www.nature.com/scientificreports

OPEN Developing a genetic manipulation system for the Antarctic archaeon, Halorubrum lacusprofundi: received: 27 May 2016 accepted: 16 September 2016 investigating acetamidase gene Published: 06 October 2016 function Y. Liao1, T. J. Williams1, J. C. Walsh2,3, M. Ji1, A. Poljak4, P. M. G. Curmi2, I. G. Duggin3 & R. Cavicchioli1

No systems have been reported for genetic manipulation of cold-adapted Archaea. Halorubrum lacusprofundi is an important member of Deep Lake, Antarctica (~10% of the population), and is amendable to laboratory cultivation. Here we report the development of a shuttle-vector and targeted gene-knockout system for this species. To investigate the function of acetamidase/formamidase genes, a class of genes not experimentally studied in Archaea, the acetamidase gene, amd3, was disrupted. The wild-type grew on acetamide as a sole source of carbon and nitrogen, but the mutant did not. Acetamidase/formamidase genes were found to form three distinct clades within a broad distribution of Archaea and Bacteria. Genes were present within lineages characterized by aerobic growth in low nutrient environments (e.g. haloarchaea, Starkeya) but absent from lineages containing anaerobes or facultative anaerobes (e.g. methanogens, Epsilonproteobacteria) or parasites of animals and plants (e.g. Chlamydiae). While acetamide is not a well characterized natural substrate, the build-up of plastic pollutants in the environment provides a potential source of introduced acetamide. In view of the extent and pattern of distribution of acetamidase/formamidase sequences within Archaea and Bacteria, we speculate that acetamide from plastics may promote the selection of amd/fmd genes in an increasing number of environmental microorganisms.

The coldest lake known to support microbial growth is Deep Lake in Antarctica where temperatures drop to −​20 °C1. Liquid water remains at these temperatures because the lake is hypersaline (~10×​ marine salinity). It is a closed, isolated marine-derived system that separated from the Southern Ocean ~3,500 years ago2. Genomic, metagenomic and metaproteomic studies have revealed that the lake community has a number of remarkable features: a low complexity community of haloarchaea that support a high level of community wide, intergenera gene exchange2; genome variation and niche adaptation occurring at the level of genera and strains2–4; virus-host interactions involving invasion, evasion and adaptation strategies5. The three most abundant members that repre- sent ~72% of the entire lake community have been cultivated and their genome sequences determined: Halohasta litchfieldiae (~44%), DL31 (an undescribed genus; ~18%) and Halorubrum lacusprofundi (~10%)2. An additional species which represents a minor fraction of the lake community has also been isolated and sequenced: DL1 (Halobacterium sp.; ~0.3%)2. By being able to cultivate the abundant members (representing about three-quarters of the lake’s cellular population), the Deep Lake system is unusual compared to most environmental systems where typically <​1% can be isolated and grown as axenic cultures in the laboratory6. Hrr. lacusprofundi is the most readily isolated species, typically representing the majority of isolates forming colonies on plates from Deep Lake, and was the first psychrophilic member of theArchaea formally described7,8.

1School of Biotechnology and Biomolecular Sciences, The University of New South Wales, Sydney, New South Wales, 2052, Australia. 2School of Physics, The University of New South Wales, Sydney, New South Wales, 2052, Australia. 3The ithree institute, University of Technology Sydney, Broadway, New South Wales, 2007, Australia. 4Bioanalytical Mass Spectrometry Facility, The University of New South Wales, Sydney, New South Wales, Australia. Correspondence and requests for materials should be addressed to R.C. (email: [email protected])

Scientific Reports | 6:34639 | DOI: 10.1038/srep34639 1 www.nature.com/scientificreports/

Figure 1. Plasmid maps of pJWID1 and pJWID1_amd3. (A) The E. coli-haloarchaea shuttle plasmid pJWID1 is based on pIDJL4039,40 which contains the SmRS-GFP gene under the control of the tryptophan-regulated p.tnaA promoter, and the selection markers bla (ampicillin resistance in E. coli), pyrE2 (for selection in pyrimidine auxotrophs) and hdrB (thymidine auxotrophy in rich media). pJWID1 has the additional selection marker, hmgA (resistance to statins including pravastatin). In pJWID1_amd3 the amd3 gene was inserted at the NdeI and EcoRI sites of pJWID1. (B) Expanded view of the cloning sites in the region containing the p.tnaA promoter and GFP gene.

In addition to the studies described above, Hrr. lacusprofundi has been the subject of genomic9–13, protein14–16, membrane lipid17, and physiological18–20 studies. To date, Methanococcoides burtonii (isolated from Ace Lake in the same region of Antarctica)21 has served as the main model for examining cold adaptation of Archaea22,23. However, M. burtonii is not readily cultivated on plates and a genetic system for it has not been developed. The development of genetic manipulation sys- tems for Archaea has greatly facilitated understanding of their molecular biology8,24. Transformation systems for haloarchaea were developed in the late 1980s25, largely built around the well-studied species, Haloferax vol- canii and Halobacterium salinarum26–29, leading to the development of molecular genetic tools including selecta- ble markers27,30–33, shuttle vectors30,34–40, reporter constructs41–44, overexpression systems40, and gene knockout systems28,29,31,32. Antibiotics and resistance genes for Archaea are different to those for Bacteria but can have parallels with those from Eucarya. Mevinolin, which is derived from the fungus Aspergillus, inhibits 3-hydroxy-3-methylglutaryl coenzyme A reductase (HmgA), which is an essential enzyme in the synthesis of isoprenoid lipids in Archaea. An overexpression mutant of this gene from Hfx. volcanii provides resistance to mevinolin38,45. In humans, choles- terol is produced from the mevalonate pathway and statins that target HmgA are used for controlling cholesterol levels. In haloarchaea, overexpression of the gene that encodes HmgA (hmgA) can also provide resistance to the statins fluvastatin, simvastatin and pravastatin33. In this study we aimed to develop a system for genetic manipulation of Hrr. lacusprofundi ACAM34. We targeted an acetamidase/formamidase (amd/fmd) gene because they have not been experimentally characterized in Archaea. Hrr. lacusprofundi encodes three amd/fmd genes sharing 29–42% identity, and here we define them as amd1 (Hlac_1866), amd2 (Hlac_2016) and amd3 (Hlac_2285). In recent proteomic studies of Hrr. lacuspro- fundi ACAM34, amd3 was identified as an abundant protein under a variety of growth conditions (Liao Y and Cavicchioli R, unpublished results). Amd/Fmd enzymes catalyze a single-step reaction (hydrolysis of acetamide or formamide) for which substrate (acetamide or formamide) is readily commercially available. We reasoned that a gene knockout would be unlikely to be lethal as the enzyme does not function in central metabolism, and the gene appears to be mono-cistronic, thereby reducing the likelihood of gene inactivation generating polar effects. Our study describes the development of transformation, construction of a shuttle-vector, disruption and phenotypic characterization of an amd3 mutant, and discusses the ecological and evolutionary significance of the findings. Results Plasmid construction. TheHfx. volcanii-Escherichia coli shuttle vector pIDJL4039,40 encodes the ColE1 ori- gin of replication and bla gene for ampicillin selection in E. coli, and the Hfx. volcanii pHV2 origin of replication and pyrE2 for selection in pyrimidine auxotrophs and hdrB gene for selection using thymidine auxotrophy in rich media. It also harbors a soluble-modified red-shifted green fluorescent protein (smRS-GFP) under the con- trol of the tryptophan-inducible promoter from the tnaA gene of Hfx. volcanii (p.tnaA) that is flanked by the Hfx. volcanii L11e ribosomal protein gene terminator (t.L11e) and a synthetic terminator (t.Syn) comprising a T track flanked by G/C-rich sequences. In order to construct a plasmid that conferred resistance to statin drugs, pJWID1 was constructed by cloning the up-regulated mutant of the hmgA gene from Hfx. volcanii33 into pIDJL40 (see Methods and Fig. 1). Strains and plasmids used in this study are listed in Table 1, and PCR primers in Table S1.

Scientific Reports | 6:34639 | DOI: 10.1038/srep34639 2 www.nature.com/scientificreports/

Strain or plasmid Relevant properties Reference or source Plasmids pBluescript II with BamHI-Xbal I fragment from pGB70 pTA131 31 containing pfdx-pyrE2; bla (AmpR) pIDJL40 gfp-fusion expression vector derived from pTA962 39, 40 Shuttle vector derived from pTA962 with pyrE2, hdrB, hmgA, bla, pJWID1 This study SmRS-GFP and pHV2 origin of replication pTA131 with EcoRI-NotI fragment containing hmgA and amd3 pTA131_Δamd3 This study flanking regions for gene inactivation pJWID1_amd3 pJWID1 with NdeI-EcoRI fragment containing amd3 This study Strains New England Biolabs, E. coli c2925 dam, dcm strain; used for preparing unmethylated plasmid DNA C2925I Hfx. volcanii DS2 Source of hmgA gene 33 Hrr. lacusprofundi ACAM34 Wild-type 7 Hrr. lacusprofundi Δ​amd3 Hrr. lacusprofundi ACAM34 with amd3 gene disruption This study

Table 1. Strains and plasmids.

Development of DNA transformation protocol for Hrr. lacusprofundi. In the initial testing phases for developing transformation, minimal inhibitory concentrations of novobiocin (0.05 μ​g mL−1), mevinolin (0.01 μ​g mL−1), simvastatin (0.005 μ​g mL−1), fluvastatin (0.05 μ​g mL−1) and pravastatin (1 μ​g mL−1) were deter- mined and competent cells prepared using a PEG-based procedure26. Initially, the shuttle vectors pJAM20235 and pCBD-sec11b37 were tested, which confer novobiocin resistance from the Haloferax strain Aa2.2 gyrB gene34, but transformants of Hrr. lacusprofundi were not obtained. Success was achieved using PEG-mediated transformation and selection of pJWID1 using 2.5 μ​g mL−1 pravastatin, with clear differences in resistance observed between transformed (up to 20 μ​g mL−1) and untransformed cells (Fig. S1). While the hmgA gene can confer resistance to mevinolin, simvastatin and fluvastatin in Hfx. volcanii33, effective resistance was only observed for pravastatin in Hrr. lacusprofundi. The plasmid was prepared in an E. coli dam dcm strain because plasmid methylation was reported to sig- nificantly reduce transformation efficiency in Hfx. volcanii46. Transformation efficiency of Hrr. lacusprofundi increased from 1 ng to 1 μ​g of DNA with the highest efficiency of ~9 ×​ 107 transformants per μ​g obtained using 1 μ​g of pJWID1 (Fig. S2), an efficiency that is similar to transformation of Haloferax strain Aa 2.2 with the novo- biocin resistance plasmid, pHK230. Using 10 μ​g of DNA, the total number of transformants was similar to using 1 μ​g, translating to ~10-fold decrease in efficiency per μ​g (Fig. S2). The data indicate there is no benefit to using more than 1 μg​ of intact plasmid DNA for transforming Hrr. lacusprofundi. Pravastatin resistant colonies were not observed if plasmid DNA was omitted, and the transformation procedure which uses EDTA and PEG600 did not reduce cell viability (data not shown). Plasmid stability was tested by growing transformed cells in liquid medium without antibiotic, plating cells on solid medium in the absence of antibiotic, and assessing the ability of the cells to grow on pravastatin (2.5 μg​ mL−1) containing plates (Fig. S3). All colonies tested (total 50) were sensitive, indicat- ing the plasmid was readily cured. The relative ease of curing provides potential benefit for experiments requiring plasmid loss. The plasmid was also effectively maintained in strains in the presence of pravastatin (2.5 μg​ mL−1).

GFP expression from pJWID1. The smRS-GFP gene is under the control of the p.tnaA promoter but the coding sequence is out of frame with the expected start codon (within NdeI) in Hfx. volcanii (Fig. 1)39. The fact that GFP expression occurs (Fig. 2, Fig. S4) demonstrates that the translation machinery in Hrr. lacusprofundi is able to recognize and initiate translation of the GFP ORF in pJWID1. Moreover, expression levels increased with tryptophan concentration (1–3 mM) demonstrating that tryptophan induction also functioned effectively in Hrr. lacusprofundi. This pattern of expression occurred throughout the growth phase from mid-log to mid-stationary phase (data not shown). Expression of GFP was sufficient to readily enable fluorescence microscopy observation of cells (Fig. S4) and quantification of GFP using a fluorescence scanner (Fig. 2). The ability to detect GFP fluo- rescence in Hrr. lacusprofundi provides the potential for constructing reporter-fusions, tracking plasmid transfer, and performing flow activated cell sorting and GFP-fusion, protein localization experiments (also see Plasmid expression of amd3 below).

Construction of gene knockouts using plasmid-mediated, gene inactivation. The hmgA gene conferring pravastatin resistance was the only effective antibiotic selection marker we identified (see Development of DNA transformation protocol for Hrr. lacusprofundi above). To construct a gene knock- out, we initially considered developing a pop-in, pop-out approach that uses pyrE auxotrophs32. Hrr. lacuspro- fundi possesses one orotate phosphoribosyltransferase, pyrE gene (Hlac_0584). However, spontaneous pyrE mutants were not isolated following the passaging of cells through increasing concentrations (200–500 μ​g mL−1) of 5-fluoroorotic acid (1–2.5-fold above the minimum inhibitory concentration) in the presence of uracil (50 μg​ mL−1). The approach was therefore abandoned in favor of a strategy that used a suicide plasmid32 and gene exchange with an hmgA inactivated amd3 gene. To inactivate the amd3 gene, plasmid pTA131_Δ​amd3 was constructed by cloning the amd3 gene that was inactivated by the insertion of the hmgA gene, into pTA13131(see Methods). Pravastatin resistant (2.5 μ​g mL−1)

Scientific Reports | 6:34639 | DOI: 10.1038/srep34639 3 www.nature.com/scientificreports/

Figure 2. Tryptophan induction of GFP expression from pJWID1 in Hrr. lacusprofundi. Quantitative measurement of fluorescence emission in response to 0, 1, 2 and 3 mM tryptophan induction. GFP expression levels of Hrr. lacusprofundi harboring plasmid pJWID1 increased with tryptophan concentration. The fluorescence is given in light absorbance units per mm2 [(LAU-BG)/mm2]. Error bars represent standard error of three replicate cultures.

colonies of Hrr. lacusprofundi arising from transformation of pTA131_Δ​amd3 can arise from a single recom- bination event leading to plasmid integration, or a double recombination event leading to exchange of the wild-type gene for the disrupted gene (Fig. 3A). Genomic DNA extracted from 10 pravastatin resistant colonies was screened by PCR to discriminate between single and double recombination events (see Methods). Two trans- formants gave a single band using P3 primers, and no product using P1, P2 and P4 primers (Fig. 3B, Fig. S5), which was diagnostic for a double recombination event. The single band (Fig. 3B) matched the size of the product expected for P3 primers (1193 bp), and analysis of the DNA sequence of the PCR product for each of the two transformants confirmed the presence of the hmgA gene within amd3. One of the two strains was designated Hrr. lacusprofundi Δ​amd3. The frequency of achieving double recombination (2/10 clones) is similar to that previously achieved in Hfx. volcanii for the construction of a pyrE gene disruption (6/16 clones)32.

Assessment of the phenotype conferred by amd3. To assess the function of amd3, the wild-type and mutant were grown in media containing various amide substrates (acetamide, formamide, glutamine, aspar- agine, nicotinamide, urea) and growth assessed using these compounds as a sole carbon, nitrogen, or carbon and nitrogen source in defined media (Fig. 4). The wild-type grew using 10 mM acetamide as a sole source of nitrogen (with 10 mM pyruvate as the carbon source; Fig. 4A), sole source of carbon (with 5 mM ammonium as the nitrogen source; Fig. 4B), or as the sole source of both carbon and nitrogen (10 mM acetamide only; Fig. 4C). In contrast, under the same conditions the mutant was unable to grow (Fig. 4A–C). The phenotypic distinctions between wild-type and mutant were marked, and the results indicate that amd3 is a functional acetamidase gene that enables Hrr. lacusprofundi to grow on acetamide. Growth using 10 mM formamide demonstrated formamide could be used by Hrr. lacusprofundi as a sole source of nitrogen (Fig. 4D), but not as a sole source of carbon (data not shown). The Δ​amd3 mutant was also capable of growth with formamide as a sole source of nitrogen (Fig. 4D). The growth of the mutant lagged behind the wild-type indicating that Amd3 had activity on formamide but Hrr. lacusprofundi possessed other amidases (possibly Amd1 and/or Amd2) that also functioned as a formamidase to enable cells to grow. Although urea did not support growth of the wild-type or mutant (data not shown), nicotinamide, glutamine or asparagine did support growth as a sole source of nitrogen (Fig. 4E–G). Hrr. lacusprofundi was not capable of growth using nicotinamide or asparagine as a sole source of carbon (data not shown), but both the wild-type and mutant did grow with glutamine as a sole source of carbon, or as a sole source of both carbon and nitrogen (Fig. 4H,I), albeit more slowly than growth on acetamide (Fig. 4C). However, unlike growth on formamide, for nicotinamide, glutamine or asparagine, the growth of the mutant was superior to the wild-type, indicating dis- ruption of amd3 had pleiotropic effects. It is not apparent why inactivation of amd3 would lead to better growth on these substrates. This could possibly occur if Amd3 (in the wild-type strain) produces a metabolite that nega- tively effects (e.g. allosteric) the regulation of gene expression or activity of the enzymes involved in catabolizing nicotinamide, glutamine, and asparagine.

Plasmid expression of amd3. Theamd3 gene was cloned in pJWID1 to construct pJWID1_amd3 (Fig. 1). The amd3 gene was cloned from start codon to stop codon downstream of the p.tnaA promoter with the open reading frame terminating prior to the beginning of the GFP open reading frame (i.e. not a translational fusion). Tryptophan (3 mM) was used to induce p.tnaA-mediated amd3 expression in Hrr. lacusprofundi. Tryptophan could not support growth as carbon (with 5 mM ammonium as nitrogen), nitrogen (with 10 mM pyruvate as carbon) or sole source of carbon and nitrogen (data not shown). GFP was expressed from this plasmid although

Scientific Reports | 6:34639 | DOI: 10.1038/srep34639 4 www.nature.com/scientificreports/

Figure 3. Construction of amd3 gene disruption. (A) Pravastatin resistant cells arising from the transformation of pTA131_Δ​amd3 into wild-type Hrr. lacusprofundi can occur due to a single (plasmid insertion) or double (gene replacement) recombination event. Only the double recombination event produces a defective amd3 gene. Four groups of primers (P1, P2, P3 and P4) were used to determine if single or double recombination events occurred. The region denoted amd3_down corresponds to a 950 bp fragment containing the last 214 bp of amd3 and 736 bp of the downstream sequence, and the region denoted amd3_up corresponds to a 970 bp DNA fragment containing 225 bp of the 5′​ coding region of amd3 and 745 bp of the upstream sequence (see Methods). In the section showing double recombination, the gene structure and diagnostic primers are shown for the amd3 disruption (Δ​amd3) and wild-type strain (WT). (B) A PCR product (1193 bp; left gel image) using the P3 primers was diagnostic of a double recombination event, whereas a PCR product (1423 bp; right gel image) using P4 primers was diagnostic of the wild-type genes being present. (A,B) Lane M, 1 kb DNA ladder; Lane N, no DNA (negative control); Lane WT, untransformed Hrr. lacusprofundi; Lane C1– C2, two strains with double recombination events. C2 was chosen as the Hrr. lacusprofundi Δ​amd3 strain. The results of other primer sets for C1 and C2 are show in Fig. S5.

fluorescence levels were lower than for pJWID1 (Fig. S6). Background fluorescence in the absence of tryptophan was also observed for both pJWID1 and pJWID1_amd3, although again it was lower for pJWID1_amd3 (Fig. S6). The data indicate that in the absence of tryptophan, expression from p.tnaA is not completely repressed in Hrr. lacusprofundi (i.e. somewhat leaky expression), and GFP expression can co-occur with expression of cloned genes in pJWID1. To assess the effects of increased gene copies and/or gene expression of amd3 on the ability to utilize acetamide, growth was compared between wild-type Hrr. lacusprofundi harbouring either pJWID1 or pJWID1_amd3 (Fig. 5). Enhanced growth was observed with pJWID1_amd3, particularly when acetamide was the sole carbon or sole carbon and nitrogen source (Fig. 5).

Scientific Reports | 6:34639 | DOI: 10.1038/srep34639 5 www.nature.com/scientificreports/

Figure 4. Phenotypic characterization of Hrr. lacusprofundi ACAM34 wild-type and Δamd3 mutant strains. Growth of wild-type (full symbols) and Δ​amd3 mutant (open symbols) on (A) 10 mM pyruvate and 10 mM acetamide; (B) 5 mM ammonium and 10 mM acetamide; (C) 10 mM acetamide; (D) 10 mM pyruvate and 10 mM formamide; (E) 10 mM pyruvate and 10 mM nicotinamide; (F) 10 mM pyruvate and 10 mM glutamine; (G) 10 mM pyruvate and 10 mM asparagine; (H) 5 mM ammonium and 10 mM glutamine; (I) 10 mM glutamine. Error bars represent standard error of three replicate cultures.

Acetamidase enzyme activity. Acetamidase enzyme activity was determined (in triplicate) for the wild-type and Δ​amd3 mutant grown in media containing acetamide plus pyruvate and ammonium (to support growth of the mutant), and wild-type cells harbouring pJWID1 or pJWID1_amd3 grown with acetamide as the sole source of carbon and nitrogen. Activity for the Δamd3​ mutant was very low (0.04 ±​ 0.01 U mg−1) compared to the wild-type (18.1 ±​ 0.4 U mg−1), and somewhat higher for cells harbouring pJWID1_amd3 (28.6 ±​ 0.5 U mg−1) compared to pJWID1 (23.8 ±​ 0.1 U mg−1). These enzyme activity data are consistent with the inability of the Δ​amd3 mutant to utilize acetamide for growth (Fig. 4A–C), and pJWID1_amd3 enhancing the ability of the wild-type strain to grow on acetamide (Fig. 5).

Scientific Reports | 6:34639 | DOI: 10.1038/srep34639 6 www.nature.com/scientificreports/

Figure 5. Growth of Hrr. lacusprofundi wild-type harboring pJWID1 or pJWID1_amd3. Growth of Hrr. lacusprofundi harboring pJWID1 (open symbols) or pJWID1_amd3 (closed symbols) with (A) acetamide as the sole source of carbon; (B) acetamide as the sole source of carbon and nitrogen. Error bars represent the standard error of three replicate cultures.

Characterization of Amd/Fmd sequences in Archaea and Bacteria. To identify Amd/Fmd sequences, UniProtKB was searched using a word search (see Methods). To validate the approach, randomly sampled sequences from the word search were used in a BLAST search of UniprotKB and cross checked to the original set. From a total of 2500 BLAST matches, only two new sequences were obtained, illustrating the word search was effective at retrieving Amd/Fmd sequences. Sequences were clustered using a 90% identity cutoff (OTU0.9) with clusters containing between one and 291 sequences. The 1323 OTU0.9 manually curated clusters consisted of 139 from Archaea and 1184 from Bacteria (Table S2). For Archaea, sequence diversity was highest in Halobacteria (haloarchaea) with 94 clusters and Thermoprotei (14 clusters), and for Bacteria, sequence diversity was highest in Actinobacteria (329), Alphaproteobacteria (245) and Bacilli (172) (Fig. S7). Phylogenetic analyses were performed using one sequence from each cluster. Three distinct Amd/Fmd clades were apparent in trees constructed using all clusters (Fig. 6A, Fig. S8), or a subsample of equal numbers of archaeal and bacterial sequences (Fig. S9). The clade structure was robust (1000 bootstraps) and the three clades rooted (bootstrap 0.996) to a bacterial origin with archaeal sequence ‘islands’ distributed within bacterial clus- ters. Archaeal sequences were present in each clade, although Clade III consisted almost exclusively of bacterial sequences. Sequences from individual organisms tended to be distributed amongst the clades rather than being confined to a single clade. For the Antarctic haloarchaea, Clade I contained Amd1, Halar_1208, Amd2, Halar_0731 and haltADL_0419; Clade II, Amd3 and Halar_3390; Clade III, haltADL_2650. Amd3 clustered with sequences from an uncultured archaeon and two other haloarchaea (Natronomonas pharaonis and Halopiger xanaduensis) and more distantly to sequences from Clostridia and Bacilli (Fig. S8). Amd1 and Amd2 do not have high sequence identity (42%) and were in subclades of Clade I. The Hht. litchfeldiae Amd/Fmd sequence halTADL_2650 was one of only three archaeal sequences in Clade III, and clustered with sequences from Haloquadratum walsbyi and an unclassified bacterium YEK0303, and more distantly with a Bacillus species (Fig. S8). Closed genomes were used to quantify the representation (including presence/absence) of Amd/Fmd sequences within taxa (Table S3; Fig. 6B). From 215 archaeal genomes, 65 contained Amd/Fmd sequences at an average 1.28 per genome, with 703 for Bacteria at an average 1.40 per genome (Fig. S10). For Archaea, 20 of 30 closed genomes from haloarchaea contained Amd/Fmd sequences, and for those carrying the genes they had the highest average number (1.75) of genes per genome for Archaea (Fig. S10). The archaeal species which con- tained the largest number of Amd/Fmd sequences was Haloarcula marismortui which contained four (Table S4). The genomes of Archaeoglobi, Thaumararchaeota Nanoarchaeota and all the methanogens (Methanobacteria, Methanococci, Methanomicrobia, Methanopyri) did not contain Amd/Fmd sequences (Table S4; Fig. 6B). For Bacteria, Amd/Fmd sequences were present in 402 species representing 225 genera (Table S4). The Bacteria that tended to have Amd/Fmd sequences (≥70%​ of the taxa) were Gemmatimonadetes, Acidobacteria and Thermotogae (Fig. 6B). Starkeya, Modestobacter, Bradyrhizobium, Agromonas and Opitutaceae sp. TAV5 contained ≥5​ Amd/Fmd sequences per genome, with the largest number (8) in Starkeya novella (Table S4). Bacterial genomes that lacked Amd/Fmd sequences were from Epsilonproteobacteria, Tenericutes, Chlamydiae, Fusobacteria, Aquificae and Chlorobi (Fig. 6B, Table S2).

Concentration of acetamide in aquatic samples. In order to assess the likelihood of acetamide serving as an environmental growth substrate, the acetamide concentration was determined in water samples from Deep Lake, hypersaline lakes from the Rauer Islands and the Southern Ocean (see Methods). Acetamide was detected at levels similar to the background levels present in Milli-Q water. The presence of 1–2.5 μ​M acetamide in the controls probably derives from the high-density polyethylene tubes the water samples were stored in. When the standard curve was corrected for background acetamide (Fig. S11), only two ocean samples were above control levels (highest 4.74 μ​M).

Scientific Reports | 6:34639 | DOI: 10.1038/srep34639 7 www.nature.com/scientificreports/

Discussion Here we report the first procedure for performing gene transfer and gene knockouts for a psychrophilic member of the Archaea. Even for psychrophilic bacteria, few systems are available for genetic manipulation47–52. Hrr. lacus- profundi is an important member of the Deep Lake community, representing ~10% of the population throughout the depth of the lake. Because of the relative ease of isolation from environmental samples3, it was the first psy- chrophilic member of the Archaea formally described7,8. Hrr. lacusprofundi is capable of growth in the laboratory at 4 °C, and very slowly at 0 or −​1 °C7,18. Intergenera gene exchange and population level genetic variation is a feature of the Deep Lake community2,3,5. The development of genetic manipulation of strain ACAM34 provides considerable scope for probing mechanisms of adaptation and gene exchange in this species.

Physiological and ecological significance of acetamide. The ability of Hrr. lacusprofundi to utilize acetamide as a sole source of both carbon and nitrogen, but formamide only as a sole source of nitrogen, indicates that cells can utilize ammonium released from either source, but that only acetate and not formate can be used as a carbon source. This is consistent with genomic evidence for Hrr. lacusprofundi, which includes a capacity for acetate assimilation via the glyoxylate cycle3,53, but no evidence for known formate assimilation pathways. This is further corroborated by growth assessments which show that Hrr. lacusprofundi can utilize acetate as a sole source of carbon3,7. The enzyme activity data and pronounced phenotype of the Hrr. lacusprofundi Δ​amd3 strain and relatively fast growth of the wild-type strain on acetamide illustrates that Amd3 functions effectively in substrate conversion and is unlikely to limit ammonium and acetate utilization pathways. Deamidation of formamide may be calatalyzed by an Amd3 homolog; possibly Amd1 and/or Amd2. The Hrr. lacusprofundi genome encodes genes for a putative asparaginase (COG0252: Hlac_2272) and nicotinamidase (COG1335: Hlac_2101, Hlac_2473) for the deamidation of asparagine and nicotinamide, respectively. A gene for glutaminase is not apparent in the Hrr. lacusprofundi genome; but glutamine can be assimilated (via glutamate) using glutamate synthase (GOGAT). Ammonium liberated by amidases can be assimilated via the glutamine synthetase-GOGAT cycle, which is pres- ent in Hrr. lacusprofundi3. The role of amides such as acetamide and formamide as sources of carbon and/or nitrogen has been exam- ined in fungi54, algae55,56 and Bacteria, including species of Pseudomonas and Burkholderia57–59, Alcaligenes60, Nocardia61, and Mycobacterium62. In the marine environment amides have been described as a potential nutri- ent source, and speculated to be derived from photodegradation of dissolved organic matter, from atmospheric input, or as a byproduct of an unspecified degradative metabolic pathway56. Acetamide is known to be gener- ated through the pyrolytic cleavage of N-acetylated biopolymers such as chitin63 and peptidoglycan64, and con- stitutes a dominant N-containing product from the fragmentation of soil organic matter, sewage sludge, and chitin-containing biomass63,65–67. Acetamide is also a byproduct of the catabolism of nitroimidazole antibiotics by bacteria, through the reductive cleavage of the imidazole ring68–70. In the Antarctic environment, acetamide would not be expected to be produced by thermal degradation (such as by fire or volcanic eruptions) of natural biopolymers. Acetamide may be generated endogenously within cells as a transient intermediate from the break- down of natural imidazoles or other compounds. Our analyses found acetamide in water samples approximated relatively high (μ​M) background concentrations. If a pool of acetamide is not maintained in cells (and released during cell lysis), whatever acetamide becomes available in the environment is likely to be rapidly metabolized. In the ocean, dissolved organic carbon (e.g. glucose) and dissolved free amino acids are in the ~1–20 nM range and can have a high flux through the labile pool of nutrients71,72, so if acetamide is metabolized as actively, concentra- tions may not exceed nM levels.

Evolution of the Amd/Fmd sequences in Archaea and Bacteria. Our study appears to be the first to examine the diversity and phylogeny of Amd/Fmd sequences in Archaea and Bacteria. The analyses revealed the presence of three distinct clades of Amd/Fmd sequences which are predicted to originate from Bacteria with sub- sequent dissemination to Archaea (Fig. 6A). Experimental data is available for very few representatives of the tree. Our data for Amd3 indicate that it effectively converts acetamide. The only other experimentally studied enzyme from Cluster II, Uniprot KB ID Q50228 from Methylophilus methylotrophus, has highest activity on formamide and relatively low activity on acetamide, propionamide, butyramide, and acrylamide73,74. The Cluster I enzyme, UniprotKB ID O25836 from Helicobacter pylori, was reported to only catalyze the conversion of formamide75. While limited, the experimental data (particularly for Cluster II) indicate that functional specialization (substrate preference for acetamide vs formamide) has occurred following lineage-specific gene acquisition. The highest number of Amd/Fmd sequences occurs in Bacteria, including Modestobacter multiseptatus, Pseudonocardia dioxanivorans, Agromonas oligotrophica, Bradyrhizobium spp., Opitutaceae sp. and Starkeya novella. Bradyrhizobium spp., A. oligotrophica, M. multiseptatus and S. novella are soil bacteria76–80; P. di ox - anivorans was isolated from industrial sludge81,82; and the putative methylotroph Opitutaceae sp. TAV5 was isolated from the hindgut of a wood-feeding termite83. Gene duplication and specialization may enhance the competitiveness of these bacterial taxa that are capable of growth by scavenging nutrients in low nutrient envi- ronments (especially soil), including growth on single-carbon compounds. While Amd/Fmd sequence distribution is wide-spread in Archaea and Bacteria, specific taxonomic groups lack them. These tend to be anaerobic or facultative anaerobic microorganisms from aquatic or terrestrial envi- ronments (Archaeoglobi, methanogens, Epsilonproteobacteria, Aquificae and Chlorobi) or parasites of animals and plants (Tenericutes, Chlamydiae and Fusobacteria). The only aerobic group lacking Amd/Fmd sequences are Thaumarchaeota which possess an ability to generate energy via ammonia-oxidation84,85. The fact that meth- anogens lack these genes is notable for several reasons. Firstly, many methanogens are capable of growth on single-carbon compounds (CO2, methanol, formate). Secondly, acetamide is a potential source of acetate for acetoclastic methanogens. Thirdly, 76 methanogen genomes are available that represent species from diverse envi- ronments (e.g. deep-sea hydrothermal vents, Antarctic lakes, rice paddies, human and ruminant gastrointestinal

Scientific Reports | 6:34639 | DOI: 10.1038/srep34639 8 www.nature.com/scientificreports/

Figure 6. Diversity distribution and abundance of Amd/Fmd sequences within Archaea and Bacteria. (A) Maximum likelihood tree of Amd/Fmd protein sequence clusters (OTU0.9) showing three distinct clades (Clade 1, green; Clade II, blue; Clade III, red) with the root of the tree (bootstrap value, 0.996) being of bacterial origin. Clusters of archaeal sequences are highlighted (black branches). The Deep Lake haloarchaeal Amd/Fmd sequences (Hrr. lacusprofundi: Amd1, Amd2, Amd3; undescribed genus DL31: Halar_0730, Halar_1208, Halar_3390; Hht. litchfeldiae: halTADL_0419, halTADL_2650) were distributed in Clade I (Amd1, Halar_1208, Amd2, Halar_0731 and haltADL_0419), Clade II (Amd3 and Halar_3390) and Clade III (haltADL_2650). Scale bar represents 1 amino acid variation per aligned position. (B) Neighbour-joining tree of 16S rRNA gene sequences for closed genomes from Archaea and Bacteria which possess Amd/Fmd sequences. 16S rRNA gene sequences represented at class or phylum level. Clades are colored according to the proportion of closed genomes that contain Amd/Fmd sequences. The number of Amd/Fmd sequences relative to total number of closed genomes in a clade is shown in parentheses after the name of the clade. Bacterial clades with less than 10 sequences that do not contain Amd/Fmd sequences are not displayed. The scale bar represents 0.1 changes per base position.

tracts), and some are characterized as supporting a high level of horizontal gene transfer86–88. The lack of Amd/Fmd sequences in methanogens is suggestive of selection against retention of the genes rather than the existence of a barrier to acquiring the genes.

Scientific Reports | 6:34639 | DOI: 10.1038/srep34639 9 www.nature.com/scientificreports/

The Antarctic haloarchaea support a high level of intergenera gene exchange, including long stretches (up to 35kb) of identical DNA2. However, the three dominant genera have distinct metabolisms enabling them to utilize different lake substrates and providing selection for sympatric speciation2–4. The clustering of Amd1 with Halar_1208, and Amd2 and Halar_0731 with haltADL_0419 in Clade I may have arisen from intergenera transfer within the community in Deep Lake. However, the presence of Amd3 and Halar_3390 on distinct branches of Clade II, and halTADL_2650 in Clade III which contains very few archaeal sequences, suggests the genes arose from acquisition and selection for specific enzymatic properties as a means of fulfilling specific physiological function(s). The pattern and extent of distribution of Amd/Fmd sequences within Archaea and Bacteria illustrates the evolutionary significance of the genes. The demonstration that acetamide can sustain microbial growth of Hrr. lacusprofundi as a sole source of carbon and nitrogen, is intriguing, and the sources and concentrations of aceta- mide in the Antarctic environment need to be accurately determined in order to consider the environmental cues controlling the selection of these genes. In industry, acetamide is used as a plasticizer and solvent89,90, and as a component of pesticides91, thereby providing avenues for acetamide to be introduced into the global envi- ronment as an industrial contaminant. Of great concern is the enormous build-up of environmental plastics92–94, as these potentially provide a significant anthropocentric source of acetamide. The selection of genetic vari- ants with new capacities to utilize unnatural substrates has been documented for both atrazine pesticides and poly(ethylene terephthalate) plastics95–97. Recently, a Rhodococcus sp. was isolated which is capable of utilizing N,N-dimethylacetamide (DMAC) and its degradation product acetamide as sole sources of carbon and nitro- gen98. DMAC is an acetamide-based compound that has become an important environmental pollutant that is widely used as an agrochemical and in a wide range of industries98. As the amd/fmd genes are already naturally occurring in a wide range of lineages, enhancing a community’s capacity to breakdown acetamide only requires dissemination and stable inheritance of one gene. As a result, we hypothesize that amd/fmd genes will arise in a greater number of microbial lineages and in a higher proportion of microbial communities that are increasingly exposed to introduced acetamide (e.g. plastics, pesticides, industrial waste). Methods Culture conditions, strains, plasmids and PCR primers. Hrr. lacusprofundi ACAM34 was grown in artificial Deep Lake vitamin succinate broth (ADLVSB)7 at 30 °C (see Supplementary information). The pheno- type of wild-type and mutant strains was tested using various defined carbon and nitrogen substrates in modified DBCM2 medium99 which had yeast extract and peptone omitted. Acetamide, formamide, glutamine, asparagine, nicotinamide, and urea were used as amide substrates. Pyruvate was used a carbon source and ammonium as a nitrogen source. All carbon substrates were used a 10 mM, nitrogen substrates at 5 mM, and substrates used as both a source of carbon and nitrogen at 10 mM. E. coli strain c2925 (dam, dcm; New England Biolabs) was used to prepare unmethylated plasmid DNA for transformation of Hrr. lacusprofundi, and was grown in Luria-Bertani medium with 100 μ​g mL−1 ampicillin.

Construction of shuttle vector pJWID1. Plasmid pJWID1 was constructed by cloning the up-regulated mutant of the hmgA gene from Hfx. volcanii33 into the Hfx. volcanii-E. coli shuttle vector pIDJL4039,40. Primers pJ_For and pJ_Rev were initially used to amplify the hmgA region from Hfx. volcanii DS2 and the product was used as template for a second PCR using the same reverse primer, and forward primer pJ_For_M that introduced two point mutations that up-regulate the promoter of hmgA. The resulting fragment was digested withPst I and pIDJL40 was digested with NsiI and alkaline phosphatase to create compatible ends for ligation, and ligation performed to generate plasmid pJWID1 (Fig. 1); the orientation and expected sequence of hmgA was verified by sequencing. A red fluorescence protein (mCherry) version of the plasmid (pJWID4) was also constructed (data not shown).

Transformation, plasmid stability and GFP expression. E. coli was transformed using a standard 100 heat-shock protocol . For Hrr. lacusprofundi, a polyethylene glycol 600 (PEG600) procedure developed for Hfx. volcanii101 was used with modifications. Compositional changes were made to buffered salt water, regeneration and transformation dilution solutions (the full procedure is in Supplementary information). Cells were har- vested for preparation of competent cells after growth in ADLVSB medium reached late-log phase: an optical 8 −1 density (OD600) of 0.8–1.0 (1.3–3.6 ×​ 10 cells mL ). Transformants were selected on ADLVSB medium sup- plemented with 0, 0.05, 0.5, 1, 2.5, 5, 7.5, 10, 15 or 20 μ​g mL−1 of pravastatin (from 5 mg mL−1 stock dissolved in MilliQ-water). Plates were incubated in sealed plastic bags (with wet tissue to maintain moisture) at 30 °C for 15 d. To test transformation efficiency, cells were transformed with 1 ng, 10 ng, 100 ng, 1 μ​g or 10 μ​g of plasmid DNA. Plasmid stability was assessed by growing cells (inoculated 1:100) in liquid ADLVSB medium without antibiotic until late log phase, plating cells on solid medium in the absence of antibiotic, and testing the ability of 50 colonies to grow on solid medium containing 2.5 μ​g mL−1 pravastatin. To assess GFP expression, pJWID1 transformants were grown to mid-log phase in liquid ADLVSB medium supplemented with 2.5 μ​g mL−1 pravastatin, and 25 mL aliquots supplemented with 0, 1, 2 or 3 mM tryptophan. After further growth, cells were diluted with basal salts (3 M NaCl, 150 mM MgSO4, 40 mM KCl) as required to bring all cultures to OD 600, 0.2. The fluorescence of sam- ples (100 μ​L) in 96 well plates was quantified using a Fujifilm FLA-5000 Fluorescent Image Analyzer (Fujifilm, Tokyo, Japan) with a 473 nm excitation laser and Fujifilm LPB filter using Fujifilm Science Lab Image Gauge Ver 4.0 software. Basal salt solution was used as a blank and assessments were performed in triplicate, and stand- ard error calculated. Cell fluorescence was also viewed and photographed with a digital microscope (Olympus BX61 microscopy with DP71 camera; Olympus, Tokyo, Japan) using bright-field or fluorescence-field imaging (Olympus WIBA filter).

Scientific Reports | 6:34639 | DOI: 10.1038/srep34639 10 www.nature.com/scientificreports/

Construction of the amd3 gene deletion strain. To construct pTA131_Δ​amd3, an in-fusion high effi- ciency directional (HD) cloning system (Clontech/Takara Bio, Mountain View, CA, USA) was used for cloning multiple fragments in a single reaction. The plasmid pTA13131 was digested with EcoRI and NotI. The hmgA gene including promoter sequence was amplified by PCR from pJWID1 using primers hmgA_For and hmgA_Rev. A 970 bp DNA fragment containing the 225 bp of the 5′ ​coding region of amd3 and 745 bp of the upstream sequence was PCR amplified. The primers used, Acet_up_For15 and Acet_up_Rev15_h, contain a 15 bp extension comple- mentary to the NotI end of digested pTA131 and a 15 bp extension complementary to the 3′ ​end of hmgA, respec- tively. Similarly, a 950 bp fragment containing the last 214 bp of amd3 and 736 bp of the downstream sequence was amplified by PCR with primers Acet_down_For15_h and Acet_down_Rev15, which contain a 15 bp extension complementary to the 5′ ​end of hmgA and a 15 bp extension complementary to the EcoRI end of digested pTA131. These three fragments and the linearized vector pTA131 (EcoRI/NotI digestion) were ligated simultaneously according to the manufacturer’s instructions. The pTA131_Δ​amd3 plasmid was transformed into competent E. coli c2925 and non-methylated plasmid DNA prepared. The plasmid pTA131_Δ​amd3 was transformed into Hrr. lacusprofundi and plated on ADLVSB medium containing 2.5 μ​g mL−1 pravastatin, and colonies screened by PCR using primers diagnostic for single or double recombination events (Table S1, Fig. 3B, Fig. S5).

Plasmid expression of amd3. To control the expression of amd3, the gene was cloned to pJWID1 under the control of the p.tnaA promoter39 using the HD cloning system as described above. The amd3 gene was ampli- fied from Hrr. lacusprofundi genomic DNA using primers pJ_2285_FW and pJ_2285_RV, which contain 15 bp extensions complementary to NdeI and EcoRI ends of digested pJWID1. The fragment was ligated into linearized vector pJWID1 (NdeI/EcoRI) to generate pJWID1_amd3. The plasmid was sequenced to confirm the correct insertion event. The plasmid pJWID1_amd3 (or pJWID1 as negative control) extracted from E. coli c2925 was transformed into Hrr. lacusprofundi Δ​amd3 and plated on ADLVSB medium supplemented with 40, 60, 80, 100, 120 or 150 μ​g mL−1 pravastatin. The plasmids were also transformed into the wild-type Hrr. lacusprofundi strain with selection on 2.5 μ​g mL−1 pravastatin.

Acetamidase enzyme activity. Hrr. lacusprofundi harboring pJWID1 or pJWID1_amd3 were inoculated 1:100 grown and grown for 40 d at 30 °C in 50 mL DBCM2 medium supplemented with 10 mM acetamide as the sole source of carbon and nitrogen plus 3 mM tryptophan to induce p. tnaA-mediated amd3 expression. In addition, the wild-type and Δ​amd3 strain were inoculated 1:100 grown and grown for 40 d at 30 °C in 50 mL DBCM2 medium supplemented with 10 mM pyruvate, 1 mM ammonium and 10 mM acetamide, with the pyru- vate and ammonium provided to support growth of the Δ​amd3 strain. Cells were pelleted by centrifugation for 20 min at 4,500 ×​ g, washed three times in DBCM2 salt solution, and suspended in DBCM2 salt buffer supple- mented with 2 mM EDTA (pH 7.2) and 0.4 mM phenylmethanesulphonylfluoride (PMSF). The suspensions were ultrasonically disrupted on ice using a Branson Sonifier 250 (Branson Ultrasonics, Danbury, CT) with the probe output set at 20% amplitude for five periods of 40 s (pulse cycle of 0.5 s on and 0.5 s off), with 40 s cooling on ice between periods of sonication to prevent excessive sample heating. The sonicate was centrifuged at 4,500 ×​ g for 5 min to remove cell debris, and the cell free extract (supernatant) filtered through a 15 mL Amicon centrifugal concentration unit (Millipore, 25 Billerica, MA) with a 3 kDa cutoff by centrifugation at 5,000 ×​ g, with three sub- sequent buffer exchanges with DBCM2 salt solution to remove EDTA and PMSF and the concentrate (~500 μ​L) stored at −​80 °C until needed. Protein concentration was determined at 562 nm with a microplate reader using Thermo Scientific Pierce BCA Protein Assay Kit (Product No. 23225) according to manufacturer’s instructions. Acetamidase activity was determined by measuring the release of ammonium based on a phenol-hypochlorite 102 ammonia detection protocol . A standard reaction mixture (100 μL)​ containing 50 mM KH2PO4–K2HPO4 (pH 7.6), 150 mM NaCl, 10 mM acetamide and 100 μ​g of crude enzyme (cell free extract) was incubated at 30 °C for 1 h and the reaction terminated by the addition of 350 μ​L of reagent A (0.59 M phenol, 1 mM sodium nitroprus- side). The color was developed by the addition of 100 μ​L of reagent B (2 M sodium hydroxide, 0.11 M sodium hypochlorite), with the mixture maintained at 30 °C in the dark for 20 min. Absorbance was measured at 600 nm with a microplate reader. The enzyme assays were performed in triplicate and a negative control that contained all reagents but no added cell free extract was included. Enzyme activity was calculated from a standard curve con- structed using 0, 0.25, 0.5, 1, 2, 4, 6 and 8 mM NH4Cl. One unit of acetamidase activity was defined as the amount of enzyme that hydrolyzed acetamide to release 1 μ​M NH3 per minute under assay conditions.

Phylogenetic analysis of Amd/Fmd sequences. Amd/Fmd protein sequences from Archaea and Bacteria were retrieved with a protein name search using “acetamidase”, “formamidase”, “Amd” and “Fmd” from UniProtKB database (18 March, 2016), and sequences recovered clustered with an identity cutoff of 90% (OTU0.9). Representative sequences of each cluster were interrogated and manually filtered to remove irrelevant sequences (e.g. transcriptional regulator of acetamidase genes). Six of the Deep Lake haloarchaeal Amd/Fmd sequences were in the search (Hrr. lacusprofundi: amd1, amd2, amd3; undescribed genus DL31: Halar_0730, Halar_1208, Halar_3390) but the two from Hht. litchfeldiae (halTADL_0419, halTADL_2650) were not and were manually added to the set and aligned against existing clusters using Clustal X 2.0103. Phylogenetic trees were constructed using Fasttree104 using the maximum likelihood method and the robustness of phylogeny tested using 1000 bootstraps. To test the ability of the word search to recover Amd/Fmd sequences, 50 sequences were randomly selected and BLAST used with each sequence against UniProtKB, and the top 50 hits from each BLAST search were cross-checked against the original datasets. To evaluate the effect of bias in the number of bacterial vs archaeal Amd/Fmd sequences, bacterial clusters were randomly subsampled to the same number of archaeal clus- ters, and the new dataset used for tree construction. To assess Amd/Fmd sequences in closed genomes, the 215 archaeal and 3872 bacterial genomes in Integrated Microbial Genomes (IMG) were searched (22 March, 2016) using the IMG Gene Cassette Search tool for the Pfam 03069 motif (includes acetamidase and formamidase).

Scientific Reports | 6:34639 | DOI: 10.1038/srep34639 11 www.nature.com/scientificreports/

The 16S rRNA gene sequences corresponding to the archaeal and bacterial genomes were extracted from Silva non-redundant reference SSU database using genome names or retrieved manually from IMG. The 16S rRNA gene sequences were aligned using SINA aligner105 and classified with the least common ancestor method based on the different taxonomies hosted by SILVA. Common gaps in alignments were removed, and phylogenetic trees were constructed using the neighbor joining method in ARB106. The sequences were clustered according to their class or phylum 16S rRNA gene taxonomic classifications.

Acetamide concentration of water samples. Water was collected in acid or ethanol washed, high-density polyethylene bottles from Deep Lake (12/2008; 11/2014; 12/2014), Rauer Islands lakes (01/2015) and the Southern Ocean (10/2008; 12/2008), and cryogenically stored at −​80 °C. A total of 12 different samples from these systems, plus controls (100 μ​L each in duplicate) were dispensed into Pyrex screw cap glass culture tubes (Kimble, ThermoFisher, Sydney, Australia). An acetamide (Sigma, USA) standard curve was prepared in the 0–20 μ​g mL−1 range. To all samples, controls and standards (for standard curve), 5 μ​L (0.1 μ​g μ​L−1) of stable 13 15 isotope labeled C2, N-acetamide internal standard (Medical Isotopes Inc., NH) was added. All samples to be analysed were dried in a vacuum centrifuge at ambient temperature (Savant speedvac, ThermoFisher, Sydney, Australia). To maximize recovery, over-drying was avoided and the hypersaline samples consisted of a moist slurry of crystals. Neat dichloromethane (1 mL) was added to each sample, control and standard, and shaken upright on a mixer platform (Intelli-Mixer, POCD Scientific, Sydney, Australia) for ~2 h at ambient temperature. The liquid extract was transferred to clean glass culture tubes, taking care not to pick up salt crystals, and dried in a vacuum centrifuge (ambient temperature, ~10 min). All samples were resuspended in 100 μL​ dichloromethane, vortexed briefly and transferred to GC vials with glass inserts. Stable isotope dilution GC/MS quantification of acetamide in lake water was carried out as described previously107 with specific modifications. Analyses were performed on a Hewlett-Packard 6890 plus gas chromatograph interfaced with an Agilent Technologies 5973 mass selective detector. A 4-mm-i.d. straight-walled silanized glass liner containing quartz wool was installed in the injection port and samples injected in the splitless mode (2 μL​ injection volume). Chromatography of underi- vatized acetamide was performed on a fused silica capillary column (free fatty acids column; Agilent J&W GC columns: HP-FFAP 50 m length, 0.2 mm id, 0.33 μ​m film thickness). Helium (BOC Gases, ultra-high purity) was used as the carrier gas at a flow rate of 1.4 mL min−1. The GC/MS conditions were as follows: injector temperature, 230 °C; transfer line, 230 °C; initial oven temperature, 40 °C (for 4 min); then increased to 190 °C at 5 °C min−1; then to 230 °C at 30 °C min−1, with a total run time of 45 min. Mass spectrometry analysis was performed using electron impact ionization mode, and conditions were as follows: electron energy, 70 eV; ion source temperature, 230 °C, MS Quad temperature 150 °C. Single ion monitoring was used to detect the molecular ions of acetamide 13 15 (59 m/z) and the C2, N-acetamide internal standard (62 m/z). Peak areas of these ions were integrated and peak area ratios calculated (Chemstation software, RTE integrator, Agilent Technologies Inc, Sydney, Australia). References 1. Cavicchioli, R. Microbial ecology of Antarctic aquatic systems. Nature. Rev. Microbiol. 13, 691–706 (2015). 2. DeMaere, M. Z. et al. High level of intergenera gene exchange shapes the evolution of haloarchaea in an isolated Antarctic lake. Proc. Natl. Acad. Sci. USA 110, 16939–16944 (2013). 3. Williams, T. J. et al. Microbial ecology of an Antarctic hypersaline lake: genomic assessment of ecophysiology among dominant haloarchaea. ISME. J. 8, 1645–1658 (2014). 4. Tschitschko, B. et al. Ecophysiological distinctions of haloarchaea from a hypersaline Antarctic lake determined using metaproteomics. Appl. Environ. Microbiol. 82, 3165–3173 (2016). 5. Tschitschko, B. et al. Antarctic archaea–virus interactions: metaproteome-led analysis of invasion, evasion and adaptation. ISME. J. 9, 2094–2107 (2015). 6. Staley, J. T. & Konopka, A. Measurement of in situ activities of nonphotosynthetic microorganisms in aquatic and terrestrial habitats. Annu. Rev. Microbiol. 39, 321–346 (1985). 7. Franzmann, P. D. et al. Halobacterium lacusprofundi sp. nov., a halophilic bacterium isolated from Deep Lake, Antarctica. Syst. Appl. Microbiol. 11, 20–27 (1988). 8. Cavicchioli, R. Archaea—timeline of the third domain. Nature. Rev. Microbiol. 9, 51–61 (2011). 9. Goo, A. Y. et al. Low-pass sequencing for microbial comparative genomics. BMC Genomics. 5, 3 (2004). 10. Brodt, A., Lurie-Weinberger, M. N. & Gophna, U. CRISPR loci reveal networks of gene exchange in archaea. Biol. Direct. 6, 65–65 (2011). 11. Maier, L. K. et al. The immune system of halophilic archaea. Mob. Genet. Elements 2, 228–232 (2012). 12. Maier, L. K. et al. Essential requirements for the detection and degradation of invaders by the Haloferax volcanii CRISPR/Cas system IB. RNA Biol. 10, 865–874 (2013). 13. Sorek, R., Lawrence, C. M. & Wiedenheft, B. CRISPR-mediated adaptive immune systems in bacteria and archaea. Annu. Rev. Biochem. 82, 237–266 (2013). 14. Giaquinto, L. et al. Structure and function of cold shock proteins in Archaea. J. Bacteriol. 189, 5738–5748 (2007). 15. DasSarma, S., Capes, M. D., Karan, R. & DasSarma, P. Amino acid substitutions in cold-adapted proteins from Halorubrum lacusprofundi, an extremely halophilic microbe from Antarctica. PLoS One 8, e58587 (2013). 16. Karan, R., Capes, M. D., DasSarma, P. & DasSarma, S. Cloning, overexpression, purification, and characterization of a polyextremophilic β​-galactosidase from the Antarctic haloarchaeon Halorubrum lacusprofundi. BMC Biotechnol. 13, 3 (2013). 17. Gibson, J. A. et al. Unsaturated diether lipids in the psychrotrophic archaeon Halorubrum lacusprofundi. Syst. Appl. Microbiol. 28, 19–26 (2005). 18. Reid, I. N. et al. Terrestrial models for extraterrestrial life: methanogens and halophiles at Martian temperatures. Int. J. Astrobiology 5, 89–97 (2006). 19. Fröls, S., Dyall-Smith, M. & Pfeifer, F. Biofilm formation by haloarchaea. Environ. Microbiol. 14, 3159–3174 (2012). 20. Fröls, S. Archaeal biofilms: widespread and complex. Biochem. Soc. Trans. 41, 393–398 (2013). 21. Franzmann, P. D., Springer, N., Ludwig, W., De Macario, E. C. & Rohde, M. A methanogenic archaeon from Ace Lake, Antarctica: Methanococcoides burtonii sp. nov. Syst. Appl. Microbiol. 15, 573–581 (1992). 22. Cavicchioli, R. Cold-adapted archaea. Nature. Rev. Microbiol. 4, 331–343 (2006). 23. Najnin, T. et al. Characterization of a temperature-responsive two component regulatory system from the Antarctic archaeon, Methanococcoides burtonii. Sci. Rep. 6, 24278 (2016).

Scientific Reports | 6:34639 | DOI: 10.1038/srep34639 12 www.nature.com/scientificreports/

24. Leigh, J. A., Albers, S. V., Atomi, H. & Allers, T. Model organisms for genetics in the domain Archaea: methanogens, halophiles, Thermococcales and Sulfolobales. FEMS Microbiol. Rev. 35, 577–608 (2011). 25. Charlebois, R. L., Lam, W. L., Cline, S. W. & Doolittle, W. F. Characterization of pHV2 from Halobacterium volcanii and its use in demonstrating transformation of an archaebacterium. Proc. Natl. Acad. Sci. USA 84, 8530–8534 (1987). 26. Cline, S. W., Lam, W. L., Charlebois, R. L., Schalkwyk, L. C. & Doolittle, W. F. Transformation methods for halophilic archaebacteria. Can. J. Microbiol. 35, 148–152 (1989). 27. Peck, R. F., DasSarma, S. & Krebs, M. P. Homologous gene knockout in the archaeon Halobacterium salinarum with ura3 as a counterselectable marker. Mol. Microbiol. 35, 667–676 (2000). 28. Peck, R. F. et al. brp and blh are required for synthesis of the retinal cofactor of bacteriorhodopsin in Halobacterium salinarum. J. Biol. Chem. 276, 5739–5744 (2001). 29. Wang, G., Kennedy, S. P., Fasiludeen, S., Rensing, C. & DasSarma, S. Arsenic resistance in Halobacterium sp. strain NRC-1 examined by using an improved gene knockout system. J. Bacteriol. 186, 3187–3194 (2004). 30. Holmes, M. L. & Dyall-Smith, M. L. A plasmid vector with a selectable marker for halophilic archaebacteria. J. Bacteriol. 172, 756–761 (1990). 31. Allers, T., Ngo, H. P., Mevarech, M. & Lloyd, R. G. Development of additional selectable markers for the halophilic archaeon Haloferax volcanii based on the leuB and trpA genes. Appl. Environ. Microbiol. 70, 943–953 (2004). 32. Bitan-Banin, G., Ortenberg, R. & Mevarech, M. Development of a gene knockout system for the halophilic archaeon Haloferax volcanii by use of the pyrE gene. J. Bacteriol. 185, 772–778 (2003). 33. Wendoloski, D., Ferrer, C. & Dyall-Smith, M. L. A new simvastatin (mevinolin)-resistance marker from Haloarcula hispanica and a new Haloferax volcanii strain cured of plasmid pHV2. Microbiology 147, 959–964 (2001). 34. Holmes, M. L. & Dyall-Smith, M. L. Mutations in DNA gyrase result in novobiocin resistance in halophilic archaebacteria. J. Bacteriol. 173, 642–648 (1991). 35. Kaczowka, S. J. & Maupin-Furlow, J. A. Subunit topology of two 20S proteasomes from Haloferax volcanii. J. Bacteriol. 185, 165–174 (2003). 36. Irihimovitch, V. & Eichler, J. Post-translational secretion of fusion proteins in the halophilic archaea Haloferax volcanii. J. Biol. Chem. 278, 12881–12887 (2003). 37. Fine, A., Irihimovitch, V., Dahan, I., Konrad, Z. & Eichler, J. Cloning, expression, and purification of functional Sec11a and Sec11b, type I signal peptidases of the archaeon Haloferax volcanii. J. Bacteriol. 188, 1911–1919 (2006). 38. Blaseio, U. & Pfeifer, F. Transformation of Halobacterium halobium: development of vectors and investigation of gas vesicle synthesis. Proc. Natl. Acad. Sci. USA 87, 6772–6776 (1990). 39. Duggin, I. G. et al. CetZ tubulin-like proteins control archaeal cell shape. Nature 519, 362–365 (2015). 40. Allers, T., Barak, S., Liddell, S., Wardell, K. & Mevarech, M. Improved strains and plasmid vectors for conditional overexpression of His-tagged proteins in Haloferax volcanii. Appl. Environ. Microbiol. 76, 1759–1769 (2010). 41. Reuter, C. J. & Maupin-Furlow, J. A. Analysis of proteasome-dependent proteolysis in Haloferax volcanii cells, using short-lived green fluorescent proteins. Appl. Environ. Microbiol. 70, 7530–7538 (2004). 42. Schmidt, I. & Pfeifer, F. Use of GFP-GvpE fusions to quantify the GvpD-mediated reduction of the transcriptional activator GvpE in haloarchaea. Arch. Microbiol. 195, 403–412 (2013). 43. Nomura, S. & Harada, Y. Functional expression of green fluorescent protein derivatives in Halobacterium salinarum. FEMS Microbiol. Lett. 167, 287–293 (1998). 44. Patenge, N., Haase, A., Bolhuis, H. & Oesterhelt, D. The gene for a halophilic β​-galactosidase (bgaH) of Haloferax alicantei as a reporter gene for promoter analyses in Halobacterium salinarum. Mol. Microbiol. 36, 105–113 (2000). 45. Lam, W. L. & Doolittle, W. F. Mevinolin-resistant mutations identify a promoter and the gene for a eukaryote-like 3-hydroxy-3- methylglutaryl-coenzyme A reductase in the archaebacterium Haloferax volcanii. J. Biol. Chem. 267, 5829–5834 (1992). 46. Holmes, M. L., Nuttall, S. D. & Dyall-Smith, M. L. Construction and use of halobacterial shuttle vectors and further studies on Haloferax DNA gyrase. J. Bacteriol. 173, 3807–3813 (1991). 47. Duilio, A., Tutino, M. L. & Marino, G. Recombinant protein production in Antarctic Gram-negative bacteria. Methods Mol. Biol. 267, 225–237 (2004). 48. Miteva, V., Lantz, S. & Brenchley, J. Characterization of a cryptic plasmid from a Greenland ice core Arthrobacter isolate and construction of a shuttle vector that replicates in psychrophilic high G +​ C Gram-positive recipients. Extremophiles 12, 441–449 (2008). 49. Singh, A. K., Pindi, P. K., Dube, S., Sundareswaran, V. R. & Shivaji, S. Importance of trmE for growth of the psychrophile Pseudomonas syringae at low temperatures. Appl. Environ. Microbiol. 75, 4419–4426 (2009). 50. Bakermans, C., Sloup, R. E., Zarka, D. G., Tiedje, J. M. & Thomashow, M. F. Development and use of genetic system to identify genes required for efficient low-temperature growth of Psychrobacter arcticus 273-4. Extremophiles 13, 21–30 (2009). 51. Giuliani, M. et al. A novel strategy for the construction of genomic mutants of the Antarctic bacterium Pseudoalteromonas haloplanktis TAC125. Methods Mol. Biol. 824, 219–233 (2012). 52. Yu, Z. C. et al. Development of a genetic system for the deep-sea psychrophilic bacterium Pseudoalteromonas sp. SM9913. Microb. Cell Fact. 13, 13 (2014). 53. Lynch, E. A. et al. Sequencing of seven haloarchaeal genomes reveals patterns of genomic flux.PLoS One 7, e41389 (2012). 54. Marzluf, G. A. Regulation of nitrogen metabolism and gene expression in fungi. Microbiol. Rev. 45, 437–461 (1981). 55. Neilson, A. H. & Larsson, T. The utilization of organic nitrogen for growth of algae: physiological aspects. Physiol. Plant. 48, 542–553 (1980). 56. Palenik, B. & Henson, S. E. The use of amides and other organic nitrogen sources by the phytoplankton Emiliania huxleyi. Limnol. Oceanogr. 42, 1544–1551 (1997). 57. Stanier, R. Y., Palleroni, N. J. & Doudoroff, M. The aerobic Pseudomonads: a taxonomic study. J. Gen. Microbiol. 43, 159–271 (1966). 58. Brown, J. E., Brown, P. R. & Clarke, P. H. Buryramide-utilizing mutants of Pseudomonas aeruginosa 8602 which produce an amidase with altered substrate specificity. Microbiology 57, 273–285 (1969). 59. Oberhofer, T. R. & Rowen, J. W. Acetamide agar for differentiation of nonfermentative bacteria. Appl. Microbiol. 28, 720–721 (1974). 60. Gilardi, G. L. Nonfermentative gram-negative bacteria encountered in clinical specimens. Antonie Van Leeuwenhoek 39, 229–242 (1973). 61. Collins, P. A. & Knowles, C. J. The utilization of nitriles and amides by Nocardia rhodochrous. Microbiology 129, 711–718 (1983). 62. Draper, P. The aliphatic acylamide amidohydrolase of Mycobacterium smegmatis: its inducible nature and relation to acyl-transfer to hydroxylamine. Microbiology 46, 111–123 (1967). 63. Köll, P. & Metzger, J. Nachweis von acetamid beim thermischen abbau von chitin. Z Lebensm Unters Forsch 113, 111–113 (1979). 64. Morgan, S. L., Watt, B. E., Ueda, K. & Fox, A. Pyrolysis GC/MS profiling of chemical markers for microorganisms In Analytical Microbiology Methods: Chromatography and Mass Spectrometry (eds Fox, A. et al.) 179–200 (Plenum Press, NY, 1990). 65. Song, X. & Farwell, S. O. Pyrolysis gas chromatography atomic emission detection method for determination of N-containing components of humic and fulvic acids. J. Anal. Appl. Pyrolysis. 71, 901–915 (2004). 66. Cao, J. P. et al. Triacetonamine formation in a bio-oil from fast pyrolysis of sewage sludge using acetone as the absorption solvent. Bior. Technol. 101, 4242–4245 (2010).

Scientific Reports | 6:34639 | DOI: 10.1038/srep34639 13 www.nature.com/scientificreports/

67. Altarawneh, M. et al. Theoretical investigation into competing unimolecular reactions encountered in the pyrolysis of acetamide. J. Phys. Chem. A 115, 14092–14099 (2011). 68. Koch, R. L., Chrystal, E. J., Beaulieu, B. B. & Goldman, P. Acetamide—a metabolite of metronidazole formed by the intestinal flora. Biochem. Pharmacol. 28, 3611–3615 (1979). 69. Schwartz, D. E., Jordan, J. C., Vetter, W. & Oesterhelt, G. Metabolic studies of ornidazole in the rat, in the dog and in man. Xenobiotica 9, 571–581 (1979). 70. Chrystal, E. J., Koch, R. L. & Goldman, P. Metabolites from the reduction of metronizadole by xanthine oxidase. Mol. Pharmacol. 18, 105–111 (1980). 71. Fuhrman, J. A. & Ferguson, R. L. Nanomolar concentrations and rapid turnover of dissolved free amino acids in seawater: agreement between chemical and microbiological measurements. Mar. Ecol. Prog. Ser. 33, 237–242 (1986). 72. Kirchman, D. L. et al. Glucose fluxes and concentrations of dissolved combined neutral sugars (polysaccharides) in the Ross Sea and Polar Front Zone, Antarctica. Deep Sea Res. Part 2 Top. Stud. Oceanogr. 48, 4179–4197 (2001). 73. Wyborn, N. R., Scherr, D. J. & Jones, C. W. Purification, properties and heterologous expression of formamidase from Methylophilus methylotrophus. Microbiology 140, 191–195 (1994). 74. Wyborn, N. R., Mills, J., Williams, S. G. & Jones, C. W. Molecular characterisation of formamidase from Methylophilus methylotrophus. Eur. J. Biochem. 240, 314–322 (1996). 75. Skouloubris, S., Labigne, A. & De Reuse, H. The AmiE aliphatic amidase and AmiF formamidase of Helicobacter pylori: natural evolution of two enzyme paralogues. Mol. Microbiol. 40, 596–609 (2001). 76. Viteri, S. E. & Schmidt, E. L. Ecology of indigenous soil rhizobia: Response of Bradyrhizobium japonicum to readily available substrates. Appl. Environ. Microbiol. 53, 1872–1875 (1987). 77. Kelly, D. P., McDonald, I. R. & Wood, A. P. Proposal for the reclassification of Thiobacillus novellus as Starkeya novella gen. nov., comb. nov., in the alpha-subclass of the Proteobacteria. Int. J. Syst. Evol. Microbiol. 50, 1797–1802 (2000). 78. Mevs, U., Stackebrandt, E., Schumann, P., Gallikowski, C. A. & Hirsch, P. Modestobacter multiseptatus gen. nov., sp. nov., a budding actinomycete from soils of the Asgard Range (Transantarctic Mountains). Int. J. Syst. Evol. Microbiol. 50, 337–346 (2000). 79. Okubo, T. et al. Soil oligotrophic bacterium Agromonas oligotrophica (Bradyrhizobium oligotrophicum) is a nitrogen-fixing symbiont of Aeschynomene indica as suggested by genome analysis. Appl. Environ. Microbiol. 79, 2542–2551 (2013). 80. Kappler, U. & Nouwens, A. S. Metabolic adaptation and trophic strategies of soil bacteria—C1-metabolism and sulfur chemolithotrophy in Starkeya novella. Front Microbiol. 4, 304 (2013). 81. Parales, R. E., Adamus, J. E., White, N. & May, H. D. Degradation of 1,4-dioxane by an actinomycete in pure culture. Appl. Environ. Microbiol. 60, 4527–4530 (1994). 82. Mahendra, S. & Alvarez-Cohen, L. Pseudonocardia dioxanivorans sp. nov., a novel actinomycete that grows on 1,4-dioxane. Int. J. Syst. Evol. Microbiol. 55, 593–598 (2005). 83. Kotak, M. et al. Complete genome sequence of the Opitutaceae bacterium strain TAV5, a potential facultative methylotroph of the wood-feeding termite Reticulitermes flavipes. Genome Announc. 3, e00060–15 (2015). 84. Thauer, R. K., Kaster, A. K., Seedorf, H., Buckel, W. & Hedderich, R. Methanogenic archaea: ecologically relevant differences in energy conservation. Nat. Rev. Microbiol. 6, 579–591 (2008). 85. Könneke, M. et al. Ammonia-oxidizing archaea use the most energy-efficient aerobic pathway for CO2 fixation. Proc. Natl. Acad. Sci. USA 111, 8239–8244 (2014). 86. Deppenmeier, U. et al. The genome of Methanosarcina mazei: evidence for lateral gene transfer between bacteria and archaea. J. Mol. Microbiol. Biotechnol. 4, 453–461 (2002). 87. Li, J., Wong, C. F., Wong, M. T., Huang, H. & Leung, F. C. Modularized evolution in archaeal methanogens phylogenetic forest. Genome Biol. Evol. 6, 3344–3359 (2014). 88. Garushyants, S. K., Kazanov, M. D. & Gelfand, M. S. Horizontal gene transfer and genome evolution in Methanosarcina. BMC Evol. Biol. 15, 102 (2015). 89. Panda, H. Hand Book on Chemical Industries (Alcohol Based) (ed. Panda, H.) 1–374, Asia Pacific Business Press Inc., Delhi, India (2002). 90. Cheung, H., Tanke, R. S. & Torrence, G. P. Acetic Acid. Ullmann’s Encyclopedia of Industrial Chemistry. doi: 10.1002/14356007. a01_045.pub2 (2011). 91. Wong, C. S. Environmental fate processes and biochemical transformations of chiral emerging organic pollutants. Anal. Bioanal. Chem. 386, 544–558 (2006). 92. Rochman, C. M. et al. Classify plastic waste as hazardous. Nature 494, 169–171 (2013). 93. Law, K. & Thompson, R. Microplastics in the sea. Science 345, 144–145 (2014). 94. van Sebille, E. et al. A global inventory of small floating plastic debris. Environ. Res. Lett. 10, 124006 (2015). 95. Seffernick J. L. et al. Melamine deaminase and atrazine chlorohydrolase: 98 percent identical but functionally different. J. Bacteriol. 183, 2405–2410 (2001). 96. Yoshida, S. et al. A bacterium that degrades and assimilates poly(ethylene terephthalate). Science 351, 1196–1199 (2016). 97. Bornscheuer, U. T. Feeding on plastic. Science 351, 1154–1155 (2016). 98. Chen, X. et al. Biodegradation of N,N-dimethylacetamide by Rhodococcus sp. strain B83 isolated from the rhizosphere of pagoda tree, http://dx.doi.org/10.1016/j.jes.2016.05.013 (2016). 99. Burns, D. G. & Dyall Smith, M. Cultivation of haloarchaea. Methods. Microbiol. 35, 535–552 (2006). 100. Froger, A. & Hall, J. E. Transformation of plasmid DNA into E. coli using the heat shock method. J. Vis. Exp. 6, 253 (2014). 101. Dyall-Smith, M. The Halohandbook: Protocols for Halobacterial Genetics (ed. Dyall-Smith, M.) 43–62 (Martinsried, 2009). 102. Weatherburn, M. W. Phenol-hypochlorite reaction for determination of ammonia. Anal. Chem. 39, 971–974 (1967). 103. Larkin, M. A. et al. Clustal W and Clustal X version 2.0. Bioinformatics 23, 2947–2948 (2007). 104. Price, M. N., Dehal, P. S. & Arkin, A. P. FastTree 2–approximately maximum-likelihood trees for large alignments. PLoS One 5, e9490 (2010). 105. Pruesse, E., Peplies, J. & Glöckner, F. O. SINA: accurate high-throughput multiple sequence alignment of ribosomal RNA genes. Bioinformatics 28, 1823–1829 (2012). 106. Westram, R. et al. ARB: a software environment for sequence data in Handbook of molecular microbial ecology I: metagenomics and complementary approaches (ed. De Bruijin, F. J.) 399–406 (John Wiley and Sons, Hoboken, NJ, 2011). 107. Diekmann, J., Wittig, A. & Stabbert, R. Gas chromatographic—mass spectrometric analysis of acrylamide and acetamide in cigarette mainstream smoke after on-column injection. J. Chromatogr. Sci. 46, 659–663 (2008). Acknowledgements This work was supported by the Australian Research Council [DP150100244]. YL was funded by the China Scholarship Council (File No. 201206910027). GC-MS results were obtained at the Bioanalytical Mass Spectrometry Facility within the Analytical Centre of the University of New South Wales. This work was undertaken using infrastructure provided by NSW Government co-investment in the National Collaborative Research Infrastructure Scheme. Subsidized access to this facility is gratefully acknowledged. We thank Sarah Payne and Alyce Hancock for collecting samples in Antarctica.

Scientific Reports | 6:34639 | DOI: 10.1038/srep34639 14 www.nature.com/scientificreports/

Author Contributions R.C. conceived the research. Y.L. performed all the experiments except J.C.W., I.G.D. and P.M.G.C. designed plasmid pJWID1 and J.C.W. constructed pJWID1, M.J. constructed the phylogenetic tree, and A.P. performed the mass spectrometry. Y.L., R.C. and T.J.W. designed the other experiments performed by Y.L. and analyzed the data and interpreted the findings. R.C., Y.L. and T.J.W. wrote the manuscript. All authors vetted the manuscript and viewed the final version. Additional Information Supplementary information accompanies this paper at http://www.nature.com/srep Competing financial interests: The authors declare no competing financial interests. How to cite this article: Liao, Y. et al. Developing a genetic manipulation system for the Antarctic archaeon, Halorubrum lacusprofundi: investigating acetamidase gene function. Sci. Rep. 6, 34639; doi: 10.1038/srep34639 (2016). This work is licensed under a Creative Commons Attribution 4.0 International License. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license, users will need to obtain permission from the license holder to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/

© The Author(s) 2016

Scientific Reports | 6:34639 | DOI: 10.1038/srep34639 15 1 Developing a genetic manipulation system for the Antarctic archaeon, Halorubrum 2 lacusprofundi: investigating acetamidase gene function 3 4 Yan Liao, Timothy J. Williams, James C. Walsh, Muyan Ji, Anne Poljak, Paul M.G. 5 Curmi, Iain G. Duggin and Ricardo Cavicchioli 6 7 Supplementary Information 8 9 Transformation protocol 10 Figures S1 – 11 11 Tables S1 – S4 (note Table S2 and S4 are provided separately as excel files) 12 Halorubrum lacusprofundi transformation protocol 13 The protocol is provided as a laboratory procedure explaining the steps performed each day of 14 the experiment. Recipes for media and solutions are provided at the end of the procedure. 15 16 Plate out the Hrr. lacusprofundi ACAM34 strain on ADLVB solid medium and inoculate a 17 single colony into 10 mL of ADLVB media. Incubate at 30°C (shaking, 120 rpm) for about 5 18 d (when the culture is turbid) and use 500 µL of this as an inoculum for a 50 mL culture in a 19 250 mL flask. Grow for approximately one more week (~ 7-10 d, shaking, 120 rpm) to

20 provide a late exponential culture (quite turbid, and has a pink color, OD600 ~ 0.8). 21 22 Day 1 23 1. Ensure adequate quantities of transformation solutions are present (i.e. buffered and 24 unbuffered spheroplasting solutions, spheroplast dilution solution and regeneration solution)

25 2. Leave PEG600 at RT to thaw overnight. Warm to 30°C if necessary. 26 27 Day 2

28 3. When the culture reaches OD600 ~0.8 (see above), pellet 10 mL by centrifuging at 5000 29 rpm for 20 min at 25°C. All subsequent steps are performed at room temperature unless 30 otherwise stated. 31 4. Resuspend pellet gently in 2 mL of buffered spheroplasting solution. Transfer to 2 ml 32 round-bottomed tube and pellet cells at 6000 rpm, 8 min at 25°C. 33 5. Very gently, resuspend in 200 µL of buffered spheroplasting solution (for each 34 transformation reaction). Avoid generating air bubbles. 35 6. For each transformation, transfer 200 µL cells to a clean 2 ml round-bottomed tube. Add 20 36 μl of 0.5 M EDTA pH 8.0 onto the side of the tube, and invert to mix. Leave at RT for 10 min 37 to form spheroplasts. 38 7. Meanwhile set up DNA samples in 30 μL total volumes: 39 10 μl of unmethylated DNA (~1 μg, ultra-pure, prepared from E. coli c2925 strain) in 40 DNase, RNase and protease-free water. 41 15 μl of unbuffered spheroplasting solution. 42 5 μl of 0.5 M EDTA pH 8.0. 43 8. Add the DNA samples (step 7) to the tubes containing the spheroplasts (step 6) to 44 commence the transformation process. 45 9. After 5 min, add 250 μL (equal volume) of 60% PEG600 to each transformation tube. Add 46 in same manner as EDTA (step 6), but shake the tube horizontally ~10 times to gently mix the 47 solution. Leave at RT for 30 min. 48 10. Add 1.5 mL spheroplast dilution solution to each transformation tube, invert to mix and 49 leave at RT for 2 min. Pellet using a microfuge at 12,000 rpm for 10 min at 25°C, and remove 50 the supernatant. 51 11. Add 1 mL regeneration solution, resuspend the pellet gently until a homogeneous solution 52 is obtained. Return to 30 °C for 4 h to regenerate cell walls (shaking, 120 rpm). 53 12. Pellet using a microfuge at 12,000 rpm for 10 min at 25°C. Remove supernatant and 54 resuspend gently in 1 mL transformation dilution solution. 55 13. Plate 100 µL on ADLVB or ADLVB + antibiotic (selective) plates. 56 14. Incubate plates at 30 °C in sealed plastic bags for about 15 d. Place wet tissue into the bag 57 to avoid media dehydration and salt crystallization. Check the plates every 3 d, and carefully 58 remove condensation that has formed on the lid. 59 60 Artificial Deep Lake Vitamin succinate Broth (ADLVSB) media (1L) 61 NaCl 180.0 g,

62 MgCl2.6H2O 75.0 g, 63 Sodium succinate 10.0 g (Sigma),

64 MgSO4.7H2O 7.4 g, 65 KCl 7.4 g,

66 CaCl2.2H2O 1.0 g (Sigma), 67 Yeast Extract 1.0 g (Oxoid); 68 10 mL Vitamin solution containing per litre: Biotin 30.0 mg, Cyanocobalamin 20.0 mg, 69 Thiamine- HCl 10.0 mg. 70 71 Adjust basal medium pH to 7.2 ± 0.2, and autoclave for 15 min at 15 psi and 121 °C. Filter 72 sterilize vitamin solution and add to basal medium after autoclaving. 73 74 Pravastatin stock 75 5 mg ml-1 in pure water 76 77 30% BSW (buffered salt water) (1L) 78 NaCl 260 g, 79 MgCl2.6H2O 10 g,

80 MgSO4.7H2O 35 g, 81 KCl 7 g, 82 1 M Tris-HCl, pH7.4 20 mL 83 Dissolve completely in ~800 mL Milli-Q water, and then bring volume to 995 mL. Autoclave.

84 Add 5 mL sterile 1M CaCl2.

85 86 10X YPC (100 mL) 87 Yeast extract 5 g 88 Oxoid peptone (not Difco Bacto) 1 g 89 Casamino acid 1 g 90 Dissolve in Milli-Q water and then bring pH to 7.4 with 2M KOH and the volume to 100 mL. 91 Use freshly or store in the fridge for a maximum of a few days. 92 93 Buffered Spheroplasting Solution 94 NaCl 5.844 g (1M) 95 KCl 0.2 g (27 mM) 96 1M Tris.HCl pH8.5 5 ml (50 mM) 97 Sucrose 15 g (15%)

98 dH2O to 100 mL 99 Filter sterilize 100 101 Unbuffered Spheroplasting Solution 102 NaCl 5.844 g (1M) 103 KCl 0.2 g (27 mM) 104 Sucrose 15 g (15%)

105 dH2O to 100 mL 106 Adjust to pH 7.5 (~ 10 µl 1 M NaOH). Filter sterilize 107 108 Spheroplast Dilution Solution 109 30% BSW 76.7 ml (23%) 110 Sucrose 15 g (15%)

111 0.5 M CaCl2 0.75 ml (3.75 mM)

112 dH2O to 100 mL 113 Filter sterilize 114 115 Regeneration Solution 116 30% BSW 192 mL (23%) 117 10X YPC 25 mL (1X) 118 Sucrose 37.5 g (15%)

119 dH2O to 250 mL 120 Filter sterilize 121 122 Transformant Dillution Solution 123 30% SW 192 mL (23%) 124 Sucrose 37.5 g (15%)

125 dH2O to 250 mL 126 Filter sterilize 127 128 Agar plates: After autoclaving the media, allow to cool to ~ 60 °C with stirring before 129 adding components. Add the corresponding volume of pravastatin stock to make the final 130 concentration required for each plate. Figure S1. Growth of pJWID1 transformed and non-transformed Hrr. lacusprofundi in the presence of pravastatin. Transformed and non-transformed cells exhibited a large difference in their ability to grow on pravastatin containing solid media. Transformation was effective when selecting on plates using 2.5 µg mL-1 pravastatin. Growth assessments were semi-quantiative: ++++, > 100 colonies; +++, ≤ 100 colonies; ++, ≤ 50 colonies; +, ≤ 10 colonies; -, no visible growth; nd, not determined. Figure S1

Type Pravastatin concentration µg mL-1

0 0.05 0.5 1 2.5 5 7.5 10 15 20

WTpJWID1 ++++ nd nd ++++ ++++ +++ ++ + + +

WT_control ++++ ++++ + + ------

WTpJWID1

WT_control

Pravastatin 0 0.05 0.5 1 2.5 7.5 10 (µg mL-1) Figure S2. Effect of plasmid concentration on transformation efficiency of pJWID1 in Hrr. lacusprofundi. The transformation efficiency was calculated using different concentrations of plasmid, performing a dilution series and counting colonies only on plates containing 30 – 300 colonies, and expressing transformation efficiency as the number of transformants per µg of pJWID1 DNA. Pravastatin was used for selection of transformants at a concentration of 2.5 µg mL-1.

Figure S3. Stability of pJWID1 in Hrr. lacusprofundi. A. The plasmid pJWID1 remained stable in transformed cells if selection pressure (2.5 µg mL-1) was maintained. Plates show the pravastatin resistance (2.5 µg mL-1) of colonies after cultures were grown in the presence of pravastatin (2.5 µg mL-1). B. The plasmid pJWID1 was not maintained in Hrr. lacusprofundi without pravastatin selection. Plates show all colonies grown in media lacking pravastatin were unable to grow when subcultured on pravastatin (2.5 µg mL-1) containing media. C. Wild-type Hrr. lacusprofundi cells were not resistant to pravastatin (2.5 µg mL-1). As a control wild-type cells not harboring the plasmid only grew on plates that did not contain pravastatin. Figure S3 A. with selection pressure (WTpJWID1)

+ 2.5 µg mL-1 pravastatin - pravastatin

B. without selection pressure (WTpJWID1)

+ 2.5 µg mL-1 pravastatin - pravastatin

C. negative control WT

+ 2.5 µg mL-1 pravastatin - pravastatin

Figure S4. Microscopy assessment of Hrr. lacusprofundi cells harboring plasmid pJWID1 following tryptophan induction of GFP expression. With tryptophan induction, particularly at the highest concentration tested (3 mM), fluorescence microscopy revealed fluorescing Hrr. lacusprofundi transformed cells. Bright field images provided for comparison. The bar represents 50 µm. Figure S4

Bright field Fluorescence

control

pJWID1 +0 mM Trp

pJWID1 + 3 mM Trp Figure S5. PCR assessment of recombination events in Hrr. lacusprofundi during the construction of the amd3 gene disruption. Pravastatin resistant colonies amplified by PCR using primers: P1 (upper panel), P2 (lower panel). Lane M, 1 kb DNA ladder; Lane N, no DNA (negative control); Lane WT, untransformed Hrr. lacusprofundi; Lane C1-C10, randomly picked transformed colonies. Both C1 and C2 failed to show a band with P1 and P2 primers, consistent with them arising from a double recombination event (also see Fig. 3). Figure S5

M N WT C1 C2 C3 C4 C5 C6 C7 C8 C9 C10

4000 4036 bp 2000 1000

M N WT C1 C2 C3 C4 C5 C6 C7 C8 C9 C10

2000 2382 bp 1500 Figure S6. GFP expression in Hrr. lacusprofundi wild-type harboring pJWID1 or pJWID1_amd3. Fluorescence was measured after 3, 5 and 7 d: pJWID1, 0 mM tryptophan (horizontal stripes); pJWID1, 3 mM tryptophan (solid grey); pJWID1_amd3, 0 mM tryptophan (white); pJWID1_amd3, 3 mM tryptophan (black). The plasmids were maintained using 2.5 µg mL-1 pravastatin. Fluorescence from pJWID1_amd3 was lower than pJWID1. Error bars represent standard error of three replicate cultures.

Figure S7. Number of Amd/Fmd sequences within OUT0.9 clusters for Archaea and Bacteria. A. Archaea; B. Bacteria. Figure S7 Figure S8. Maximum likelihood cladogram for Amd/Fmd sequences from Archaea and Bacteria. A total of 1323 clusters (OTU0.9) are shown. Clade 1, green lines; Clade II, blue lines; Clade III, red lines; Archaeal sequences within clades, black lines. The eight Amd/Fmd sequences from the Deep Lake haloarchaea are labelled: B9LQ06 (Amd1); B9LQH3 (Amd2); B9LRY7 (Amd3); G2MFV3 (Halar_0731); G2MKL2 (Halar_1208); G2MN64 (Halar_3390); halTADL_0419; halTADL_2650. The phylogenetic tree was tested by 1000 bootstraps, and the separation of three clades was supported by a bootstrap value of 0.996. A0A0U0GMU7 Bacteria Bacilli Streptococcus pneumoniae 1.000 A0A0U0N2N0 Bacteria Bacilli Streptococcus pneumoniae

D4BHN1 Bacteria Gammaproteobacteria Citrobacter youngae

E8V7P8 Bacteria Acidobacteriia Terriglobus saanensis

J2G490 Bacteria Alphaproteobacteria Caulobacter sp.

A3D4Y9 Bacteria Gammaproteobacteria Shewanella baltica

0.894 A0A0G9HHU7 Bacteria Gammaproteobacteria Luteibacter rhizovicinus 0.978 0.559 A0A0R0AVP9 Bacteria Gammaproteobacteria Stenotrophomonas panacihumi 0.763 0.985 0.992 A0A0Q5IWL7 Bacteria Gammaproteobacteria Xanthomonas sp. A0A0K1JVD8 Bacteria Betaproteobacteria Massilia sp.

0.982 A0A0J6G1U9 Bacteria Gammaproteobacteria Xanthomonas axonopodis 0.879 A0A0R0CA92 Bacteria Gammaproteobacteria Stenotrophomonas humi 1.000 0.989 A0A0R0C3P2 Bacteria Gammaproteobacteria Stenotrophomonas terrae 0.401 0.988 0.993 A0A0R0BNV9 Bacteria Gammaproteobacteria Stenotrophomonas nitritireducens 0.998 0.924 A0A0D0JGA4 Bacteria Gammaproteobacteria Stenotrophomonas maltophilia 0.537 A0A031HAV3 Bacteria Gammaproteobacteria Stenotrophomonas sp. 0.912 H8N1C9 Bacteria delta/epsilon subdivisions Corallococcus coralloides

0.979 L7U3W2 Bacteria delta/epsilon subdivisions Myxococcus stipitatus 0.973 A0A0F7BTA2 Bacteria delta/epsilon subdivisions Myxococcus fulvus 0.925 A0A0H4WTC8 Bacteria delta/epsilon subdivisions Myxococcus sp.

I3ZFM7 Bacteria Acidobacteriia Terriglobus roseus 0.937 Q01VE0 Bacteria Solibacteres Solibacter usitatus 0.834 0.766 I3ZJ29 Bacteria Acidobacteriia Terriglobus roseus E8X708 Bacteria Acidobacteriia Granulicella tundricola 0.984 Q01Z87 Bacteria Solibacteres Solibacter usitatus

Q028Q2 Bacteria Solibacteres Solibacter usitatus 1.000 L0DLR1 Bacteria Planctomycetia Singulisphaera acidiphila 0.937 F5LHZ6 Bacteria Bacilli Paenibacillus sp.

A0A0S7ZR49 Bacteria Spirochaetia Spirochaetes bacterium

A0A0P0Z5B7 Bacteria Alphaproteobacteria Aurantimonas manganoxydans

J1T788 Bacteria Alphaproteobacteria Rhizobium sp. 0.996 0.999 A0A0B4X599 Bacteria Alphaproteobacteria Rhizobium gallicum 0.973 Q2K214 Bacteria Alphaproteobacteria Rhizobium etli

0.929 B8R8V4 Bacteria uncultured bacterium uncultured bacterium 0.705 0.075 0.998 B9JJ01 Bacteria Alphaproteobacteria Agrobacterium radiobacter 0.998 0.990 L0LT70 Bacteria Alphaproteobacteria Rhizobium tropici

A0A0F5L9A0 Bacteria Alphaproteobacteria Devosia soli 1.000 A0A087LZM5 Bacteria Alphaproteobacteria Devosia riboflavina 0.955 A0A0F5FZV7 Bacteria Alphaproteobacteria Devosia geojensis

0.931 0.260 A0A0Q7DJW9 Bacteria Alphaproteobacteria Devosia sp. 0.922 0.032 A0A090EK45 Bacteria Alphaproteobacteria Mesorhizobium plurifarium

A0A0Q3KFJ2 Bacteria Alphaproteobacteria Bosea thiooxidans 1.000 A0A085FDS6 Bacteria Alphaproteobacteria Bosea sp. 0.992 0.579 A0A0Q9IYN7 Bacteria Alphaproteobacteria Bosea sp.

I4YYF6 Bacteria Alphaproteobacteria Microvirga lotononidis

A0A0P9D106 Bacteria unclassified Chloroflexi Kouleothrix aurantiaca 0.955 D3PTT0 Bacteria Deinococci Meiothermus ruber 0.993 D7BBR3 Bacteria Deinococci Meiothermus silvanus

C0CY33 Bacteria Clostridia Clostridium asparagiforme]

A0A090HXA4 Bacteria Clostridia Peptoniphilus sp.

B6WRY6 Bacteria delta/epsilon subdivisions Desulfovibrio piger 0.629 0.252 F4LVF2 Bacteria Clostridia Tepidanaerobacter acetatoxydans 0.838 0.986 K0AUR3 Bacteria Clostridia Clostridium acidurici 0.991 0.736 X4ZFZ9 Bacteria Bacilli Paenibacillus sabinae

1.000 A0A0P9EWE1 Bacteria Bacilli Alicyclobacillus ferrooxydans 0.953 A0A0A8JHZ8 Bacteria Bacilli Bacillus sp.

S6A8A8 Bacteria Spirochaetia Treponema pedis 0.297 0.730 A0A095XJM6 Bacteria Tissierellia Tissierellia bacterium

0.992 R7PPW8 Bacteria Negativicutes Dialister sp. 0.882 1.000 F2BXY1 Bacteria Negativicutes Dialister micraerophilus 0.917 F2BXY7 Bacteria Negativicutes Dialister micraerophilus

R5CGT4 Bacteria Bacilli Firmicutes bacterium 0.933 0.401 R5FQS8 Bacteria Erysipelotrichia Coprobacillus sp.

A0A0A8B5R5 Bacteria Coriobacteriia Coriobacteriaceae bacterium

0.998 C8WNS8 Bacteria Coriobacteriia Eggerthella lenta 0.981 S6CCX0 Bacteria Coriobacteriia Adlercreutzia equolifaciens

E7NT13 Bacteria Spirochaetia Treponema phagedenis

0.984 F2I7U9 Bacteria Bacilli Aerococcus urinae 0.977 0.409 V6Z435 Bacteria Bacilli Streptococcus agalactiae A0A0B8PLW0 Bacteria Gammaproteobacteria Vibrio sp. 0.298 1.000 A0A0B8QH80 Bacteria Gammaproteobacteria Vibrio sp.

B2A6V0 Bacteria Clostridia Natranaerobius thermophilus

D7WBF4 Bacteria Actinobacteria Corynebacterium genitalium

A0A099RNI5 Bacteria Clostridia Clostridium sp. 0.885 A0A0L0WAD5 Bacteria Clostridia Clostridium purinilyticum 0.992 0.935 A0A0L0QLR8 Bacteria Bacilli Virgibacillus pantothenticus 0.394 W1SIC2 Bacteria Bacilli Bacillus vireti 0.930 A0A0K9YS67 Bacteria Bacilli Brevibacillus reuszeri

0.476 E7GRZ9 Bacteria Clostridia Clostridium symbiosum 0.999 A0A0U5P8H4 Bacteria Clostridia Clostridium sp.

0.246 C0DAC8 Bacteria Clostridia Clostridium asparagiforme]

0.926 0.993 A0A0F0CDU7 Bacteria Clostridia Clostridium sp. 0.927 0.991 C5ET20 Bacteria Clostridia Clostridiales bacterium

U2CL10 Bacteria Clostridia Clostridium sp. 1.000 0.630 C6JL50 Bacteria Fusobacteriia Fusobacterium varium B0A6Z2 Bacteria Clostridia Intestinibacter bartlettii

A0A0M0KC05 Bacteria Bacilli Bacillus okuhidensis 0.939 C1D2F8 Bacteria Deinococci Deinococcus deserti

A0A0J1FF27 Bacteria Clostridia Peptococcaceae bacterium

A0A074LK10 Bacteria Bacilli Tumebacillus flagellatus 0.942 K8E559 Bacteria Bacilli Carnobacterium maltaromaticum 0.838 0.981 C0DYE9 Bacteria Betaproteobacteria Eikenella corrodens

0.919 A0A0G3CHN9 Bacteria Gammaproteobacteria Pragia fontium 0.736 0.999 0.000 A0A085HGD8 Bacteria Gammaproteobacteria Leminorella grimontii 0.937 A0A095VJA4 Bacteria Gammaproteobacteria Tatumella morbirosei

0.993 0.969 A0A0E0WTU5 Bacteria Gammaproteobacteria Klebsiella oxytoca

0.156 A0A0F7H7P6 Bacteria Gammaproteobacteria Serratia fonticola 1.000 A0A084A3V0 Bacteria Gammaproteobacteria Serratia sp. 0.683 A0A0J8VSQ1 Bacteria Gammaproteobacteria Cronobacter sp.

A0A069CY99 Bacteria Bacilli Weissella oryzae 0.534 A0A078MGR1 Bacteria Bacilli Lysinibacillus sp. 0.997 0.916 A0A099WIJ2 Bacteria Bacilli Listeriaceae bacterium 0.995 W7DGE5 Bacteria Bacilli Listeria riparia

0.945 W7BJP4 Bacteria Bacilli Listeria cornellensis 0.943 W7D275 Bacteria Bacilli Listeria rocourtiae 0.517 0.944 W7BU70 Bacteria Bacilli Listeria grandensis 0.958 E3ZTR7 Bacteria Bacilli Listeria seeligeri

1.000 A0ALT9 Bacteria Bacilli Listeria welshimeri A0A0P6T581 Bacteria Bacilli Listeria monocytogenes 0.920 0.175 A0A0K0YVS4 Bacteria Bacilli Listeria monocytogenes 0.726 0.982 1.000 0.879 A0A0B8RIJ4 Bacteria Bacilli Listeria monocytogenes E3YTE8 Bacteria Bacilli Listeria marthii

A0A084H9I1 Bacteria Bacilli Bacillus sp.

0.695 A0A0D1Y1Y9 Bacteria Bacilli Aneurinibacillus migulanus

0.000 A0A073K892 Bacteria Bacilli Bacillus gaemokensis

1.000 A0A090Z2L8 Bacteria Bacilli Bacillus mycoides C2UE76 Bacteria Bacilli Bacillus cereus 0.703 0.252 1.000 A0A0K6M2H0 Bacteria Bacilli Bacillus cereus 0.982 A9VHN1 Bacteria Bacilli Bacillus weihenstephanensis 0.916 0.922 A0A0D6S4G9 Bacteria Bacilli Bacillus mycoides F6B5A8 Bacteria Clostridia Desulfotomaculum nigrificans

A0A0P9EV91 Bacteria Bacilli Alicyclobacillus ferrooxydans

0.966 D5WY30 Bacteria Bacilli Kyrpidia tusciae

0.916 J9HP82 Bacteria Bacilli Alicyclobacillus hesperidum 0.867 B7DMZ6 Bacteria Bacilli Alicyclobacillus acidocaldarius 1.000 C8WU54 Bacteria Bacilli Alicyclobacillus acidocaldarius

A9BH43 Bacteria Thermotogae Petrotoga mobilis

M5E398 Bacteria Clostridia Halanaerobium saccharolyticum

0.980 E4RJW6 Bacteria Clostridia Halanaerobium hydrogeniformans 0.290 0.997 M5EDK1 Bacteria Clostridia Halanaerobium saccharolyticum M5DY49 Bacteria Clostridia Halanaerobium saccharolyticum

0.998 E3DP37 Bacteria Clostridia Halanaerobium praevalens 0.116 M5DXP2 Bacteria Clostridia Halanaerobium saccharolyticum

W7YXC2 Bacteria Bacilli Bacillus sp. 0.999 A0A061P4B6 Bacteria Bacilli Geomicrobium sp.

G2TQT2 Bacteria Bacilli Bacillus coagulans

A0A0J6FYA9 Bacteria Bacilli Anaerobacillus macyae 0.007 0.858 W4F7E0 Bacteria Bacilli Viridibacillus arenosi 1.000 W4Q7Y9 Bacteria Bacilli Bacillus wakoensis A0A0A8JJT8 Bacteria Bacilli Bacillus sp. 0.936 0.769 M7NGX0 Bacteria Bacilli Bhargavaea cecembensis

0.500 0.338 A0A098EHA8 Bacteria Bacilli Planomicrobium sp. 0.974 1.000 A0A0U2Z847 Bacteria Bacilli Planococcus rifietoensis

A0A0D6Z7R5 Bacteria Bacilli Bacillus subterraneus 0.885 0.959 A0A023CKZ7 Bacteria Bacilli Geobacillus stearothermophilus 1.000 A0A0N0I478 Bacteria Bacilli Geobacillus sp.

S9UMC8 Bacteria Bacilli Paenibacillus alvei 0.986 0.909 A6CMG9 Bacteria Bacilli Bacillus sp.

0.949 A0A0V8HDP4 Bacteria Bacilli Bacillus enclensis 0.994 A0A0D6Z5S8 Bacteria Bacilli Bacillus subterraneus 0.812 0.241 K2GF64 Bacteria Bacilli Salimicrobium jeotgali 0.977 A0A0B5AUD8 Bacteria Bacilli Jeotgalibacillus sp. 0.996 A0A0C2VQG1 Bacteria Bacilli Jeotgalibacillus alimentarius

A0A0F7HNU4 Bacteria Bacilli Salinicoccus halodurans 0.852 1.000 A0A0M2SLY2 Bacteria Bacilli Salinicoccus sp. 0.998 A0A078LZA8 Bacteria Bacilli Jeotgalicoccus sp. 0.987 A0A0M2SGX8 Bacteria Bacilli Salinicoccus sp. 0.990 A0A0F7D3P7 Bacteria Bacilli Salinicoccus halodurans

C7N1R6 Bacteria Coriobacteriia Slackia heliotrinireducens

1.000 D0WH77 Bacteria Coriobacteriia Slackia exigua

0.371 0.992 A0A0A8B1V6 Bacteria Coriobacteriia Coriobacteriaceae bacterium

0.019 S6C649 Bacteria Coriobacteriia Adlercreutzia equolifaciens 0.656 F0HMS9 Bacteria Coriobacteriia Eggerthella sp. 0.010 D6E822 Bacteria Coriobacteriia Gordonibacter pamelaeae

A0A0F2J9Y0 Bacteria Clostridia Desulfosporosinus sp.

Q8R8S5 Bacteria Clostridia Caldanaerobacter subterraneus

D9TSC9 Bacteria Clostridia Thermoanaerobacterium thermosaccharolyticum 0.973 0.983 0.838 0.999 F6BJW9 Bacteria Clostridia Thermoanaerobacterium xylanolyticum 0.968 0.974 I3VXL9 Bacteria Clostridia Thermoanaerobacterium saccharolyticum 0.834 B0K6C6 Bacteria Clostridia Thermoanaerobacter sp. 0.956 M8CV11 Bacteria Clostridia Thermoanaerobacter thermohydrosulfuricus

H9U9W0 Bacteria Thermotogae Fervidobacterium pennivorans 1.000 H9UBG0 Bacteria Thermotogae Fervidobacterium pennivorans

0.995 T4W9Q9 Bacteria Clostridia Clostridium bifermentans

1.000 T2RCI2 Bacteria Clostridia Clostridium sordellii 0.784 0.994 A0A0C7RBS9 Bacteria Clostridia Clostridium sordellii 0.652 T2RDK0 Bacteria Clostridia Clostridium sordellii

D2Z646 Bacteria Synergistia Dethiosulfovibrio peptidovorans 0.989 M1ZKE6 Bacteria Clostridia Clostridium ultunense 0.999 M1ZAP7 Bacteria Clostridia Clostridium ultunense

Q9WXX3 Bacteria Thermotogae Thermotoga maritima 1.000 A0A0B5KW32 Bacteria Thermotogae Thermotoga sp. 0.988 0.990 A0A0X1KP16 Bacteria Thermotogae Pseudothermotoga hypogea 0.899 A8F665 Bacteria Thermotogae Pseudothermotoga lettingae 0.753 F7YUP8 Bacteria Thermotogae Pseudothermotoga thermarum

0.792 B1L5R6 Archaea Candidatus Korarchaeota Korarchaeum cryptofilum

A0A0U3QX51 Archaea Thermococci Thermococcus sp.

A0A0U3QM70 Archaea Thermococci Thermococcus sp.

I3RDR9 Archaea Thermococci Pyrococcus sp. 0.195 0.478 0.544 0.908 0.682 I6UPX8 Archaea Thermococci Pyrococcus furiosus 0.965 G8ZI83 Archaea Thermococci Pyrococcus abyssi 0.805 0.089 F0LH46 Archaea Thermococci Thermococcus barophilus 0.954 0.987 F8AJ17 Archaea Thermococci Pyrococcus yayanosii

A0A0U3SXP5 Archaea Thermococci Thermococcus sp.

B8D4K7 Archaea Thermoprotei Desulfurococcus kamchatkensis

0.971 A0A0T5XF32 Bacteria Synergistia Anaerobaculum hydrogeniformans 1.000 I4BWH1 Bacteria Synergistia Anaerobaculum mobile

I2F1P4 Bacteria Thermotogae Mesotoga prima

A0A0Q3X0I7 Bacteria Bacilli Bacillus shackletonii 0.918 1.000 0.750 G2TLF5 Bacteria Bacilli Bacillus coagulans 0.948 A0A090I143 Bacteria Clostridia Peptoniphilus sp.

0.990 C3W9D7 Bacteria Fusobacteriia Fusobacterium mortiferum

0.987 J0N4J7 Bacteria Clostridia Clostridium sp. 0.337 D1Y816 Bacteria Synergistia Pyramidobacter piscolens 0.032 R6J752 Bacteria Negativicutes Phascolarctobacterium sp.

D5XE92 Bacteria Clostridia Thermincola potens

0.748 A6TSA4 Bacteria Clostridia Alkaliphilus metalliredigens 0.916 C2L081 Bacteria Clostridia Oribacterium sinus 0.914 1.000 E6LQL4 Bacteria Clostridia Lachnoanaerobaculum saburreum

B9Y820 Bacteria Erysipelotrichia Holdemania filiformis 0.916 V6M9F5 Bacteria Bacilli Brevibacillus panacihumi

M0ELL2 Archaea Halobacteria Halorubrum coriense

M0EMT0 Archaea Halobacteria Halorubrum coriense 0.992 0.341 A0A0N0BSD6 Archaea Halobacteria Halorubrum sp. 0.130 M0DDR9 Archaea Halobacteria Halorubrum tebenquichense 0.814 0.908 V6DXR2 Archaea Halobacteria Halorubrum sp.

0.915 M0NMB0 Archaea Halobacteria Halorubrum lipolyticum 0.517 B9LQ06 (Amd1) Archaea Halobacteria Halorubrum lacusprofundi

M0NJM7 Archaea Halobacteria Halorubrum lipolyticum 0.117 V4Y654 Archaea uncultured archaeon uncultured archaeon 0.981 0.783 Q5UWY2 Archaea Halobacteria Haloarcula marismortui 0.975 V4HDB2 Archaea Halobacteria Candidatus Halobonum

Q18I60 Archaea Halobacteria Haloquadratum walsbyi 0.940 0.567 G0HZ40 Archaea Halobacteria Haloarcula hispanica 0.892 V4YGB4 Archaea uncultured archaeon uncultured archaeon 0.493 M0MM18 Archaea Halobacteria Halococcus morrhuae

M0L4W7 Archaea Halobacteria Halobiforma nitratireducens

A0A0P7I2U5 Archaea Halobacteria Halolamina pelagica 1.000 0.984 G2MKL2 (Halar_1208) Archaea Halobacteria halophilic archaeon DL31

L9X959 Archaea Halobacteria Natronococcus amylolyticus 1.000 L0K0E7 Archaea Halobacteria Natronococcus occultus 0.853 D3SS61 Archaea Halobacteria Natrialba magadii

0.996 M0AZK2 Archaea Halobacteria Natrialba asiatica 0.988 0.209 M0B3I3 Archaea Halobacteria Natrialba aegyptia 0.999 0.572 L0IDI1 Archaea Halobacteria Halovivax ruber L0AMK2 Archaea Halobacteria Natronobacterium gregoryi 0.913 0.982 M0LYQ5 Archaea Halobacteria Halobiforma lacisalsi

0.481 F8D8L6 Archaea Halobacteria Halopiger xanaduensis

0.944 0.780 L9WUZ8 Archaea Halobacteria Natronolimnobius innermongolicus

L9VUS2 Archaea Halobacteria Natronorubrum tibetense

A0A0S7CVI1 Bacteria Actinobacteria Arthrobacter sp.

S5SSG9 Bacteria Actinobacteria Corynebacterium maris

0.986 0.884 A0A0Q9LYB5 Bacteria Actinobacteria Phycicoccus sp. 0.872 A0A0Q9KU51 Bacteria Actinobacteria Knoellia sp.

0.998 A0A0J1EZH4 Bacteria Actinobacteria Kocuria sp.

A0A0B8ZWF2 Bacteria Actinobacteria Brevibacterium linens 0.665 0.790 A0A095Y4K2 Bacteria Actinobacteria Actinomyces sp.

A0A0Q5JB00 Bacteria Actinobacteria Agreia sp.

0.294 0.965 A0A0Q5L5Z1 Bacteria Actinobacteria Frigoribacterium sp. 0.737 0.926 A0A0N1M1I0 Bacteria Actinobacteria Frigoribacterium sp. 0.790 A0A0N6ZY07 Bacteria Actinobacteria Curtobacterium sp. 0.842 0.999 A0A022LU94 Bacteria Actinobacteria Curtobacterium flaccumfaciens

E8N7C9 Bacteria Actinobacteria Microbacterium testaceum 0.987 A0A074UKM0 Bacteria Actinobacteria Microbacterium sp. 0.722 A0A0Q4DQ50 Bacteria Actinobacteria Microbacterium sp.

R5F4Z9 Bacteria Clostridia Clostridium bolteae

A0A0P9EEU1 Archaea unclassified Candidatus Bathyarchaeota Bathyarchaeota archaeon

A0A0G1JX24 Bacteria unclassified Candidatus Peregrinibacteria Peregrinibacteria bacterium

A0A0J5G0H6 Bacteria Actinobacteria Rhodococcus fascians

0.289 A0A0D6IBR7 Bacteria Actinobacteria Mycobacterium smegmatis 0.963 A0A0M2CR68 Bacteria Actinobacteria Kocuria sp.

U7MMJ3 Bacteria Actinobacteria Corynebacterium sp. 0.995 E0MZB8 Bacteria Actinobacteria Corynebacterium accolens 0.964 W5WQF0 Bacteria Actinobacteria Corynebacterium falsenii

0.992 A8ZM75 Bacteria Oscillatoriophycideae Acaryochloris marina 0.535 A0A0W0ZP21 Bacteria Gammaproteobacteria Legionella tucsonensis 0.225 A0A071LR89 Bacteria Gammaproteobacteria Mangrovibacter sp. 0.709 0.863 Q7N278 Bacteria Gammaproteobacteria Photorhabdus luminescens 0.996 0.998 Q6N8I0 Bacteria Alphaproteobacteria Rhodopseudomonas palustris 0.961 Q3AGE4 Bacteria Oscillatoriophycideae Synechococcus sp. 1.000 0.632 0.970 0.417 F1YUN4 Bacteria Alphaproteobacteria Acetobacter pomorum A0A086XUR5 Bacteria Alphaproteobacteria Paenirhodobacter enshiensis

G7HTY0 Bacteria Actinobacteria Corynebacterium casei

Q72CW9 Bacteria delta/epsilon subdivisions Desulfovibrio vulgaris

G2TLJ4 Bacteria Bacilli Bacillus coagulans 0.941 0.999 A0RHV8 Bacteria Bacilli Bacillus thuringiensis 0.079 0.963 A0A0B6B0D8 Bacteria Bacilli Bacillus megaterium 0.187 F7V7J1 Bacteria Clostridia Clostridium sp. 0.995 O25836 Bacteria delta/epsilon subdivisions Helicobacter pylori

D0L147 Bacteria Gammaproteobacteria Halothiobacillus neapolitanus

A0A0C2HN13 Bacteria Bacilli Salinicoccus roseus

A0A0Q7V5W4 Bacteria Alphaproteobacteria Mesorhizobium sp. 0.934 U2EP64 Bacteria Gammaproteobacteria Salinisphaera shabanensis

B4WNN3 Bacteria Oscillatoriophycideae Synechococcus sp. 0.851 0.998 K9F622 Bacteria Oscillatoriophycideae Leptolyngbya sp. 0.212 0.205 0.562 A0A0P7ZIL6 Bacteria Oscillatoriophycideae Phormidesmis priestleyi A0A0N7Z4V1 Bacteria Oscillatoriophycideae Leptolyngbya sp. 0.978 0.984 A0A0C1X662 Bacteria Nostocales Scytonema millei 0.575 K9XAJ1 Bacteria Oscillatoriophycideae Gloeocapsa sp. 0.893 K9SK57 Bacteria Oscillatoriophycideae Pseudanabaena sp.

W6KAK6 Bacteria Alphaproteobacteria Magnetospira sp.

A0A0M6YTV2 Bacteria Alphaproteobacteria Labrenzia alba 0.977 F2IWR6 Bacteria Alphaproteobacteria Polymorphum gilvum

A0A058ZKK1 Bacteria Alphaproteobacteria Actibacterium atlanticum 0.914 0.883 A0A095DLF5 Bacteria Alphaproteobacteria Rhodovulum sp. 0.578 0.492 0.740 F7ZEL0 Bacteria Alphaproteobacteria Roseobacter litoralis

0.000 A0A037ZIU7 Bacteria Alphaproteobacteria Actibacterium mucosum 0.902 0.308 B7RHN0 Bacteria Alphaproteobacteria Roseobacter sp. 1.000 A0A085BYS3 Bacteria Alphaproteobacteria Sulfitobacter sp.

A0A0D6P5I7 Bacteria Alphaproteobacteria Acidisphaera rubrifaciens 0.898 A0A0J6VCE5 Bacteria Alphaproteobacteria Methylobacterium aquaticum 0.892 A0A0Q5DM82 Bacteria Alphaproteobacteria Methylobacterium sp. 0.515 A0A0Q4Z4T4 Bacteria Alphaproteobacteria Methylobacterium sp. 0.905 0.724 0.925 B1ZB52 Bacteria Alphaproteobacteria Methylobacterium populi

A0A0P6VPN1 Bacteria Alphaproteobacteria Prosthecomicrobium hirschii

0.951 H0RSM7 Bacteria Alphaproteobacteria Bradyrhizobium sp. 0.942 0.988 W1JRN6 Bacteria Alphaproteobacteria Bradyrhizobium sp. 0.990 Q89H51 Bacteria Alphaproteobacteria Bradyrhizobium diazoefficiens

A0A0Q6CIC6 Bacteria Alphaproteobacteria Aureimonas sp. 0.956 A0A0P0YX21 Bacteria Alphaproteobacteria Aureimonas altamirensis 0.947 0.886 C6BAU6 Bacteria Alphaproteobacteria Rhizobium leguminosarum 0.993 W0IVK4 Bacteria Alphaproteobacteria Rhizobium leguminosarum 1.000 F2AJJ4 Bacteria Alphaproteobacteria Rhizobium etli 0.414 0.591 B9K1J4 Bacteria Alphaproteobacteria Agrobacterium vitis E0MIR2 Bacteria Alphaproteobacteria Ahrensia sp.

0.937 A0A0Q7DNR8 Bacteria Alphaproteobacteria Devosia sp. 0.974 A0A0F5FN71 Bacteria Alphaproteobacteria Devosia chinhatensis

W6QY63 Bacteria Gammaproteobacteria Pseudomonas pseudoalcaligenes

F2ZKC5 Bacteria Gammaproteobacteria Pseudomonas coronafaciens 0.070 0.491 F3FD11 Bacteria Gammaproteobacteria Pseudomonas syringae 0.174 1.000 Q887D9 Bacteria Gammaproteobacteria Pseudomonas syringae 0.900 A0A0P9RZ34 Bacteria Gammaproteobacteria Pseudomonas amygdali

A0A0J4QSW0 Bacteria Gammaproteobacteria Klebsiella pneumoniae 1.000 0.880 H0JJB8 Bacteria Gammaproteobacteria Pseudomonas psychrotolerans

K0CBZ1 Bacteria Gammaproteobacteria Alcanivorax dieselolei

A0A0L6TAH1 Bacteria Betaproteobacteria Methylibium sp.

A0A0P8Z5W9 Bacteria Betaproteobacteria Variovorax paradoxus 0.820 0.844 0.987 E6V1D7 Bacteria Betaproteobacteria Variovorax paradoxus 0.329 T1X3G9 Bacteria Betaproteobacteria Variovorax paradoxus 0.511 A0A0Q4XXN7 Bacteria Betaproteobacteria Pseudorhodoferax sp.

0.878 H5WRD7 Bacteria Betaproteobacteria Burkholderiales bacterium 0.355 0.105 0.999 D6CNT8 Bacteria Betaproteobacteria Thiomonas arsenitoxydans 0.931 A0A0N1AG70 Bacteria Betaproteobacteria beta proteobacterium

A0A069PWU7 Bacteria Betaproteobacteria Burkholderia glathei 0.979 0.478 K8RBL4 Bacteria Betaproteobacteria Burkholderia sp. A0A014NGF4 Bacteria Betaproteobacteria Comamonas aquatica

F8I9C2 Bacteria Clostridia Sulfobacillus acidophilus

A0A0F0FVF1 Bacteria Betaproteobacteria Burkholderiaceae bacterium

U1UQD8 Bacteria Gammaproteobacteria Pseudomonas fluorescens 1.000 J1ID26 Bacteria Gammaproteobacteria Pseudomonas sp. 0.786 A0A024EKU3 Bacteria Gammaproteobacteria Pseudomonas mandelii 0.999 0.945 Q3KEI3 Bacteria Gammaproteobacteria Pseudomonas fluorescens 0.752 W0V236 Bacteria Betaproteobacteria Janthinobacterium agaricidamnosum

0.031 W6XN35 Bacteria Betaproteobacteria Burkholderia sp. 0.936 0.586 0.126 A0A069PFM9 Bacteria Betaproteobacteria Burkholderia glathei 0.875 F2LJQ8 Bacteria Betaproteobacteria Burkholderia gladioli

Q3K469 Bacteria Gammaproteobacteria Pseudomonas fluorescens

R7X393 Bacteria Betaproteobacteria Pandoraea sp. 1.000 A0A081V7J2 Bacteria Betaproteobacteria Burkholderia cepacia 0.115 U3A616 Bacteria Alphaproteobacteria Novosphingobium tardaugens

1.000 A0A0N0KCJ7 Bacteria Alphaproteobacteria Novosphingobium sp. 0.731 0.965 A0A0M3AP90 Bacteria Alphaproteobacteria Sphingobium chungbukense 0.999 A0A0C5XRU2 Bacteria Alphaproteobacteria Sphingobium sp.

W0JJ06 Archaea Halobacteria Halostagnicola larsenii 0.642 L0IDL6 Archaea Halobacteria Halovivax ruber 0.996 M0BBI3 Archaea Halobacteria Halovivax asiaticus

0.995 G2MFV3 (Halar_0731) Archaea Halobacteria halophilic archaeon DL31 0.911 V6DYK1 Archaea Halobacteria Halorubrum sp. 0.976 0.100 A0A0U5H7R1 Archaea Halobacteria Halobacterium hubeiense

1.000 V4YE91 Archaea uncultured archaeon uncultured archaeon

0.810 M0KP71 Archaea Halobacteria Haloarcula amylolytica 0.987 0.637 M0JHL1 Archaea Halobacteria Haloarcula vallismortis 0.988 B9LQH3 (Amd2) Archaea Halobacteria Halorubrum lacusprofundi

L0JN35 Archaea Halobacteria Natrinema pellirubrum 0.891 0.941 A0A063V1M3 Archaea Halobacteria Haloterrigena sp. 0.878 M0CS02 Archaea Halobacteria Haloterrigena limicola 0.733 M0BYU9 Archaea Halobacteria Haloterrigena salina 1.000 D2RWF9 Archaea Halobacteria Haloterrigena turkmenica 1.000 M0A9M7 Archaea Halobacteria Natrialba chahannaoensis

0.102 L9WN08 Archaea Halobacteria Natronococcus jeotgali 0.834 L0JWX6 Archaea Halobacteria Natronococcus occultus

M0LIC3 Archaea Halobacteria Halobiforma lacisalsi 0.308 D3SZ09 Archaea Halobacteria Natrialba magadii 0.623 L0AGV7 Archaea Halobacteria Natronobacterium gregoryi 0.941 M0MT96 Archaea Halobacteria Halococcus morrhuae

halTADL 0419 Archaea Halobacteria Halohasta litchfieldiae tADL

0.725 0.789 M0H308 Archaea Halobacteria Haloferax lucentense 0.996 0.713 M0JB25 Archaea Halobacteria Haloferax denitrificans 0.937 0.930 Q18J36 Archaea Halobacteria Haloquadratum walsbyi 0.925 1.000 U1PZP8 Archaea Halobacteria Haloquadratum sp. 0.923 1.000 Q5V394 Archaea Halobacteria Haloarcula marismortui

V4XZF3 Archaea uncultured archaeon uncultured archaeon

M0B4Y6 Archaea Halobacteria Natrialba asiatica 0.819 0.092 E7QVP5 Archaea Halobacteria Haladaptatus paucihalophilus

0.996 R4W773 Archaea Halobacteria Salinarchaeum sp. 0.527 A0A0F7PB27 Archaea Halobacteria Halanaeroarchaeum sulfurireducens

E4RNB7 Bacteria Clostridia Halanaerobium hydrogeniformans

0.991 A0A0F2S8I5 Bacteria Clostridia Peptococcaceae bacterium

0.900 0.973 F8I9C4 Bacteria Clostridia Sulfobacillus acidophilus

0.384 A0A0F2Q4P6 Bacteria Clostridia Clostridiaceae bacterium 0.923 I4BXM4 Bacteria Synergistia Anaerobaculum mobile 0.996 A0A0T5X7Y5 Bacteria Synergistia Anaerobaculum hydrogeniformans

A0A0M0BL50 Archaea unclassified Crenarachaeota miscellaneous Crenarchaeota 0.851 1.000 A0A0F7DBH6 Archaea Archaeoglobi Geoglobus ahangari 0.476 H3ZQ98 Archaea Thermococci Thermococcus litoralis 0.999 C6A4X7 Archaea Thermococci Thermococcus sibiricus

A0A011STY0 Bacteria Alphaproteobacteria Aquamicrobium defluvii

Q3IWH3 Bacteria Alphaproteobacteria Rhodobacter sphaeroides 0.120 A0A0D6AXX6 Bacteria Alphaproteobacteria Rhodovulum sulfidophilum 0.761 0.986 D5RP35 Bacteria Alphaproteobacteria Roseomonas cervicalis 0.799 0.935 A0A0A0HP76 Bacteria Alphaproteobacteria Roseovarius mucosus

0.397 V7EHX7 Bacteria Alphaproteobacteria Rhodobacter sp. 0.951 0.954 1.000 A8LUH0 Bacteria Alphaproteobacteria Dinoroseobacter shibae 0.833 A6FUS5 Bacteria Alphaproteobacteria Roseobacter sp.

D5BUK7 Bacteria Alphaproteobacteria Puniceispirillum marinum

A0A085TRC4 Bacteria Alphaproteobacteria Thioclava sp.

D1C438 Bacteria Thermomicrobia Sphaerobacter thermophilus 0.716 I0I7G6 Bacteria Caldilineae Caldilinea aerophila 0.777 0.905 D3FEY5 Bacteria Thermoleophilia Conexibacter woesei

0.991 C4WPZ1 Bacteria Alphaproteobacteria Ochrobactrum intermedium 1.000 A0A0Q8T0P4 Bacteria Alphaproteobacteria Ensifer sp. 0.000 A0A0Q6UNF6 Bacteria Alphaproteobacteria Rhizobium sp.

0.913 A0A0B5APZ4 Bacteria Bacilli Jeotgalibacillus sp. 1.000 A0A0B4R9F9 Bacteria Bacilli Planococcus sp.

0.753 I4X6H4 Bacteria Bacilli Planococcus antarcticus 0.975 A0A098EPH2 Bacteria Bacilli Planomicrobium sp. 0.261 C5DA68 Bacteria Bacilli Geobacillus sp. 0.994 A0A0J6D1P6 Bacteria Bacilli Anaerobacillus macyae 0.962 A0A0D6ZE83 Bacteria Bacilli Bacillus subterraneus 0.660 D6XUC3 Bacteria Bacilli Bacillus selenitireducens

0.650 K2GF55 Bacteria Bacilli Salimicrobium jeotgali

0.986 A0A0C2HDT8 Bacteria Bacilli Salinicoccus roseus 1.000 0.951 0.911 A0A0F7HKC5 Bacteria Bacilli Salinicoccus halodurans 0.998 A0A0M2SHP7 Bacteria Bacilli Salinicoccus sp.

A0A0M9WYC2 Bacteria Bacilli Lysinibacillus contaminans

0.994 B1HXL7 Bacteria Bacilli Lysinibacillus sphaericus 0.943 0.123 D7X002 Bacteria Bacilli Lysinibacillus fusiformis 0.034 1.000 X2GGW1 Bacteria Bacilli Lysinibacillus varians A0A0A3IWG9 Bacteria Bacilli Lysinibacillus odysseyi 0.957 0.336 0.925 F2F5B1 Bacteria Bacilli Solibacillus silvestris

M1E5U2 Bacteria Clostridia Thermodesulfobium narugense

0.865 B5Y871 Bacteria Clostridia Coprothermobacter proteolyticus

0.980 F1ZWZ9 Bacteria Clostridia Thermoanaerobacter ethanolicus 0.985 0.657 Q8RCU9 Bacteria Clostridia Caldanaerobacter subterraneus F5SII1 Bacteria Bacilli Desmospora sp. 0.964 V6MBF1 Bacteria Bacilli Brevibacillus panacihumi 0.999 A0A0K9YQ82 Bacteria Bacilli Brevibacillus reuszeri

0.991 K0AYI4 Bacteria Clostridia Clostridium acidurici 0.673 B8DMH2 Bacteria delta/epsilon subdivisions Desulfovibrio vulgaris 0.991 C0QBL1 Bacteria delta/epsilon subdivisions Desulfobacterium autotrophicum

D5WTI6 Bacteria Bacilli Kyrpidia tusciae 0.908 C5EEN8 Bacteria Clostridia Clostridiales bacterium

F8I9C3 Bacteria Clostridia Sulfobacillus acidophilus

A0A0B7MI75 Bacteria Clostridia Syntrophaceticus schinkii

A0A081BWW3 Bacteria unclassified bacteria bacterium UASB270

A0A072CXQ2 Bacteria Alphaproteobacteria Sinorhizobium americanum

0.444 F5JJ11 Bacteria Alphaproteobacteria Agrobacterium sp. 1.000 1.000 0.989 A0A072CJZ4 Bacteria Alphaproteobacteria Sinorhizobium americanum 0.973 A0A0H1ABF3 Bacteria Alphaproteobacteria Mesorhizobium sp. 0.799 A0A0Q6DBU7 Bacteria Alphaproteobacteria Aureimonas sp. 0.336 0.967 I3X3I0 Bacteria Alphaproteobacteria Sinorhizobium fredii D7A1H5 Bacteria Alphaproteobacteria Starkeya novella

0.995 A0A0L6JF22 Bacteria Alphaproteobacteria Methylobacterium sp. 0.756 I0GG92 Bacteria Alphaproteobacteria Bradyrhizobium sp. 0.962 0.938 0.972 A4YYS5 Bacteria Alphaproteobacteria Bradyrhizobium sp.

D5BMC8 Bacteria Alphaproteobacteria Puniceispirillum marinum

0.925 A0A0D2WQ71 Bacteria Alphaproteobacteria Skermanella aerolata 0.999 A0A0D5VPF6 Bacteria Betaproteobacteria Burkholderia fungorum 0.951 A0A0J1CLF6 Bacteria Betaproteobacteria Burkholderia glathei

A6CBV7 Bacteria Planctomycetia Gimesia maris

0.863 L0DDK2 Bacteria Planctomycetia Singulisphaera acidiphila 0.954 0.559 D2R5N0 Bacteria Planctomycetia Pirellula staleyi

A0A0U1KWI8 Bacteria Negativicutes Sporomusa sp.

A5FYF1 Bacteria Alphaproteobacteria Acidiphilium cryptum

A0A0Q5P3Y8 Bacteria Betaproteobacteria Burkholderia sp. 0.886 A0A069PCQ0 Bacteria Betaproteobacteria Burkholderia glathei 0.963 1.000 0.999 A0A060PE73 Bacteria Betaproteobacteria Burkholderia sp. A0A0E3CB19 Bacteria Betaproteobacteria Comamonas testosteroni 0.688 A0A0F6ZJ79 Bacteria Gammaproteobacteria Yersinia enterocolitica

0.604 A0A0P7DCZ5 Bacteria Gammaproteobacteria Pseudomonas putida

0.964 A0A078BIY9 Bacteria Betaproteobacteria Thiomonas sp. 0.806 A0A069PIH6 Bacteria Betaproteobacteria Burkholderia glathei 0.855 0.349 E2RVF2 Bacteria uncultured bacterium uncultured bacterium 1.000 A0A0P9BYA1 Bacteria Betaproteobacteria Variovorax paradoxus 0.977 H5WRF8 Bacteria Betaproteobacteria Burkholderiales bacterium

A0A0R3DNL1 Bacteria Alphaproteobacteria Bradyrhizobium manausense

A0A0D2UBZ3 Bacteria Alphaproteobacteria Skermanella aerolata 0.945 M9RCM9 Bacteria Alphaproteobacteria Octadecabacter antarcticus 1.000 A6FP84 Bacteria Alphaproteobacteria Roseobacter sp. 0.569 A0A0Q7W656 Bacteria Alphaproteobacteria Mesorhizobium sp.

A0A0Q6EPH2 Bacteria Alphaproteobacteria Aurantimonas sp.

0.991 S5XZL0 Bacteria Alphaproteobacteria Paracoccus aminophilus 0.979 0.644 A0A074JNL1 Bacteria Alphaproteobacteria Thioclava pacifica 0.180 0.967 A0A095DJP0 Bacteria Alphaproteobacteria Rhodovulum sp.

0.140 Q212X6 Bacteria Alphaproteobacteria Rhodopseudomonas palustris

0.981 I0GAS6 Bacteria Alphaproteobacteria Bradyrhizobium sp. 0.960 0.886 A5EGM5 Bacteria Alphaproteobacteria Bradyrhizobium sp. 0.481 0.862 A0A0M2J186 Bacteria Actinobacteria Streptomyces mangrovisoli 0.965 0.166 A8IKB3 Bacteria Alphaproteobacteria Azorhizobium caulinodans

0.955 D7A853 Bacteria Alphaproteobacteria Starkeya novella B1M7Z2 Bacteria Alphaproteobacteria Methylobacterium radiotolerans 0.882 0.945 A0A0D6P427 Bacteria Alphaproteobacteria Acidisphaera rubrifaciens

A0A0Q6MVS8 Bacteria Alphaproteobacteria Mesorhizobium sp.

T2L9B5 Bacteria Gammaproteobacteria Halomonas sp.

A0A0U2N0E4 Bacteria Bacilli Paenibacillus naphthalenovorans 0.972 R5GXA0 Bacteria Clostridia Eubacterium sp. 0.998 A0A0C7NMG3 Bacteria Clostridia Moorella glycerini

0.899 A0A023X3D6 Bacteria Rubrobacteria Rubrobacter radiotolerans 0.854 B8FSX8 Bacteria Clostridia Desulfitobacterium hafniense

A0A090GC92 Bacteria Alphaproteobacteria Mesorhizobium plurifarium

0.940 A0A0D8FTY4 Bacteria Acidimicrobiia Ferrimicrobium acidiphilum 0.998 C7M1X7 Bacteria Acidimicrobiia Acidimicrobium ferrooxidans

C7QGJ7 Bacteria Actinobacteria Catenulispora acidiphila 0.982 A0A0C2B0T2 Bacteria Actinobacteria Streptomyces sp. 0.998 A0A0C1XU36 Bacteria Actinobacteria Streptomyces sp. 0.987 0.447 A0A0F7W3Q7 Bacteria Actinobacteria Streptomyces leeuwenhoekii

0.987 A0A0M2YYU2 Bacteria Actinobacteria Streptomyces sp. 0.596 A0A0J8D0B2 Bacteria Actinobacteria Streptomyces regensis 0.996 0.998 H2K375 Bacteria Actinobacteria Streptomyces hygroscopicus

A0A0L8QH47 Bacteria Actinobacteria Streptomyces varsoviensis 0.813 A0A0L8QH97 Bacteria Actinobacteria Streptomyces varsoviensis 0.726 F8JZM5 Bacteria Actinobacteria Streptomyces cattleya

A1T2T3 Bacteria Actinobacteria Mycobacterium vanbaalenii

1.000 W9ASK4 Bacteria Actinobacteria Mycobacterium cosmeticum

0.418 A0A0J6VR49 Bacteria Actinobacteria Mycobacterium obuense 0.383 V5X5X5 Bacteria Actinobacteria Mycobacterium neoaurum

0.994 0.784 S4MLC8 Bacteria Actinobacteria Streptomyces afghaniensis 0.957 1.000 A0A0D7CP11 Bacteria Actinobacteria Streptomyces natalensis E3J8N3 Bacteria Actinobacteria Frankia sp.

F4CSZ9 Bacteria Actinobacteria Pseudonocardia dioxanivorans 0.999 A0A0M4PVT3 Bacteria Actinobacteria Pseudonocardia sp. 0.973 0.415 A0A0J8ACD1 Bacteria Actinobacteria Streptomyces regensis 0.838 A0A0T1WLE7 Bacteria Actinobacteria Mycobacterium sp.

A1UGD8 Bacteria Actinobacteria Mycobacterium sp. 0.844 0.967 1.000 I4BEF2 Bacteria Actinobacteria Mycobacterium chubuense 0.797 A1T4C1 Bacteria Actinobacteria Mycobacterium vanbaalenii 0.867 0.843 A4T1J1 Bacteria Actinobacteria Mycobacterium gilvum 0.956 0.838 A0A0D6ILW7 Bacteria Actinobacteria Mycobacterium smegmatis 0.915 V5X5I8 Bacteria Actinobacteria Mycobacterium neoaurum

D2Q2H6 Bacteria Actinobacteria Kribbella flavida 0.400 F4CK15 Bacteria Actinobacteria Pseudonocardia dioxanivorans

W9GH20 Bacteria Actinobacteria Intrasporangium oryzae

0.999 A0A0Q9M970 Bacteria Actinobacteria Tetrasphaera sp. 0.063 0.996 0.939 E6S7Q4 Bacteria Actinobacteria Intrasporangium calvum 0.956 I4F096 Bacteria Actinobacteria Modestobacter marinus 0.857 D2SEX0 Bacteria Actinobacteria Geodermatophilus obscurus 0.988 0.945 A0A0Q5V8K9 Bacteria Actinobacteria Geodermatophilus sp.

A0A0D8HJK6 Bacteria Acidimicrobiia Acidithrix ferrooxidans

0.842 A0A099JPY4 Bacteria Actinobacteria Cryobacterium roopkundense 0.972 A0A0P7FU59 Bacteria Actinobacteria Arthrobacter sp. 0.995 A0A0S9D6Z6 Bacteria Actinobacteria Arthrobacter sp.

I4F1T7 Bacteria Actinobacteria Modestobacter marinus 1.000 A0A010YIW1 Bacteria Actinobacteria Cryptosporangium arvum

D3Q9L5 Bacteria Actinobacteria Stackebrandtia nassauensis

0.933 G8S3K9 Bacteria Actinobacteria Actinoplanes sp.

0.966 A8LYY6 Bacteria Actinobacteria Salinispora arenicola D9T7V7 Bacteria Actinobacteria Micromonospora aurantiaca 1.000 0.992 D9T0U4 Bacteria Actinobacteria Micromonospora aurantiaca 0.463 A0A0D0VKL5 Bacteria Actinobacteria Micromonospora carbonacea 0.480 I0L1S8 Bacteria Actinobacteria Micromonospora lupini 0.844 0.894 A0A0M2RX67 Bacteria Actinobacteria Micromonospora sp.

W5W756 Bacteria Actinobacteria Kutzneria albida

0.698 R4LR90 Bacteria Actinobacteria Actinoplanes sp. 0.795 W2EFV1 Bacteria Actinobacteria Microbispora sp. 0.952 D2AZQ8 Bacteria Actinobacteria Streptosporangium roseum

A0A0B2AKZ0 Bacteria Actinobacteria Sinomonas humi

0.905 A0A0Q6FIC2 Bacteria Actinobacteria Marmoricola sp.

0.606 A0A022MLK1 Bacteria Actinobacteria Streptomyces sp.

0.943 A0A0F4JAZ0 Bacteria Actinobacteria Streptomyces sp. 0.946 A0A0T6LR49 Bacteria Actinobacteria Streptomyces vitaminophilus 0.944 0.843 E4N5H2 Bacteria Actinobacteria Kitasatospora setae 0.886 0.781 A0A066YIG2 Bacteria Actinobacteria Kitasatospora cheerisanensis

A0A0T9MKY9 Bacteria Actinobacteria Mycobacterium tuberculosis 0.871 K0JZY8 Bacteria Actinobacteria Saccharothrix espanaensis 0.020 A0A074Q2G0 Bacteria Actinobacteria Georgenia sp. 0.510 0.994 W9GIS5 Bacteria Actinobacteria Intrasporangium chromatireducens

0.934 A0A0K1F7I8 Bacteria Actinobacteria Arsenicicoccus sp. 0.998 H5UPM8 Bacteria Actinobacteria Mobilicoccus pelagius

H6RNB7 Bacteria Actinobacteria Blastococcus saxobsidens 0.987 I4EV33 Bacteria Actinobacteria Modestobacter marinus

A0A0D5YTI2 Bacteria Bacteroidetes Muricauda lutaonensis

T0LVW7 Archaea Thermoplasmata Thermoplasmatales archaeon 0.895 A0A0D5ZHI2 Archaea uncultured archaeon uncultured archaeon

A0A0Q0RYF4 Archaea Thermoplasmata Acidiplasma cupricumulans 1.000 0.954 Q6L2P5 Archaea Thermoplasmata Picrophilus torridus 0.042 0.716 T0M270 Archaea Thermoplasmata Thermoplasmatales archaeon L0A9Z0 Archaea Thermoprotei Caldisphaera lagunensis 0.841 F0QYD2 Archaea Thermoprotei Vulcanisaeta moutnovskia 0.996 V4M6I9 Archaea Thermoprotei uncultured Acidilobus

H2C4K8 Archaea Thermoprotei Metallosphaera yellowstonensis

0.965 A0A088E2I4 Archaea Thermoprotei Metallosphaera sedula 0.862 F4FZW2 Archaea Thermoprotei Metallosphaera cuprina 1.000 W7KGY4 Archaea Thermoprotei Sulfolobales archaeon

0.811 E1QU64 Archaea Thermoprotei Vulcanisaeta distributa

0.794 M1J176 Archaea Thermoprotei Sulfolobus acidocaldarius 0.630 A0A031LT29 Archaea Thermoprotei Candidatus Acidianus

L0AEE9 Archaea Halobacteria Natronobacterium gregoryi

0.469 M0MJ51 Archaea Halobacteria Halobiforma nitratireducens 0.968 0.996 M0LG58 Archaea Halobacteria Halobiforma lacisalsi

F8D623 Archaea Halobacteria Halopiger xanaduensis

0.704 L9WKV8 Archaea Halobacteria Natronorubrum bangense 1.000 L9WAE3 Archaea Halobacteria Natronorubrum sulfidifaciens

0.951 L9XCJ3 Archaea Halobacteria Natronococcus amylolyticus 0.975 L9XRX0 Archaea Halobacteria Natronococcus jeotgali 0.911 D2RRV6 Archaea Halobacteria Haloterrigena turkmenica 0.694 L9VWF1 Archaea Halobacteria Natronorubrum tibetense 0.917 0.923 L9Y714 Archaea Halobacteria Natrinema versiforme

D8J8C8 Archaea Halobacteria Halalkalicoccus jeotgali

A0A0W1RAD2 Archaea Halobacteria Halobacteriaceae archaeon 1.000 0.888 0.962 M0M024 Archaea Halobacteria Halococcus hamelinensis 0.896 J3A6X7 Archaea Halobacteria Halogranum salarium 0.821 M0ISD4 Archaea Halobacteria Haloferax mucosum 1.000 0.439 I3R4U9 Archaea Halobacteria Haloferax mediterranei 1.000 M0HD11 Archaea Halobacteria Haloferax larsenii 0.455 A0A0W1SWX8 Archaea Halobacteria Haloferax sp. 0.980 L0JUX0 Archaea Halobacteria Natronococcus occultus 0.202 0.192 V4XB47 Archaea uncultured archaeon uncultured archaeon

0.667 M0MDQ0 Archaea Halobacteria Halococcus saccharolyticus

V4HDA9 Archaea Halobacteria Candidatus Halobonum 1.000 G2MN64 (Halar_3390) Archaea Halobacteria halophilic archaeon DL31 0.488 0.963 M0LWG5 Archaea Halobacteria Halococcus hamelinensis 0.632 0.486 E7QZ34 Archaea Halobacteria Haladaptatus paucihalophilus

B5JCK1 Bacteria Verrucomicrobia Verrucomicrobiae bacterium 1.000 A0A0E3YWC9 Bacteria Verrucomicrobia Verrucomicrobia bacterium 0.999 W0J1R9 Bacteria Verrucomicrobia Opitutaceae bacterium

L0A573 Bacteria Deinococci Deinococcus peraridilitoris

A0A072NM34 Bacteria Deinococci Deinococcus sp. 0.571 1.000 0.233 A0A0A7KES6 Bacteria Deinococci Deinococcus swuensis 0.983 C1D2T4 Bacteria Deinococci Deinococcus deserti 0.726 A0A0F7JNT6 Bacteria Deinococci Unclassified Deinococcus

A0A0M6ZGM9 Bacteria Alphaproteobacteria Labrenzia alba 0.641 A9WFI7 Bacteria Chloroflexia Chloroflexus aurantiacus 0.616 1.000 A7NIX5 Bacteria Chloroflexia Roseiflexus castenholzii

0.905 A0A023WZQ0 Bacteria Rubrobacteria Rubrobacter radiotolerans M3D0F6 Bacteria Bacilli Planococcus halocryophilus

0.973 0.993 A0A0K9T0H4 Bacteria Bacilli Planococcus sp. 0.460 A0A0U2ZL15 Bacteria Bacilli Planococcus kocurii

0.993 A0A091C8K7 Bacteria Bacilli Tetragenococcus muriaticus

0.878 A0A091C628 Bacteria Bacilli Tetragenococcus muriaticus 0.907 1.000 A0A091CDY4 Bacteria Bacilli Tetragenococcus muriaticus

A0A091C6L5 Bacteria Bacilli Tetragenococcus muriaticus

D6TVW7 Bacteria Ktedonobacteria Ktedonobacter racemifer

D7CTI4 Bacteria Deinococci Truepera radiovictrix

A0A075FJ99 Archaea uncultured Euryarchaeota uncultured marine archaeon

A0A0D5LNZ7 Bacteria Alphaproteobacteria Martelella endophytica 0.994 0.924 A0A098T5C8 Bacteria Alphaproteobacteria Hoeflea sp. 0.815 A0A0C1V2S4 Bacteria Oscillatoriophycideae Lyngbya confervoides

B5WML3 Bacteria Betaproteobacteria Burkholderia sp. 0.842 0.950 0.832 W9GXP8 Bacteria Alphaproteobacteria Skermanella stibiiresistens 0.990 A0A0D2USH8 Bacteria Alphaproteobacteria Skermanella aerolata

Q2CET9 Bacteria Alphaproteobacteria Oceanicola granulosus 0.851 0.982 A0A0L1JSD7 Bacteria Alphaproteobacteria Aestuariivita atlantica 1.000 Q16A66 Bacteria Alphaproteobacteria Roseobacter denitrificans 0.170 E7C386 Bacteria Gammaproteobacteria uncultured gamma 1.000 0.170 A0A0M6Z9U4 Bacteria Alphaproteobacteria Labrenzia alba 0.843 0.978 A0A076JXQ2 Bacteria Alphaproteobacteria Planktomarina temperata

0.526 Q5LSD4 Bacteria Alphaproteobacteria Ruegeria pomeroyi

A0A0A8K521 Bacteria Alphaproteobacteria Methyloceanibacter caenitepidi

W5Y783 Bacteria Alphaproteobacteria Komagataeibacter xylinus 0.993 D5QJD3 Bacteria Alphaproteobacteria Komagataeibacter hansenii

Q1M5T9 Bacteria Alphaproteobacteria Rhizobium leguminosarum 0.520 0.815 0.872 A0A0Q7P0E2 Bacteria Alphaproteobacteria Rhizobium sp. 1.000 A0A0Q6SZP1 Bacteria Alphaproteobacteria Rhizobium sp. 0.957 B9K1H2 Bacteria Alphaproteobacteria Agrobacterium vitis 0.997 0.840 N6U7X8 Bacteria Alphaproteobacteria Rhizobium freirei 0.941 J3BE11 Bacteria Alphaproteobacteria Rhizobium sp. 0.762 A0A021X8Y9 Bacteria Alphaproteobacteria Shinella sp.

A0A090EYE2 Bacteria Alphaproteobacteria Mesorhizobium sp.

H0HJD9 Bacteria Alphaproteobacteria Mesorhizobium alhagi

B7RGI9 Bacteria Alphaproteobacteria Roseobacter sp. 0.898 0.822 A0A0D6TED1 Bacteria Alphaproteobacteria Paracoccus sp. 0.927 Q0FP12 Bacteria Alphaproteobacteria Pelagibaca bermudensis

A0A0R2W748 Bacteria Alphaproteobacteria Rhodobacter sp. 0.945 V7ELL0 Bacteria Alphaproteobacteria Rhodobacter sp. 0.473 0.943 K2ATW9 Bacteria uncultured bacterium uncultured bacterium 0.887 0.948 0.126 C8S5F7 Bacteria Alphaproteobacteria Rhodobacter sp. 0.895 0.919 A0A017HJG3 Bacteria Alphaproteobacteria Rubellimicrobium mesophilum 0.951 0.989 0.335 S9R7H3 Bacteria Alphaproteobacteria Rubellimicrobium thermophilum 0.874 A3PRU9 Bacteria Alphaproteobacteria Rhodobacter sphaeroides

0.529 A0A074JGB7 Bacteria Alphaproteobacteria Thioclava sp. 0.931 A0A099GDL5 Bacteria Alphaproteobacteria Paracoccus sanguinis

0.120 U2Z4V6 Bacteria Alphaproteobacteria Loktanella cinnabarina S5YTM5 Bacteria Alphaproteobacteria Paracoccus aminophilus

E8TEK8 Bacteria Alphaproteobacteria Mesorhizobium ciceri 0.860 0.958 0.811 V7FRJ0 Bacteria Alphaproteobacteria Mesorhizobium sp. 0.884 A0A0P0Z355 Bacteria Alphaproteobacteria Aureimonas frigidaquae 0.701 A0A0Q5GVX1 Bacteria Alphaproteobacteria Aureimonas sp.

A0A0A0D3P3 Bacteria Alphaproteobacteria Inquilinus limosus

A0A0M6Y5N0 Bacteria Alphaproteobacteria Labrenzia aggregata

0.992 Q1R131 Bacteria Gammaproteobacteria Chromohalobacter salexigens 0.975 0.555 H0JJ27 Bacteria Gammaproteobacteria Pseudomonas psychrotolerans 0.892 A0A0F6U7Z3 Bacteria Gammaproteobacteria Pseudomonas aeruginosa 0.682 A0A098SZT8 Bacteria Gammaproteobacteria Pseudomonas lutea 0.901 0.877 0.928 A0A075PJ97 Bacteria Gammaproteobacteria Pseudomonas fluorescens

M1FG77 Bacteria Gammaproteobacteria Marinobacter sp. 0.960 0.985 0.347 N6WAL9 Bacteria Gammaproteobacteria Marinobacter nanhaiticus 0.154 W1E1Y5 Bacteria Gammaproteobacteria Klebsiella pneumoniae

A0A0F5PVV1 Bacteria Alphaproteobacteria Devosia psychrophila 0.959 0.952 H0HJE0 Bacteria Alphaproteobacteria Mesorhizobium alhagi 0.854 A6UAA5 Bacteria Alphaproteobacteria Sinorhizobium medicae

A0A0W7WJJ2 Bacteria Alphaproteobacteria Ponticoccus sp. 0.943 A0A095DPY4 Bacteria Alphaproteobacteria Rhodovulum sp.

L0A2D9 Bacteria Deinococci Deinococcus peraridilitoris

A0A0F4RE52 Bacteria Gammaproteobacteria Halomonas sp. 0.969 A0A094MZF3 Bacteria Alphaproteobacteria Acidihalobacter prosperus 0.882 A0A0T6AKZ7 Bacteria Fimbriimonadia Armatimonadetes bacterium 0.410 A0A0K2SH20 Bacteria Limnochordia Limnochorda pilosa

D6Y0A3 Bacteria Bacilli Bacillus selenitireducens

0.944 D1C910 Bacteria Thermomicrobia Sphaerobacter thermophilus 0.359 K6PRF6 Bacteria Clostridia Thermaerobacter subterraneus 1.000 E6SH59 Bacteria Clostridia Thermaerobacter marianensis

X5KYF9 Bacteria Actinobacteria Mycobacterium mageritense 0.963 L8F2Q3 Bacteria Actinobacteria Mycobacterium smegmatis 0.423 1.000 K0UIJ3 Bacteria Actinobacteria Mycobacterium vaccae A0A0D6G7I7 Bacteria Actinobacteria Mycobacterium smegmatis

D1CAV5 Bacteria Thermomicrobia Sphaerobacter thermophilus

0.913 B9L432 Bacteria Thermomicrobia Thermomicrobium roseum 0.618 0.680 Q1ASP9 Bacteria Rubrobacteria Rubrobacter xylanophilus 0.073 A0A010Z4J1 Bacteria Actinobacteria Cryptosporangium arvum 0.111 A0A075HQA2 Archaea uncultured Thaumarchaeota uncultured marine

A0A0R2V2K4 Bacteria Alphaproteobacteria Pelagibacteraceae bacterium

0.887 B4WPW3 Bacteria Oscillatoriophycideae Synechococcus sp.

0.146 A0A0R3L5X2 Bacteria Alphaproteobacteria Bradyrhizobium valentinum 0.915 0.774 A0A0S8DCZ7 Bacteria Betaproteobacteria Betaproteobacteria bacterium 0.907 C6AYB0 Bacteria Alphaproteobacteria Rhizobium leguminosarum 0.270 0.962 0.957 W4LJU8 Bacteria Gammaproteobacteria Candidatus Entotheonella A4A744 Bacteria Gammaproteobacteria Congregibacter litoralis 1.000 B8KJR6 Bacteria Gammaproteobacteria gamma proteobacterium 1.000 1.000 B8KXJ3 Bacteria Gammaproteobacteria Luminiphilus syltensis

1.000 A4A9S6 Bacteria Gammaproteobacteria Congregibacter litoralis 0.688 B8KXJ2 Bacteria Gammaproteobacteria Luminiphilus syltensis

A5V4W6 Bacteria Alphaproteobacteria Sphingomonas wittichii

G7VE40 Archaea Thermoprotei Pyrobaculum ferrireducens 0.966 Q9YEQ1 Archaea Thermoprotei Aeropyrum pernix

F0NK10 Archaea Thermoprotei Sulfolobus islandicus

0.735 C7MWP7 Bacteria Actinobacteria Saccharomonospora viridis 1.000 1.000 N1M7S7 Bacteria Actinobacteria Rhodococcus sp. 0.918 A0A0A1DS94 Bacteria Actinobacteria Nocardioides simplex 0.999 A0A0Q6P9A8 Bacteria Actinobacteria Microbacterium sp.

A0A0M7D9B0 Bacteria Betaproteobacteria Achromobacter sp.

0.996 A0A009JT55 Bacteria Gammaproteobacteria Acinetobacter baumannii 0.950 D8IXM3 Bacteria Betaproteobacteria Herbaspirillum seropedicae 0.815 F1W2R4 Bacteria Betaproteobacteria Oxalobacteraceae bacterium

D2SFT5 Bacteria Actinobacteria Geodermatophilus obscurus 1.000 A0A098Y821 Bacteria Actinobacteria Modestobacter sp.

Q1ASQ3 Bacteria Rubrobacteria Rubrobacter xylanophilus

D1CAT6 Bacteria Thermomicrobia Sphaerobacter thermophilus 0.997 H5XFJ4 Bacteria Actinobacteria Saccharomonospora cyanea 0.000 D2B144 Bacteria Actinobacteria Streptosporangium roseum

0.426 0.995 T2S5G9 Bacteria Actinobacteria Saccharopolyspora erythraea 0.353 H2JLF6 Bacteria Actinobacteria Streptomyces hygroscopicus 0.272 A0A0N1FIG9 Bacteria Actinobacteria Actinobacteria bacterium 1.000 A0A0B5DKR4 Bacteria Actinobacteria Streptomyces nodosus 0.978 J7L336 Bacteria Actinobacteria Nocardiopsis alba

0.997 A0A0A6VT62 Bacteria Actinobacteria Kocuria polaris 0.547 Q07838 Bacteria Actinobacteria Mycobacterium smegmatis 0.699 A0A0Q6Y570 Bacteria Actinobacteria Streptomyces sp.

F4CLC7 Bacteria Actinobacteria Pseudonocardia dioxanivorans 0.890 0.991 1.000 0.235 L0IQE0 Bacteria Actinobacteria Mycobacterium smegmatis 0.299 A0A0T9KB10 Bacteria Actinobacteria Mycobacterium tuberculosis 0.883 A0A0T9KUX5 Bacteria Actinobacteria Mycobacterium tuberculosis

C7MV34 Bacteria Actinobacteria Saccharomonospora viridis

0.999 H5X4N3 Bacteria Actinobacteria Saccharomonospora marina 0.567 H5XF87 Bacteria Actinobacteria Saccharomonospora cyanea

K6WL00 Bacteria Actinobacteria Gordonia namibiensis 0.999 V5XID7 Bacteria Actinobacteria Mycobacterium neoaurum

A0A078MMR9 Bacteria Actinobacteria Arthrobacter sp.

0.984 0.999 C0XRQ6 Bacteria Actinobacteria Corynebacterium lipophiloflavum 0.864 Q8FNE6 Bacteria Actinobacteria Corynebacterium efficiens 0.913 M1NSX7 Bacteria Actinobacteria Corynebacterium halotolerans

B2GIX0 Bacteria Actinobacteria Kocuria rhizophila 0.944 0.998 A0A076NSY4 Bacteria Actinobacteria Corynebacterium imitans

0.992 C7MBU9 Bacteria Actinobacteria Brachybacterium faecium 0.202 0.939 A0A097IFB5 Bacteria Actinobacteria Corynebacterium doosanense

A0A0P0RUW7 Bacteria Actinobacteria Pseudonocardia sp. 0.973 A0A0M3U805 Bacteria Actinobacteria Pseudonocardia sp. 0.993 0.758 0.951 F4CRF7 Bacteria Actinobacteria Pseudonocardia dioxanivorans 0.995 A0A0M4QKG0 Bacteria Actinobacteria Pseudonocardia sp.

0.454 I0HQW0 Bacteria Betaproteobacteria Rubrivivax gelatinosus V9XL57 Bacteria Actinobacteria Rhodococcus pyridinivorans 0.928 K9ANG5 Bacteria Actinobacteria Brevibacterium casei 0.991 0.687 A0A0Q6GKL0 Bacteria Actinobacteria Rhodococcus sp.

0.979 X7XQF1 Bacteria Actinobacteria Mycobacterium kansasii 1.000 X7ZNR3 Bacteria Actinobacteria Mycobacterium kansasii 0.579 D0LA99 Bacteria Actinobacteria Gordonia bronchialis 0.758 H6MVA6 Bacteria Actinobacteria Gordonia polyisoprenivorans 0.873 0.634 L8F8B6 Bacteria Actinobacteria Mycobacterium smegmatis 0.894 0.948 A0A0U1DRM7 Bacteria Actinobacteria Mycobacterium conceptionense A0A0Q5R342 Bacteria Actinobacteria Williamsia sp.

K8XMT8 Bacteria Actinobacteria Rhodococcus opacus 0.877 0.563 Q0SEV5 Bacteria Actinobacteria Rhodococcus jostii 0.999 A0A0D8I1N5 Bacteria Actinobacteria Rhodococcus sp. 0.983 0.994 M2UZC1 Bacteria Actinobacteria Rhodococcus qingshengii

0.541 A0A0U1B081 Bacteria Actinobacteria Mycobacterium abscessus 0.926 0.762 0.907 A0A0U1APE5 Bacteria Actinobacteria Mycobacterium abscessus 0.999 A0A0U1AY81 Bacteria Actinobacteria Mycobacterium abscessus 0.682 0.834 A0A0U1CC71 Bacteria Actinobacteria Mycobacterium abscessus

K6W704 Bacteria Actinobacteria Kineosphaera limosa

D9T205 Bacteria Actinobacteria Micromonospora aurantiaca

0.996 K0F5L6 Bacteria Actinobacteria Nocardia brasiliensis 0.967 W5TD13 Bacteria Actinobacteria Nocardia nova

D5ZTY1 Bacteria Actinobacteria Streptomyces ghanaensis 0.264 0.999 X7XS13 Bacteria Actinobacteria Mycobacterium kansasii 0.247 I4F1E7 Bacteria Actinobacteria Modestobacter marinus

0.924 A0A098YA01 Bacteria Actinobacteria Modestobacter sp. 0.156 0.929 D2SFT6 Bacteria Actinobacteria Geodermatophilus obscurus

A0A0U1DTD2 Bacteria Actinobacteria Mycobacterium conceptionense 0.541 D5UM59 Bacteria Actinobacteria Tsukamurella paurometabola 0.889 A0A0A6VYP0 Bacteria Actinobacteria Kocuria polaris

C8XC71 Bacteria Actinobacteria Nakamurella multipartita

0.795 A0A0Q9R7K2 Bacteria Actinobacteria Arthrobacter sp. 0.757 A0A010Q268 Bacteria Actinobacteria Nesterenkonia sp. 0.949 0.380 N1V9G2 Bacteria Actinobacteria Arthrobacter crystallopoietes 0.592 A0A061LZC3 Bacteria Actinobacteria Leucobacter sp. 0.863 0.816 0.972 M7MW53 Bacteria Actinobacteria Arthrobacter gangotriensis A0A0A1DLW9 Bacteria Actinobacteria Nocardioides simplex

A0A078MWJ7 Bacteria Actinobacteria Arthrobacter sp.

D6A703 Bacteria Actinobacteria Streptomyces ghanaensis

I4EFE2 Bacteria Thermomicrobia Nitrolancea hollandica 0.958 A0A023X670 Bacteria Rubrobacteria Rubrobacter radiotolerans

A0A0D1XUP8 Bacteria Bacilli Aneurinibacillus migulanus

A0A0C2W0P6 Bacteria Bacilli Jeotgalibacillus soli

0.828 A0A0C2Y2U4 Bacteria Bacilli Bacillus badius

0.987 A0A0M0X833 Bacteria Bacilli Bacillus sp. 0.691 0.980 F9DNL9 Bacteria Bacilli Sporosarcina newyorkensis 0.917 A0A0K9F7D6 Bacteria Bacilli Lysinibacillus xylanilyticus

A0A061PH72 Bacteria Bacilli Geomicrobium sp. 0.972 0.608 A0A061N4D1 Bacteria Bacilli Geomicrobium sp. 0.970 0.986 A0A061P4L4 Bacteria Bacilli Geomicrobium sp.

A0A061PCQ6 Bacteria Bacilli Geomicrobium sp.

0.991 A0A0A5GAH7 Bacteria Bacilli Pontibacillus litoralis

A0A0C2E5P0 Bacteria Bacilli Salinicoccus roseus

0.985 H0DJF2 Bacteria Bacilli Staphylococcus pettenkoferi 0.763 0.869 B9DJX7 Bacteria Bacilli Staphylococcus carnosus 0.842 0.960 E8SEA1 Bacteria Bacilli Staphylococcus pseudintermedius 0.869 0.957 A0A0S2EXI8 Bacteria Bacilli Staphylococcus agnetis 0.146 0.893 A0A0E8TRL2 Bacteria Bacilli Streptococcus pneumoniae 0.994 0.652 C5QNS8 Bacteria Bacilli Staphylococcus caprae

C4W7K2 Bacteria Bacilli Staphylococcus warneri

K9AL76 Bacteria Bacilli Staphylococcus massiliensis 0.759 C0ZGM4 Bacteria Bacilli Brevibacillus brevis

H0UBM0 Bacteria Bacilli Brevibacillus laterosporus 0.748 0.929 A0A075RC78 Bacteria Bacilli Brevibacillus laterosporus 0.755 0.932 A0A0F7EFV3 Bacteria Bacilli Brevibacillus laterosporus 0.962 0.834 A0A0U2U2L3 Bacteria Bacilli Paenibacillus naphthalenovorans

L5MWK4 Bacteria Bacilli Brevibacillus agri

M8D4D5 Bacteria Bacilli Brevibacillus borstelensis

0.986 B7DSE2 Bacteria Bacilli Alicyclobacillus acidocaldarius 1.000 C8WRQ6 Bacteria Bacilli Alicyclobacillus acidocaldarius

D1AB49 Bacteria Actinobacteria Thermomonospora curvata

K9XHV8 Bacteria Oscillatoriophycideae Gloeocapsa sp. 0.996 0.717 A0A0D8ZZR2 Bacteria Oscillatoriophycideae Chroococcales cyanobacterium

K9YBF8 Bacteria Oscillatoriophycideae Halothece sp. 0.820 D8FTJ6 Bacteria Oscillatoriophycideae Oscillatoria sp.

A0A0P7YWM9 Bacteria Oscillatoriophycideae Phormidesmis priestleyi 0.451 0.863 0.971 L8N5U2 Bacteria Oscillatoriophycideae Pseudanabaena biceps

0.974 K9PAL9 Bacteria Oscillatoriophycideae Cyanobium gracile 0.994 0.847 Q3AGE3 Bacteria Oscillatoriophycideae Synechococcus sp. 0.314 0.545 Q2JS29 Bacteria Oscillatoriophycideae Synechococcus sp. 0.358 K9TYN4 Bacteria Pleurocapsales Chroococcidiopsis thermalis

B5W045 Bacteria Oscillatoriophycideae Arthrospira maxima

0.976 K9T310 Bacteria Pleurocapsales Pleurocapsa sp.

0.905 A0A0P7ZWP8 Bacteria Oscillatoriophycideae Phormidium sp.

0.962 L8MBC1 Bacteria Pleurocapsales Xenococcus sp. 0.940 B0C2N8 Bacteria Oscillatoriophycideae Acaryochloris marina

L0JV39 Archaea Halobacteria Natronococcus occultus

1.000 L9XNN9 Archaea Halobacteria Natronococcus jeotgali

0.950 G0LJJ0 Archaea Halobacteria Haloquadratum walsbyi 0.400 M0MD37 Archaea Halobacteria Halococcus saccharolyticus 0.998 L0K772 Archaea Halobacteria Natronococcus occultus

L9XPQ0 Archaea Halobacteria Natronococcus jeotgali 1.000 V4XUV4 Archaea uncultured archaeon uncultured archaeon 0.890 B9LRY7 (Amd3) Archaea Halobacteria Halorubrum lacusprofundi 0.988 0.921 Q3ILY7 Archaea Halobacteria Natronomonas pharaonis 0.405 0.892 Q5V6S4 Archaea Halobacteria Haloarcula marismortui 0.999 0.778 U1PQM8 Archaea Halobacteria Haloquadratum walsbyi

F8D7I0 Archaea Halobacteria Halopiger xanaduensis 0.159 M0MD10 Archaea Halobacteria Halococcus saccharolyticus

Q67Q45 Bacteria Clostridia Symbiobacterium thermophilum

1.000 F5L3T4 Bacteria Bacilli Caldalkalibacillus thermarum

0.039 E6SHC0 Bacteria Clostridia Thermaerobacter marianensis 0.948 0.995 K6PZM6 Bacteria Clostridia Thermaerobacter subterraneus

B8GQ32 Bacteria Gammaproteobacteria Thioalkalivibrio sulfidiphilus

Q7WB20 Bacteria Betaproteobacteria Bordetella parapertussis 1.000 A0A0T7QJF1 Bacteria Betaproteobacteria Bordetella pertussis 0.898 A0A0T7RCZ6 Bacteria Betaproteobacteria Bordetella pertussis 0.997 B6JIF1 Bacteria Alphaproteobacteria Oligotropha carboxidovorans

0.947 A1B7Z3 Bacteria Alphaproteobacteria Paracoccus denitrificans 0.995 0.368 A0A021X2C6 Bacteria Alphaproteobacteria Shinella sp. 0.247 A0A0A1PNY7 Bacteria unclassified bacteria bacterium YEK0313

F5SWI4 Bacteria Gammaproteobacteria Methylophaga aminisulfidivorans

I1YJD5 Bacteria Gammaproteobacteria Methylophaga frappieri 0.999 Q50228 Bacteria Betaproteobacteria Methylophilus methylotrophus 0.422 0.463 V5BER5 Bacteria Gammaproteobacteria Methyloglobulus morosus 0.031 0.928 C6XAL1 Bacteria Betaproteobacteria Methylovorus glucosetrophus 0.967 0.905 0.148 D7DI54 Bacteria Betaproteobacteria Methylotenera versatilis

Q1H0E2 Bacteria Betaproteobacteria Methylobacillus flagellatus

A0A094MYV4 Bacteria Alphaproteobacteria Acidihalobacter prosperus

0.919 A0A0R2XQW4 Bacteria Verrucomicrobia Opitutaceae bacterium

0.969 I0II47 Bacteria Phycisphaerae Phycisphaera mikurensis 0.195 I6ATP8 Bacteria Verrucomicrobia Opitutaceae bacterium

A0A0W1RTT9 Bacteria Gammaproteobacteria Halothiobacillus sp. 0.956 0.999 D0L155 Bacteria Gammaproteobacteria Halothiobacillus neapolitanus

A0A0J6NR46 Bacteria Betaproteobacteria Chromobacterium sp.

I3TUP7 Bacteria Alphaproteobacteria Tistrella mobilis

A0A0D2W2F5 Bacteria Alphaproteobacteria Skermanella aerolata

R9PJK2 Bacteria Gammaproteobacteria Agarivorans albus 0.979 R4YNS0 Bacteria Gammaproteobacteria Oleispira antarctica 0.337 0.427 W8FUZ4 Bacteria Gammaproteobacteria Thalassolituus oleivorans

0.580 G4T100 Bacteria Gammaproteobacteria Methylomicrobium alcaliphilum

Q21GF2 Bacteria Gammaproteobacteria Saccharophagus degradans 0.441 0.747 0.857 0.942 C5BI86 Bacteria Gammaproteobacteria Teredinibacter turnerae

A0A0B4XLM3 Bacteria Gammaproteobacteria Alcanivorax pacificus 0.232 0.976 Q0VN22 Bacteria Gammaproteobacteria Alcanivorax borkumensis 0.828 0.601 A0A060B5W0 Bacteria Gammaproteobacteria Halomonas campaniensis 0.789 0.770 A0A0F4QQQ2 Bacteria Gammaproteobacteria Halomonas sp.

1.000 A0A0F7LYJ1 Bacteria Gammaproteobacteria Spongiibacter sp. 0.974 0.942 F6D0A7 Bacteria Gammaproteobacteria Marinomonas posidonica Q1YUC1 Bacteria Gammaproteobacteria gamma proteobacterium 0.953 E4PHB4 Bacteria Gammaproteobacteria Marinobacter adhaerens 0.633 H8WA44 Bacteria Gammaproteobacteria Marinobacter hydrocarbonoclasticus 0.946 A0A0Q8IJ86 Bacteria Alphaproteobacteria Devosia sp. 0.911 A0A081MIS7 Bacteria Alphaproteobacteria Rhizobium sp. 0.353 Q1YDJ5 Bacteria Alphaproteobacteria Aurantimonas manganoxydans

0.913 A0A0M6Y6R1 Bacteria Alphaproteobacteria Labrenzia aggregata 0.938 A0A0M7B0X1 Bacteria Alphaproteobacteria Labrenzia alba 0.885 A0A095CRR4 Bacteria Alphaproteobacteria Rhodovulum sp. 0.999 0.589 A0A0H4KZA8 Bacteria Alphaproteobacteria Marinovum algicola 0.999 A0A0L6CRM9 Bacteria Alphaproteobacteria Roseovarius tolerans

0.344 A0A0P1G4B9 Bacteria Alphaproteobacteria Tropicibacter multivorans A0A060DRE9 Bacteria Alphaproteobacteria Azospirillum brasilense

A0A0D6PE56 Bacteria Alphaproteobacteria Acidocella aminolytica

0.953 A0A0D6P6C0 Bacteria Alphaproteobacteria Acidisphaera rubrifaciens 0.907 Q0BR23 Bacteria Alphaproteobacteria Granulibacter bethesdensis

D7A3G1 Bacteria Alphaproteobacteria Starkeya novella

B0UPW0 Bacteria Alphaproteobacteria Methylobacterium sp. 0.913 0.941 B1LZJ9 Bacteria Alphaproteobacteria Methylobacterium radiotolerans 0.920 F8J7X3 Bacteria Alphaproteobacteria Hyphomicrobium sp. 0.781 F5RBP6 Bacteria Betaproteobacteria Methyloversatilis universalis 0.965 0.416 A4Z2V7 Bacteria Alphaproteobacteria Bradyrhizobium sp. 0.863 A0A0S3PUT9 Bacteria Alphaproteobacteria Variibacter gotjawalensis 0.125 A0A0K2DJT1 Bacteria Alphaproteobacteria Chelatococcus sp.

A0A0D5VM99 Bacteria Betaproteobacteria Burkholderia fungorum 0.718 Q0K546 Bacteria Betaproteobacteria Cupriavidus necator

0.608 A0A088X797 Bacteria Betaproteobacteria Burkholderia oklahomensis 0.914 0.795 A0A0J1G316 Bacteria Betaproteobacteria Burkholderia glathei 0.838 A0A060PB61 Bacteria Betaproteobacteria Burkholderia sp. 0.912 0.906 A0A0C4YAD8 Bacteria Betaproteobacteria Cupriavidus basilensis

A0A0Q8JMA6 Bacteria Betaproteobacteria Rhizobacter sp. 0.859 A0A0R0LGQ1 Bacteria Betaproteobacteria Ferrovum sp. 0.970 A4G536 Bacteria Betaproteobacteria Herminiimonas arsenicoxydans

A0A0A1H6H4 Bacteria Betaproteobacteria Burkholderiales bacterium 0.173 Q2KYM6 Bacteria Betaproteobacteria Bordetella avium 0.932 D4XFK1 Bacteria Betaproteobacteria Achromobacter piechaudii 0.974 0.865 N6YHV5 Bacteria Betaproteobacteria Thauera sp.

0.610 C5TD47 Bacteria Betaproteobacteria Acidovorax delafieldii 0.700 F6B1E5 Bacteria Betaproteobacteria Delftia sp. 0.582 C5T7M6 Bacteria Betaproteobacteria Acidovorax delafieldii

B2II42 Bacteria Alphaproteobacteria Beijerinckia indica 1.000 A0A0P0YXB5 Bacteria Alphaproteobacteria Aureimonas altamirensis 0.764 F2MX85 Bacteria Gammaproteobacteria Pseudomonas stutzeri

0.896 0.986 A0A023WV21 Bacteria Gammaproteobacteria Pseudomonas stutzeri 0.938 G8Q7F7 Bacteria Gammaproteobacteria Pseudomonas fluorescens

0.997 S6SHX3 Bacteria Gammaproteobacteria Pseudomonas syringae 0.749 0.997 A0A0K8LZH0 Bacteria Gammaproteobacteria Pseudomonas syringae 0.511 S6SGA1 Bacteria Gammaproteobacteria Pseudomonas syringae

0.371 A0A084ILJ2 Bacteria Gammaproteobacteria Salinisphaera hydrothermalis 0.868 C3X7L0 Bacteria Betaproteobacteria Oxalobacter formigenes

W7WQS9 Bacteria Betaproteobacteria Hydrogenophaga sp. 0.786 T1XDB2 Bacteria Betaproteobacteria Variovorax paradoxus 0.568 S2WKW7 Bacteria Betaproteobacteria Delftia acidovorans

0.918 W7WA94 Bacteria Betaproteobacteria Methylibium sp. 0.175 A0A0A0DRS7 Bacteria Betaproteobacteria Aquabacterium sp.

0.848 A0A0R0MJF3 Bacteria Betaproteobacteria Curvibacter sp. 0.559 0.987 F3KP28 Bacteria Betaproteobacteria Hylemonella gracilis

A0A0Q9CS32 Bacteria Betaproteobacteria Acidovorax sp. 0.924 I4MUL8 Bacteria Betaproteobacteria Hydrogenophaga sp.

A0A0A1PUX4 Bacteria unclassified bacteria bacterium YEK0313

A0A0Q6CM54 Bacteria Betaproteobacteria Methylophilus sp. 0.716 A9BMP6 Bacteria Betaproteobacteria Delftia acidovorans 0.831 0.995 W9UXP4 Bacteria Gammaproteobacteria Nitrincola nitratireducens

A0A0R0LNH8 Bacteria Betaproteobacteria Ferrovum sp. 0.840 A0A0N0B994 Bacteria Actinobacteria Streptomyces purpurogeneiscleroticus

1.000 A9W0X7 Bacteria Alphaproteobacteria Methylobacterium extorquens 0.979 B1Z746 Bacteria Alphaproteobacteria Methylobacterium populi 0.922 0.783 A0A0Q5ZW60 Bacteria Alphaproteobacteria Methylobacterium sp. 0.971 0.944 A0A0Q4ZSN4 Bacteria Alphaproteobacteria Methylobacterium sp.

A0A095CMW9 Bacteria Alphaproteobacteria Rhodovulum sp. 1.000 A0A0Q7DDJ8 Bacteria Alphaproteobacteria Devosia sp. 0.993 0.964 0.037 X6GDM4 Bacteria Alphaproteobacteria Mesorhizobium sp.

A0A0D1MLI3 Bacteria Alphaproteobacteria Bradyrhizobium elkanii

W9GZW7 Bacteria Alphaproteobacteria Skermanella stibiiresistens 0.943 0.198 J2PXS3 Bacteria Alphaproteobacteria Novosphingobium sp. 0.995 0.861 H5YJ21 Bacteria Alphaproteobacteria Bradyrhizobium sp.

A0A0C1UTF0 Bacteria Oscillatoriophycideae Lyngbya confervoides 0.000 1.000 A0A0P7ZKH7 Bacteria Oscillatoriophycideae Phormidesmis priestleyi 0.969 B4WPA8 Bacteria Oscillatoriophycideae Synechococcus sp.

D7A2Z2 Bacteria Alphaproteobacteria Starkeya novella 1.000 1.000 A0A0Q6NFR9 Bacteria Betaproteobacteria Variovorax sp. 0.992 A0A0J1CKJ2 Bacteria Betaproteobacteria Burkholderia glathei

K9YU13 Bacteria Oscillatoriophycideae Dactylococcopsis salina

W4BRQ3 Bacteria Bacilli Paenibacillus sp. 1.000 A0A069DIP2 Bacteria Bacilli Paenibacillus sp. 0.893 C6D199 Bacteria Bacilli Paenibacillus sp.

A0A0M2SRX5 Bacteria Bacilli Bacillus sp.

0.960 A0A0A1PSJ2 Bacteria unclassified bacteria bacterium YEK0313 0.956 halTADL 2650 Archaea Halobacteria Halohasta litchfieldiae tADL 0.944 U1PPD0 Archaea Halobacteria Haloquadratum walsbyi

A0A060UQL8 Bacteria Gammaproteobacteria Acidithiobacillus ferrivorans 1.000 G0JLS7 Bacteria Gammaproteobacteria Acidithiobacillus ferrivorans

A0A075P0S2 Bacteria Gammaproteobacteria Alteromonas australica 0.952 A7HRS2 Bacteria Alphaproteobacteria Parvibaculum lavamentivorans

1.000 F3SBW7 Bacteria Alphaproteobacteria Gluconacetobacter sp. 0.835 1.000 A0A070AE17 Bacteria Alphaproteobacteria Komagataeibacter rhaeticus 0.934 F3SBX0 Bacteria Alphaproteobacteria Gluconacetobacter sp. 1.000 0.891 A0A0D6MQ00 Bacteria Alphaproteobacteria Tanticharoenia sakaeratensis 0.988 A0A023D5X2 Bacteria Alphaproteobacteria Acidomonas methanolica 0.999 M9MLU1 Bacteria Alphaproteobacteria Gluconobacter thailandicus

A0A0V2F475 Bacteria Alphaproteobacteria Caulobacter vibrioides

0.981 B0T4I0 Bacteria Alphaproteobacteria Caulobacter sp. 0.911 0.860 D5VGF6 Bacteria Alphaproteobacteria Caulobacter segnis 0.994 0.832 A0A0U1Q038 Bacteria Betaproteobacteria Lampropedia cohaerens

0.969 A0A0J1CJ28 Bacteria Betaproteobacteria Burkholderia glathei 1.000 A0A0F5K412 Bacteria Betaproteobacteria Burkholderia andropogonis

C6XP50 Bacteria Alphaproteobacteria Hirschia baltica 0.993 0.951 A0A059DWJ7 Bacteria Alphaproteobacteria Hyphomonas atlantica 0.799 J2GQI2 Bacteria Alphaproteobacteria Novosphingobium sp. 0.131 0.997 0.034 A0A0N1AP97 Bacteria Alphaproteobacteria Novosphingobium sp. 0.488 F1Z3H2 Bacteria Alphaproteobacteria Novosphingobium nitrogenifigens 0.958 A0A0F7KPT8 Bacteria Alphaproteobacteria Altererythrobacter atlanticus

A0A0S6X457 Bacteria Alphaproteobacteria Novosphingobium sp. 0.995 0.977 0.864 F6IKQ6 Bacteria Alphaproteobacteria Novosphingobium sp. 0.962 W0AAQ5 Bacteria Alphaproteobacteria Sphingomonas sanxanigenens 0.889 0.249 A0A0C5LM11 Bacteria Alphaproteobacteria Sphingomonas hengshuiensis

E8RUS1 Bacteria Alphaproteobacteria Asticcacaulis excentricus

D0KZ44 Bacteria Gammaproteobacteria Halothiobacillus neapolitanus 0.230 A0A069PKZ8 Bacteria Betaproteobacteria Burkholderia glathei 0.919 X2JY18 Bacteria Betaproteobacteria Pandoraea pnomenusa 0.996 Q0K401 Bacteria Betaproteobacteria Cupriavidus necator

A0A0D6P6S0 Bacteria Alphaproteobacteria Acidisphaera rubrifaciens

A0A0J6WEA2 Bacteria Actinobacteria Mycobacterium obuense 0.980 0.158 W9ASA7 Bacteria Actinobacteria Mycobacterium cosmeticum 1.000 A0A0T1WBG6 Bacteria Actinobacteria Mycobacterium sp. 0.852 L0J2D2 Bacteria Actinobacteria Mycobacterium smegmatis 0.000 A0A0G3ISS2 Bacteria Actinobacteria Mycobacterium sp.

B4WKX1 Bacteria Oscillatoriophycideae Synechococcus sp.

1.000 K9XD72 Bacteria Oscillatoriophycideae Gloeocapsa sp. 0.996 A0A0D8ZSA6 Bacteria Oscillatoriophycideae Chroococcales cyanobacterium 0.530 K9TYF2 Bacteria Pleurocapsales Chroococcidiopsis thermalis

W7ZKI3 Bacteria Bacilli Bacillus sp. 1.000 A0A060LNY9 Bacteria Bacilli Bacillus lehensis

A0A0U2WFK2 Bacteria Bacilli Paenibacillus naphthalenovorans 0.966 W4B6T3 Bacteria Bacilli Paenibacillus sp. 0.997 1.000 A0A0M2T288 Bacteria Bacilli Bacillus sp. 0.961 V9GBX8 Bacteria Bacilli Paenibacillus sp.

1.000 W4AV69 Bacteria Bacilli Paenibacillus sp. 0.977 D3E8W1 Bacteria Bacilli Geobacillus sp.

0.534 A0A0D2W4K5 Bacteria Alphaproteobacteria Skermanella aerolata

A0A0R0A677 Bacteria Gammaproteobacteria Psychrobacter sp.

0.814 A0A0L6Y8Q4 Bacteria Gammaproteobacteria Acinetobacter baumannii

0.902 A0A0L6KJD6 Bacteria Gammaproteobacteria Acinetobacter baumannii 0.954 F0KHY3 Bacteria Gammaproteobacteria Acinetobacter calcoaceticus 0.827 0.998 0.768 A0A013S389 Bacteria Gammaproteobacteria Acinetobacter baumannii

A0A009P2W7 Bacteria Gammaproteobacteria Acinetobacter baumannii

0.835 K2FP36 Bacteria uncultured bacterium uncultured bacterium D0SA80 Bacteria Gammaproteobacteria Acinetobacter johnsonii 0.910 1.000 0.857 I4ZWQ4 Bacteria Gammaproteobacteria Acinetobacter sp. 0.913 0.766 A0A031LWH4 Bacteria Gammaproteobacteria Acinetobacter sp.

A0A0N9VGI0 Bacteria Gammaproteobacteria Acinetobacter equi

A0A090RMR6 Bacteria Gammaproteobacteria Vibrio sp. 0.889 0.251 1.000 A0A078M8Z5 Bacteria Gammaproteobacteria Pseudomonas sp. 0.969 A0A031MI98 Bacteria Gammaproteobacteria Pseudomonas bauzanensis

X5DTH2 Bacteria Actinobacteria Corynebacterium glyciniphilum

I4F3L3 Bacteria Actinobacteria Modestobacter marinus 0.943 I0H9Q2 Bacteria Actinobacteria Actinoplanes missouriensis 0.985 0.873 U5W194 Bacteria Actinobacteria Actinoplanes friuliensis

A0A0S2A8H9 Bacteria Actinobacteria Propionibacterium acidipropionici

A0A0L0BKB2 Bacteria Actinobacteria Arthrobacter sp. 1.000 0.635 A0A0S9DAH9 Bacteria Actinobacteria Arthrobacter sp. 0.999 0.374 A0A0Q7UB01 Bacteria Actinobacteria Microbacterium sp.

Z9JTT0 Bacteria Actinobacteria Brachybacterium phenoliresistens 0.997 0.715 A0A0M9ULC1 Bacteria Actinobacteria Brachybacterium sp.

A0A0T1WKX8 Bacteria Actinobacteria Mycobacterium sp. 0.998 A0A0D5AJV0 Bacteria Actinobacteria Rhodococcus sp. 0.943 0.862 A1UFL6 Bacteria Actinobacteria Mycobacterium sp. 0.126 A0A0J6W659 Bacteria Actinobacteria Mycobacterium obuense 0.947 0.950 0.201 E6TK23 Bacteria Actinobacteria Mycobacterium gilvum 0.870 0.651 0.941 K0UZ41 Bacteria Actinobacteria Mycobacterium vaccae L8F5S1 Bacteria Actinobacteria Mycobacterium smegmatis 0.995 G7CCC6 Bacteria Actinobacteria Mycobacterium thermoresistibile

D1BAM3 Bacteria Actinobacteria Sanguibacter keddieii

A0A0A6VWQ8 Bacteria Actinobacteria Kocuria polaris 1.000 A0A0M2CZM0 Bacteria Actinobacteria Kocuria sp.

A6WGH5 Bacteria Actinobacteria Kineococcus radiotolerans

1.000 H5WXS6 Bacteria Actinobacteria Saccharomonospora marina 0.998 0.053 A0A074PWB9 Bacteria Actinobacteria Georgenia sp.

0.901 A0A0Q6FGS4 Bacteria Actinobacteria Marmoricola sp. 0.986 A0A0S9Q4V5 Bacteria Actinobacteria Nocardioides sp.

D6M310 Bacteria Actinobacteria Streptomyces sp.

1.000 D9UIH5 Bacteria Actinobacteria Streptomyces sp. 0.823 F3ZCD7 Bacteria Actinobacteria Streptomyces sp. 0.919 D3CYP1 Bacteria Actinobacteria Frankia sp. 1.000 A8L5W9 Bacteria Actinobacteria Frankia sp. 0.998 A0A0Q7N865 Bacteria Actinobacteria Nocardia sp.

1.000 A0A0H5RPI7 Bacteria Actinobacteria Mycobacterium neworleansense 0.977 X5LQM2 Bacteria Actinobacteria Mycobacterium vulneris

Q0RHW7 Bacteria Actinobacteria Frankia alni

A0A0Q6DQZ1 Bacteria Actinobacteria Microbacterium sp.

0.982 M5B6Z5 Bacteria Actinobacteria Clavibacter michiganensis

0.928 0.446 A0A0V8SCS7 Bacteria Actinobacteria Cellulomonas sp.

0.515 A1T1T9 Bacteria Actinobacteria Mycobacterium vanbaalenii

1.000 A0A0H5S680 Bacteria Actinobacteria Mycobacterium neworleansense 0.859 0.821 A0A0U1DA45 Bacteria Actinobacteria Mycobacterium conceptionense 0.933 X5LXY2 Bacteria Actinobacteria Mycobacterium vulneris

A0A0D0W0C7 Bacteria Actinobacteria Micromonospora carbonacea 0.971 A0A010YHD6 Bacteria Actinobacteria Cryptosporangium arvum

0.533 D3D272 Bacteria Actinobacteria Frankia sp.

0.345 E3IW61 Bacteria Actinobacteria Frankia sp.

1.000 F8AXZ7 Bacteria Actinobacteria Frankia symbiont

0.948 I8QZ61 Bacteria Actinobacteria Frankia sp. 0.174 1.000 A0A0D8BHQ0 Bacteria Actinobacteria Frankia sp. 0.731 A8L3S8 Bacteria Actinobacteria Frankia sp. 1.000 D3CWP3 Bacteria Actinobacteria Frankia sp.

A0A0Q9CK69 Bacteria Actinobacteria Cellulomonas sp.

A0A0P0DQ12 Bacteria Actinobacteria Microbacterium sp. 0.275 0.992 U2YVQ7 Bacteria Actinobacteria Microbacterium sp.

A0A0M2HIV5 Bacteria Actinobacteria Microbacterium ketosireducens 1.000 0.919 W0ZER9 Bacteria Actinobacteria Microbacterium sp.

A0A0N0RRS7 Bacteria Actinobacteria Microbacterium chocolatum

0.792 0.898 E8N7N6 Bacteria Actinobacteria Microbacterium testaceum

1.000 A0A0Q4DI43 Bacteria Actinobacteria Microbacterium sp. 0.934 0.720 0.315 A0A0V8H1V2 Bacteria Actinobacteria Microbacterium enclense 0.846 A0A0Q5JWG6 Bacteria Actinobacteria Microbacterium sp.

A0A0F0LTI7 Bacteria Actinobacteria Microbacterium ginsengisoli 0.925 A0A0Q7U0L1 Bacteria Actinobacteria Microbacterium sp.

A0A0A0B6M4 Bacteria Actinobacteria Cellulomonas cellasea 0.741 A0A0B2BA85 Bacteria Actinobacteria Mumia flava

A0A0Q6F8P9 Bacteria Actinobacteria Marmoricola sp. 0.412 0.802 0.393 0.977 A0A0Q8UPV6 Bacteria Actinobacteria Nocardioides sp. 0.953 A0A0Q8X0W2 Bacteria Actinobacteria Nocardioides sp. 0.994 0.013 A0A0Q8HIJ2 Bacteria Actinobacteria Nocardioides sp. 0.891 0.324 A0A0Q8PU21 Bacteria Actinobacteria Nocardioides sp. A0A0U4CR07 Bacteria Actinobacteria Aeromicrobium erythreum 0.861 A0A0V9UE00 Bacteria Actinobacteria Rhodococcus pyridinivorans

D5UJM6 Bacteria Actinobacteria Cellulomonas flavigena

A0A0Q5CS66 Bacteria Actinobacteria Frondihabitans sp.

0.801 A0A0Q5N2W8 Bacteria Actinobacteria Frigoribacterium sp. 0.871 0.708 A0A0Q5L2W5 Bacteria Actinobacteria Frigoribacterium sp. 0.917 0.668 A0A0Q5S323 Bacteria Actinobacteria Frigoribacterium sp. 0.027 0.995 A0A0N0KVR2 Bacteria Actinobacteria Frigoribacterium sp.

A0A0D7QMK2 Bacteria Actinobacteria Agreia bicolorata 0.999 A0A0S9PAL4 Bacteria Actinobacteria Agreia sp. 0.590 0.932 A0A099JN28 Bacteria Actinobacteria Cryobacterium roopkundense 1.000 A0A086E2T7 Bacteria Actinobacteria Cryobacterium sp.

A0A0Q5RPH9 Bacteria Actinobacteria Rathayibacter sp. 1.000 0.949 A0A0Q5BE73 Bacteria Actinobacteria Rathayibacter sp. 0.971 A0A0Q9KUX4 Bacteria Actinobacteria Arthrobacter sp. 1.000 A0A0Q9NKF8 Bacteria Actinobacteria Arthrobacter sp. 0.925 A0A0Q9J5S8 Bacteria Actinobacteria Agromyces sp.

A0A0N7A1H9 Bacteria Actinobacteria Curtobacterium sp. 1.000 A0A022LX17 Bacteria Actinobacteria Curtobacterium flaccumfaciens

D0LCE2 Bacteria Actinobacteria Gordonia bronchialis

A0A087CI37 Bacteria Actinobacteria Bifidobacterium psychraerophilum

1.000 A0A087CU14 Bacteria Actinobacteria Bifidobacterium ruminantium 0.621 0.982 A0A087E2I1 Bacteria Actinobacteria Bifidobacterium thermacidophilum 1.000 A0A087EEX0 Bacteria Actinobacteria Bifidobacterium thermophilum 0.876 0.999 A0A087A8W1 Bacteria Actinobacteria Bifidobacterium callitrichos 0.995 0.942 A0A076JMB8 Bacteria Actinobacteria Bifidobacterium adolescentis 1.000 0.999 A0A0A7I414 Bacteria Actinobacteria Bifidobacterium kashiwanohense A0A0B8NC29 Bacteria Actinobacteria Nocardia seriolae 0.096 D2Q7Z8 Bacteria Actinobacteria Bifidobacterium dentium

F4CW98 Bacteria Actinobacteria Pseudonocardia dioxanivorans

A0A0A0BXD9 Bacteria Actinobacteria Cellulomonas bogoriensis 0.998 D1BGT2 Bacteria Actinobacteria Sanguibacter keddieii 0.952 A0A0Q5WD66 Bacteria Actinobacteria Modestobacter sp. 1.000 0.969 I4EU82 Bacteria Actinobacteria Modestobacter marinus

S4ME00 Bacteria Actinobacteria Streptomyces afghaniensis 0.941 E3JD98 Bacteria Actinobacteria Frankia sp.

A0A0M1JMI9 Bacteria Oscillatoriophycideae Planktothricoides sp. 0.625 B5W6M5 Bacteria Oscillatoriophycideae Arthrospira maxima 0.844 0.913 F5UCA4 Bacteria Oscillatoriophycideae Microcoleus vaginatus

K9W9F1 Bacteria Oscillatoriophycideae Microcoleus sp.

K9ZCM8 Bacteria Nostocales Anabaena cylindrica 0.934 0.920 K9WXX4 Bacteria Nostocales Cylindrospermum stagnale B2IX68 Bacteria Nostocales Nostoc punctiforme 0.403 0.905 K9QDV4 Bacteria Nostocales Nostoc sp.

0.904 A0A0D6KPY7 Bacteria Nostocales Tolypothrix sp.

0.640 K9QPL9 Bacteria Nostocales Nostoc sp.

0.623 A0ZGU0 Bacteria Nostocales Nodularia spumigena 0.996 A0A0P1C0A9 Bacteria Nostocales Chrysosporum ovalisporum 0.999 A0A0C1UFN4 Bacteria Nostocales Hassallia byssoidea

0.894 G6FRT1 Bacteria Stigonematales Fischerella sp. 0.988 0.898 A0A0D6YFN0 Bacteria Stigonematales Mastigocladus laminosus 0.934 A0A0C2KWE8 Bacteria Nostocales Tolypothrix campylonemoides 0.950 A0A0C2QAV1 Bacteria Nostocales Scytonema tolypothrichoides 0.425 A0A0C1N2G5 Bacteria Nostocales Tolypothrix bouteillei 0.521 K9RDT2 Bacteria Nostocales Rivularia sp. 0.872 A0A0V7ZIT1 Bacteria Stigonematales Mastigocoleus testarum 0.705 0.859 A0A0T7BYR6 Bacteria Nostocales Calothrix sp. 0.965 0.399 K9UX41 Bacteria Nostocales Calothrix sp.

A0A0C1WSP5 Bacteria Nostocales Scytonema millei 0.000 K9XHN4 Bacteria Oscillatoriophycideae Gloeocapsa sp. 1.000 U5DNC1 Bacteria Oscillatoriophycideae Rubidibacter lacunae 0.627 A0YLS0 Bacteria Oscillatoriophycideae Lyngbya sp. 0.999 A0A0J9EXS2 Bacteria Oscillatoriophycideae Limnoraphis robusta

A0A0N8KMU4 Bacteria Oscillatoriophycideae Phormidesmis priestleyi 0.864 K8GHZ0 Bacteria Oscillatoriophycideae Oscillatoriales cyanobacterium

A0A0J5QH43 Bacteria Alphaproteobacteria Puniceibacterium sp.

I4YNL9 Bacteria Alphaproteobacteria Microvirga lotononidis 0.310 A0A0P7XY44 Bacteria Alphaproteobacteria Rhizobiales bacterium 1.000 A0A0D6PA89 Bacteria Alphaproteobacteria Acidisphaera rubrifaciens 0.848 A0A0S3PQS6 Bacteria Alphaproteobacteria Variibacter gotjawalensis 0.672 A0A0A1Q0P8 Bacteria unclassified bacteria bacterium YEK0313 0.833 A0A0N8K4K0 Bacteria Alphaproteobacteria Rhodobacteraceae bacterium

B6AUM7 Bacteria Alphaproteobacteria Rhodobacteraceae bacterium 0.802 0.743 0.950 B6AUM6 Bacteria Alphaproteobacteria Rhodobacteraceae bacterium 0.949 0.985 B7RRK5 Bacteria Alphaproteobacteria Roseobacter sp. 0.907 B9NVT4 Bacteria Alphaproteobacteria Rhodobacteraceae bacterium 0.755 A0A0M6YFJ3 Bacteria Alphaproteobacteria Jannaschia donghaensis 0.821 0.961 A0A0T7FFQ6 Bacteria Alphaproteobacteria Neorhizobium galegae 0.776 A4YVR2 Bacteria Alphaproteobacteria Bradyrhizobium sp.

0.000 A0A0M6XVW1 Bacteria Alphaproteobacteria Jannaschia rubra 0.863 A0A0S3PYF7 Bacteria Alphaproteobacteria Variibacter gotjawalensis 0.967 K2J4M7 Bacteria Alphaproteobacteria Oceanibaculum indicum

D5RSZ7 Bacteria Alphaproteobacteria Roseomonas cervicalis

B8IKM2 Bacteria Alphaproteobacteria Methylobacterium nodulans 0.887 1.000 B0UNL9 Bacteria Alphaproteobacteria Methylobacterium sp. 0.994 B1M484 Bacteria Alphaproteobacteria Methylobacterium radiotolerans 0.993 0.661 A0A089NQS2 Bacteria Alphaproteobacteria Methylobacterium oryzae A0A0D6P745 Bacteria Alphaproteobacteria Acidisphaera rubrifaciens 0.999 0.982 0.887 A5EP20 Bacteria Alphaproteobacteria Bradyrhizobium sp. 0.994 D7A1I5 Bacteria Alphaproteobacteria Starkeya novella 0.567 I0GG97 Bacteria Alphaproteobacteria Bradyrhizobium sp.

A1B7J3 Bacteria Alphaproteobacteria Paracoccus denitrificans 1.000 Q3IWN7 Bacteria Alphaproteobacteria Rhodobacter sphaeroides 0.995 A4WU81 Bacteria Alphaproteobacteria Rhodobacter sphaeroides

A5V6R9 Bacteria Alphaproteobacteria Sphingomonas wittichii

J3AU83 Bacteria Alphaproteobacteria Caulobacter sp. 0.999 0.998 B0T8S1 Bacteria Alphaproteobacteria Caulobacter sp. 1.000 R0CV70 Bacteria Alphaproteobacteria Caulobacter crescentus 0.974 0.908 A0A0H3CCU8 Bacteria Alphaproteobacteria Caulobacter crescentus 0.638 D5RS97 Bacteria Alphaproteobacteria Roseomonas cervicalis 1.000 G9ZUT7 Bacteria Alphaproteobacteria Acetobacteraceae bacterium

A0A031HZL1 Bacteria Alphaproteobacteria Sphingomonas sp.

A0A0J1GES7 Bacteria Betaproteobacteria Massilia sp. 0.727 0.960 0.996 I3ZE16 Bacteria Acidobacteriia Terriglobus roseus 0.863 1.000 E8V2I1 Bacteria Acidobacteriia Terriglobus saanensis

1.000 G8P1E2 Bacteria Acidobacteriia Granulicella mallensis 0.885 E8WX90 Bacteria Acidobacteriia Granulicella tundricola

A0A0U3K3T4 Bacteria Bacteroidetes Hymenobacter sp.

0.818 W0RH87 Bacteria Gemmatimonadetes Gemmatirosa kalamazoonesis 0.803 0.374 Q01Z67 Bacteria Solibacteres Solibacter usitatus 0.215 E3T6T1 Bacteria uncultured bacterium uncultured bacterium

V4XLC6 Archaea uncultured archaeon uncultured archaeon

W0J0N2 Bacteria Verrucomicrobia Opitutaceae bacterium 0.188 0.922 W0IW21 Bacteria Verrucomicrobia Opitutaceae bacterium 1.000 I6AVH0 Bacteria Verrucomicrobia Opitutaceae bacterium 0.946 0.976 W0J0W6 Bacteria Verrucomicrobia Opitutaceae bacterium A0A0E3ZT99 Bacteria Cytophagia Spirosoma radiotolerans

1.000 I0K5L3 Bacteria Cytophagia Fibrella aestuarina 0.762 I2GH07 Bacteria Fibrisoma Fibrisoma limi

A0A0D6QGF9 Bacteria delta/epsilon subdivisions Anaeromyxobacter sp.

W6WG66 Bacteria Betaproteobacteria Burkholderia sp. 0.994 1.000 A0A0D8DV71 Bacteria Betaproteobacteria Burkholderia sp.

1.000 A0A0F0FKB3 Bacteria Betaproteobacteria Burkholderiaceae bacterium 0.245 A0A022G7G5 Bacteria Betaproteobacteria Cupriavidus sp. 0.800 0.442 A0A0U5LZL1 Bacteria Actinobacteria Streptomyces reticuli 0.993 A0A0Q5J8J1 Bacteria Actinobacteria Agreia sp.

A0A0A2SNX6 Bacteria Gammaproteobacteria Legionella norrlandica

A0A0T6AGS1 Bacteria delta/epsilon subdivisions Deltaproteobacteria bacterium 0.954 1.000 I4C723 Bacteria delta/epsilon subdivisions Desulfomonile tiedjei

0.966 A0A0T5ZZ80 Bacteria Gammaproteobacteria Candidatus Rokubacteria 1.000 A0A0T6A1C3 Bacteria candidate division JS1 candidate division

0.966 A0A0P4UU30 Bacteria Oscillatoriophycideae Leptolyngbya sp.

0.999 A4SZ74 Bacteria Betaproteobacteria Polynucleobacter necessarius 1.000 D5PFC8 Bacteria Actinobacteria Mycobacterium parascrofulaceum 0.906 B0UQ89 Bacteria Alphaproteobacteria Methylobacterium sp.

C0DBC9 Bacteria Clostridia Clostridium asparagiforme]

0.993 A0A0F0CAW9 Bacteria Clostridia Clostridium sp. 0.992 C5EIK5 Bacteria Clostridia Clostridiales bacterium

A0A0M2VV49 Bacteria Bacilli Paenibacillus sp.

G4HGU1 Bacteria Bacilli Paenibacillus lactis 0.983 0.952 A0A0M0W224 Bacteria Bacilli Bacillus sp. 0.484 0.988 D3ELZ1 Bacteria Bacilli Geobacillus sp. 1.000 W4BHP5 Bacteria Bacilli Paenibacillus sp.

W7YSZ4 Bacteria Bacilli Bacillus sp.

0.992 A0A060LWY5 Bacteria Bacilli Bacillus lehensis 1.000 W7ZP28 Bacteria Bacilli Bacillus sp.

A0A068NS35 Bacteria Fimbriimonadia Fimbriimonas ginsengisoli 0.976 D6TR17 Bacteria Ktedonobacteria Ktedonobacter racemifer

0.921 D6U3W3 Bacteria Ktedonobacteria Ktedonobacter racemifer 0.435 A0A075R4X5 Bacteria Bacilli Brevibacillus laterosporus 0.998 0.999 0.973 A0A0K9YP71 Bacteria Bacilli Brevibacillus reuszeri 0.032 A0A0V8HG35 Bacteria Bacilli Bacillus enclensis

A0A0B0HWJ1 Bacteria Bacilli Paenibacillus sp. 0.456 1.000 A0A0U2URB9 Bacteria Bacilli Paenibacillus sp.

0.592 A0A0N0UIE0 Bacteria Bacilli Paenibacillus sp. 0.906 W4B2B2 Bacteria Bacilli Paenibacillus sp.

W7LEA1 Bacteria Bacilli Bacillus firmus 0.991 A0A0U2Z6P3 Bacteria Bacilli Planococcus rifietoensis 0.983 0.969 E7RF20 Bacteria Bacilli Planococcus donghaensis 0.989 0.779 I4X5W5 Bacteria Bacilli Planococcus antarcticus 0.000 R9BV26 Bacteria Bacilli Bacillus nealsonii 0.994 N0AQM2 Bacteria Bacilli Bacillus sp. 0.862 A0A0B0IBN5 Bacteria Bacilli Bacillus okhensis 0.871 A0A0Q3S8Y9 Bacteria Bacilli Bacillus sp. 0.905 0.929 A0A0C2VYS5 Bacteria Bacilli Jeotgalibacillus campisalis 0.990 A0A0C2W3R1 Bacteria Bacilli Jeotgalibacillus alimentarius 1.000 A0A0B5AMS7 Bacteria Bacilli Jeotgalibacillus sp.

A0A0P9CBD9 Bacteria Bacilli Alicyclobacillus ferrooxydans

A0A0M8XMN7 Bacteria Actinobacteria Micromonospora sp. 1.000 I0L2F8 Bacteria Actinobacteria Micromonospora lupini

0.749 A0A0Q5WCC0 Bacteria Actinobacteria Modestobacter sp. 1.000 A0A0Q5VT97 Bacteria Actinobacteria Geodermatophilus sp. 0.993 A0A098Y761 Bacteria Actinobacteria Modestobacter sp. 0.923 I4EQW1 Bacteria Actinobacteria Modestobacter marinus

A0A022LHR8 Bacteria Actinobacteria Curtobacterium flaccumfaciens 0.000 A0A0Q5RCM8 Bacteria Actinobacteria Curtobacterium sp. 1.000 A0A0N6ZWD8 Bacteria Actinobacteria Curtobacterium sp. 0.614 0.948 A0A0Q4UJZ8 Bacteria Actinobacteria Curtobacterium sp. A0A0S9D7V6 Bacteria Actinobacteria Arthrobacter sp. 0.146 1.000 A0A0L0BGS4 Bacteria Actinobacteria Arthrobacter sp. 0.822 A0A0N1M150 Bacteria Actinobacteria Frigoribacterium sp.

0.985 A0A0Q5NCL0 Bacteria Actinobacteria Frigoribacterium sp. 0.993 0.887 A0A0Q5L0S4 Bacteria Actinobacteria Frigoribacterium sp.

A6WFM7 Bacteria Actinobacteria Kineococcus radiotolerans

1.000 A0A0C2BDD8 Bacteria Actinobacteria Streptomyces sp. 0.903 0.926 W7SA15 Bacteria Actinobacteria Kutzneria sp. 0.263 A0A0K3BQ75 Bacteria Actinobacteria Kibdelosporangium sp.

0.990 A0A066UC49 Bacteria Actinobacteria Amycolatopsis rifamycinica 1.000 G0FVN9 Bacteria Actinobacteria Amycolatopsis mediterranei

A0A0Q9LGE8 Bacteria Actinobacteria Phycicoccus sp. 0.999 A0A0T2IJE3 Bacteria Actinobacteria Phycicoccus sp. Figure S9. Maximum likelihood tree constructed from a subsample of equal numbers of Amd/Fmd clusters from Archaea and Bacteria. A total of 139 sequences were subsampled from bacterial OTU0.9 clusters to equal the number of archaeal clusters. The three clades root with a bacterial origin, similar to the full trees (Fig. 6 and Fig. S8). Clade 1, green lines; Clade II, blue lines; Clade III, red lines; Archaeal sequences within clades, black lines. Scale represents 1 amino acid variation per aligned position. Figure S9 Figure S10. Number of Amd/Fmd sequences in closed genomes from Archaea and Bacteria. A. Average number of Amd/Fmd sequences within genomes that contain Amd/Fmd sequences. B. Average number of Amd/Fmd sequences within genomes of Archaea that contain Amd/Fmd sequences, with taxa shown at the class level. C. Average number of Amd/Fmd sequences within genomes of Bacteria that contain Amd/Fmd sequences, with taxa shown at the phylum/class level. Figure S10 Figure S11. GC/MS analyses of acetamide. A. A five point acetamide standard series in the 0 – 20 µg mL-1 range fitted with a two point polynomial standard curve. B. GC/MS chromatogram of acetamide standards (m/z 59 ion), showing the typical elution time of ~28 min. Figure S11

A.

B. Table S1. Oligodeoxynucleotide primers used in this study.

Primers used for plasmid construction Primer name Sequence Description pJ_For GGCGGCCGTTGGAAGAACCGG hmgA amplification for creating pJWID1, forward primer pJ_For_M GATACTGCAGAACGCTTTAAGGCC hmgA amplification for creating pJWID1, mutated forward primer; promoter GGCGCGGG mutations sites underlined pJ_Rev GATACTGCAGTTACCGACCGAGTT hmgA amplification for creating pJWID1, reverse primer CGGCGTGG hmgA_For GCAGGAAAGAACATGCAGAACG hmgA amplification for creating pTA131_Δamd3, forward primer hmgA_Rev CCATGCAGTTACCGACCGAGTT hmgA amplification for creating pTA131_Δamd3, reverse primer Acet_down_For15_h CATGTTCTTTCCTGCCCTCAAGAAG amd3 deletion, 15 bp overlap with 5’ end of hmgA (underlined) TTCGGCTACA Acet_down_Rev15 GCTTGATATCGAATTCGGATACGC amd3 deletion, 15 bp overlap with EcoRI ends of pTA131 (underlined) CTGAATCGTGAG Acet_up_For15 ACCGCGGTGGCGGCCGCTCGTGGT amd3 deletion, 15 bp overlap with NotI ends of pTA131 (underlined) CGTGGCTGTAGAGGTGG Acet_up_Rev15_h TCGGTAACTGCATGGGGCGAGGTA amd3 deletion, 15bp overlap with 3’ end of hmgA GTGGACTTGCGTGAGG pJ_2285_FW GACCTATTGCGCATATGATGCCAG Complementation, 15 bp overlap with NdeI ends of pJWID1 AAGTCAAATTCGA pJ_2285_RV CGGGCTGCAGGAATTCTCACTCAA Complementation, 15 bp overlap with EcoRI ends of pJWID1 GGGGATCGTC Primer used in the PCR assessment for Hlac_2285 gene deletion Primer group-diagnostic purpose Primer name Primer location Sequence Product size P1: single recombination, position 1 SR1_For ColE1 of pTA131 ACTACGGCTACACTAGAAGGA 4036 bp SR1_Rev amd3 CGGGAACCACGACATCAA

P2: single recombination, position 2 SR2_For amd3 TTGATGTCGTGGTTCCCG 2382 bp SR2_Rev ColE1 of pTA131 TCCTTCTAGTGTAGCCGTAGT

P3: double recombination, replacting DRP_For Chromosome downstream of amd3 CAACCGTCGGATCAGTGAG 1193 bp amd3 with hmgA (positive test) DRP_Rev hmgA CGCTTCGAGTTCGTGGAG

P4. double recombination, replacing amd3 DRP_For Chromosome downstream of amd3 CAACCGTCGGATCAGTGAG 1423 bp with hmgA (negative control) SR1_Rev amd3 CGGGAACCACGACATCAA

Table S3. Taxonomic distribution of Amd/Fmd sequences in closed genomes of Archaea and Bacteria.

Taxonomic group Number of Number of genomes Number of Average number of Average number of genomes containing Amd/Fmd Amd/Fmd Amd/Fmd Amd/Fmd sequences sequences in closed sequences in all sequences genomes containing closed genomes Amd/Fmd sequences Archaea Euryarchaeota Halobacteria 30 20 35 1.75 1.17 Thermococci 19 9 11 1.22 0.58 Thermoplasmata 7 2 2 1 0.29 Archaeoglobi 7 0 0 - 0 Methanobacteria 13 0 0 - 0 Methanococci 15 0 0 - 0 Methanomicrobia 47 0 0 - 0 Methanopyri 1 0 0 - 0 unclassified 3 0 0 - 0 Korarchaeota unclassified 1 1 1 1 1 Crenarchaeota Thermoprotei 58 33 34 1.03 0.59 Thaumarchaeota unclassified 12 0 0 - 0 Nanoarchaeota unclassified 1 0 0 - 0 Unclassified Archaea 1 0 0 - 0 Total 215 65 83 1.28 0.39 Bacteria Acidobacteria 8 6 13 2.17 1.63 Actinobacteria 425 125 202 1.66 0.49 Aquificae 14 0 0 - 0 Armatimonadetes 2 1 1 1 0.5 Bacteroidetes 138 3 3 1 0.02 Caldiserica 1 0 0 - 0 Candidatus Saccharibacteria 2 0 0 - 0 Chlamydiae 108 0 0 - 0 Chlorobi 11 0 0 - 0 Chloroflexi 25 8 13 1.7 0.52 Cloacimonetes 1 0 0 - 0 Cyanobacteria 91 31 38 1.2 0.42 Deferribacteres 4 0 0 - 0 Deinococcus-Thermus 21 8 10 1.25 0.48 Dictyoglomi 2 0 0 - 0 Elusimicrobia 3 0 0 - 0 Fibrobacteres 1 0 0 - 0 Bacilli 703 191 210 1.10 0.30 Clostridia 178 32 45 1.41 0.25 Tissierellia 3 1 2 2 0.67 Negativicutes 8 0 0 - 0 Erysipelotrichia 1 0 0 - 0 Fusobacteria 20 0 0 - 0 Gemmatimonadetes 2 2 2 1 1 Kryptonia 2 0 0 - 0 Nitrospirae 6 0 0 - 0 Planctomycetes 7 3 4 1.33 0.57 Alphaproteobacteria 350 104 198 1.90 0.57 Betaproteobacteria 289 61 103 1.69 0.36 Deltaproteobacteria 70 9 9 1 0.13 Gammaproteobacteria 970 97 105 1.08 0.11 Epsilonproteobacteria 155 0 0 - 0 Spirochaetes 82 1 1 1 0.01 Synergistetes 5 1 2 2 0.4 Tenericutes 129 0 0 - 0 Thermodesulfobactera 3 0 0 - 0 Thermotogae 23 17 18 1.06 0.78 Verrucomicrobia 7 2 6 3 0.86 Unclassified Bacteria 2 0 0 - 0 Total 3872 703 985 1.40 0.25