DOCSLIB.ORG

Pdf Surveillance for Foodborne Disease Outbreaks—United States, 25

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Pdf Surveillance for Foodborne Disease Outbreaks—United States, 25 A Peer-Reviewed Journal Tracking and Analyzing Disease Trends pages 993–1166 EDITOR-IN-CHIEF D. Peter Drotman EDITORIAL STAFF EDITORIAL BOARD Dennis Alexander, Addlestone Surrey, United Kingdom Founding Editor Ban Allos, Nashville, Tennessee, USA Joseph E. McDade, Rome, Georgia, USA Michael Apicella, Iowa City, Iowa, USA Managing Senior Editor Barry J. Beaty, Ft. Collins, Colorado, USA Martin J. Blaser, New York, New York, USA Polyxeni Potter, Atlanta, Georgia, USA David Brandling-Bennet, Washington, D.C., USA Associate Editors Donald S. Burke, Baltimore, Maryland, USA Charles Ben Beard, Ft. Collins, Colorado, USA Jay C. Butler, Anchorage, Alaska David Bell, Atlanta, Georgia, USA Arturo Casadevall, New York, New York, USA Charles H. Calisher, Ft. Collins, Colorado, USA Kenneth C. Castro, Atlanta, Georgia, USA Thomas Cleary, Houston, Texas, USA Patrice Courvalin, Paris, France Anne DeGroot, Providence, Rhode Island, USA Stephanie James, Bethesda, Maryland, USA Vincent Deubel, Shanghai, China Takeshi Kurata, Tokyo, Japan Ed Eitzen, Washington, D.C., USA Brian W.J. Mahy, Atlanta, Georgia, USA Duane J. Gubler, Honolulu, Hawaii, USA Richard L. Guerrant, Charlottesville, Virginia, USA Martin I. Meltzer, Atlanta, Georgia, USA Scott Halstead, Arlington, Virginia, USA David Morens, Bethesda, Maryland, USA David L. Heymann, Geneva, Switzerland J. Glenn Morris, Baltimore, Maryland, USA Sakae Inouye, Tokyo, Japan Tanja Popovic, Atlanta, Georgia, USA Charles King, Cleveland, Ohio, USA Patricia M. Quinlisk, Des Moines, Iowa, USA Keith Klugman, Atlanta, Georgia, USA S.K. Lam, Kuala Lumpur, Malaysia Gabriel Rabinovich, Buenos Aires, Argentina Bruce R. Levin, Atlanta, Georgia, USA Didier Raoult, Marseilles, France Myron Levine, Baltimore, Maryland, USA Pierre Rollin, Atlanta, Georgia, USA Stuart Levy, Boston, Massachusetts, USA David Walker, Galveston, Texas, USA John S. MacKenzie, Perth, Australia Henrik C. Wegener, Copenhagen, Denmark Tom Marrie, Edmonton, Alberta, Canada John E. McGowan, Jr., Atlanta, Georgia, USA Copy Editors Philip P. Mortimer, London, United Kingdom Angie Frey, Thomas Gryczan, Ronnie Henry, Fred A. Murphy, Davis, California, USA Anne Mather, Carol Snarey Barbara E. Murray, Houston, Texas, USA Production P. Keith Murray, Ames, Iowa, USA Stephen Ostroff, Honolulu, Hawaii, USA Reginald Tucker, Ann Jordan, Maureen Marshall Rosanna W. Peeling, Geneva, Switzerland Editorial Assistant David H. Persing, Seattle, Washington, USA Carolyn Collins Gianfranco Pezzino, Topeka, Kansas, USA Richard Platt, Boston, Massachusetts, USA www.cdc.gov/eid Mario Raviglione, Geneva, Switzerland Emerging Infectious Diseases Leslie Real, Atlanta, Georgia, USA Emerging Infectious Diseases is published monthly by the David Relman, Palo Alto, California, USA National Center for Infectious Diseases, Centers for Disease Nancy Rosenstein, Atlanta, Georgia, USA Control and Prevention, 1600 Clifton Road, Mailstop D61, Connie Schmaljohn, Frederick, Maryland, USA Atlanta, GA 30333, USA. Telephone 404-371-5329, Tom Schwan, Hamilton, Montana, USA fax 404-371-5449, email [email protected]. Ira Schwartz, Valhalla, New York, USA Tom Shinnick, Atlanta, Georgia, USA The opinions expressed by authors contributing to this journal Patricia Simone, Atlanta, Georgia, USA do not necessarily reflect the opinions of the Centers for Disease Control and Prevention or the institutions with which the authors Bonnie Smoak, Bethesda, Maryland, USA are affiliated. Rosemary Soave, New York, New York, USA P. Frederick Sparling, Chapel Hill, North Carolina, USA All material published in Emerging Infectious Diseases is in Jan Svoboda, Prague, Czech Republic the public domain and may be used and reprinted without special Bala Swaminathan, Atlanta, Georgia, USA permission; proper citation, however, is required. Robert Swanepoel, Johannesburg, South Africa Phillip Tarr, St. Louis, Missouri, USA Use of trade names is for identification only and does not Timothy Tucker, Cape Town, South Africa imply endorsement by the Public Health Service or by the U.S. Elaine Tuomanen, Memphis, Tennessee, USA Department of Health and Human Services. John Ward, Atlanta, Georgia, USA ∞ Emerging Infectious Diseases is printed on acid-free paper that meets J. Todd Weber, Atlanta, Georgia, USA the requirements of ANSI/NISO 239.48-1992 (Permanence of Paper) Mary E. Wilson, Cambridge, Massachusetts, USA Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 11, No. 7, July 2005 A Peer-Reviewed Journal Tracking and Analyzing Disease Trends Vol. 11, No. 7, July 2005 On the Cover Research The Painted Gallery (17,000 BC) Ceiling, Lascaux Caves, West Nile Virus–associated Perigord, Dordogne, France Flaccid Paralysis . .1021 Image courtesy of CNP - Ministère J.J. Sejvar et al. de la Culture, France Poliomyelitislike syndrome, the most common mechanism of WNV-associated paralysis, causes About the Cover p. 1164 frequent illness and death. Primate-to-Human Retroviral Transmission in Asia . .1028 L. Jones-Engel et al. Simian foamy virus infection is documented in a Balinese monkey temple worker. Influenza A H5N1 Replication Sites in Humans . .1036 M. Uiprasertkul et al. Perspectives H5N1 replication in humans is restricted to the Attributing Illness to Food . .993 lungs and intestines. M.B. Batz et al Attributing foodborne illness to specific foods is Nipah Virus in Flying critical, but an adequate source of US data does Foxes, Cambodia . .1042 not exist. J.-M. Reynes et al. Flying foxes could be the natural host of Nipah virus. Wildlife Trade and Global Disease Emergence . .1000 Leptospirosis in Germany, W.B. Karesh et al. 1962–2003 . .1048 Regulating the global wildlife trade could A. Jansen et al. decrease disease risk. p. 1001 Changes in leptospirosis transmission patterns may facilitate disease spread in temperate climates. Occupational Deaths among Healthcare Workers . .1003 Tickborne Infections K.A. Sepkowitz and L. Eisenberg in Denmark . .1055 National registry would quantify occupational p. 1038 S. Skarphédinsson et al. deaths among healthcare workers A marked shift has occurred in the distribution of tickborne encephalitis–complex virus in Denmark. Drug-resistant Neisseria gonorrhoeae in Michigan . .1009 Risk Factors for Group A K.E. Macomber et al. Streptococcal Disease . .1062 Fluoroquinolone-resistant N. gonorrhoeae S.H. Factor et al. surveillance guides local STD programs. Household characteristics that influence exposure most affect development of invasive disease. Synopsis Emergency Department SARS Vaccine Development . .1016 Response to SARS, Taiwan . .1067 S. Jiang et al. W.-K. Chen et al. Recombinant RBDs may be used as safe vaccines Centralizing treatment of SARS patients in early for SARS-CoV. stages of infection may reduce epidemic spread. Human Metapneumovirus Genetic Variability . .1074 H.P. Ludewick et al. A Peer-Reviewed Journal Tracking and Analyzing Disease Trends Vol. 11, No. 7, July 2005 The complex circulating pattern of human metapneumovirus in Africa allows the virus to 1128 Yersinia pseudotuberculosis evade preexisting immunity. Septicemia and HIV Norovirus Recombination in M.G. Paglia et al. ORF1/ORF2 Overlap . .1079 1131 Bordetella petrii Clinical Isolate R.A. Bull et al. N.K. Fry et al. This recombination hotspot is a subgenomic 1134 Caliciviruses and Foodborne RNA promoter. Gastroenteritis, Chile p. 1087 R. Vidal et al. Policy Review 1138 Beliefs about Appropriate Adventitious Agents and Antibacterial Therapy K.C. Cummings et al. Smallpox Vaccine . .1086 F.A. Murphy and B.I. Osburn 1142 Asymptomatic SARS Coronavirus Old smallpox vaccines should be tested for Infection, Singapore adventitious infectious agents. A. Wilder-Smith et al. Dispatches Another Dimension 1090 New Chlamydia trachomatis 1103 Landscape Variant, Amsterdam M. Oliver J. Spaargaren et al. 1093 Household Transmission of Letters Gastroenteritis S. Perry et al. 1146 Hedgehog Zoonoses (Replies) 1097 Nosocomial Malaria and Saline 1146 Bartonella henselae, Cats, Jamaica Flush 1148 Pandemic Vibrio parahaemolyticus S.K. Jain et al. O3:K6 Spread, France 1100 West Nile Virus Surveillance, 1150 Third Borrelia Species in Mice Guadeloupe, 2003–2004 T. Lefrançois et al. 1151 Comparing Diagnostic Coding and Laboratory Results 1104 Enterotoxigenic Escherichia coli Diarrhea, Bangladesh 1153 Concurrent Dengue and Malaria F. Qadri et al. p. 1102 1154 West Nile Virus Detection and 1108 SARS Coronavirus Detection Commercial Assays Methods 1155 Hepatitis A, Italy S.K.P. Lau et al. 1157 Stenotrophomonas maltophilia 1112 Veillonella montpellierensis in Salad Endocarditis C. Rovery et al. 1158 Avian Influenza H5N1 and Healthcare Workers 1115 Burkholderia fungorum Septicemia 1160 Cell Phones and Acinetobacter G.P. Gerrits et al. Transmission 1118 Blackwater Fever in Children, Burundi Book Reviews F. Gobbi et al. 1121 Cervids as Babesiae Hosts, 1162 Beasts of the Earth: Animals, Slovenia Humans, and Disease D. Duh et al. 1162 Viral Haemorrhgic Fevers 1124 Salmonella Agona Outbreak from Contaminated Aniseed, Germany J. Koch et al. News & Notes About the Cover 1164 Global Wildlife Trade PERSPECTIVE Attributing Illness to Food Michael B. Batz,* Michael P. Doyle,† J. Glenn Morris, Jr.,‡ John Painter,§ Ruby Singh,¶ Robert V. Tauxe,§ Michael R. Taylor,* and Danilo M.A. Lo Fo Wong,# for the Food Attribution Working Group1 Identification and prioritization of effective food safety increasingly robust data on the incidence of illness due to interventions require an understanding of the relationship specific enteric pathogens, no method exists
Load more

Recommended publications
  • Comparative Phylogeny of the Genus Bordetella Using Sequence Analysis of 16S Rrna and Ompa Genes
    J Med Bacteriol. Vol. 6, No. 3, 4 (2017): pp.1-13 jmb.tums.ac.ir Comparative Phylogeny of the Genus Bordetella Using Sequence Analysis of 16S rRNA and ompA Genes Ali Badamchi 1, Moslem Papizadeh 2* 1 Children's Medical Center Hospital, Tehran University of Medical Sciences, Tehran, Iran. 2 Department of Microbiology, Pasteur Institute of Iran (IPI), Tehran, Iran. ARTICLE INFO ABSTRACT Article type: Background: The genus Bordetella harbors 16 species; three of them are well-known for their high Original Article medical importance. The phylogenetic diversity of the genus is currently not very well investigated. Methods: In this study, 16S rRNA gene sequence of 16 type strains of the Bordetella species were Article history: analyzed. Also, phylogenies conducted on the same gene of 247 isolates of Bordetella species, Received: 19 Jan 2017 comprising a wide physiological as well as ecological diversity and encompassing ex-type Revised: Jun Mar 2017 representatives of the 16 Bordetella species, were analyzed. Accepted: 11 Sep 2017 Results: It was found that the phylogenetic diversity of the genus may be very different from that is Published: 15 Oct 2017 currently assumed. Interestingly, the 16S rRNA gene signals could not resolve some species with Keywords: promising bootstrap and posterior probability values as our phylogenies, using maximum likelihood Alcaligenaceae, and Bayesian inference methods, showed. Biogeography, Bordetella Conclusion: Our results indicate a probable need for additional phylogenetic signals which can be species, Ecological provided by coding genes. Therefore, sequence data of ompA gene of Bordetella species, a critically distribution, Phylogenetic significant genomic region in pathogenesis, was here analyzed, phylogenetically.
    [Show full text]
  • Glossary for Narrative Writing
    Periodontal Assessment and Treatment Planning Gingival description Color: o pink o erythematous o cyanotic o racial pigmentation o metallic pigmentation o uniformity Contour: o recession o clefts o enlarged papillae o cratered papillae o blunted papillae o highly rolled o bulbous o knife-edged o scalloped o stippled Consistency: o firm o edematous o hyperplastic o fibrotic Band of gingiva: o amount o quality o location o treatability Bleeding tendency: o sulcus base, lining o gingival margins Suppuration Sinus tract formation Pocket depths Pseudopockets Frena Pain Other pathology Dental Description Defective restorations: o overhangs o open contacts o poor contours Fractured cusps 1 ww.links2success.biz [email protected] 914-303-6464 Caries Deposits: o Type . plaque . calculus . stain . matera alba o Location . supragingival . subgingival o Severity . mild . moderate . severe Wear facets Percussion sensitivity Tooth vitality Attrition, erosion, abrasion Occlusal plane level Occlusion findings Furcations Mobility Fremitus Radiographic findings Film dates Crown:root ratio Amount of bone loss o horizontal; vertical o localized; generalized Root length and shape Overhangs Bulbous crowns Fenestrations Dehiscences Tooth resorption Retained root tips Impacted teeth Root proximities Tilted teeth Radiolucencies/opacities Etiologic factors Local: o plaque o calculus o overhangs 2 ww.links2success.biz [email protected] 914-303-6464 o orthodontic apparatus o open margins o open contacts o improper
    [Show full text]
  • Impact of HIV on Gastroenterology/Hepatology
    Core Curriculum: Impact of HIV on Gastroenterology/Hepatology AshutoshAshutosh Barve,Barve, M.D.,M.D., Ph.D.Ph.D. Gastroenterology/HepatologyGastroenterology/Hepatology FellowFellow UniversityUniversityUniversity ofofof LouisvilleLouisville Louisville Case 4848 yearyear oldold manman presentspresents withwith aa historyhistory ofof :: dysphagiadysphagia odynophagiaodynophagia weightweight lossloss EGDEGD waswas donedone toto evaluateevaluate thethe problemproblem University of Louisville Case – EGD Report ExtensivelyExtensively scarredscarred esophagealesophageal mucosamucosa withwith mucosalmucosal bridging.bridging. DistalDistal esophagealesophageal nodulesnodules withwithUniversity superficialsuperficial ulcerationulceration of Louisville Case – Esophageal Nodule Biopsy InflammatoryInflammatory lesionlesion withwith ulceratedulcerated mucosamucosa SpecialSpecial stainsstains forfor fungifungi revealreveal nonnon-- septateseptate branchingbranching hyphaehyphae consistentconsistent withwith MUCORMUCOR University of Louisville Case TheThe patientpatient waswas HIVHIV positivepositive !!!! University of Louisville HAART (Highly Active Anti Retroviral Therapy) HIV/AIDS Before HAART After HAART University of Louisville HIV/AIDS BeforeBefore HAARTHAART AfterAfter HAARTHAART ImmuneImmune dysfunctiondysfunction ImmuneImmune reconstitutionreconstitution OpportunisticOpportunistic InfectionsInfections ManagementManagement ofof chronicchronic ¾ Prevention diseasesdiseases e.g.e.g. HepatitisHepatitis CC ¾ Management CirrhosisCirrhosis NeoplasmsNeoplasms
    [Show full text]
  • Dry Socket (Alveolar Osteitis): Incidence, Pathogenesis, Prevention and Management
    See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/273250883 Dry Socket (Alveolar Osteitis): Incidence, Pathogenesis, Prevention and Management Article · January 2013 CITATIONS READS 4 6,266 4 authors, including: Deepak Viswanath Mahesh kumar R krishnadevaraya college of dental sciences krishnadevaraya college of dental sciences 46 PUBLICATIONS 131 CITATIONS 14 PUBLICATIONS 29 CITATIONS SEE PROFILE SEE PROFILE Some of the authors of this publication are also working on these related projects: AID reviews View project Systematic Reviews View project All content following this page was uploaded by Mahesh kumar R on 08 March 2015. The user has requested enhancement of the downloaded file. GirishREVIEW G Gowda ARTICLE et al Dry Socket (Alveolar Osteitis): Incidence, Pathogenesis, Prevention and Management Girish G Gowda, Deepak Viswanath, Mahesh Kumar, DN Umashankar ABSTRACT registered.12-15 The duration varies from 5 to 10 days Alveolar osteitis (AO) is the most common postoperative depending on the severity of the condition. complication after tooth extraction. The pathophysiology, etiology, prevention and treatment of the alveolar osteitis are ETIOLOGY very essential in oral surgery. The aim of this article is to provide a better basis for clinical management of the condition. In The exact etiology of AO is not well understood. Birn addition, the need for identification and elimination of the risk suggested that the etiology of AO is an increased local factors as well as preventive and symptomatic management of fibrinolysis leading to disintegration of the clot. However, the condition are discussed. several local and systemic factors are known to be Keywords: Alveolar osteitis, Localised osteitis, Septic socket, contributing to the etiology of AO.
    [Show full text]
  • Recognizing and Treating New and Emerging Infections Encountered in Everyday Practice
    Recognizing and treating new and emerging infections encountered in everyday practice STEVEN M. GORDON, MD NFECTIOUS DISEASES, pre- MiikWirj:« Although infectious diseases were once considered a dicted earlier in this cen- diminishing threat, new pathogens are constantly challenging tury to be eliminated as a the health care system. This article reviews the clinical presen- public health problem, re- tation, diagnosis, and treatment of seven emerging infections I main the chief cause of death that primary care physicians are likely to encounter. worldwide and a significant cause of death and morbidity in i Parvovirus B19 attacks erythrocyte precursors; the United States.1 Challenging infection is usually benign and self-limiting but can cause the US public health system are aplastic crises in patients with chronic hemolytic disorders. several newly identified patho- Hemorrhagic colitis due to Escherichia coli 0157:H7 infection gens (eg, human immunodefi- can lead to the hemolytic-uremic syndrome, especially in chil- ciency virus [HIV], Escherichia dren; it also can cause thrombotic thrombocytopenia purpura. coli 0157:H7, hepatitis C) and a Chlamydia pneumoniae causes a mild pneumonia that resem- resurgence of old diseases pre- bles mycoplasmal pneumonia. Bacillary angiomatosis primar- sumed to be under control (eg, ily affects immunocompromised patients, especially those tuberculosis, syphilis). Further, infected with human immunodeficiency virus (HIV). At least multiple-drug resistance in two organisms can cause bacillary angiomatosis: Bartonella hense- strains of pneumococci, gono- lae and Bartonella quintana. Hantavirus pulmonary syndrome cocci, enterococci, staphylo- is spread by exposure to the droppings of infected rodents. cocci, salmonella, and mycobac- Contrary to previous thought, HIV continues to replicate teria undermines efforts to throughout the course of the illness and does not have a latency control the diseases they cause.2 phase.
    [Show full text]
  • Zeroing in on the Cause of Your Patient's Facial Pain
    Feras Ghazal, DDS; Mohammed Ahmad, Zeroing in on the cause MD; Hussein Elrawy, DDS; Tamer Said, MD Department of Oral Health of your patient's facial pain (Drs. Ghazal and Elrawy) and Department of Family Medicine/Geriatrics (Drs. Ahmad and Said), The overlapping characteristics of facial pain can make it MetroHealth Medical Center, Cleveland, Ohio difficult to pinpoint the cause. This article, with a handy at-a-glance table, can help. [email protected] The authors reported no potential conflict of interest relevant to this article. acial pain is a common complaint: Up to 22% of adults PracticE in the United States experience orofacial pain during recommendationS F any 6-month period.1 Yet this type of pain can be dif- › Advise patients who have a ficult to diagnose due to the many structures of the face and temporomandibular mouth, pain referral patterns, and insufficient diagnostic tools. disorder that in addition to Specifically, extraoral facial pain can be the result of tem- taking their medication as poromandibular disorders, neuropathic disorders, vascular prescribed, they should limit disorders, or atypical causes, whereas facial pain stemming activities that require moving their jaw, modify their diet, from inside the mouth can have a dental or nondental cause and minimize stress; they (FIGURE). Overlapping characteristics can make it difficult to may require physical therapy distinguish these disorders. To help you to better diagnose and and therapeutic exercises. C manage facial pain, we describe the most common causes and underlying pathological processes. › Consider prescribing a tricyclic antidepressant for patients with persistent idiopathic facial pain. C Extraoral facial pain Extraoral pain refers to the pain that occurs on the face out- 2-15 Strength of recommendation (SoR) side of the oral cavity.
    [Show full text]
  • Calicivirus from Novel Recovirus Genogroup in Human Diarrhea
    DISPATCHES οf ≈6.4–8.4 kb, cause illness in animals and humans (8,9), Calicivirus from including gastroenteritis in humans. The family Caliciviri- dae consists of 5 genera, Norovirus, Sapovirus, Lagovirus, Novel Recovirus Vesivirus, and Nebovirus, and 3 proposed genera, Recovi- Genogroup in rus, Valovirus, and chicken calicivirus (8–10). The Study Human Diarrhea, Each year, >100,000 diarrhea patients are admitted to Bangladesh the Dhaka hospital of the International Centre for Diarrheal Disease Research, Bangladesh (ICDDR,B). Fecal samples Saskia L. Smits, Mustafi zur Rahman, from 2% of these patients are collected and examined as part Claudia M.E. Schapendonk, Marije van Leeuwen, of systematic routine surveillance system for the presence Abu S.G. Faruque, Bart L. Haagmans, of enteric pathogens (11). All procedures were performed in Hubert P. Endtz, and Albert D.M.E. Osterhaus compliance with relevant laws and institutional guidelines and in accordance with the Declaration of Helsinki. To identify unknown human viruses in the enteric tract, we examined 105 stool specimens from patients with diar- rhea in Bangladesh. A novel calicivirus was identifi ed in a sample from 1 patient and subsequently found in samples from 5 other patients. Phylogenetic analyses classifi ed this virus within the proposed genus Recovirus. iarrhea, characterized by frequent liquid or loose Dstools, commonly results from gastroenteritis caused by infection with bacteria, parasites, or viruses. Patients with mild diarrhea do not require medical attention; the ill- ness is typically self-limited, and disease symptoms usually resolve quickly. However, diarrheal diseases can result in severe illness and death worldwide and are the second lead- ing cause of death around the world in children <5 years of age, particularly in low- and middle-income countries (1).
    [Show full text]
  • Downloads/Global-Burden-Report.Pdf (Accessed on 20 December 2017)
    viruses Review The Interactions between Host Glycobiology, Bacterial Microbiota, and Viruses in the Gut Vicente Monedero 1, Javier Buesa 2 and Jesús Rodríguez-Díaz 2,* ID 1 Department of Food Biotechnology, Institute of Agrochemistry and Food Technology (IATA, CSIC), Av Catedrático Agustín Escardino, 7, 46980 Paterna, Spain; [email protected] 2 Departament of Microbiology, Faculty of Medicine, University of Valencia, Av. Blasco Ibañez 17, 46010 Valencia, Spain; [email protected] * Correspondence: [email protected]; Tel.: +34-96-386-4903; Fax: +34-96-386-4960 Received: 31 January 2018; Accepted: 22 February 2018; Published: 24 February 2018 Abstract: Rotavirus (RV) and norovirus (NoV) are the major etiological agents of viral acute gastroenteritis worldwide. Host genetic factors, the histo-blood group antigens (HBGA), are associated with RV and NoV susceptibility and recent findings additionally point to HBGA as a factor modulating the intestinal microbial composition. In vitro and in vivo experiments in animal models established that the microbiota enhances RV and NoV infection, uncovering a triangular interplay between RV and NoV, host glycobiology, and the intestinal microbiota that ultimately influences viral infectivity. Studies on the microbiota composition in individuals displaying different RV and NoV susceptibilities allowed the identification of potential bacterial biomarkers, although mechanistic data on the virus–host–microbiota relation are still needed. The identification of the bacterial and HBGA interactions that are exploited by RV and NoV would place the intestinal microbiota as a new target for alternative therapies aimed at preventing and treating viral gastroenteritis. Keywords: rotavirus; norovirus; secretor; fucosyltransferase-2 gene (FUT2); histo-blood group antigens (HBGAs); microbiota; host susceptibility 1.
    [Show full text]
  • Table S1. Primers Used for PCR Amplification
    Table S1. Primers used for PCR amplification Name Primer Sequence (5’-3’) Gene target Taxon target Reference First PCR round DGGE analysis FGPH19 TACGGCAARGGTGGNATHG nifH Diazotrophic (Simonet et al. 1991) POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) 799F AACMGGATTAGATACCCKG 16S rRNA Bacteria (Chelius and Triplett 2001) 1492R TACGGYTACCTTGTTACGACTT 16S rRNA Bacteria (Chelius and Triplett 2001) F203α CCGCATACGCCCTACGGGGGAAAGATTTAT 16S rRNA Alphaproteobacteria (Gomes et al. 2001) F948β CGCACAAGCGGTGGATGA 16S rRNA Betaproteobacteria (Gomes et al. 2001) F243HCG GGATGAGCCCGCGGCCTA 16S rRNA Actinobacteria (Heuer et al. 1997) BACF GGGAAACCGGGGCTAATACCGGAT 16S rRNA Firmicutes (Garbeva et al. 2003) Second PCR round DGGE analysis POLF-GC CGCCCGCCGCGCCCCGCGCCCGGCCCGCCCCCG nifH Diazotrophic (Poly et al. 2001) CCCCTGCGAYCCSAARGCBGACTC AQER GACGATGTAGATITCCTG nifH Diazotrophic (Poly et al. 2001) F968-GC CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGC 16S rRNA Bacteria (Heuer et al. 1999) ACGGGGGGAACGAAGAACCTTAC R1401 CGGTGTGTACAAGACCC 16S rRNA Bacteria (Heuer et al. 1997) qPCR analysis POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) POLF TGCGAYCCSAARGCBGACTC nifH Diazotrophic (Poly et al. 2001) 6S-27F AGAGTTTGATCCTGGCTCAG 16S rRNA Bacteria Bulgari et al., 2014 338R GCTGCCTCCCGTAGGAGT 16S rRNA Bacteria Bulgari et al., 2014 Table 2. Primers used for Ion Torrent pyrosequencing analysis. Primer Primer sequence (5´-3´) Reference 967F-PP CNACGCGAAGAACCTTANC (Jünemann et al. 2012) 967F-UC1 CAACGCGAAAAACCTTACC (Jünemann et al. 2012) 967F-UC2 CAACGCGCAGAACCTTACC (Jünemann et al. 2012) 967F-UC3 ATACGCGARGAACCTTACC (Jünemann et al. 2012) 967F-AQ CTAACCGANGAACCTYACC (Jünemann et al. 2012) 1046R CGACAGCCATGCANCACCT (Jünemann et al. 2012) 1046R-PP CGACAACCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ1 CGACGGCCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ2 CGACGACCATGCANCACCT (Jünemann et al. 2012) Table S3. Alpha diversity indices. Statistical analysis of the total endophytic and diazotrophic endophytic bacterial community associated with sweet sorghum cv.
    [Show full text]
  • Cystic Fibrosis Mice Develop Spontaneouschronic Bordetella
    ISSN 2470-3176 SciO p Forschene n HUB for Sc i e n t i f i c R e s e a r c h Journal of Infectious Pulmonary Diseases Research Article Volume: 3.2 Open Access Received date: 11 Oct 2017; Accepted date: 28 Cystic Fibrosis Mice Develop Spontaneous Oct 2017; Published date: 02 Nov 2017. Chronic Bordetella Airway Infections Citation: Darrah R, Bonfield T, LiPuma JJ, Litman P, Hodges CA, et al. (2017) Cystic Fibrosis Mice Darrah R1*, Bonfield T2, LiPuma JJ3, Litman P1, Hodges CA4, Jacono F5 and Develop Spontaneous Chronic Bordetella Airway Drumm M6 Infections. J Infect Pulm Dis 3(2): doi http://dx.doi. org/10.16966/2470-3176.128 1Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA 2Department of Pediatrics, Case Western Reserve University, Cleveland Ohio, USA Copyright: © 2017 Darrah R, et al. This is an 3Department of Pediatrics and Communicable Diseases, University of Michigan Medical School, Ann open-access article distributed under the terms Arbor, Michigan, USA of the Creative Commons Attribution License, 4Departments of Radiology, Biomedical Engineering, and Pediatrics, Case Western Reserve University, which permits unrestricted use, distribution, and Cleveland Ohio, USA reproduction in any medium, provided the original 5Department of Medicine, Case Western Reserve University, and Louis Stokes VA Cleveland Medical author and source are credited. Center, USA 6Departments of Pediatrics and Genetics Genome Sciences, Case Western Reserve University, Cleveland Ohio, USA *Corresponding author: Rebecca Darrah, Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA, Tel: 216-368-4911; E-mail: [email protected] Abstract Chronic pulmonary disease and infection is the primary cause of morbidity and mortality in people with cystic fibrosis (CF).
    [Show full text]
  • Bordetella Petrii Clinical Isolate Isolates of This Species Have Been Previously Reported from 4
    routine laboratory protocols. Initial susceptibility testing Bordetella petrii using disk diffusion indicated apparent susceptibility of the isolate to erythromycin, gentamicin, ceftriaxone, and Clinical Isolate piperacillin/tazobactam. The isolate was resistant to amox- icillin, co-amoxiclav, tetracycline, clindamycin, ciproflo- Norman K. Fry,* John Duncan,* Henry Malnick,* xacin, and metronidazole. After initial sensitivity results, a Marina Warner,* Andrew J. Smith,† 6-week course of oral clarithromycin (500 mg, 8 hourly) Margaret S. Jackson,† and Ashraf Ayoub† was begun. We describe the first clinical isolate of Bordetella petrii At follow-up appointments 3 months and 6 months from a patient with mandibular osteomyelitis. The only pre- after antimicrobial drug therapy ceased, clinical and radi- viously documented isolation of B. petrii occurred after the ographic findings were not unusual, and the infected area initial culture of a single strain from an environmental healed successfully. Despite the successful clinical out- source. come, the isolate was subsequently shown to be resistant to clarithromycin in vitro (Table). Improvement of the 67-year-old man visited an emergency dental clinic, osteomyelitis may also have been facilitated by the biopsy Awhere he complained of toothache in the lower right procedure, during which a sequestrum of bone was mandibular quadrant. Examination showed a root-filled removed. lower right canine tooth that was mobile and tender to per- The gram-negative bacillus (designated strain cussion. The tooth was extracted uneventfully under local GDH030510) was submitted to the Health Protection anesthesia. The patient returned after several days with Agency, Centre for Infections, London, for identification. pain at the extraction site. A localized alveolar osteitis was Preliminary tests results were consistent with those diagnosed, and local debridement measures were institut- described for members of the genus Bordetella.
    [Show full text]
  • NEWSLETTER Supplementingtrack & FIELD NEWS Twice Monthly
    TRACKNEWSLETTER SupplementingTRACK & FIELD NEWS twice monthly. Vol. 10, No. 1 August 14, 1963 Page 1 Jordan Shuffles Team vs. Germany British See 16'10 1-4" by Pennel Hannover, Germany, July 31- ~Aug. 1- -Coach Payton Jordan London, August 3 & 5--John Pennel personally raised the shuffled his personnel around for the dual meet with West Germany, world pole vault record for the fifth time this season to 16'10¼" (he and came up with a team that carried the same two athletes that com­ has tied it once), as he and his U.S. teammates scored 120 points peted against the Russians in only six of the 21 events--high hurdles, to beat Great Britain by 29 points . The British athl_etes held the walk, high jump, broad jump, pole vault, and javelin throw. His U.S. Americans to 13 firsts and seven 1-2 sweeps. team proceeded to roll up 18 first places, nine 1-2 sweeps, and a The most significant U.S. defeat came in the 440 relay, as 141 to 82 triumph. the Jones boys and Peter Radford combined to run 40 . 0, which equal­ The closest inter-team race was in the steeplechase, where ed the world record for two turns. Again slowed by poor baton ex­ both Pat Traynor and Ludwig Mueller were docked in 8: 44. 4 changes, Bob Hayes gained up to five yards in the final leg but the although the U.S. athlete was given the victory. It was Traynor's U.S. still lost by a tenth. Although the American team had hoped second fastest time of the season, topped only by his mark against for a world record, the British victory was not totally unexpected.
    [Show full text]