DOCSLIB.ORG

<I>MICROCYSTIS</I> BLOOMS

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
<I>MICROCYSTIS</I> BLOOMS University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 8-2018 MOLECULAR CHARACTERIZATION OF FACTORS CONSTRAINING THE SUCCESS AND TOXICITY OF MICROCYSTIS BLOOMS Lauren Elisabeth Krausfeldt University of Tennessee, [email protected] Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss Recommended Citation Krausfeldt, Lauren Elisabeth, "MOLECULAR CHARACTERIZATION OF FACTORS CONSTRAINING THE SUCCESS AND TOXICITY OF MICROCYSTIS BLOOMS. " PhD diss., University of Tennessee, 2018. https://trace.tennessee.edu/utk_graddiss/5030 This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a dissertation written by Lauren Elisabeth Krausfeldt entitled "MOLECULAR CHARACTERIZATION OF FACTORS CONSTRAINING THE SUCCESS AND TOXICITY OF MICROCYSTIS BLOOMS." I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Doctor of Philosophy, with a major in Microbiology. Steven W. Wilhelm, Major Professor We have read this dissertation and recommend its acceptance: Alison Buchan, Shawn R. Campagna, Karen G. Lloyd Accepted for the Council: Dixie L. Thompson Vice Provost and Dean of the Graduate School (Original signatures are on file with official studentecor r ds.) MOLECULAR CHARACTERIZATION OF FACTORS CONSTRAINING THE SUCCESS AND TOXICITY OF MICROCYSTIS BLOOMS A Dissertation Presented for the Doctor of Philosophy Degree The University of Tennessee, Knoxville Lauren Elisabeth Krausfeldt August 2018 Copyright © 2018 by Lauren E. Krausfeldt. All rights reserved. ii DEDICATION To my dad, my hero. And my sister, forever my best friend. iii ACKNOWLEDGEMENTS I would first like the acknowledge Dr. Wilhelm for being an exceptional advisor. I am incredibly grateful for the tremendous research opportunities I have been given in graduate school. Thank you for your mentorship, support and advice in research and in life. Thank you for creating and encouraging a positive work environment. I am truly appreciative to have worked in such a collaborative atmosphere with people I call friends. To my committee members, I look up to you all with great admiration and so appreciate your guidance over the years. I have to especially thank my undergraduate research advisor Dr. Tamara Marsh for giving me the opportunity to dive into research and always believing in me. I wouldn’t be where I am today without her. I have been lucky to have collaborated with many wonderful people – Drs. Boyer, Tang, Bullerjahn, McKay, Steffen, Bodrossy, Hector, Abigail and many more, thank you for all of your input on my work and the many valuable discussions. I also have to thank Elizabeth McPherson for not only being a tremendous teaching supervisor but also a great friend. To my labmates, past and present – I am so grateful for our time commiserating over failed experiments, the celebration of our successes, and our talks about life and research in the lab and out. A special shout needs to go out to Gary LeCleir for all the help throughout the years! I am so lucky to have such a wonderful support system in my family and friends. Thank you all for your love, encouragement and never-ending support even when distance sometimes keeps us apart. A special thank you goes to all of the friends I have made in Knoxville – I love you all, thank you for making Knoxville home. I have to especially thank my family for always making sure that I know how proud they are of me. And to my little family here in Knoxville – Bob, Theodore, and Rocky, I love coming home to you at the end of every day! iv ABSTRACT Harmful cyanobacterial blooms (cyanoHABs) have detrimental effects on freshwater lakes and reservoirs around the world. CyanoHABs severely reduce water quality, altering the food web and disrupting fishing and tourism industries. In addition, many bloom-forming cyanobacteria have the capacity to produce potent toxins, making the negative impacts of cyanoHABs of ecological and economic importance and a serious public health risk. Microcystis spp., which are the typically dominating cyanobacteria in blooms, often produce thick scums, taste and odor compounds and the hepatotoxins, microcystin, implicated in water advisories, human and animal poisonings and drinking water shutdowns globally. Primarily driven by anthropogenic nutrient loading and climate change, Microcystis blooms are on the rise, not only increasing in frequency but also intensity. Nitrogen (N) and phosphorus (P) are considered the most important nutrients in driving bloom formation and persistence but historically management practices have solely focused on P abatements. Large inputs of N into the environment have now been tied to the increased prevalence of toxic Microcystis. To better understand the role of N and other environmental factors impacting the success and toxicity of Microcystis, a number of molecular techniques were employed to characterize bloom community dynamics and the physiology of Microcystis. Results from environmental studies generated new hypotheses about the role of heterotrophic bacteria in N-cycling and microcystin degradation, while observations from laboratory studies provided novel insight into the metabolism of N by Microcystis and subsequent microcystin production was proposed. Together, the findings presented here can be extrapolated to the natural environment and provide greater insight into the mechanisms that contribute to cyanoHAB expansion and toxicity. v TABLE OF CONTENTS Harmful cyanobacterial blooms ............................................................................................... 2 Microcystins: Toxicity and risks.............................................................................................. 3 The fate of microcystins in the environment ............................................................................ 8 Microcystis and the microcystin production........................................................................... 12 Factors that influence the success and persistence of Microcystis blooms .............................. 15 Nitrogen and phosphorus: Has the debate come to an end? .................................................... 17 References ............................................................................................................................ 21 Publication note .................................................................................................................... 29 Abstract ................................................................................................................................ 30 Introduction .......................................................................................................................... 31 Methods ................................................................................................................................ 33 Sample collection and environmental parameters .............................................................. 33 RNA extraction ................................................................................................................. 34 Microarray analyses .......................................................................................................... 36 Multivariate Analysis ........................................................................................................ 36 Results .................................................................................................................................. 39 Status of the lake ............................................................................................................... 39 N-cycling gene expression................................................................................................. 43 Discussion............................................................................................................................. 49 Acknowledgements ............................................................................................................... 56 Appendix .............................................................................................................................. 63 vi Figures .............................................................................................................................. 63 Tables ............................................................................................................................... 68 Supplementary Information ............................................................................................. 101 References ............................................................................................................................ 57 Publication note .................................................................................................................. 107 Abstract .............................................................................................................................. 108 Introduction .......................................................................................................................
Load more

Recommended publications
  • Developing a Genetic Manipulation System for the Antarctic Archaeon, Halorubrum Lacusprofundi: Investigating Acetamidase Gene Function
    www.nature.com/scientificreports OPEN Developing a genetic manipulation system for the Antarctic archaeon, Halorubrum lacusprofundi: Received: 27 May 2016 Accepted: 16 September 2016 investigating acetamidase gene Published: 06 October 2016 function Y. Liao1, T. J. Williams1, J. C. Walsh2,3, M. Ji1, A. Poljak4, P. M. G. Curmi2, I. G. Duggin3 & R. Cavicchioli1 No systems have been reported for genetic manipulation of cold-adapted Archaea. Halorubrum lacusprofundi is an important member of Deep Lake, Antarctica (~10% of the population), and is amendable to laboratory cultivation. Here we report the development of a shuttle-vector and targeted gene-knockout system for this species. To investigate the function of acetamidase/formamidase genes, a class of genes not experimentally studied in Archaea, the acetamidase gene, amd3, was disrupted. The wild-type grew on acetamide as a sole source of carbon and nitrogen, but the mutant did not. Acetamidase/formamidase genes were found to form three distinct clades within a broad distribution of Archaea and Bacteria. Genes were present within lineages characterized by aerobic growth in low nutrient environments (e.g. haloarchaea, Starkeya) but absent from lineages containing anaerobes or facultative anaerobes (e.g. methanogens, Epsilonproteobacteria) or parasites of animals and plants (e.g. Chlamydiae). While acetamide is not a well characterized natural substrate, the build-up of plastic pollutants in the environment provides a potential source of introduced acetamide. In view of the extent and pattern of distribution of acetamidase/formamidase sequences within Archaea and Bacteria, we speculate that acetamide from plastics may promote the selection of amd/fmd genes in an increasing number of environmental microorganisms.
    [Show full text]
  • Table S1. Primers Used for PCR Amplification
    Table S1. Primers used for PCR amplification Name Primer Sequence (5’-3’) Gene target Taxon target Reference First PCR round DGGE analysis FGPH19 TACGGCAARGGTGGNATHG nifH Diazotrophic (Simonet et al. 1991) POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) 799F AACMGGATTAGATACCCKG 16S rRNA Bacteria (Chelius and Triplett 2001) 1492R TACGGYTACCTTGTTACGACTT 16S rRNA Bacteria (Chelius and Triplett 2001) F203α CCGCATACGCCCTACGGGGGAAAGATTTAT 16S rRNA Alphaproteobacteria (Gomes et al. 2001) F948β CGCACAAGCGGTGGATGA 16S rRNA Betaproteobacteria (Gomes et al. 2001) F243HCG GGATGAGCCCGCGGCCTA 16S rRNA Actinobacteria (Heuer et al. 1997) BACF GGGAAACCGGGGCTAATACCGGAT 16S rRNA Firmicutes (Garbeva et al. 2003) Second PCR round DGGE analysis POLF-GC CGCCCGCCGCGCCCCGCGCCCGGCCCGCCCCCG nifH Diazotrophic (Poly et al. 2001) CCCCTGCGAYCCSAARGCBGACTC AQER GACGATGTAGATITCCTG nifH Diazotrophic (Poly et al. 2001) F968-GC CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGC 16S rRNA Bacteria (Heuer et al. 1999) ACGGGGGGAACGAAGAACCTTAC R1401 CGGTGTGTACAAGACCC 16S rRNA Bacteria (Heuer et al. 1997) qPCR analysis POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) POLF TGCGAYCCSAARGCBGACTC nifH Diazotrophic (Poly et al. 2001) 6S-27F AGAGTTTGATCCTGGCTCAG 16S rRNA Bacteria Bulgari et al., 2014 338R GCTGCCTCCCGTAGGAGT 16S rRNA Bacteria Bulgari et al., 2014 Table 2. Primers used for Ion Torrent pyrosequencing analysis. Primer Primer sequence (5´-3´) Reference 967F-PP CNACGCGAAGAACCTTANC (Jünemann et al. 2012) 967F-UC1 CAACGCGAAAAACCTTACC (Jünemann et al. 2012) 967F-UC2 CAACGCGCAGAACCTTACC (Jünemann et al. 2012) 967F-UC3 ATACGCGARGAACCTTACC (Jünemann et al. 2012) 967F-AQ CTAACCGANGAACCTYACC (Jünemann et al. 2012) 1046R CGACAGCCATGCANCACCT (Jünemann et al. 2012) 1046R-PP CGACAACCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ1 CGACGGCCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ2 CGACGACCATGCANCACCT (Jünemann et al. 2012) Table S3. Alpha diversity indices. Statistical analysis of the total endophytic and diazotrophic endophytic bacterial community associated with sweet sorghum cv.
    [Show full text]
  • Comparative Genomics of Pandoraea, a Genus Enriched in Xenobiotic Biodegradation and Metabolism
    fmicb-10-02556 November 4, 2019 Time: 15:40 # 1 ORIGINAL RESEARCH published: 06 November 2019 doi: 10.3389/fmicb.2019.02556 Comparative Genomics of Pandoraea, a Genus Enriched in Xenobiotic Biodegradation and Metabolism Charlotte Peeters1, Evelien De Canck1, Margo Cnockaert1, Evie De Brandt1, Cindy Snauwaert2, Bart Verheyde1, Eliza Depoorter1, Theodore Spilker3, John J. LiPuma3 and Peter Vandamme1,2* 1 Laboratory of Microbiology, Department of Biochemistry and Microbiology, Faculty of Sciences, Ghent University, Ghent, Belgium, 2 BCCM/LMG Bacteria Collection, Department of Biochemistry and Microbiology, Faculty of Sciences, Ghent Edited by: University, Ghent, Belgium, 3 Department of Pediatrics, University of Michigan Medical School, Ann Arbor, MI, United States Iain Sutcliffe, Northumbria University, United Kingdom Comparative analysis of partial gyrB, recA, and gltB gene sequences of 84 Pandoraea Reviewed by: reference strains and field isolates revealed several clusters that included no taxonomic Martin W. Hahn, reference strains. The gyrB, recA, and gltB phylogenetic trees were used to select 27 University of Innsbruck, Austria Stephanus Nicolaas Venter, strains for whole-genome sequence analysis and for a comparative genomics study that University of Pretoria, South Africa also included 41 publicly available Pandoraea genome sequences. The phylogenomic Aharon Oren, The Hebrew University of Jerusalem, analyses included a Genome BLAST Distance Phylogeny approach to calculate pairwise Israel digital DNA–DNA hybridization values and their
    [Show full text]
  • Cystic Fibrosis Mice Develop Spontaneouschronic Bordetella
    ISSN 2470-3176 SciO p Forschene n HUB for Sc i e n t i f i c R e s e a r c h Journal of Infectious Pulmonary Diseases Research Article Volume: 3.2 Open Access Received date: 11 Oct 2017; Accepted date: 28 Cystic Fibrosis Mice Develop Spontaneous Oct 2017; Published date: 02 Nov 2017. Chronic Bordetella Airway Infections Citation: Darrah R, Bonfield T, LiPuma JJ, Litman P, Hodges CA, et al. (2017) Cystic Fibrosis Mice Darrah R1*, Bonfield T2, LiPuma JJ3, Litman P1, Hodges CA4, Jacono F5 and Develop Spontaneous Chronic Bordetella Airway Drumm M6 Infections. J Infect Pulm Dis 3(2): doi http://dx.doi. org/10.16966/2470-3176.128 1Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA 2Department of Pediatrics, Case Western Reserve University, Cleveland Ohio, USA Copyright: © 2017 Darrah R, et al. This is an 3Department of Pediatrics and Communicable Diseases, University of Michigan Medical School, Ann open-access article distributed under the terms Arbor, Michigan, USA of the Creative Commons Attribution License, 4Departments of Radiology, Biomedical Engineering, and Pediatrics, Case Western Reserve University, which permits unrestricted use, distribution, and Cleveland Ohio, USA reproduction in any medium, provided the original 5Department of Medicine, Case Western Reserve University, and Louis Stokes VA Cleveland Medical author and source are credited. Center, USA 6Departments of Pediatrics and Genetics Genome Sciences, Case Western Reserve University, Cleveland Ohio, USA *Corresponding author: Rebecca Darrah, Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA, Tel: 216-368-4911; E-mail: [email protected] Abstract Chronic pulmonary disease and infection is the primary cause of morbidity and mortality in people with cystic fibrosis (CF).
    [Show full text]
  • Bordetella Petrii Clinical Isolate Isolates of This Species Have Been Previously Reported from 4
    routine laboratory protocols. Initial susceptibility testing Bordetella petrii using disk diffusion indicated apparent susceptibility of the isolate to erythromycin, gentamicin, ceftriaxone, and Clinical Isolate piperacillin/tazobactam. The isolate was resistant to amox- icillin, co-amoxiclav, tetracycline, clindamycin, ciproflo- Norman K. Fry,* John Duncan,* Henry Malnick,* xacin, and metronidazole. After initial sensitivity results, a Marina Warner,* Andrew J. Smith,† 6-week course of oral clarithromycin (500 mg, 8 hourly) Margaret S. Jackson,† and Ashraf Ayoub† was begun. We describe the first clinical isolate of Bordetella petrii At follow-up appointments 3 months and 6 months from a patient with mandibular osteomyelitis. The only pre- after antimicrobial drug therapy ceased, clinical and radi- viously documented isolation of B. petrii occurred after the ographic findings were not unusual, and the infected area initial culture of a single strain from an environmental healed successfully. Despite the successful clinical out- source. come, the isolate was subsequently shown to be resistant to clarithromycin in vitro (Table). Improvement of the 67-year-old man visited an emergency dental clinic, osteomyelitis may also have been facilitated by the biopsy Awhere he complained of toothache in the lower right procedure, during which a sequestrum of bone was mandibular quadrant. Examination showed a root-filled removed. lower right canine tooth that was mobile and tender to per- The gram-negative bacillus (designated strain cussion. The tooth was extracted uneventfully under local GDH030510) was submitted to the Health Protection anesthesia. The patient returned after several days with Agency, Centre for Infections, London, for identification. pain at the extraction site. A localized alveolar osteitis was Preliminary tests results were consistent with those diagnosed, and local debridement measures were institut- described for members of the genus Bordetella.
    [Show full text]
  • Vitek®2 Id & Ast Cards
    ® VITEK 2 ID & AST CARDS Reliable • safe • rapid RESULTS YOU CAN TRUST FOCUS The VITEK 2 ADVANCED EXPERT SYSTEM™ software lets you focus your time where it is most required in ® the lab. The ADVANCED EXPERT SYSTEM™ validates VITEK 2 ID & AST CARDS ON WHAT every result and quickly identi es those truly needing a Microbiologist’s valuable time and attention. This allows the majority of results to be quickly and con dently reported to clinicians without need for MATTERS 2,8,11,13,15 review Rapid, Flexible, E cient EFFICIENCY THROUGH AUTOMATION VITEK 2 cards o er the shortest preparation time in the industry, considerably reducing labor Each self-contained, costs1,3,7,9,10,14. They also have the least contaminated waste, o ering up to 64% cost savings for disposal disposable test card compared to other systems6,10,12.The cards provide provides rapid and INNOVATIVE AND FLEXIBLE DESIGN increased standardization and automated, same-day accurate species- results helping clinicians to optimise antibiotic level identi cation or • Each card contains microwells with biochemicals or antimicrobials therapy sooner2,3. susceptibility results with • Ready and simple to use accurate MICs* based on • Pre-applied barcodes for maximum traceability • EUCAST and CLSI compliant AST formulations available Designed for VITEK 2 automated systems, VITEK 2 reference CLSI** and identi cation (ID) and susceptibility (AST) cards provide ISO *** MIC methods UP TO 50% FEWER PREPARATION STEPS THAN and EUCAST****, OTHER SYSTEMS,3,9,10: reliable and accurate results for clinically important US FDA*****, bacteria and yeasts1,2,4,5 or CLSI® breakpoint • Inoculation with a simple, standardised suspension of organism in saline interpretations1,3,4,5,7,8,10.
    [Show full text]
  • The Fate of Microcystins in the Environment and Challenges for Monitoring
    Toxins 2014, 6, 3354-3387; doi:10.3390/toxins6123354 OPEN ACCESS toxins ISSN 2072-6651 www.mdpi.com/journal/toxins Review The Fate of Microcystins in the Environment and Challenges for Monitoring Justine R. Schmidt 1,*, Steven W. Wilhelm 2 and Gregory L. Boyer 1 1 Department of Chemistry, College of Environmental Science and Forestry, State University of New York, Syracuse, NY 13210, USA; E-Mail: [email protected] 2 Department of Microbiology, University of Tennessee, Knoxville, TN 37996-0845, USA; E-Mail: [email protected] * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +1-315-470-6844; Fax: +1-315-470-6856. External Editor: Lesley V. D'Anglada Received: 1 November 2014; in revised form: 29 November 2014 / Accepted: 5 December 2014 / Published: 12 December 2014 Abstract: Microcystins are secondary metabolites produced by cyanobacteria that act as hepatotoxins in higher organisms. These toxins can be altered through abiotic processes, such as photodegradation and adsorption, as well as through biological processes via metabolism and bacterial degradation. Some species of bacteria can degrade microcystins, and many other organisms metabolize microcystins into a series of conjugated products. There are toxicokinetic models used to examine microcystin uptake and elimination, which can be difficult to compare due to differences in compartmentalization and speciation. Metabolites of microcystins are formed as a detoxification mechanism, and little is known about how quickly these metabolites are formed. In summary, microcystins can undergo abiotic and biotic processes that alter the toxicity and structure of the microcystin molecule. The environmental impact and toxicity of these alterations and the metabolism of microcystins remains uncertain, making it difficult to establish guidelines for human health.
    [Show full text]
  • Which Organisms Are Used for Anti-Biofouling Studies
    Table S1. Semi-systematic review raw data answering: Which organisms are used for anti-biofouling studies? Antifoulant Method Organism(s) Model Bacteria Type of Biofilm Source (Y if mentioned) Detection Method composite membranes E. coli ATCC25922 Y LIVE/DEAD baclight [1] stain S. aureus ATCC255923 composite membranes E. coli ATCC25922 Y colony counting [2] S. aureus RSKK 1009 graphene oxide Saccharomycetes colony counting [3] methyl p-hydroxybenzoate L. monocytogenes [4] potassium sorbate P. putida Y. enterocolitica A. hydrophila composite membranes E. coli Y FESEM [5] (unspecified/unique sample type) S. aureus (unspecified/unique sample type) K. pneumonia ATCC13883 P. aeruginosa BAA-1744 composite membranes E. coli Y SEM [6] (unspecified/unique sample type) S. aureus (unspecified/unique sample type) graphene oxide E. coli ATCC25922 Y colony counting [7] S. aureus ATCC9144 P. aeruginosa ATCCPAO1 composite membranes E. coli Y measuring flux [8] (unspecified/unique sample type) graphene oxide E. coli Y colony counting [9] (unspecified/unique SEM sample type) LIVE/DEAD baclight S. aureus stain (unspecified/unique sample type) modified membrane P. aeruginosa P60 Y DAPI [10] Bacillus sp. G-84 LIVE/DEAD baclight stain bacteriophages E. coli (K12) Y measuring flux [11] ATCC11303-B4 quorum quenching P. aeruginosa KCTC LIVE/DEAD baclight [12] 2513 stain modified membrane E. coli colony counting [13] (unspecified/unique colony counting sample type) measuring flux S. aureus (unspecified/unique sample type) modified membrane E. coli BW26437 Y measuring flux [14] graphene oxide Klebsiella colony counting [15] (unspecified/unique sample type) P. aeruginosa (unspecified/unique sample type) graphene oxide P. aeruginosa measuring flux [16] (unspecified/unique sample type) composite membranes E.
    [Show full text]
  • Table S5. the Information of the Bacteria Annotated in the Soil Community at Species Level
    Table S5. The information of the bacteria annotated in the soil community at species level No. Phylum Class Order Family Genus Species The number of contigs Abundance(%) 1 Firmicutes Bacilli Bacillales Bacillaceae Bacillus Bacillus cereus 1749 5.145782459 2 Bacteroidetes Cytophagia Cytophagales Hymenobacteraceae Hymenobacter Hymenobacter sedentarius 1538 4.52499338 3 Gemmatimonadetes Gemmatimonadetes Gemmatimonadales Gemmatimonadaceae Gemmatirosa Gemmatirosa kalamazoonesis 1020 3.000970902 4 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas indica 797 2.344876284 5 Firmicutes Bacilli Lactobacillales Streptococcaceae Lactococcus Lactococcus piscium 542 1.594633558 6 Actinobacteria Thermoleophilia Solirubrobacterales Conexibacteraceae Conexibacter Conexibacter woesei 471 1.385742446 7 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas taxi 430 1.265115184 8 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas wittichii 388 1.141545794 9 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas sp. FARSPH 298 0.876754244 10 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sorangium cellulosum 260 0.764953367 11 Proteobacteria Deltaproteobacteria Myxococcales Polyangiaceae Sorangium Sphingomonas sp. Cra20 260 0.764953367 12 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas panacis 252 0.741416341
    [Show full text]
  • Insights Into the Pathogenicity of Burkholderia Pseudomallei
    REVIEWS Melioidosis: insights into the pathogenicity of Burkholderia pseudomallei W. Joost Wiersinga*, Tom van der Poll*, Nicholas J. White‡§, Nicholas P. Day‡§ and Sharon J. Peacock‡§ Abstract | Burkholderia pseudomallei is a potential bioterror agent and the causative agent of melioidosis, a severe disease that is endemic in areas of Southeast Asia and Northern Australia. Infection is often associated with bacterial dissemination to distant sites, and there are many possible disease manifestations, with melioidosis septic shock being the most severe. Eradication of the organism following infection is difficult, with a slow fever-clearance time, the need for prolonged antibiotic therapy and a high rate of relapse if therapy is not completed. Mortality from melioidosis septic shock remains high despite appropriate antimicrobial therapy. Prevention of disease and a reduction in mortality and the rate of relapse are priority areas for future research efforts. Studying how the disease is acquired and the host–pathogen interactions involved will underpin these efforts; this review presents an overview of current knowledge in these areas, highlighting key topics for evaluation. Melioidosis is a serious disease caused by the aerobic, rifamycins, colistin and aminoglycosides), but is usually Gram-negative soil-dwelling bacillus Burkholderia pseu- susceptible to amoxicillin-clavulanate, chloramphenicol, domallei and is most common in Southeast Asia and doxycycline, trimethoprim-sulphamethoxazole, ureido- Northern Australia. Melioidosis is responsible for 20% of penicillins, ceftazidime and carbapenems2,4. Treatment all community-acquired septicaemias and 40% of sepsis- is required for 20 weeks and is divided into intravenous related mortality in northeast Thailand. Reported cases are and oral phases2,4. Initial intravenous therapy is given likely to represent ‘the tip of the iceberg’1,2, as confirmation for 10–14 days; ceftazidime or a carbapenem are the of disease depends on bacterial isolation, a technique that drugs of choice.
    [Show full text]
  • Genome Diversification in Globally Distributed Novel Marine
    bioRxiv preprint doi: https://doi.org/10.1101/814418; this version posted October 22, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Genome diversification in globally distributed novel 2 marine Proteobacteria is linked to environmental adaptation 3 4 Authors: Zhichao Zhou1, Patricia Q. Tran1, 2, Kristopher Kieft1, Karthik Anantharaman1* 5 6 7 Affiliations: 8 1Department of Bacteriology, University of Wisconsin–Madison, Madison, WI, 53706, USA 9 2Department of Integrative Biology, University of Wisconsin–Madison, Madison, WI 53706, 10 USA 11 12 13 *Corresponding author 14 Email: [email protected] 15 Address: 4550 Microbial Sciences Building, 1550 Linden Dr., Madison, WI, 53706 16 17 Abstract 18 Proteobacteria constitute the most diverse and abundant group of microbes on Earth. In 19 productive marine environments like deep-sea hydrothermal systems, Proteobacteria have been 20 implicated in autotrophy coupled to sulfur, methane, and hydrogen oxidation, sulfate reduction, 21 and denitrification. Beyond chemoautotrophy, little is known about the ecological significance 22 of novel Proteobacteria that are globally distributed and active in hydrothermal systems. Here 23 we apply multi-omics to characterize 51 metagenome-assembled genomes from three 24 hydrothermal vent plumes in the Pacific and Atlantic Oceans that are affiliated with nine novel 25 Proteobacteria lineages. Metabolic analyses revealed these organisms to contain a diverse 26 functional repertoire including chemolithotrophic ability to utilize sulfur and C1 compounds, 27 and chemoorganotrophic ability to utilize environment-derived fatty acids, aromatics, 28 carbohydrates, and peptides.
    [Show full text]
  • Identification of Bordetella Spp. in Respiratory Specimens From
    504 Clinical Microbiology and Infection, Volume 14 Number 5, May 2008 isolates of extended-spectrum-beta-lactamase-producing Original Submission: 27 October 2007; Revised Sub- Shigella sonnei. Ann Trop Med Parasitol 2007; 101: 511–517. mission: 5 December 2007; Accepted: 19 December 21. Rice LB. Controlling antibiotic resistance in the ICU: 2007 different bacteria, different strategies. Cleve Clin J Med 2003; 70: 793–800. Clin Microbiol Infect 2008; 14: 504–506 22. Boyd DA, Tyler S, Christianson S et al. Complete nucleo- 10.1111/j.1469-0691.2008.01968.x tide sequence of a 92-kilobase plasmid harbouring the CTX-M-15 extended spectrum b-lactamase involved in an outbreak in long-term-care facilities in Toronto, Canada. Cystic fibrosis (CF) is an autosomal recessive Antimicrob Agents Chemother 2004; 48: 3758–3764. disease, characterised by defective chloride ion channels that result in multi-organ dysfunction, most notably affecting the respiratory tract. The RESEARCH NOTE alteration in the pulmonary environment is asso- ciated with increased susceptibility to bacterial infection. Recent advances in bacterial taxonomy and improved microbial identification systems Identification of Bordetella spp. in have led to an increasing recognition of the respiratory specimens from individuals diversity of bacterial species involved in CF lung with cystic fibrosis infection. Many such species are opportunistic T. Spilker, A. A. Liwienski and J. J. LiPuma human pathogens, some of which are rarely found in other human infections [1]. Processing Department of Pediatrics and Communicable of CF respiratory cultures therefore employs Diseases, University of Michigan Medical selective media and focuses on detection of School, Ann Arbor, MI, USA uncommon human pathogens.
    [Show full text]