genes responsible for biofilm formation(Nam, Eui-Hwa, Sungjin, Chae, & Hwang)(Brombacher, Baratto, Dorel, & Landini)(Murakami, et al.) genes selected and its primer sequence were as in table

Biofilm forming as well as non-biofilm forming isolates were selected and screened for the presence and absence of fimH, Psl1, Psl2 and CsgD genes. following results were observed. fimH gene was detected in the biofilm forming strains of uropathogens and absent in non biofilm strains tested. In figure 5.90, wells 3 to 6 are non biofilm forming strains were fim Hwas absent gene and wells 7 to 12 shows presence of fim H gene

179

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

fim H

1 2 3 4 5 6 7 8 9 10 11 12

Figure 4.64. Detection of fim H gene in biofilm forming uropathogens

1. Blank 2. Control 3. Non biofilm Pseudomonas aeruginosa 4. Non biofilm Pseudomonas alcaligenes 5. Non biofilm Klebsiella pneumonia 6. Non biofilm Escherichia coli 7. Biofilm formingPseudomonas aeruginosa 8. Biofilm formingPseudomonas alcaligenes 9. Biofilm formingKlebsiella pneumonia 10. Biofilm formingEscherichia coli 11. Biofilm formingEnterococci

PsL1 gene of 2.5kb was detected in biofilm forming E. coli and P. aeruginosa and fim H gene was detected in all biofilm forming isolates tested (Figure 5.91).

180

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

PsL-1 fim H

Figure 4.65. Detection of Psl 1and fim H gene in biofilm forming uropathogens

PsL2gene of 1200bp was detected in biofilm forming E. coli and P. aeruginosa(Figure 5.92)

PsL-2

fim H

Figure 4.66. Detection of Psl 2and fim Hgenes in biofilm forming uropathogens

All three genes were detected in the biofilm forming Pseudomonas alcaligenesPsL-2 (1200bp), fimH (508bp) and Csg D (584bp)

181

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

PsL-2 fim H Csg D

Blank Control

Figure 4.67. Detection of PsL-2, fim H, Csg Dgenes in Pseudomonas alcaligenes

fim H gene of 508bp was detected in all the uropathogens tested and compared with blank and control

fim H

Blank

Control

Figure 4.68.Detection of fim H gene in biofilm forming uropathogens

Discussion

Selected isolates from urinary catheter samples were processed for amplification of fimH,PsL1,PsL-2 and CsgDgenes by Polymerase Chain Reaction using specific primers. all thesegenes are mainly responsible for biofilm formation.

182

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

fim H gene is responsible for fimbriae adhesion, PsL-1 and PsL-2are responsible for exopolysaccharides production, Csg D.In present study type 1 fimbriae are present among biofilm forming uropathogens to the extent that the fimH gene was detected in all strong and moderate biofilm forming strains. The high binding ability of fimH could result in increased bacterial binding to target cells and increased pathogenicity of pathogens .

In study conducted by Hojati et al., (2015) fimH gene was amplified using specific primers and appeared as a band of about 164 bp on polyacrylamide gel. The fimH gene was found in 130 isolates (92.8%) of UPEC. Of the 130 isolates positive for the fimH gene, 62 (47.7%) and 68 (52.3%) belonged to hospitalized patients and outpatients, respectively, Brombacher et al., (2006) studied Curli fibers, encoded by the csgBAC genes, promote biofilm formation in Escherichia coli and other enterobacteria and found that curli production is dependent on the CsgD transcription activator, which also promotes cellulosebiosynthesis. Murakami et al.,(2017)studied transposonmutagenesis, isolated a mutant with reduced tolerance to biapenem from adherent cells. Sequencing analysis revealed a mutation in the pslLgene, which is a part of the polysaccharide biosynthesis operon. P. aeruginosaPAO1ΔpslBCD mutant demonstrated a 100-fold lower survival during exposure tobiapenem in planktonic and biofilm cells, with a similar phenotype observed in mouseinfection model and clinical strains. The effect of pslBCD on antibiotic tolerance was evident, with 50- and 200- fold lower survival in the presence of ofloxacin and tobramycin, respectively. They speculate that the psl genes, which are activated by surface adherence through elevated intracellular c-di-GMP levels, confer tolerance to antimicrobials

In present study presence of gene fim H was 100% means present in all the isolate tested. Psl1Psl2 was in 40% and CsgD only in 20% of isolates.

183

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

5. Conclusion Nosocomial infection has a significant impact on the length of hospital stay and medical care cost. Nosocomial infections caused by different isolates have increased dramatically in the last 2 decades. UTI is the most common infection in patient with a long term indwelling bladder catheter. About 80-90% of nosocomial UTI’s are associated with urinary catheter. This creates an open channel into the body allowing bacterial access to the urinary tract. The distinct phenotype of microbial biofilms makes them resistant to antibiotics and their matrix makes them resistant to the antimicrobial molecules and cells mobilized by the host. Due to their indolent nature, biofilm related infections are usually diagnosed well after they have been established. A greater understanding of the nature of intraluminal bacterial communities in acute and chronic infections which can aid in the development of new and more effective problematic diseases is required. In the previous and present decades, a number of strategies have been or are being developed for the prevention and/or eradication of biofilm formation over implanted or inserted medical devices. Even some of the novel approaches developed at laboratory levels is really interesting, and the obtained results are encouraging from the medical and social points of view.

Once a biofilm has formed on an implanted medical device it is difficult to treat such infections because of significantly decreased levels of susceptibility of antimicrobial agents and lower levels of phagocytosis relative to the levels of resistance or tolerance and phagocytosis for their planktonic counterparts. Thus, supraphysiological concentrations of antibacterial agents may be required to eliminate the microorganisms embedded in biofilms. In the last decade, the study of bacterial biofilms and surface-associated communities has met with rekindled interest. It is now recognized that many of the early findings were rather generalized and that biofilms are much more complex and dynamic than originally anticipated. The reviews past and current P. aeruginosa biofilm research provides insight into how older paradigms are challenged by newer and sometimes conflicting observations. The reports show how strain background as well as the choice of biofilm reactors and growth medium can substantially influence the outcome of a given experiment and reflect the ability of P. aeruginosa to successfully adapt to various environmental conditions. However,

184

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR) the broad spectrum of results obtained in these studies also reminds us that our understanding of P. aeruginosa biofilm formation, architecture, and resistance phenotype is rudimentary and that we have merely scratched its surface. The present study was aimed at development of novel strategies for preventing biofilm formation by nosocomial uropathogens

Total 560 urinary catheter samples of patients were studied. Sample were collected from 12 different hospitals of Amravati city, Maharashtra, India. Patients history was recorded at the time of sample collection including age, duration, gender etc. The frequency of contaminated catheters from different hospitals was variable. Total 560 urinary catheter samples of 33 different type of diseased patient in which more number of samples with caesarean delivery (29%) and Kidney stone (22%). From total 560 catheter samples 61% of samples were of female catheterized patients From total samples of female patients 94% was found with contamination showing that females are on high risk to developing CAUTI due to increased use of catheter. In the study it was noted that 25% of collected samples were of patients with age in between 20-30yrs. Contamination depends on the duration of catheterization. Longer the duration more diverse flora was observed. Samples collected were of less than 1 day up to 40days. It was investigated that 44% of contaminated samples were of duration 1-5days.

Frequency of contamination was different in samples based on durations. 100% contamination was observed in sample with duration of 7days, 9days, 11days, 15days, 28days and 40days. Biofilm forming ability of uropathogens is directly proportional to the duration of catheterization. Uropathogens isolated from the samples with longer duration shows strong biofilm forming ability.

In present study total 22 different uropathogens were isolated (as per methodology) which included 21 bacteria and 1 fungal species. The major pathogen investigated during the study was P. aeruginosa. From the total 2940 isolated strains 16% of Pseudomonas aeruginosa was identified. Pseudomonas aeruginosa was found to be the dominating pathogens during the study. Sample were observed with multiple growth in single catheter sample. It was observed that maximum 6 different strains 185

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR) was isolated from a single catheter samples. As the duration of catheter is more so the diversity in the flora of CAUTI pathogens is more. From total samples, 12 was reported with 6 different uropathogens in each and 161 samples with only single uropathogen. E. coli was investigated more in mixed species. In single species P. aeruginosa observed more in number In present study E. coli and P. aeruginosa was reported as the major cause of nosocomial infection of CAUTI. Stenotrophomonas maltophilia, Granulicatella adiacens, Enterococcus faecalis, Enterococcus faecium, Proteus vulgaris, Bordetella hinzii, Shigella group were found only in mixed species.

Present study was also based on section wise isolation of uropathogens from the collected samples in five different section A, B, C, D and E as per methodology. Section wise study was done to investigate the site of contamination initiated and increased cause of contamination. So it was concluded that most prominent bacteria during the study was E. coli and P. aeruginosa. From all other sections Section A and section E are the two opposite opening. The investigation of these 2 sections was focused to find out the route of contamination. In section A the highest count of E. coli was isolated and it may be possible that these E. coli was of human flora. In section E, P. aeruginosa was isolated more in number. In section E, route of contamination of catheter was exogenous the section E was connected to the urine bag and in contact with hospital environment. The possibility of infection of section E by environmental flora of hospital can be concluded. In section A, uropathogens isolated are mostly moderate and non biofilm forming and E. coli was found with highest count. In section B, C, D and E moderate biofilm formation was seen high count of P. aeruginosa.

Antibiotic sensitivity pattern shows that MAR index was more then 0.2 for almost all the uropathogens tested concluding that there is antibiotic stress on uropathogens and rate of resistance increased rapidly. Biofilm forming ability was investigated in uropathogens and due to biofilm formation they are highly antibiotic resistant. Out of total isolates (2940), 68% of uropathogens were biofilm forming. From total 472 P. aeruginosa, 49% were moderate biofilm forming. The most effective drugs which were effective over uropathogens were Ciprofloxacin, Chloramphenicol, Gentamycin, Erythromycin, Ceftazidime and Tobramycin followed 186

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

by Ceftriaxone and Piperacillin. The least effective drugs were Amoxycillin, Cefaclor and Cefixime. MIC and MBEC was determined against selected antimicrobial agents. Triclosan was investigated as most effective antimicrobial agent with least MIC of 1ug/mL and 4 ug/mL for MBEC. Other prominent antimicrobial as well as antibiofilm agents reported during the study were copper nanoparticles, Chloramphenicol, Ceftazidime, Ciprofloxacin, Erythromycin and Gentamycin. It was observed that concentration required for MBEC is higher than MIC.

The effective antimicrobial agents were selected to treated the Foley catheter. In the study triclosan was reported as effective antibiofilm as well as antimicrobial agent in treated catheter and prevent uropathogenic biofilm formation for up to 24 days. Combination of copper nanoparticles and ceftazidime antibiotics showed synergistic activity and prevented the growth for up to 23 days. The treated catheter was compared with untreated catheter (control) in which growth was observed in just 3 days. From this study it was concluded that. Pseudomonas aeruginosa was found to be the most multidrug resistant organism followed by Candida albicans, Escherichia coli, Acinetobacter baumannii, Pseudomonas alcaligenes, Klebsiella pneumonia, Sphingomonas paucimobilis, Dermacoccus nishinomiyaensis, Staphylococcus aureus, Enterococcus faecalis, Staphylococcus pseudintermedius, Bordetella hinzii, Raoultella ornithinolytica, Staphylococcus haemolyticus, Proteus mirabilis, Stenotrophomonas maltophilia, Enterococcus faecium, Granulicatella elegans, Gemella bergeri, Granulicatella adiacens, Shigella group and Proteus vulgaris. Females are more prone to developed infection in early days of catheterization. Duration is the major factor of all the infections due to longer duration it increased rapidly in pathogenicity. Biofilm is the main problem to develop antibiotic resistance. So in present study effective antimicrobial agents was reported, the concentration range was determined and developed new antimicrobial strategies to treat the catheter samples and prevent biofilm formation and uropathogens In the present study the most active antimicrobial agent against all uropathogens isolated was triclosan, Over all study concluded that triclosan is most effective antimicrobial agents against strong biofilm forming isolates. 187

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Future prospective The biofilm concept is important in the understanding of catheter related infections in terms of diagnosis, prevention, and treatment. Until recently it was assumed that, outside of natural orifices, medical infections tend to be caused predominantly by a single pathogen. However, emerging evidence from the examination of clinical specimens suggests that polymicrobial infection is more common than previously thought, and it is now of interest to look at the less well-known microorganisms which have been found in biofilm-related infections in order to investigate the question of whether they play a role in the pathology, or represent incidental bystanders. However, they may also indicate whether infectious bacteria are located in a biofilm which may directly result in a better treatment and patient management. In the future more quantitative assays with a focus on the active fraction of microorganisms in the biofilm will be relevant in clinical microbial departments in hospitals. While improved diagnostics and treatment of catheter infections are desirable for more efficient catheter management, the ultimate goal is to design catheters which do not allow sustained microbial colonization or the formation of biofilms in the first place. The development of an infection-free catheter remains an elusive goal, despite efforts reaching back over four decades. However, as the direct examination of clinical specimens using modern techniques raises the awareness of the true extent of the “foreign body–biofilm infection” problem with catheters, an increasing number of academic and industrial researchers are drawn to the problem, bringing ever-imaginative strategies. The awareness that biofilms are often the underlying cause of infections allows researchers to focus on relevant prevention strategies. Increased understanding of basic biofilm developmental biology provides more opportunities for intervention. Finally, incomplete understanding of the mechanisms of catheter infection has permitted the acceptance of infection as an almost inevitable consequence of catheter use. Now we know that biofilms are the enemy, these high rates of infection should no longer be tolerated. Safe urological practice relies upon the availability of effective antibiotics, which is now threatened by the ongoing rapid evolution of resistance in bacterial uropathogens. Although some new drugs with activity against Gram-negative bacteria, including activity against strains with highly resistant phenotypes, might be 188

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR) available in the near future, they are likely to be expensive and might be best left for situations when no alternatives exist. Furthermore, the existence of a single agent with activity against the great diversity of resistance is unlikely.

6. References (1998). 98th General Meeting Workshop Program. Practical Approach to the Identification of the Medically Important Glucose Non-Fermenting Gram-Negative Bacilli. Washington D. C.: American society for Microbiology. Abdallah, N. M., Elsayed, S. B., Mostafa, M. Y., & El-gohary, G. M. (2011). Biofilm forming bacteria isolated from urinary tract infection, relationto catheterization and susceptibility to antibiotics. Biotechnology and Molecular Biology Research. , 172-178. Aguiniga, L. M., Yaggie, R. E., Schaffer, A. J., & Klumpp, D. J. (2016). Lipopolysaccharide domains modulate urovirulence. Infect. Immun. , 3131-3140. Aka, S., & Haji, S. (2015). Sub MIC of antibiotics induced biofilmformation of Pseudomonas aeruginosa in the presence of Chlorhexidine. J Microbiol , 149-154. Albini, S., Abril, C., Franchini, M., Hussy, D., & Filipoussis, G. (2009). Stenotrophomonas maltophilia isolated from the airways of animals with chromic respiratory disease. Schweizer Archiy fur Tierheilkunde , 323-328. Al-Hulu, S. M., Charrakh, A. H., & Saadi, M. A. (2009). Isolation and characterization of Raoultella ornithinolytica from Clinical specimens in Hilla city Iraq. Med. J. Babylon , 42-47. Alqahtani, M. (2013). Current Practice Improvment in Prevention of Catheter Associated Urinary Tract Infections in Adult Patients in Acute Medical Care at a Military Hospital. J Curr Microbiol App Sci. , 9. Alves, M. J., Barreira, J. C., Carvalho, I., Trinat, L., Perreira, L., Ferreira, I. C., et al. (2014). Proprnsity for biofilm formation by clinical isolates from urinary tract infections: developing a multifactorial predictive model to improve antibio therapy. Journal of Medical Microbiology , 471-477. Amyes, S. G. (2007). Enterococci and streptococci. Int. J. Antimicob. Agents , 43-52. Andes, D., Nett, J., Oschel, P., Albrecht, R., Marchillo, K., & Pitula, A. (2004). Development and characterization of an in vivo central venous catheter Candida albicans biofilm model. Infect Immun , 6023–6031. Arias, C. A., Contreras, G. A., & Murray, B. E. (2010). Mangement of multidrug-resistant enterococcal infections. Clin Microbiol Infect , 555-62. Arvand, M., Feldhues, R., Mieth, M., Kraus, T., & Vandamme, P. (2004). Chronic cholangitis caused by Bordetella hinzii ina liver transplant recipient. J Clin Microbiol. , 2335-2337. Atlas, R. A. (1993). Handbook of Microbiology Media. Ann Arbor . Bagshaw, S. M., & Laupland, K. B. (2006). Epidemiology of intensive care unit acquired urinary tract infections. Curr Opin Infect Dis. , 67-71.

189

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Bahashwan, S., & Shafey, H. (2013). Antimicrobial resistance patterns of Proteus isolates from clinical specimens . J. Sci. , 188-202. Balasubramanian, A., Chairman, K., Singh, A., & Alagumuthu, G. (2012). Isolation and Identification of microbes from biofilm of Urinary catheters and antimicrobial susceptibility evaluation. J Tro Bio. , 1780-1783. Bannoehr, & Guardabassi. (2012). Staphylococcus pseudintermedius in the dog: taxonomy, diagnostics,ecology, epidemiology and pathogenicity. Vet Dermatol , 253-66. Bannoehr, J., Ben Zakour, N., Waller, A., Guardabassi, L., Thoday, K., Van den broek, A., et al. (2007). Population genetic structure of the Staphylococcus intermedius group: insight into diversification and the emergence of methicillin-resistant strains. Journal of bacteriology , 8685-92. Barnhart, M. M., & Chapman, M. R. (2006). Curli biogeness and function. Ann. Rev. Microbiol , 131- 147. Barros, R. R., Carvalho, G. S., Peralta, J. M., Facklam, R. R., & Teixeira, L. M. (2001). Phenotypic and Genotypic Characterization of Pediococcus Strains Isolated from Human Clinical Sources. J. Clin. Microbiol. , 1241-1246. Bekele, T., Tesfaye, A., Sewunet, T., & Waktola, H. D. (2015). Pseudomonas aeruginosa isolates and their antimicrobial susceptibility pattern amongcatheterized patients at Jimma univerisyt teaching hospital, Jimma. Ethiopia , 488-452. Berg, G., Roskot, N., & Smalla, K. (1999). Genotypic and phenotypic relationships between clinical and envionmental isolates of Stenotrophomonas maltophilia. J. Clin. Microbiol. , 3594-600. Bille, J., Catimel, B., Bannerman, E., Jacquet, C., & Yersin, M. N. (1992). API Listeria a New and Promising one-day system toidentify Listeria isolates. Appl. Environ. Microbiol. , 1857-1860. Biofilm forming bacteria isolated from urinary tract infection, relation to catheterization and susceptibility to antibiotics2011International Journal for Biotechnology and Molecular Biology Research 172-178 Bizzaro, M. J., Callan, D. A., Farrel, P. A., Dembry, L. M., & Gallagher, P. G. (2011). Granulicatella adiascens and early onset sepsis neonate. . 1971-1973. Bjarnsholt, T., Jensen, P. O., Fiandaca, M. J., Pedersen, J., Hansen, C. R., & Andersen, C. B. (2009). Pseudomonas aeruginosa biofilms in the respiratory tract of cystic fibrosis patients. Pediatr Pulmonol , 547–558. Bourigault, C., Daniel, L., & Jordain, S. (2007). Contamination with Sphingomonas paucimobilis: about seven cases isolated on conservation and transport medium of corneal grafts. Pathol Biol , 127-130. Bouza, E., Burillo, A., & Munoz, P. (2002). Catheter-related infections: diagnosis and intravascular. Clin Microbiol Infect , 265-274. Brachman, P. S. (1980). Nosocomial surgical infecions: incidence and cost. . SurgClin North Am , 15- 25. Brenner, D. J., Grimont, P., Steigerwalt, A. G., Fanning, G. R., Ageron, E., & Riddle, C. F. (1993). Classification of Citrobacteria by DNA Hybridization: Designation of Citrobacter farmeri sp. 190

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

nov., Citrobacter youngae sp. nov., Citrobacter braakii sp. and theree unamedCitrobacter Genomospecies. . Int.J. Syst. Bacteriol. , 645-658. Brink, B. (2010). Urease Test Protocol. American society for Microbiology , 1-7. Brombacher, E., Baratto, A., Dorel, C., & Landini, P. (2006). Gene expression regulation by the curli activator CsgD protein: Modulation of cellulose Biosynthesis and Control of Negative determinants for Microbial adhesion. Journal of bacteriology , 2027-2037. Brooks, T., & Keevil, C. W. (1997). A simple artificial urine for the growthof urinary pathogens. Letter in Applied Microbiology , 203-206. Burke, J. P., & Zavasky, D. (1999). Nosocomial urinary tract infections, in Hospital Epidemiology and Infection Control. 173-187. Bursaferro, S., Arnoldo, L., Cattani, G., Fabbro, E., Cookson, B., & Gallagher, R. (2015). Harmonizing and supporting infection control trainingin Europe . Europe J Hosp Infect , 351-6. Bursle, E. C. (2015). Risk factors for urinary catheter associated bloodstream infection. J. Infect. , 585- 591. Cathcart, L., & Shields, P. (2010). Oxidase Test Protocol. American society for Microbiology , 1-9. Ceri, H., Olson, M. E., Read, R. R., Morck, D. W., Burett, A. G., & Read, R. R. (2001). The MBEC Assay system multiple equivalent biofilmfor antibiotic and biocide susceptibility testing. Methos Enzymol , 377-385. Chang, Y. H., Han, J., Chun, J., Lee, K. C., Rhee, M. S., Kim, Y. B., et al. (2002). Comamonas koreensis sp.nov., a non-motile species from wetland in Woopo,Korea. Int. J. Syst. Evol. Microbiol. , 377-318. Chang, Ya Ting, L., Chum, Y., Chen, Y. H., & Hsueh. (2015). Update on infections caused by Stenotrophomonas maltophilia with particular attention to resistance mechanisms and therapeutic options. Infectious Diseases , 893. Chapman, M. R., Robinson, L. S., Pinkner, J. S., Roth, R., Heuser, J., & Hammar, M. (2002). Role of Escherichia coli curli operons in directing amyloidal fiber formation. Science , 851-855. Chen, Y. H., Ko, W., & Hsueh, P. R. (2013). Emerging resistance problems and future prespective in pharmacotherapy for complicated urinary tract infections. Expert Opin Pharmacother. , 587- 596. Chenoweth, C. E., Gould, C. V., & Saint, S. (2014). Diagnosis, Management and Prevention of catheter associated urinary tract infections. Infect. Dis Clin. North Am. , 105-119. Cho, Y. H., Antunes, M. B., Palmer, J. N., & Cohen, N. A. (2007). Evaluation of the in vivo efficacy of topical tobramycin against Pseudomonas sinonasal biofilms. J Antimicrob Chemothe , 1130– 1134. Choog, S., & Whitfield, H. (2000). Biofilms and their role in infections in urology. BJU Int , 935-941. Chowdhury, S., & Parial, R. (2015). Antibiotic susceptibility patterns of bacteria among urinary tract infection patients in chittagong, Bangladesh. 413-418. Christensen, G. D., Simpson, A. W., Younger, J. J., Baddour, L. M., Barrett, F. F., Melton, D. M., et al. (1985). Adherence of Coagulase-Negative Staphylococci to Plastic Tissue Culture Plates: a

191

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Quantitative Model for the Adherence of Staphylococci to Medical Devices. Journal of Clinical Microbiology , 996-1006. Christensen, G. D., Simpson, W. A., & Younger, J. A. (1995). Adherence of coagulase negative Staphylococci to plastic tissue cultures: a quantitative model for the adherence of Staphylococci to medical devices. J Clin Microbiol , 996-1006. Clayton, C. L. (1982). Some observations on urinary tract infections in patients undergoing long-term bladder catheterization. J Hosp Infect , 39-47. Coenye, T., Vandamme, P., Gowan, J., & Lipuma, J. J. (2001). Taxonomy and Identification of the Burkholderia cepacia complex. J. Clin. Microbiol. , 3427-3436. Collins, M. D., & Lawson, P. A. (2000). The genus Abiotrophia is not monophyletic is not monophyletic Nov. Int J Syst Evol Microbiol , 365-369. Collins, M. D., & Lawson, P. A. (2000). The genus Abiotrophiais not monophiletic: proposal of Granulicatella gen. nov., Granulicatella adiacens comb. nov., Granulicatella elegans comb. nov. and Granulicatella balaenopterae. comb. nov. Int. J. Syst. Evol. Microbiol. , 365-369. Collins, M. D., Hutson, R. A., Hoyles, L., Falsen, E., & Nikolaitchouk, N. (2001). Streptococcus ovis sp. nov. isolated from sheep. Int.J. Sust. Evol. Microbiol. , 1147-1150. Comparison between Antimicrobial Minimum Biofilm Eradication Concentration and Minimum Inhibitory Concentration in Clinical Isoaltes in Device Related Infections2016Egyptian Journal of Medical Microbiology 91-100 Cools, H. J., & Van der Meer, J. W. (1986). Restriction of long-term indwelling urethral catheterisation in the elderly. Br J Urol , 683-688. Courvalin, P. (2006). Vancomycin resistance in Gram-positive cocci. Clin. Infect. Dis , 25-34. Cox, A. J., & Hukins, D. W. (1989). Morphology of mineral deposits on encrusted urinary catheters investigated by scanning electron microscopy. J Urol. , 1347-1350. Cruse, P. E., & Ford, R. (1980). A epidemiology of wound infection. A 10 years prospective study of 62,939 wounds. SurgClin North Am , 27-40. Cucarella, C., Tormo, M. A., & Knecht, E. (2002). Expression of the biofilm-associated protein interferes with host protein receptors of Staphylococcus aureus and alters the infective process. Infect Immun , 3180–3186. Danese, P. N., Pratt, L. A., Dove, S. L., & Kolter, R. (2000). The outer membrane protein, antigen 43, mediates cell to cell interactions with Escherichia coli biofilms. Mol. Microbiol. , 424-432. Davies, D. G., Parsek, M. R., Pearson, J. P., Iglewski, B. H., Costerton, J. W., & Greenberg, E. P. (1998). The involvement of cell to cell signals in the development of a bacterial biofilm. Sci , 295-298. De Baere, T., Steyaert, Wauters, G., De Vos, P., Goris, J., Coenye, T., et al. (2001). Classification of Ralstonia pickettii biovar 3/ ‘thomasii’ strains (Pickett 1994) and of new isolates related to nosocomial recurrent meningitis as Ralstonia mannitolytica sp.nov. Int. J. Syst. Evol. Microbiol. , 547-558. Denton, M., & Kerr, K. G. (1998). Microbial and clinical aspects of infection associated with Stenotrophomonas maltophilia. Clinical Microbiology Reviews , 57-80. 192

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Determination of minimum biofilm eradication concentration of orbifloxacin for canine bacterial uropathogens over different treatment periods2017Microbiol Immunol 17-22 Devriese, L., Vancanneyt, M., Baele, M., Vaneechoutte, M., De, G., Snauwaert, C., et al. (2005). Staphylococcus pseudintermedius sp. nov., a coagulase positive species from animals. Int. J. Syst Evol Microbiol , 1569-73. Djeribi, R., Jouenne, T., & Menaa, B. (2012). Characterization of bacterial biofilms formed on urinary catheters. . J Inf Count , 854-859. Dohnt, K., Sauer, M., Muller, M., Atallah, K., Weidemann, M., Gronemeyer, P., et al. (2011). An in vitro urinary tract catheter system to invetigate biofilm development in catheter asoociated urinary tract infections. J. Microbiol Meth , 302-308. Domingue, G. J., & Hellstrom, W. G. (1998). Prostatitis. Clin Microbiol , 604-613. Donlan, R. (2001). Biofilm formation: a clinically relevant microbiological process. Clin Infect Dis , 1387–1392. Doring, G., Conway, S. P., Heijerman, H. G., Hodson, M. E., Hoiby, N., & Smyth, A. (2000). Antibiotic therapy against Pseudomonas aeruginosa in cystic fibrosis: a European consensus. Eur Respir , 749-767. Doshi, R., Patel, G., Mackay, R., & Wallach, F. (2009). Healthcare-associated Infections: epidemiology,. Mt Sinai J Med , 84-94. Ducel, G., Fabry, J., & Nicolle, L. (2002-12). Prevention of hospital acquired infection A practice guide 2nd edition. Dund, J. V., Ninama, R., & Sinha, M. (2015). Antibiotic sensitivity pattern of bacteria isolated from catheter associated urinary tract infection in tertiary care hospital,jamangar. 1985-1988. Duque, A. S., Ferreira, A. F., Cezario, R. C., & Filho, G. P. (2007). Nosocomial infections in two hospitals in Uberlandia,Brazil. Rev PanamInfectol , 14-8. Ehinmidu, J. O. (2003). Antibiotics susecptibility patterns of urine bacterial isolates in Zaria, Nigeria. Trop J Pharm Res , 223-8. Emori, T. G., & Gaynes, R. P. (1993). An overview of nosocomial infections, including the role of the microbiology laboratory. Clin. Microbiol Rev , 428-442. Ennis, J. D., Wierbicky, J., & Nesathurai. (2015). Essential of Physical Medicine and Rehabilitation. Philadelphia. PA: Elsevier Saunders , 156. Essomba, C., Leme, L., Esiene, A., Abong, T., Etoundi, O., Gweth, M., et al. (2013). Identification and quantification of bacteria associated with indwelling urinary catheterization. J Cirr Microbiol App Sci , 168-177. EEtiology and antibiotic resistance patterns of community-acquired urinary tract infections in J N M C Hospital Aligarh, India2007Annals of Clinical Microbiology and Antimicrobials 1-7 Eto, D. S., Jones, T. A., Sundsbak, J. L., & Mulvey, M. A. (2007). Integrin-mediated host cell invasion by type-1 piliateduropathogenic Escherichia coli. PLoSPathog . Evaluation of different detection methods of biofilm formation in clinical isolates2011Braz J Infect Dis 305-311

193

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Fabry, J. (1982). Cost of nosocomial infections: analysisof 512 digestive surgery patients. World J Surg , 362-365. Falagas, M. E., Kastoris, A. C., Vouloumanou, E. K., & Dimopoulos, G. (2009). Community acquired Stenotrophomonas maltophilia: a systematic review. . European Journal of Clinical Microbiology and Infectious Disease. , 719-730. Falagas, M. E., Kastoris, A. C., Vouloumanou, E. K., Rafaildis, P. I., Kapaskelis, A. M., & Dimopoulos, G. (2009). Attributable mortality of Stenotrophomonas maltophilia infections: asystemic review of the literature. Future Microbiol , 1103-9. Ferman, J., Otero, R., Gonzalez, E., & Trevino, S. (2014). Stenotrophomonas maltophilia in Mexico: antimicrobial resistance, biofilm formation and clonal diversity. J Med Microbiol , 1524-1530. Fisher, J. F., Kavanagh, K., Sobel, J. D., Kauffman, C. A., & Newman, C. A. (2011). Candida urinary tract infection: pathogenesis. Clin. Infect Dis , 437-451. Flores-Mireles, A. L., Walker, J. N., Caparon, M., & Hultgren, S. J. (2015). Urinary tract infections: epidemiology, mechanisms of infection and teatment options. Nat Rev. Microbiol , 269-284. Foley, F. E. (1937). A hemostatic bag catheter: one piece latex rubber structure for control of bleeding and constant drainage following prostatic reaction. J Urol. , 134-9. Forbes, B. A., Sahm, D. F., & Weissfelf, A. S. (2007). Bailey and Scott's Diagnostic Microbiology. Elsevier Inc. , 842-951. Foxman, B. (2003). Epidemiology of urinary tract infections: incidence,morbidity and econoic costs. Dis Mon , 53-70. Foxman, B. (2010). The epidemiology of urinary tract infection. Nature Rev. Urol. , 653-660. Foxman, B. (2014). Urinary tract infection syndromes: occurrence, recurrence, bacteriology, risk factors, and disease burden. Infect. Dis Clin. North Am , 1-13. Freney, J., Renaud, F., Hansen, W., & Bollet, C. (2000). Précis de bactériologie clinique. ESKA . Fridkin, S. K., Wekbel, S. F., & Weinstein, R. A. (1997). Magnitude and prevention of nosocomial infections in the intensive care unit. Infect Dis Clin North Am , 479-96. Fry, N. K., Duncan, J., Edwards, M. T., Tilley, R. E., Chitnayis, D., & Harman, R. (2007). A UK clinical isolate of Bordetellahinzii from a patient with myelodysplastic syndrome. J Med Microbiol , 1700-3. Funke, G., Hess, T., von Graevenitz, A., & Vandamme, P. (1996). Characteristics of Bordetella hinzii strains isolated from a cystic fibrosis patient over a 3 year period. J Clin Microbiol , 966-9. Ganderton, L. (1992). Scanning electron microscopy of bacterial biofilmson indwelling bladder catheters. EurJ Clin Microbiol Infect Dis , 789-796. Gatermann, S., Funfstuck, R., Handrick, W., Leitritz, L., Naber, K. G., & Podbielski, A. (2005). Urinary tract infections: Quality standards for microbiological infections. Urban and Fischer , 21. Gavini, F., Mergaert, J., Beji, A., Mielcarek, C., Lzard, D., Kersters, K., et al. (1989). Transfer of Enterobacter agglomerans (Beijerinck 1888) Ewing and Fife to Pantoea gen. nov. as Pantoea agglomerans comb. nov. and Description ofPantoea dispersa sp. nov. . Int. J. Syst. Bacteriol. , 337-345. 194

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Getliffe, K. A., & Mulhall, A. B. (1991). The encrustration of indwelling catheters. Br J Urol. , 337- 341. Getliffe, K. (2003). Managing recurrent urinary catheter blockage: Problems, promises, and practicalities. J WOCN , 146-151. Ghanwate, N. A. (2012). Biofilm eradicationstudies on uropathogenic E. coli using ciprofloxacin and nitrofurantoin. Int. J. of Pharm and biomedical research , 127-131. Ghanwate, N., Thakare, P., Bhise, P., Dhanke, A., & Apotikar, S. (2012). Prevention of biofilm formation in urinary catheterby coating enzyme/ gentamycin/EDTA. J Sci Engg and Technol , 899-901. Gilligan, P. H., Lum, G., VanDamme, P., Whittier, S., Murray, P. R., Baron, E. J., et al. (2003). Burkholderia, Stenotrophomonas, Ralstonia, Brevundimonas,vundimonas,Comamonas, Delftia, Pandoraea, and Acidivorax. Manual of Clinical Microbiology (8th ed.) , 255-4. Glupczynscky, Y., Hansen, W., & Dratwa, M. (1984). Pseudomonas paucimobilis peritonitis in patients treated by peritoneal dialysis. J clinic Microbiol , 1225-26. Gordon, R. J., & Lowy, F. D. (2008). Pathogenesis of methicillin-resistance Staphylococcus aureus infection,. Clin Infect Dis , 50-9. Gorman, S. P., & Jones, D. S. (2003). Biofilm complications of urinary tract devices. In:Wilson M, Devine. Cambridge university press, Cambridge , 136-170. Goyal, P., Krasteva, P. V., Van Genven, N., Gubellini, F., Broeck, V. D., & Troupiotis-Tsailaki, A. (2014). Structural and mechanistic insights into the bacterial amyloid secretion channel CsgD. Nature , 250-253. Gray, M. (2001). Managing urinary encrustation in the indwelling catheter. J WOCN , 226–229. Hahn, E., Wild, P., Hermanns, U., Sebbel, P., Glockshuber, & Haner, M. (2002). Exploring the 3D molecular architecture of Escherichia coli type 1 pili. J. Mol. Biol. , 5-7. Hajek, V. (1976). Staphylococcus intermedius a new species isolated from animals. Int. J. Syst. Bacteriol , 408. Hajiroussou, V., Holmes, B., & Bullas, J. (1979). Meningitis caused by Pseudomonas paucimobilis. J clinic Pathol. , 953-955. Hannan, T. J., Totsika, M., Mansfield, K. J., Moore, K. H., Schembri, M. A., & Hultgren, S. J. (2012). Host pathogen checkpoints and population bottlenecks in persistent and intracellular uropathogenic Escherichia coli bladder infection. FEMS Microbiol. Rev. , 616-648. Hayashimoto, N., Morita, H., Yasuda, M., Ishida, T., Kameda, S., & Takakura, A. (2012). Prevalence of Bordetella hinzii in mice in experimental facilities in Japan. Res Vet Sci , 624-6. Hayashimoto, N., Yasuda, M., Goto, K., Takakura, A., & Itoh, T. (2008). Study of a Bordetella hinzii isolate from a laboratory mouse. . Comp Med , 440-6. Hedelin, H. (1984). The composition of catheter encrustrations, including the effects of allopurinol treatment. Br J Urol , 250-254. Hentzr, M., Teitzel, G., Heydorn, A., Molin, S., Givskov, M., & Parsek, M. (2001). Alginate Overproduction Affects Pseudomonas aeruginosa Biofilm Structure and Function. Journal of Biotechnology , 5395-5401. 195

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Hojati, Z., Zamanzaad, B., Hashemzadeh, M., Molaie, R., & Gholipour, A. (2015). Detection of fim H gene in uropathogenic Escherichia coli strains isolated from patients with urinary tract infection. Jundishapur J Microbiol , 17520. Holland, N. J., Sandhu, G. S., Ghufoor, K., & Frosh, A. (2001). The Foley catheter in the management of epistaxis. International Journal of clinical practice , 14-5. Holt, J. G., Krieg, N. R., Sneath, P., Staley, J. T., & Williams, S. T. (1994). Bergey’s Manual of Determinative Bacteriology,. 9th ed. Williamsand Wilkins,Baltimore,Maryland . Hooton, T. M. (2012). Uncomplicated urinary tract infections. New Engl. J. Med. , 1028-1037. Hooton, T. M., Bradley, S. F., Cardenas, D. D., & Colgan, R. (2009). Diagnosis,prevention and treatment of CAUTI in adylts. International clinical practice guidelines from Infectious dieases . 2213-2217. Horan, T. C., Andrus, M., & Dudeck, M. A. (2008). Surveillance definition of health care-associated infection and criteria for specific types of infections in the acute care setting. Am J Infect Control , 309-32. Horvath, D. J. (2011). Morphological plastic promotes resistance to phagocyte killing of uropathogenic Escherichia coli. Microbes Infect. , 426-437. Incidence and nature of peritoneal catheter biofilm dtermined by electron and confocal laser scanning microscopy1994Epidemiol.Infect. 551-559 Kadurugamuwa, J. L., Modi, K., Yu, J., Francis, K., DeBoer, M., Rubin, M., et al. (2003). Direct continuous method for monitoring biofilm infection in a. Infect Immun , 882-890. Kalsi, J., Arya, M., Wilson, P., & Mundy, A. (2003). Hospital acquired urinary tract infection. Int J Clin Pract , 388-91. Kanamaru, S., Kurazono, H., Terai, A., Monden, K., Kumon, H., Mizunoe, Y., et al. (2006). Increased biofilmformation in Escherichia coli isolated from acute prostatitis. Int J Antimicrob Agents , 21-25. Kattar, M. M., Chavez, J. F., Limaye, A. P., Rassoulian-Barrett, S. L., Yarfitz, S. L., & Carlson, L. C. (2000). Application of16s rRNA gene sequensing to identify Bordetella hinzii as the causative agent of fatal septicemia. J Clin Microbiol. , 789-94. Kilic, A., Senses, Z., Kurekci, E., Aydogan, H., Sener, K., & Kismet. (2007). Nosocomial outbreak of Sphingomonaspaucimobilis bacterimia in a hemato/oncology unit. J Infect Dis. , 394-396. Kirkland, K. B. (1999). The impact of surgerical site infectionsin the 1990's: attributable morality, excess length of hospitalization and extra costs. Infect Control Hosp Epidemiol , 725-730. Klein, E., Smith, D. L., & Laxminarayan, R. (2007). Hospitalizations and deaths caused by methicillin resistance staphylococcus aureus, United states . Emerg Infect Dis , 1840-6. Klemm, P., Vejborg, R. M., & Hancock, V. (2010). Prevention of bacterial adhesion. Appl. Microbiol. Biotechnol. , 451-459. Kline, K. A., Falker, S., Dahlberg, S., Normark, S., & Henriques-Normark, B. (2009). Bacterial adhesins in host-microbe interactions. Cell Host Microbe , 580-592.

196

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Kline, K. A., Schwartz, D. J., Lewis, W. G., Hultgren, S. J., & Lewis, A. L. (2011). Immune activation and suppression by group B Streptococcus in a murine model of urinary tract infection. Infect. Immun. , 3588-3595. Kohler-Ockmore, J., & Feneley, R. C. (1996). Longterm catheterization of the bladder: Prevalence and morbidity. Br. J Urol , 347-351. Koshariya, M., Songra, M., Namdeo, R., Chaudhary, A., Agarwal, S., & Rai, A. (2015). Prevalence of pathogens and their antimicrobial susceptibility in catheter associated urinary tract infections. JIAIM . Kostakioti, M., Hadjifrangiskou, M., & Hultgren, S. (2013). Bacterial biofilms: development, dispersal, and therapeutic strategies in the dawn of the postantibiotic era. Cold spring herb. Prespect. Med. Kovarikova, S., Husnik, R., Honzak, D., Kohout, P., & Fictum, P. (2012). Stenotrophomonas maltophilia urinary tract infectionin three dogs: a case report. Veterinarni Medicina , 383-387. Krishna-Prakash, S. (2014). Nosocomial infections an overview. 10. Kunin, C. M. (1997). Care of urinary catheter. In Urinary Tract Infections: Detection, Prevention and Management. Williams and Wilkins , 226-278. Kunin, C. M. (1987). Careof urinary catheter in urinary tract infections: In Detection, Prevention and Management of urinary Tract Infections. Philadelphia: Lea & Febiger , 245-298. Kwa, A. L., Low, J. G., Lim, T. P., Leow, P. C., Kurup, A., & Tam, V. H. (2008). Independent predictors for mortality in patientswith positive Stenotrophomona maltophilia clusters. Ann Acad Med Singap , 826-30. Laverty, G., Alkawareek, M., & Gilmore, B. (2014). The In vitro susceptibility of biofilm forming medical device related pathogensto conventional antibiotic. J Hindwai . Lee, J., Bansal, T., & Jayaraman, A. (2007). Enterohemorrhagic Escherichia coli biofilms are inhibited by 7-hydroxyindole and stimulated by isatin. Appl Environ Microbiol , 4100–4109. Leis, J. A. (2014). Reducing antimicrobial therapy for asymptomatic bacteriuria among non catheterized inpatients:a proof-of-concept study. Clin. Infect. Dis , 980-983. Levison, M. E., & Kaye, D. (2013). Treatment of complicated urinary tract infections with an emphasis on drug resistant gram negative uropathogens. Curr. Infect. Dis. Rep. , 109-115. Liao, C. H., Teng, L. J., Hsueh, P. R., Chen, Y. C., Huang, L. M., & Chang, S. C. (2004). Nutritionally variant Streptococcal infections at a university hospital in Taiwan disease emergency and high prevalence of beta lactam and Macrolide resistance. Clinical Infectious Diseases. , 452-455. Lichtenberger, P., & Hooton, T. M. (2008). Complicated urinary tract infections. Curr. Infect. Dis Rep. , 499-504. Liedl, B. (2001). Catheter-associated urinary tract infections. CurrOpin Urol , 75-79. Lolekha, S., Ratanaubol, B., & Manu, P. (1981). Nosocmial infectionin a teaching hospital in the Thailand. Phil J Microbiol Infect Dis , 103-14. MacDonald, A., Dinah, F., Mackenzie, D., & Wilson, A. (2004). Performance feedback of hand hygiene, useing alcohol gel as the skin decontaminan, reduced the number of inpatients newly affected by MRSA and antibiotic costs. J Hosp Infect. , 56-63. 197

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Macleod, S. M., & Stickler, D. J. (2007). Species interactions in mixed-community crystalline biofilms on urinary catheters. J Med Microbiol , 1549-1557. MacWilliams, M. P. (2009). Citrate Test Protocol. American society for Microbiology , 1-7. Maki, D. G., & Tambyah, P. A. (2001). Engineering out the risk of infection with urinary catheters. Emerg Infect Dis. , 342-347. Mandal, Z., Acharya, S., Buddhapriya, D., & Parija, S. (2012). Antibiotic resistance pattern among common bacterial uropathogens with special reference to ciprofloxacin resistant Escherichia coli. Indian Journal ofMedical Research , 842-849. Maryam, A., Mohammadreza, J., Ali, D., & Mahdieh, G. (2012). Frequency of nosocmial infections with antibiotic resistant Acintobacter spp. in intensive care unit (ICU) patients. J Microbiol Res, , 6769-6772. Matsukawa, M. (2005). Bacterial colonization on intraluminal surface of urethral catheter. Urology , 440-444. May, E., Hnilica, K., Frank, L., Jones, R., & Bernis, D. (2005). Isolation of Staphylococcus schleiferi fromhealthy dogs and dogs with otitis, pyoderma or both. J Am Vet Med Assoc , 928-31. Mayon-White, R. T. (1988). An international survey of the prevalence of hospital - acquired infection. J Hosp Infect , 43-49. McDevitt, S. (2009). Methyl Red and Voges-Proskauer Test Protocols. American society of Microbiology , 1-9. McLean, R. J. (1996). Biofilm mediated calculus formation in the urinary tract. Cells Mater , 165-174. Mengeloglu, F., Cakir, D., & Terzi, H. (2011). Comparison of reisitance in isolates of Enterococcus faecalis and Enterococcus faecium. . J. Microbiol and Inf Dis. , 10-13. Mittal, R., Aggarwal, S., Sharma, S., Chhibber, S., & Harjai, K. (2009). Urinary tract infections caused by Pseudomonas aeruginosa: A minireview. Journal of infection and Public Health , 101-111. Mohamed, J. A., & Huang, D. B. (2007). Biofilm formation by enterococci. Journal of Medical Microbiology , 1581–1588. Morris, D., Rook, K., Shofer, F., & Rankin, S. (2006). Screening of Staphylococcus aureus, Staphylococcus intermedius, and Stapylococcus scheiferi isolates obtained fromsmall companion animals for antimicrobial resistance. Vet Dermatol , 332-7. Morris, N. S. (1999). The development of bacterial biofilms on indwelling urethral catheters. World J Urol , 345-350. Moue, A., Syed, A., Aktaru, Z., Ferdous, N., Karim, R., Khalil, M., et al. (2015). Prevalence of urinary tract infection in both out patient department and in patient department at a medical college setting of Bangladesh. Int J of Biosci , 146-152. Murakami, K., Tsuneko, O., Darija, V., Somiya, Y., Kariyama, R., Hori, K., et al. (2017). The role of psl genes in antibiotic tolerance of adherent Pseudomonas aeruginosa. Antimicrob. Agents Chemother . Murray, P. R., Baron, E. J., Pfaller, M. A., Tenover, F. C., & Yolken, R. H. (1999). Manual Of Clinical Microbiology. 7th ed. American society for Microbiology .

198

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Murray, P. R., Rosenthal, K. S., & Pfaller, M. A. (2005). Medical Microbiology. 5th edition Missouri: MosbyInc .

Murtaza, M., Jaistin, T., & Muniandy, R. (2015). Faculty of Medicine and Health siences, University Malaysia Sabah, Kota Jinabalu, Sabah Malaysia. 20-26. Nam, Eui-Hwa, Sungjin, K., Chae, J.-S., & Hwang, C.-Y. (2013). Characterization and Zooonotic Potential of Uropathogenic Escherichia coli isolated from Dogs. J. Microbiol. Biotechnol. , 422-429. Nickel, J. C., & Costerton, J. W. (1992). Coagulase-negative Staphylococus in chronic prostatitis. J Urol , 398-400. Nickel, J. C., Downey, J. A., & Costerton, J. W. (1989). Ultrastructural study of microbiologic colonization of urinary catheters. 284-291. Nickel, J. C., Gristina, A. G., & Costerton, J. W. (1985). Electron microscopic study of an infected Foley catheter. Can J Surg , 50-51. Nielubowicz, G. R., & Mobley, H. L. (2010). Host pathogen interactions in urinary tract infection. Nature Rev. Urol. , 430-441. Nosocomial infections and their control strategies2015Asian Pacific Journal of Tropical Biomedicine 509-514 O’Toole, A. G., & Kolter, R. (1998). Initiation of biofilm formation in Pseudomonas fluorescens WCS365 proceeds via multiple, convergent signalling pathways: a genetic analysis. Mol Microbio , 449-461. O’Toole, G. A., & Kolter, R. (1998). Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development. Mol Microbiol , 295–304. Obiero, C. W., Seale, A. C., & Berkley, J. A. (2015). Empiric treatment of neonatal sepsis in developing countries. Pediatr Infect Dis J , 659-61. O'Brien, V. P., Hannan, T. J., Nielsen, H. V., & Hultgren, S. J. (2016). Drug and vaccine development for the treatment and preventionof urinary tract infections. Microbiol. Spectr. OOhkawa, M., Sugata, T., Sawaki, M., Nakashima, T., Fuse, H., & Hisazumi, H. (1990). Bacterial and crystal adherence to the surfaces of indwelling urethral catheters. J Urol , 717-721. Olafsson, M., Kristinsson, K. G., & Sigurdosson, J. A. (2000). Urinary tract infection antibiotic resistance and sales of antimicrobial drug--an observational study of uncomplicated urinary tract infections in Icelandic women. Scand J Prim Health Care , 35-8. Olson, M. E., Ceri, H., Morck, D., Buret, ,. A., & Read, R. R. (2002). Biofilm bacteria: formation and comparative susceptibility to antibiotics. The Canadian Journal of Veterinary Research , 86- 92. Orlando, F., Ghiselli, R., Cirioni, O., Minardi, D., Tomasinsig, L., Mocchegiani, F., et al. (2008). BMAP-28 improves the efficacy of vancomycin in rat models of gram-positive cocci ureteral stentinfection. Peptides , 1118-1123. Paez, J. I., & Costa, S. F. (2008). Risk factors associated withmortality of infections caused by Stenotrophomonas maltophilia: a systematic review. J Hosp Infect , 101-8. 199

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Palleroni, N., & Bradbury, J. (1993). Stenotrophomonas, a new bacterial genus for Xanthomonas maltophilia. Int J Syst Bacteriol , 43-3. Panicker, J. N., DasGupta, R., & Batla, A. (2016). Bradley's Neurology in Clinical Practice. Elsevier Saunders , 47. Parsek, M., & Singh, P. (2003). Bacterial biofilms: an emerging link to disease pathogenesis. Annu Rev Microbiol , 677–701. Peel, M. M., Davis, J. M., Amstrong, W. L., Wilson, J. R., & Holmes, B. (1979). Pseudomonas pauicimobilis from a leg ulcer on a Japanese seaman. J Clin. Microbiol. , 561-564. Perola, O., Nousiainen, T., & Soumalainen, S. (2002). Recurrent Sphingomonas paucimobilisbacteria associated multi-bacterial water-borne epidemic among neutropenic patients. J Hosp Infect , 196-201. Phu, V. D., Heiman, F. L., Wertheim, Larsson, M., Nadjm, B., Dinh, Q., et al. (2016). Burden of hospital acquired infections and antimicrobial use in vietnamese adult intensive careunits. PLoS ONE , 1-15. Pincus, D. (2007). Microbial identification by useing BIOMÉRIEUX VITEK 2 system. Encyclopedia of Rapid Microbiological Methods , 1-32. Pittet, D., Hugonnet, S., Harbarth, S., Mourouga, P., Sauvan, V., Touveneau, S., et al. (2010). Rising Threat of Infections Unfazed by Antibiotics. New York Time , 123-453. Prabhakar, P. (1983). Nosocomial surgical infections: incidence and cost in a developing country. Am J Infect Control , 51-56. Pradhan, N., Bhat, S., & Ghadage, D. (2014). Nosocomial Infections in the Medical ICU: A Retrospective Study Highlighting their Prevalence, Microbiological Profile and Impact on ICU sTAY and Mortality. J Ass of Phy of India , 18-21. Preventing Hospital-Acquired Infections: A National Survey of Practices Reported by U.S. Hospitals in 2005 and 20092011J Gen Intern Med 773-9 Preventing Hospital-Acquired Urinary Tract Infection in the United States: A National Survey2008Clinical Infectious Diseases 43-50 Qu. (2010). Antibiotic susceptibility of Staphylococci spp. isolated from very low birth weight babies comprehensive comparisions of bacteria at different stages of biofilm formation. J.Clin Microbiol , 16. Qu, Y., Daley, A., Istivan, T., Garland, S., & Deighton, M. (2010). Antibiotic susceptibility of coagulase negative Staphylococci from very low birth weight babies: comprehesive comparisons of bacteria at different stages of biofilm formation. J Clin Microbiol. , 16. Raad, I. I., Hohn, D. C., Gilbreath, B. J., Suleiman, N., Hill, L. A., Bruso, P. A., et al. (1994). Prevention of central venouscatheter related infections by using maximal sterile barrier precautions during insertion. Infect. Control Hosp.Epidemiol. , 231-238. Raka, L., Zoutman, D., Mulliqi, G., Krasniqi, S., Dedushaj, I., & Raka, N. (2006). Prevalence of nosocomial infections in high risk units in the university clinical center of Kosoya. Infect Control Hosp Epidemiol , 241-3.

200

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Register, K. B., Register, K. B., Sacco, R. E., & Nordholm, G. E. (2003). Comparison of ribotyping and restriction enzyme analysis for inter and intra species discrimination of Bordetella avium and Bordetella hinzii. J Clin Microbiol , 1512-9. Reid, G., Denstedt, J. D., Yang, Y. S., Lam, D., & Nause, C. (1992). Microbial adhesion and biofilm formation on urethral stents in-vitro and in-vivo. J Urol , 1592-1594. Reiner, K. (2010). Catalase Test Protocol. American society for Microbiology , 1-9. Richardd, C., & Kiredjian, M. (1992). Laboratory methods for the Identification of the Medically Important Glucose Nonfermenting Gram-Negative Bacilli. Rodríguez-Baño, S, M., F, F.-C., JM, C., J, P., A, P., et al. (2008). Biofilm formation in Acinetobacter baumannii: associated features and clinical implications. Clin Microbiol Infect. , 1469-0691. Rosenthal, M. B. (2007). Nonpayment for performance? Medicare’s new reimbursement rule. N Engl J Med , 1573–1575. Rouff, K. L. (1991). Nurtitionally variant streptococci. Clin Microbiol , 184-190. Ryan, M. P., & Adley, C. C. (2010). Sphingomonas paucimobilis a persistant Gram negative nosocomial infectious organism. J. Hospital infection , 153-157. Safdar, N., & Maki, D. G. (2004). The pathogenesis of catheter-related bloodstream infection with. Intensive Care Med , 62-67. Saify, H., Patidar, R., Sahare, K., & Singh, V. (2013). Difference in biofilm development capability of vancomycin and ciprofloxacin reisitant Staphylococcus aureus clinical isolates. J Inf Dis . Saint, S., & Chenoweth, C. E. (2003). Biofilms and catheter-associated urinary tract infections. Infect Dis Clin North Am , 411-432. Salazar, R., Martino, R., Sureda, A., Brunet, S., Subir'a, M., & Domingo-Albo's, A. (1995). Catheter related bactermia due to Pseudomonas paucimobilis in confirmed central venous related bacterimia in neutropenic cancer patients: report of two cases. Clin Infect Dis. , 1573-4. Salih, M. K., Alrabadi, N. I., Thalij, K. M., & Hussien, A. S. (2016). Isolationof pahogenic gram negative bacteria from urinary tract infected patients, this study investigated the susceptibility pattern of differnt bacteria isolated from urinary tract infection to different antibiotics. Open J of Med Microbiol , 59-65. Samie, A., & Shivambu, N. (2011). Biofilm production and antibiotic susceptibility profiles of Staphylococcus aureus isolated from HIV and AIDS patients in the Limpopo Province,South Africa. . J Biotech , 14625-14636. Sandhu, R., Dahiya, S., & Sayal, P. (2016). Evaluation of multiple antibioticresistance (MAR) index and deoxycycline susceptibility of Acinetobacter species among inpatients. Indian J Microbiol Res , 299-304. Sandoe, J. A., Waaome, West, A. P., & Heritage, J. (2006). Measurement of ampicillin vancomycinlinezolide and gentamycin activity against enterococci biofilms. J. Antimicrobial chemotherapy , 767-770. Sasaki, T., Kikuchi, K., Tanaka, Y., Takahashi, N., Kamata, S., & Hiramatsu, K. (2007). Reclassification ofphenotypically identified staphylococcus intermedius strains. J Clin Microbiol. , 2770-8. 201

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Schaeffer, A. J., Rajan, N., Cao, Q., Anderson, B. E., & Pruden, D. L. (2001). Host pathogenesis in urinary tract infections. Int J Antimicrob Agents , 245-51. Senn, L., Entenza, J., & Greub, G. (2006). Bloodstream and endovascular infections due to Abiotrophia defective and Granulicatella species. BMC Infect Dis , 6-9. Sepandj, F., Ceri, H., Gibb, Read, & Olson, M. (2003). Minimum inhibitory concentration versus minimum biofilm elminatingconcentration in evaluation of antibiotic sensitivity of Gramnegative bacilli causing peritonitis. Peritoneal Dialysis Interantional , 65-67. Shah, P., Ostwal, K., Jadhav, A., & Shaikh, N. (2015). Post hysterectomy wound infection by Dermacoccus nishinomiyaensis - A first case report in India. J. Biom and Pharm Sci. , 329- 335. Shalini, S., Kranthi, K., & Gopalkrishna, K. (2010). The Microbiological Profile of Nosocomial Infection in the Intensive Care Unit. . J Clin and Diag Res , 3109-3112. Sharma, D., Tiwari, Y., Vyas, N., & Maheshwari, R. (2013). An investigation of the incidence of Noscocmial infections among the patients admitted inthe intensive care unit of a tertiary care hospital in Rajastha, India . J Curr Microbiol App Sci , 428-435. Sharma, M., Yadav, S., & Chaudhary, U. (2009). Biofilm production in uropathogenic E. coli . Indian J of Pathology and Microbiol , 32. Shivappa, S., Kulkarni, M., Manjula, S., & Oral, B. (2014). Granulicatella elegans bacterimia and meningitis in a child withoutneurological intervemtions. J of Dental and Medical Sciences. , 13-14. Shivaraj, S., Murugesan, P., Muthuvelu, S., Purusithaman, S., & Silambarasan, A. (2011). Comparative study of Pseudomonas aerudinosa Isolate reovered from clinical and enviromental samples againstantibiotics. J Pharm , 103-107. Silverstein, A., & Donatucci, C. F. (2003). Bacterial biofilms and implantable prosthetic devices. Int J Impot Res , 150-154. Slotnick, I. J., Hall, J., & Sacks, H. (1979). Septicemia caused by Pseudomonas paucimobilis. Am. J. Clin. Pathol , 882-884. Smith, S. K., Sutton, D. C., Fuerst, J. A., & Reichelt, J. L. (1991). Evaluation of the Genus Listonella and the reassignment of Listonella damselaMacDonell and Colwell to the Genus Photobacterium as Photobacterium damsela comb.nov.with an Emended Description. Int. J. Syst. Bacteriol. , 529-534. Southern, P. M., & Kutscher, A. E. (1981). Pseduomonas paucimobilis bacterimia. J. Clin. Microbiol , 1070-1073. Spaulding, C. N., & Hultgren, S. J. (2016). Adhesive pili in UTI pathogenesis and drug deveopment. Pathogens 5 , 18. Spicuzza, L., Sciuto, C., Vitaliti, G., DiDio, G., Leonardi, S., & La Rosa, M. (2009). Emerging pathogens in cystic fibrosis: ten years of follow-upin a cohort of patients. European Journal of Clinical Microbiology and Infectious Disease , 191-195. Stamm, W. E. (1991). Catheter-associatedurinary tractinfections: epidemiology, pathogenesis and prevention. Am J Med , 65-71. 202

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Stickler, D. (2008). Bacterial biofilms in patients with indwelling urinary catheters. Nature clinical practice urology , 598-608. Stickler, D. J. (2008). Bacterial biofilm in patients with indwelling urinary catheters. . 441-450. Stickler, D. J. (2008). Bacterial biofilms in patients with indwelling urinary catheter. Nature Clinical Practice Urology , 598-608. Stickler, D. J. (2008). Bacterial biofilms in patients with indwelling urinary catheters. Nat Clin Pract Urol , 598–608. Stickler, D. J., & Zimakoff, J. (1994). Complications of urinary tractinfections associated with devices used for long-term bladder management. . J Hosp Infect. , 177-194. Stickler, D. (1993). Proteus mirabilis biofilms and the encrustration of urethral catheters. Urol Res. , 407-411. Sue Katz, D. (2009). Coagulase Test Protocol. American society of Microbiology , 1-12. T, S. S., K, S. A., & Unni, G. (2013). Infective endocarditis caused by Granulicatella adiacens. Indian heart journal , 447-449. Tailly, T., & Denstedt, J. D. (2016). Fundamentalsof urinary tact drainage. . Campbell-Walsh Urology , 6. Taiwa, S. S., & Aderounmu, A. (2006). Catheter associated urinary tract infection aetiologic agents and antimicrobial susceptibility pattern in Ladoke Akintola university teaching hospital, Osogbo, Nigeria. 141-148. Taiwo, S., & Aderounmu, A. (2006). Catheter associated urinary tract infection: Aetiologic agents and antimicrobial susceptibility pattern in Ladoke Akintola university teaching hospital, Osogbo, Nigeria. J Bio Res. , 141-148. Tambyah, P. A. (1999). A Prospective study of pathogenesis of catheter-associated urinary tract infections. Mayo ClinProc , 131-136. Tenke, P. (2008). European andAsian guidelines on management and prevention of catheter- associatedurinary tract infections. Int J Antimicrob Agents , 68-78. Tenke, P., Kovacs, B., Jackel, M., & Nagy, E. (2006). The role of biofilm infection in urology. World J Urol , 13-20. Terlizzi, M. E., Gribaudo, G., & Maffei, M. (2017). UroPathogenic Escherichia coli (UPEC) Infections: Virulence Factors,Bladder Responses, Antibiotic, and Non-antibiotic Antimicrobial Strategies. Forniture in Microbiology , 1566. Terlizzi, M., Gribaudo, G., & Maffei, M. (2017). Uropathogenic Escherichia coli (UPEC) Infections: Virulence Factors, Bladder Responses, Antibiotic andNon-antibiotic antimicrobial strategies. Fronties in Microbiology , 1-23. TTrautner, B. W., & Darouiche, R. O. (2004). Role of biofilm in catheter-associated urinary tract infection. Am J Infect Control , 177-183. Trautner, B., & Darouiche, R. (2004). Catheter-associated infections: pathogenesis affects prevention. Arch Intern Med , 842–850.

203

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Trevino, S., Ferman, J., Otero, R., & Gonzalez, E. (2014). Stenotrophomonas maltophilia in Mexico: antimicrobial resistance, biofilm formation and clonal diversity. J Med Microbiol. , 1524- 1530. Tu Quoc, P. H., Genevaux, P., & Pajunen, M. (2007). Isolation and characterization of biofilm formation-defective mutants of Staphylococcus aureus. Infect Immun , 1079–1088. Tully, J. L., Friedland, G. H., Baldini, L. M., & Goldmann, D. A. (1981). Complications of intravenous therapy with steel needless and Tefl on catheter: a comparative study. Am J Med , 702-706. Ulrika, W. (2015). Bacterial infections in dogs with special reference to urinary tract infections, surgical site infections and methicillin resistant Staphylococcus pseudintermedius. 6657-679. Valle, J., Toledo-Arana, A., & Berasain, C. (2003). SarA and not sigmaB is essential for biofilmdevelopment by Staphylococcus aureus. Mol Microbiol , 1075-1087. Vandamme, P., Goris, J., Coenye, T., Hoste, B., Janssens, D., Kersters, K., et al. (1999). Assignment of Centers for Disease Control group IVc-2 to the genus Ralstonia as Ralstonia paucula sp.nov. Int. J. Syst. Bacteriol. , 663-669. Vandamme, P., Hommez, J., Vancanneyt, M., Hoste, B., & Cookson, B. (1995). Bordetella hinzii sp. isolated from poultry and humans. Int. J Syst Bacteriol , 37-45. Wagenlehner, F., & Naber, K. G. (2006). The treatment of bacterial urinary tract infections: presence and future. Eur Urol , 235-244. Walters, Roe, Bugnicourt, Franklin, & Stewart. (2003). Contributions of antibiotic penetration, oxygen limitation, and low metabolic activity to tolerance of Pseudomonas aeruginosa biofilms to ciprofloxacin and tobramycin. Antimicrob Agents Chemother , 317-23. Waren, J. W. (1991). The catheter and urinary tract infection. Med Clin North Am , 481-493. Warren, J. W. (1982). Cephalexin forsusceptible bacteriuria in afebrile, long-term catheterized patients. JAMA , 454-458. Warren, J., Tenney, J., Hoopes, J., Muncie, H., & Anthony, W. (1982). A Propective Microbiologic Study of Bacteriuria in Patients with Chronic Indwelling Urethral Catheters. J Inf Dis , 719- 723. Warren, J., Tenney, J., Hoopes, J., Muncie, H., & Anthony, W. (1982). Aprospective Microbiologic study of bacteriuria in patients with chronic indwelling urethral catheters. J Inf Dis. , 719-723. Werneburg, G. T., Henderson, N. S., Portnoy, E., Sarowar, S., Hultgren, S. J., & Li, H. L. (2015). The pilus usher controls protein interactions via domain masking and is functional as an oligomer. Nat. Struct. Mol. Biol. , 540-546. Wilson, M. (2009). Biofilm and other causes of pain in catheterization. Br J Community Nurs , 102- 113. Winther, L., Anderson, R. M., Baptiste, K. E., Aalbak, B., & Guardabassi, L. (2010). Association of Stenotrophomonasmaltophilia infection with lowe airway disease in the horse. A retrospective case series. Veterinary Journal , 358-363. World Health Organization Prevention of hospital-acquired infections: a practical guide. (2015). Geneva: World health organization 2002 .

204

UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No. 43- Catheters 472/2014(SR)

Zhanel, G. G., Hoban, D. J., & Karlowsky, J. A. (2001). Nitrofurantoin is active against vancomycin- resistant enterococci. Antimicrob, Agents Chemother , 324-326. Zhang, G., Meredith, T. C., & Kahne, D. (2013). On the essentiality of lipopolysaccharideto Gram- negative bacteria. . Curr. Opin. Microbiol. , 779-785.

Principle Investigator Co-investigator Dr. Niraj Ghanwate Dr. P V Thakare Asst. Professor Associate Professor Dept of Microbiology Dept of Biotechnology S G B Amravati University S G B Amravati University Amravati. Amravati

205