DOCSLIB.ORG

PDF For- Tries Reported Holding the Material in Only 1 Institute

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
PDF For- Tries Reported Holding the Material in Only 1 Institute Peer-Reviewed Journal Tracking and Analyzing Disease Trends pages 2117–2292 EDITOR-IN-CHIEF D. Peter Drotman Associate Editors EDITORIAL BOARD Paul Arguin, Atlanta, Georgia, USA Dennis Alexander, Addlestone, Surrey, UK Charles Ben Beard, Ft. Collins, Colorado, USA Timothy Barrett, Atlanta, Georgia, USA Ermias Belay, Atlanta, Georgia, USA Barry J. Beaty, Ft. Collins, Colorado, USA David Bell, Atlanta, Georgia, USA Martin J. Blaser, New York, New York, USA Sharon Bloom, Atlanta, GA, USA Christopher Braden, Atlanta, Georgia, USA Mary Brandt, Atlanta, Georgia, USA Arturo Casadevall, New York, New York, USA Corrie Brown, Athens, Georgia, USA Kenneth C. Castro, Atlanta, Georgia, USA Michel Drancourt, Marseille, France Louisa Chapman, Atlanta, Georgia, USA Paul V. Effler, Perth, Australia Thomas Cleary, Houston, Texas, USA David Freedman, Birmingham, Alabama, USA Vincent Deubel, Shanghai, China Peter Gerner-Smidt, Atlanta, Georgia, USA Ed Eitzen, Washington, DC, USA Stephen Hadler, Atlanta, Georgia, USA Daniel Feikin, Baltimore, Maryland, USA Nina Marano, Nairobi, Kenya Anthony Fiore, Atlanta, Georgia, USA Martin I. Meltzer, Atlanta, Georgia, USA Isaac Chun-Hai Fung, Statesboro, Georgia, USA David Morens, Bethesda, Maryland, USA Kathleen Gensheimer, College Park, MD, USA J. Glenn Morris, Gainesville, Florida, USA Duane J. Gubler, Singapore Richard L. Guerrant, Charlottesville, Virginia, USA Patrice Nordmann, Fribourg, Switzerland Scott Halstead, Arlington, Virginia, USA Didier Raoult, Marseille, France Katrina Hedberg, Portland, Oregon, USA Pierre Rollin, Atlanta, Georgia, USA David L. Heymann, London, UK Frank Sorvillo, Los Angeles, California, USA Charles King, Cleveland, Ohio, USA David Walker, Galveston, Texas, USA Keith Klugman, Seattle, Washington, USA Senior Associate Editor, Emeritus Takeshi Kurata, Tokyo, Japan Brian W.J. Mahy, Bury St. Edmunds, Suffolk, UK S.K. Lam, Kuala Lumpur, Malaysia Stuart Levy, Boston, Massachusetts, USA Managing Editor John S. MacKenzie, Perth, Australia Byron Breedlove, Atlanta, Georgia, USA Marian McDonald, Atlanta, Georgia, USA John E. McGowan, Jr., Atlanta, Georgia, USA Copy Editors Claudia Chesley, Laurie Dieterich, Karen Foster, Jennifer H. McQuiston, Atlanta, Georgia, USA Thomas Gryczan, Jean Michaels Jones, Shannon O’Connor, Tom Marrie, Halifax, Nova Scotia, Canada Rhonda Ray, Carol Snarey, P. Lynne Stockton Nkuchia M. M’ikanatha, Harrisburg, Pennsylvania, USA Philip P. Mortimer, London, UK Production William Hale, Aaron Moore, Barbara Segal, Fred A. Murphy, Galveston, Texas, USA Reginald Tucker Barbara E. Murray, Houston, Texas, USA P. Keith Murray, Geelong, Australia Editorial Assistant Jared Friedberg Stephen M. Ostroff, Silver Spring, MD, USA Ann Powers, Fort Collins, Colorado, USA Communications/Social Media Sarah Logan Gregory Gabriel Rabinovich, Buenos Aires, Argentina Founding Editor Mario Raviglione, Geneva, Switzerland Joseph E. McDade, Rome, Georgia, USA David Relman, Palo Alto, California, USA Connie Schmaljohn, Frederick, Maryland, USA Emerging Infectious Diseases is published monthly by the Centers for Disease Control and Tom Schwan, Hamilton, Montana, USA Prevention, 1600 Clifton Road, Mailstop D61, Atlanta, GA 30329-4027, USA. Telephone Ira Schwartz, Valhalla, New York, USA 404-639-1960, fax 404-639-1954, email [email protected]. Tom Shinnick, Atlanta, Georgia, USA The conclusions, findings, and opinions expressed by authors contributing Bonnie Smoak, Bethesda, Maryland, USA to this journal do not necessarily reflect the official position of the U.S. Depart- Rosemary Soave, New York, New York, USA ment of Health and Human Services, the Public Health Service, the Centers for P. Frederick Sparling, Chapel Hill, North Carolina, USA Disease Control and Prevention, or the authors’ affiliated institutions. Use of Robert Swanepoel, Pretoria, South Africa trade names is for identification only and does not imply endorsement by any of the groups named above. Phillip Tarr, St. Louis, Missouri, USA All material published in Emerging Infectious Diseases is in the public Timothy Tucker, Cape Town, South Africa domain and may be used and reprinted without special permission; proper Elaine Tuomanen, Memphis, Tennessee, USA citation, however, is required. John Ward, Atlanta, Georgia, USA Use of trade names is for identification only and does not imply J. Todd Weber, Atlanta, Georgia, USA endorsement by the Public Health Service or by the U.S. Department of Health and Human Services. Mary E. Wilson, Cambridge, Massachusetts, USA EMERGING INFECTIOUS DISEASES™ is a trademark of the US ∞ Emerging Infectious Diseases is printed on acid-free paper that meets the Department of Health and Human Services. requirements of ANSI/NISO 239.48-1992 (Permanence of Paper) Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 21, No. 12, December 2015 December 2015 On the Cover High Prevalence of Intermediate Leptospira spp. DNA in Febrile Walter Crane (1845–1915), Humans from Urban and Beauty and the Beast, 1875. Rural Ecuador ............................ 2141 Book illustration, wood engraving, printed in color, 10 9/16 x 9 3/16 x 1/8 in / J. Chiriboga et al. 26.8 x 23.3 x 0.3 cm. Metropolitan Museum Intermediate cluster may cause disease in of Art, Open Access Collection, areas where dengue and malaria are present, The Elisha Whittelsey Collection, 1972. so differential diagnosis is necessary. About the Cover p. 2282 Historical Review Biological Warfare Plan in the 17th Century—the Siege of Candia, 1648–1669 ............... 2148 E. Thalassinou et al. Synopses This incident illustrates the acceptability of using biological weapons within a religious Identifying and Reducing world view. Remaining Stocks of Rinderpest Virus ........................ 2117 K. Hamilton et al. Dispatches Virus-containing material remains stored in an 2154 Influenza A(H6N1) Virus unacceptably high number of scientific in Dogs, Taiwan facilities worldwide. H.-T. Lin et al. Opportunistic Pulmonary 2158 Methicillin-Resistant Bordetella hinzii Infection p. 2130 Staphylococcus aureus after Avian Exposure ................. 2122 Prevalence among Captive A. Fabre et al. Chimpanzees, Texas, USA, 2012 Diagnosing infections involving this species by P. Hanley et al. routine methods is difficult. 2161 Novel Waddlia Intracellular Research Bacterium in Artibeus intermedius Fruit Bats, Mexico Zoonotic Leprosy in the S.A. Pierlé et al. Southeastern United States ....... 2127 p. 2134 2164 Tembusu-Related Flavivirus in R. Sharma et al. Ducks, Thailand The geographic range and complexity of this A. Thontiravong et al. disease are increasing. 2168 Japanese Macaques (Macaca Infection Risk for Persons fuscata) as Natural Reservoir Exposed to Highly Pathogenic of Bartonella quintana Avian Influenza A H5 Virus–Infected S. Sato et al. Birds, United States, December 2014–March 2015 ..... 2135 2171 Increased Number of Human C.S. Arriola et al. Cases of Influenza Virus No infections have been reported among >100 A(H5N1) Infection, exposed persons, suggesting a low risk for Egypt, 2014–15 animal-to-human transmission. S. Refaey et al. Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 21, No. 12, December 2015 2174 Replication Capacity of Avian Influenza A(H9N2) Virus in Pet Birds and Mammals, Bangladesh December 2015 B.J. Lenny et al. 2217 Association of Human Q Fever with Animal Husbandry, 2178 Pyrethroid and DDT Resistance Taiwan, 2004–2012 and Organophosphate Susceptibility among C.-H. Lai et al. Anopheles spp. Mosquitoes, 2221 Factors Associated with Severe Western Kenya Leptospirosis, Martinique, C.L. Wanjala et al. 2010–2013 2182 Hendra Virus Infection in Dog, P. Hochedez et al. Australia, 2013 2225 Sindbis and Middelburg Old P.D. Kirkland et al. World Alphaviruses Associated with Neurologic Disease 2186 Kinetics of Serologic Responses in Horses, South Africa to MERS Coronavirus Infection in Humans, South Korea S. van Niekerk et al. W.B. Park et al. p. 2162 2230 Spillover of Peste des Petits Ruminants Virus from 2190 No Evidence of Gouléako and Domestic to Wild Ruminants Herbert Virus Infections in in the Serengeti Ecosystem, Pigs, Côte d’Ivoire and Ghana Tanzania S. Junglen et al. M. Mahapatra et al. 2194 Oropharyngeal Tularemia 2235 Porcine Epidemic Diarrhea Outbreak Associated with Virus among Farmed Pigs, Drinking Contaminated Ukraine Tap Water, Turkey, July─September 2013 A. Dastjerdi et al. D. Aktas et al. Letters 2197 Asymptomatic MERS-CoV Infection in Humans Possibly 2238 Isolation of Porcine Epidemic Linked to Infected Dromedaries p. 2165 Diarrhea Virus during Imported from Oman to United Outbreaks in South Korea, Arab Emirates, May 2015 2013–2014 Z.M. Al Hammadi et al. 2240 Tickborne Lympadenopathy 2201 Aquatic Bird Bornavirus 1 in Complicated by Acute Wild Geese, Denmark Myopericarditis, Spain A.F. Thomsen et al. 2242 Parainfluenza Virus 5 as Possible Cause of Severe Respiratory Disease in Calves, China 2204 Life-Threatening 2244 Alternative Routes of Zoonotic Sochi Virus Vaccinia Virus Transmission, Infections, Russia Brazil D.H. Kruger et al. 2246 Hunter Island Group 2209 Vectorborne Transmission of Phlebovirus in Ticks, Australia Leishmania infantum from Hounds, United States 2248 Toxoplasma gondii R.G. Schaut et al. in Wild Red Squirrels, the Netherlands, 2014 2213 Water as Source of Francisella tularensis Infection in 2249 CTX-M-15–Producing Humans, Turkey Escherichia coli in Dolphin, S. Kilic et al. Portugal Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 21, No. 12, December 2015 2271 Surveillance for Ebola Virus in Wildlife,
Load more

Recommended publications
  • Table S1. Primers Used for PCR Amplification
    Table S1. Primers used for PCR amplification Name Primer Sequence (5’-3’) Gene target Taxon target Reference First PCR round DGGE analysis FGPH19 TACGGCAARGGTGGNATHG nifH Diazotrophic (Simonet et al. 1991) POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) 799F AACMGGATTAGATACCCKG 16S rRNA Bacteria (Chelius and Triplett 2001) 1492R TACGGYTACCTTGTTACGACTT 16S rRNA Bacteria (Chelius and Triplett 2001) F203α CCGCATACGCCCTACGGGGGAAAGATTTAT 16S rRNA Alphaproteobacteria (Gomes et al. 2001) F948β CGCACAAGCGGTGGATGA 16S rRNA Betaproteobacteria (Gomes et al. 2001) F243HCG GGATGAGCCCGCGGCCTA 16S rRNA Actinobacteria (Heuer et al. 1997) BACF GGGAAACCGGGGCTAATACCGGAT 16S rRNA Firmicutes (Garbeva et al. 2003) Second PCR round DGGE analysis POLF-GC CGCCCGCCGCGCCCCGCGCCCGGCCCGCCCCCG nifH Diazotrophic (Poly et al. 2001) CCCCTGCGAYCCSAARGCBGACTC AQER GACGATGTAGATITCCTG nifH Diazotrophic (Poly et al. 2001) F968-GC CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGC 16S rRNA Bacteria (Heuer et al. 1999) ACGGGGGGAACGAAGAACCTTAC R1401 CGGTGTGTACAAGACCC 16S rRNA Bacteria (Heuer et al. 1997) qPCR analysis POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) POLF TGCGAYCCSAARGCBGACTC nifH Diazotrophic (Poly et al. 2001) 6S-27F AGAGTTTGATCCTGGCTCAG 16S rRNA Bacteria Bulgari et al., 2014 338R GCTGCCTCCCGTAGGAGT 16S rRNA Bacteria Bulgari et al., 2014 Table 2. Primers used for Ion Torrent pyrosequencing analysis. Primer Primer sequence (5´-3´) Reference 967F-PP CNACGCGAAGAACCTTANC (Jünemann et al. 2012) 967F-UC1 CAACGCGAAAAACCTTACC (Jünemann et al. 2012) 967F-UC2 CAACGCGCAGAACCTTACC (Jünemann et al. 2012) 967F-UC3 ATACGCGARGAACCTTACC (Jünemann et al. 2012) 967F-AQ CTAACCGANGAACCTYACC (Jünemann et al. 2012) 1046R CGACAGCCATGCANCACCT (Jünemann et al. 2012) 1046R-PP CGACAACCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ1 CGACGGCCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ2 CGACGACCATGCANCACCT (Jünemann et al. 2012) Table S3. Alpha diversity indices. Statistical analysis of the total endophytic and diazotrophic endophytic bacterial community associated with sweet sorghum cv.
    [Show full text]
  • Cystic Fibrosis Mice Develop Spontaneouschronic Bordetella
    ISSN 2470-3176 SciO p Forschene n HUB for Sc i e n t i f i c R e s e a r c h Journal of Infectious Pulmonary Diseases Research Article Volume: 3.2 Open Access Received date: 11 Oct 2017; Accepted date: 28 Cystic Fibrosis Mice Develop Spontaneous Oct 2017; Published date: 02 Nov 2017. Chronic Bordetella Airway Infections Citation: Darrah R, Bonfield T, LiPuma JJ, Litman P, Hodges CA, et al. (2017) Cystic Fibrosis Mice Darrah R1*, Bonfield T2, LiPuma JJ3, Litman P1, Hodges CA4, Jacono F5 and Develop Spontaneous Chronic Bordetella Airway Drumm M6 Infections. J Infect Pulm Dis 3(2): doi http://dx.doi. org/10.16966/2470-3176.128 1Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA 2Department of Pediatrics, Case Western Reserve University, Cleveland Ohio, USA Copyright: © 2017 Darrah R, et al. This is an 3Department of Pediatrics and Communicable Diseases, University of Michigan Medical School, Ann open-access article distributed under the terms Arbor, Michigan, USA of the Creative Commons Attribution License, 4Departments of Radiology, Biomedical Engineering, and Pediatrics, Case Western Reserve University, which permits unrestricted use, distribution, and Cleveland Ohio, USA reproduction in any medium, provided the original 5Department of Medicine, Case Western Reserve University, and Louis Stokes VA Cleveland Medical author and source are credited. Center, USA 6Departments of Pediatrics and Genetics Genome Sciences, Case Western Reserve University, Cleveland Ohio, USA *Corresponding author: Rebecca Darrah, Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA, Tel: 216-368-4911; E-mail: [email protected] Abstract Chronic pulmonary disease and infection is the primary cause of morbidity and mortality in people with cystic fibrosis (CF).
    [Show full text]
  • Bordetella Petrii Clinical Isolate Isolates of This Species Have Been Previously Reported from 4
    routine laboratory protocols. Initial susceptibility testing Bordetella petrii using disk diffusion indicated apparent susceptibility of the isolate to erythromycin, gentamicin, ceftriaxone, and Clinical Isolate piperacillin/tazobactam. The isolate was resistant to amox- icillin, co-amoxiclav, tetracycline, clindamycin, ciproflo- Norman K. Fry,* John Duncan,* Henry Malnick,* xacin, and metronidazole. After initial sensitivity results, a Marina Warner,* Andrew J. Smith,† 6-week course of oral clarithromycin (500 mg, 8 hourly) Margaret S. Jackson,† and Ashraf Ayoub† was begun. We describe the first clinical isolate of Bordetella petrii At follow-up appointments 3 months and 6 months from a patient with mandibular osteomyelitis. The only pre- after antimicrobial drug therapy ceased, clinical and radi- viously documented isolation of B. petrii occurred after the ographic findings were not unusual, and the infected area initial culture of a single strain from an environmental healed successfully. Despite the successful clinical out- source. come, the isolate was subsequently shown to be resistant to clarithromycin in vitro (Table). Improvement of the 67-year-old man visited an emergency dental clinic, osteomyelitis may also have been facilitated by the biopsy Awhere he complained of toothache in the lower right procedure, during which a sequestrum of bone was mandibular quadrant. Examination showed a root-filled removed. lower right canine tooth that was mobile and tender to per- The gram-negative bacillus (designated strain cussion. The tooth was extracted uneventfully under local GDH030510) was submitted to the Health Protection anesthesia. The patient returned after several days with Agency, Centre for Infections, London, for identification. pain at the extraction site. A localized alveolar osteitis was Preliminary tests results were consistent with those diagnosed, and local debridement measures were institut- described for members of the genus Bordetella.
    [Show full text]
  • Vitek®2 Id & Ast Cards
    ® VITEK 2 ID & AST CARDS Reliable • safe • rapid RESULTS YOU CAN TRUST FOCUS The VITEK 2 ADVANCED EXPERT SYSTEM™ software lets you focus your time where it is most required in ® the lab. The ADVANCED EXPERT SYSTEM™ validates VITEK 2 ID & AST CARDS ON WHAT every result and quickly identi es those truly needing a Microbiologist’s valuable time and attention. This allows the majority of results to be quickly and con dently reported to clinicians without need for MATTERS 2,8,11,13,15 review Rapid, Flexible, E cient EFFICIENCY THROUGH AUTOMATION VITEK 2 cards o er the shortest preparation time in the industry, considerably reducing labor Each self-contained, costs1,3,7,9,10,14. They also have the least contaminated waste, o ering up to 64% cost savings for disposal disposable test card compared to other systems6,10,12.The cards provide provides rapid and INNOVATIVE AND FLEXIBLE DESIGN increased standardization and automated, same-day accurate species- results helping clinicians to optimise antibiotic level identi cation or • Each card contains microwells with biochemicals or antimicrobials therapy sooner2,3. susceptibility results with • Ready and simple to use accurate MICs* based on • Pre-applied barcodes for maximum traceability • EUCAST and CLSI compliant AST formulations available Designed for VITEK 2 automated systems, VITEK 2 reference CLSI** and identi cation (ID) and susceptibility (AST) cards provide ISO *** MIC methods UP TO 50% FEWER PREPARATION STEPS THAN and EUCAST****, OTHER SYSTEMS,3,9,10: reliable and accurate results for clinically important US FDA*****, bacteria and yeasts1,2,4,5 or CLSI® breakpoint • Inoculation with a simple, standardised suspension of organism in saline interpretations1,3,4,5,7,8,10.
    [Show full text]
  • Which Organisms Are Used for Anti-Biofouling Studies
    Table S1. Semi-systematic review raw data answering: Which organisms are used for anti-biofouling studies? Antifoulant Method Organism(s) Model Bacteria Type of Biofilm Source (Y if mentioned) Detection Method composite membranes E. coli ATCC25922 Y LIVE/DEAD baclight [1] stain S. aureus ATCC255923 composite membranes E. coli ATCC25922 Y colony counting [2] S. aureus RSKK 1009 graphene oxide Saccharomycetes colony counting [3] methyl p-hydroxybenzoate L. monocytogenes [4] potassium sorbate P. putida Y. enterocolitica A. hydrophila composite membranes E. coli Y FESEM [5] (unspecified/unique sample type) S. aureus (unspecified/unique sample type) K. pneumonia ATCC13883 P. aeruginosa BAA-1744 composite membranes E. coli Y SEM [6] (unspecified/unique sample type) S. aureus (unspecified/unique sample type) graphene oxide E. coli ATCC25922 Y colony counting [7] S. aureus ATCC9144 P. aeruginosa ATCCPAO1 composite membranes E. coli Y measuring flux [8] (unspecified/unique sample type) graphene oxide E. coli Y colony counting [9] (unspecified/unique SEM sample type) LIVE/DEAD baclight S. aureus stain (unspecified/unique sample type) modified membrane P. aeruginosa P60 Y DAPI [10] Bacillus sp. G-84 LIVE/DEAD baclight stain bacteriophages E. coli (K12) Y measuring flux [11] ATCC11303-B4 quorum quenching P. aeruginosa KCTC LIVE/DEAD baclight [12] 2513 stain modified membrane E. coli colony counting [13] (unspecified/unique colony counting sample type) measuring flux S. aureus (unspecified/unique sample type) modified membrane E. coli BW26437 Y measuring flux [14] graphene oxide Klebsiella colony counting [15] (unspecified/unique sample type) P. aeruginosa (unspecified/unique sample type) graphene oxide P. aeruginosa measuring flux [16] (unspecified/unique sample type) composite membranes E.
    [Show full text]
  • Table S5. the Information of the Bacteria Annotated in the Soil Community at Species Level
    Table S5. The information of the bacteria annotated in the soil community at species level No. Phylum Class Order Family Genus Species The number of contigs Abundance(%) 1 Firmicutes Bacilli Bacillales Bacillaceae Bacillus Bacillus cereus 1749 5.145782459 2 Bacteroidetes Cytophagia Cytophagales Hymenobacteraceae Hymenobacter Hymenobacter sedentarius 1538 4.52499338 3 Gemmatimonadetes Gemmatimonadetes Gemmatimonadales Gemmatimonadaceae Gemmatirosa Gemmatirosa kalamazoonesis 1020 3.000970902 4 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas indica 797 2.344876284 5 Firmicutes Bacilli Lactobacillales Streptococcaceae Lactococcus Lactococcus piscium 542 1.594633558 6 Actinobacteria Thermoleophilia Solirubrobacterales Conexibacteraceae Conexibacter Conexibacter woesei 471 1.385742446 7 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas taxi 430 1.265115184 8 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas wittichii 388 1.141545794 9 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas sp. FARSPH 298 0.876754244 10 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sorangium cellulosum 260 0.764953367 11 Proteobacteria Deltaproteobacteria Myxococcales Polyangiaceae Sorangium Sphingomonas sp. Cra20 260 0.764953367 12 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas panacis 252 0.741416341
    [Show full text]
  • Insights Into the Pathogenicity of Burkholderia Pseudomallei
    REVIEWS Melioidosis: insights into the pathogenicity of Burkholderia pseudomallei W. Joost Wiersinga*, Tom van der Poll*, Nicholas J. White‡§, Nicholas P. Day‡§ and Sharon J. Peacock‡§ Abstract | Burkholderia pseudomallei is a potential bioterror agent and the causative agent of melioidosis, a severe disease that is endemic in areas of Southeast Asia and Northern Australia. Infection is often associated with bacterial dissemination to distant sites, and there are many possible disease manifestations, with melioidosis septic shock being the most severe. Eradication of the organism following infection is difficult, with a slow fever-clearance time, the need for prolonged antibiotic therapy and a high rate of relapse if therapy is not completed. Mortality from melioidosis septic shock remains high despite appropriate antimicrobial therapy. Prevention of disease and a reduction in mortality and the rate of relapse are priority areas for future research efforts. Studying how the disease is acquired and the host–pathogen interactions involved will underpin these efforts; this review presents an overview of current knowledge in these areas, highlighting key topics for evaluation. Melioidosis is a serious disease caused by the aerobic, rifamycins, colistin and aminoglycosides), but is usually Gram-negative soil-dwelling bacillus Burkholderia pseu- susceptible to amoxicillin-clavulanate, chloramphenicol, domallei and is most common in Southeast Asia and doxycycline, trimethoprim-sulphamethoxazole, ureido- Northern Australia. Melioidosis is responsible for 20% of penicillins, ceftazidime and carbapenems2,4. Treatment all community-acquired septicaemias and 40% of sepsis- is required for 20 weeks and is divided into intravenous related mortality in northeast Thailand. Reported cases are and oral phases2,4. Initial intravenous therapy is given likely to represent ‘the tip of the iceberg’1,2, as confirmation for 10–14 days; ceftazidime or a carbapenem are the of disease depends on bacterial isolation, a technique that drugs of choice.
    [Show full text]
  • Identification of Bordetella Spp. in Respiratory Specimens From
    504 Clinical Microbiology and Infection, Volume 14 Number 5, May 2008 isolates of extended-spectrum-beta-lactamase-producing Original Submission: 27 October 2007; Revised Sub- Shigella sonnei. Ann Trop Med Parasitol 2007; 101: 511–517. mission: 5 December 2007; Accepted: 19 December 21. Rice LB. Controlling antibiotic resistance in the ICU: 2007 different bacteria, different strategies. Cleve Clin J Med 2003; 70: 793–800. Clin Microbiol Infect 2008; 14: 504–506 22. Boyd DA, Tyler S, Christianson S et al. Complete nucleo- 10.1111/j.1469-0691.2008.01968.x tide sequence of a 92-kilobase plasmid harbouring the CTX-M-15 extended spectrum b-lactamase involved in an outbreak in long-term-care facilities in Toronto, Canada. Cystic fibrosis (CF) is an autosomal recessive Antimicrob Agents Chemother 2004; 48: 3758–3764. disease, characterised by defective chloride ion channels that result in multi-organ dysfunction, most notably affecting the respiratory tract. The RESEARCH NOTE alteration in the pulmonary environment is asso- ciated with increased susceptibility to bacterial infection. Recent advances in bacterial taxonomy and improved microbial identification systems Identification of Bordetella spp. in have led to an increasing recognition of the respiratory specimens from individuals diversity of bacterial species involved in CF lung with cystic fibrosis infection. Many such species are opportunistic T. Spilker, A. A. Liwienski and J. J. LiPuma human pathogens, some of which are rarely found in other human infections [1]. Processing Department of Pediatrics and Communicable of CF respiratory cultures therefore employs Diseases, University of Michigan Medical selective media and focuses on detection of School, Ann Arbor, MI, USA uncommon human pathogens.
    [Show full text]
  • <I>MICROCYSTIS</I> BLOOMS
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 8-2018 MOLECULAR CHARACTERIZATION OF FACTORS CONSTRAINING THE SUCCESS AND TOXICITY OF MICROCYSTIS BLOOMS Lauren Elisabeth Krausfeldt University of Tennessee, [email protected] Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss Recommended Citation Krausfeldt, Lauren Elisabeth, "MOLECULAR CHARACTERIZATION OF FACTORS CONSTRAINING THE SUCCESS AND TOXICITY OF MICROCYSTIS BLOOMS. " PhD diss., University of Tennessee, 2018. https://trace.tennessee.edu/utk_graddiss/5030 This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a dissertation written by Lauren Elisabeth Krausfeldt entitled "MOLECULAR CHARACTERIZATION OF FACTORS CONSTRAINING THE SUCCESS AND TOXICITY OF MICROCYSTIS BLOOMS." I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Doctor of Philosophy, with a major in Microbiology. Steven W. Wilhelm, Major Professor We have read this dissertation and recommend its acceptance: Alison Buchan, Shawn R. Campagna, Karen G. Lloyd Accepted for the Council: Dixie L. Thompson Vice Provost and Dean of the Graduate School (Original signatures are on file with official studentecor r ds.) MOLECULAR CHARACTERIZATION OF FACTORS CONSTRAINING THE SUCCESS AND TOXICITY OF MICROCYSTIS BLOOMS A Dissertation Presented for the Doctor of Philosophy Degree The University of Tennessee, Knoxville Lauren Elisabeth Krausfeldt August 2018 Copyright © 2018 by Lauren E.
    [Show full text]
  • Final Report of the Work Done on Major Research Project
    Final Report of the work done on Major Research Project Granted by University Grant Commission, New Delhi [F.No.-43-472/2014 (SR), w.e.f. 01/07/2015] Studies on Bacterial Colonization and Prevention of Biofilms in Urinary Catheters SUBMITTED BY Dr. NIRAJ GHANWATE Principal Investigator and Assistant Professor Department Of Microbiology Sant Gadge Baba Amravati University Amravati, 444602 Acknowledgement The investigators gratefully acknowledge the University Grants Commission, New Delhi, for sanctioning this major research project and providing financial assistance. Investigators also record their sincere thanks to the Vice Chancellor of Sant Gadge Baba Amravati University, Dr. Murlidhar Chandekar for providing the infrastructural facilities and all the amenities for the conduct of the study. We also express our sincere thanks to the Registrar Dr. Ajay Deshmukh for his timely help and support. We are grateful to the Heads of the departments of Microbiology and Biotechnology for their co-operation rendered in the conduct of the study. The researchers express their sincere thanks to all the administrative staff of the university and the students involved in the project. Principle Investigator Co-investigator Dr. Niraj Ghanwate Dr. P V Thakare Asst. Professor Associate Professor. Dept of Microbiology Dept of Biotechnology S G B Amravati University S G B Amravati University Amravati. Amravati Table of Contents Sr. No. Contents Page no. 1 Introduction and 1-17 Aims and Objectives 2 Review of Literature 18-20 3 Material and Methods 21-45 4 Results and Discussion 46-183 5 Conclusions 184-187 6 Bibliography 189-205 UGC-MRP Studies on Bacterial Colonization and Prevention Of Biofilm in Urinary F.No.
    [Show full text]
  • S41467-021-24668-7.Pdf
    ARTICLE https://doi.org/10.1038/s41467-021-24668-7 OPEN In vivo evolution of an emerging zoonotic bacterial pathogen in an immunocompromised human host ✉ A. Launay1, C.-J. Wu1, A. Dulanto Chiang 1, J.-H. Youn2, P. P. Khil1,2 & J. P. Dekker 1,2 Zoonotic transfer of animal pathogens to human hosts can generate novel agents, but the genetic events following such host jumps are not well studied. Here we characterize the mechanisms driving adaptive evolution of the emerging zoonotic pathogen Bordetella hinzii in β fi B. hinzii 1234567890():,; a patient with interleukin-12 receptor 1deciency. Genomic sequencing of 24 isolates cultured from blood and stool over 45 months revealed a clonal lineage that had undergone extensive within-host genetic and phenotypic diversification. Twenty of 24 iso- lates shared an E9G substitution in the DNA polymerase III ε-subunit active site, resulting in a proofreading deficiency. Within this proofreading-deficient clade, multiple lineages with mutations in DNA repair genes and altered mutational spectra emerged and dominated clinical cultures for more than 12 months. Multiple enzymes of the tricarboxylic acid cycle and gluconeogenesis pathways were repeatedly mutated, suggesting rapid metabolic adaptation to the human environment. Furthermore, an excess of G:C > T:A transversions suggested that oxidative stress shaped genetic diversification during adaptation. We propose that inacti- vation of DNA proofreading activity in combination with prolonged, but sub-lethal, oxidative attack resulting from the underlying host immunodeficiency facilitated rapid genomic adap- tation. These findings suggest a fundamental role for host immune phenotype in shaping pathogen evolution following zoonotic infection.
    [Show full text]
  • VITEK 2 Cards.Pdf
    ■ Streptococcus alactolyticus ■ Atopobium vaginae ■ Prevotella denticola ■ Candida famata ■ Streptococcus anginosus ■ Bacteroides caccae ■ Prevotella intermedia ■ Candida freyschussii ■ Streptococcus canis ■ Bacteroides eggerthii ■ Prevotella melaninogenica ■ Candida glabrata ■ Streptococcus constellatus ssp. ■ Bacteroides fragilis ■ Prevotella oralis ■ Candida guilliermondii constellatus ■ Bacteroides ovatus ■ Prevotella oris ■ Candida haemulonii ■ Streptococcus constellatus ssp. ■ Bacteroides stercoris ■ Propionibacterium acnes ■ Candida inconspicua / pharyngis ■ Bacteroides thetaiotaomicron ■ Propionibacterium granulosum Candida lambica ■ Streptococcus cristatus ■ Bacteroides uniformis ■ Propionibacterium propionicum ■ Candida intermedia ■ Streptococcus downei ■ Bacteroides vulgatus (Propionibacterium propionicus) ■ Candida kefyr ■ Streptococcus dysgalactiae ssp. ■ Bifidobacterium spp. ■ Staphylococcus saccharolyticus ■ Candida krusei ID & AST Cards dysgalactiae ■ Campylobacter (Bacteroides) ■ Trueperella pyogenes ■ Candida lipolytica ■ Streptococcus dysgalactiae ssp. ureolyticus (Arcanobacterium pyogenes) ■ Candida lusitaniae RELIABLE SAFE RAPID equisimilis ■ Clostridium barati ■ Turicella otitidis ■ Candida magnoliae ■ Streptococcus equi ssp. equi ■ Clostridium bifermentans ■ Veillonella spp. ■ Candida norvegensis ■ Streptococcus equi ssp. zooepidemicus ■ Clostridium butyricum ■ Candida parapsilosis ■ Streptococcus equinus ■ Clostridium cadaveris ■ Candida pelliculosa ■ Streptococcus gallolyticus ssp. ■ Clostridium chauvoei ■ Candida
    [Show full text]