DOCSLIB.ORG

Strains from the Burkholderia Cepacia Complex: Relationship to Opportunistic Pathogens1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Strains from the Burkholderia Cepacia Complex: Relationship to Opportunistic Pathogens1 Journal of Nematology 35(2):208–211. 2003. © The Society of Nematologists 2003. Strains from the Burkholderia cepacia Complex: Relationship to Opportunistic Pathogens1 Peter Vandamme2 and Eshwar Mahenthiralingam3 Abstract: Burkholderia cepacia-like organisms attract much interest from the agricultural industry as natural promoters of plant growth and biological control agents, and for bioremediation. Some of these organisms, however, cause life-threatening infections, particularly in cystic fibrosis patients for whom this multi-resistant bacterium is a major pathogen. The biodiversity of this group of bacteria is severely underestimated, and current identification procedures are inadequate. Presumed B. cepacia isolates belong to at least nine distinct genomic species (genomovars), referred to collectively as the B. cepacia complex. All these B. cepacia complex genomovars have been isolated from clinical and environmental sources. There are no phenotypic, genomic, or taxonomic grounds to differentiate environmental and clinical strains of the B. cepacia complex or to use the source of isolation to assess the safety of biopesticides containing members of the B. cepacia complex. Key words: Burkholderia cepacia complex, cystic fibrosis, epidemiology, genomovar, strain typing. Burkholderia cepacia is an extremely versatile organism tions caused numerous deaths in cystic fibrosis popula- that is truly considered both a friend and foe to humans tions worldwide and new guidelines were issued to re- (Govan et al., 2000). It is a genuinely ubiquitous organ- duce the risk of B. cepacia acquisition (Govan and ism with soil, water (including antiseptic and pharma- Deretic, 1996). More recently, serious outbreaks with ceutical solutions, and seawater), animals, plants, and fatalities have occurred in non-cystic fibrosis patients humans as niches. Although originally known as a plant treated in intensive care units in Europe and North pathogen, it is now also recognized as a most useful America (Holmes et al., 1999; Ledson et al., 1998). organism with a range of biotechnological applications There have been few reports of B. cepacia infection in that include biocontrol, bioremediation, and plant- veterinary medicine. Burkholderia cepacia has been re- growth promotion. However, it simultaneously has be- ported in mixed culture in clinical specimens from come notorious as a naturally multi-resistant and life- horses with pneumonia and in specific-pathogen-free threatening pathogen in immune-suppressed hosts piglets, as the sole organism involved in a case of veg- such as cystic fibrosis patients and patients with chronic etative endocarditis in a horse, and as the causative granulomatous disease (LiPuma, 1998; Speert, 2001). agent of an epidemic outbreak of subclinical mastitis Infections in humans and animals: The genus Burkhol- associated with infection in a large flock of milking deria comprises several established human pathogens. sheep (Berriatua et al., 2001). Before the early 1980s, reports of human infections Biotechnological applications: Care and concern for the caused by B. cepacia were sporadic and generally re- environment urge scientists, private firms, and legal au- stricted to hospitalized patients exposed to contami- thorities to develop biological alternatives to the nated disinfectant and anesthetic solutions in which present chemical controls in the agro-industry, thereby this highly adaptable saprophyte survives for long peri- reducing environmental chemical pollution (Parke and ods (LiPuma, 1998). A rising incidence, particularly in Gurian-Sherman, 2001). The major reasons for the in- patients with cystic fibrosis, was noted during the early terest in bacterial biopesticides or bioremediation are 1980s. Cystic fibrosis is the most common lethal inher- to provide environmentally benign means of control- ited disease of Caucasian populations, with pulmonary ling pests, remove toxic and other dangerous chemicals infections as the major cause of morbidity and mortal- from the environment, or use environment-friendly fer- ity. Infection or colonization by B. cepacia leads to dif- tilizers. Control of plant diseases, insects, and nema- ferent outcomes in different patients (Mahenthiralin- todes by bacteria and fungi has been proposed as an gam et al., 2001). However, a prime cause for concern alternative or supplement to chemical pesticides such is that pulmonary colonization reduces survival by 50% as captan, thiram, and thiobendazole. Roots and rhizo- and that about one-third to one-half of the patients spheres of various economically important crops in- succumb to “cepacia syndrome,” a rapidly fatal necro- cluding corn, maize, rice, pea, sunflower, and radish tizing pneumonia, sometimes accompanied by bacte- can be colonized by B. cepacia-like organisms, some of remia (Govan and Deretic, 1996). During the 1980s which produce a variety of antimicrobial compounds and 1990s, several major outbreaks of B. cepacia infec- that are active against soil pathogens (Govan and Van- damme, 1998; Parke and Gurian-Sherman, 2001). Us- ing these B. cepacia-like organisms as seed inoculants or 1 Symposium paper presented at the 40th Annual Meeting of the Society of root dips for biological control of pathogens that cause Nematologists, 25–29 August 2001, Salt Lake City, UT. 2 Laboratorium voor Microbiologie, Faculteit Wetenschappen, Universiteit rot of seeds or seedlings can increase crop yields sig- Gent, Ghent, Belgium. nificantly. In addition, in absence of soil pathogens, a 3 School of Biosciences, Cardiff University, Cardiff, United Kingdom. E-mail: [email protected] significant growth-promoting effect has been reported. This paper was edited by B. C. Hyman. The exceptional nutritional potential of some B. ce- 208 B. cepacia Complex Taxonomy: Vandamme, Mahenthiralingam 209 pacia strains is also used in the bioremediation of haz- TABLE 1. Current Burkholderia species and their sources. ardous waste sites and effluents. Carcinogenic or toxic products such as ethers present in gasoline, polycyclic Species Sources aromatic compounds, and other constituents of crude B. ambifaria (B. cepacia genomo- Soil, humans oils and coal cause serious concerns whenever acciden- var VII) tal spillage, improper disposal, transportation, or im- B. anthina (B. cepacia genomovar Soil, rhizosphere, humans, VIII) animals proper commercial usage occurs. Herbicides such as B. andropogonisa Plants 2,4-dichlorophenoxyacetic acid or 2,4,5-trichlorophe- B. caledonica Rhizosphere noxyacetic acid (the principal component of Agent B. caribensis Soil Orange) can efficiently be degraded by certain B. cepa- B. caryophylli Plants B. cepacia (genomovar I) Plants, soil, water, humans cia strains (Govan and Vandamme, 1998; Holmes et al., B. cepacia (genomovar III) Plants, soil, humans, animals 1998). B. cepacia (genomovar VI) Humans, soil Taxonomic history: Burkholderia cepacia was first de- B. fungorum Fungi, root nodules, animals, scribed as Pseudomonas cepacia by Walter Burkholder in humans B. gladiolib Plants, soil, humans 1950 as the phytopathogen responsible for bacterial rot B. glathei Soil of onions (Burkholder, 1950). In their seminal taxo- B. glumae Plants nomic study published in the 1960s, Stanier and col- B. graminis Soil, rhizosphere B. kururiensis Water leagues (Stanier et al., 1966) noted the extraordinary B. mallei Animals metabolic versatility of another novel pseudomonad, P. B. multivorans (B. cepacia ge- Plants, soil, humans multivorans. This novel species was mainly isolated from nomovar II) soil and water samples. A few years later Ballard et al. B. phenazinium Soil B. plantariic Plants (1970) reported on the synonymy between P. cepacia B. pseudomallei Soil, humans and P. multivorans. Nomenclatural priority was given to B. pyrrocinia (B. cepacia genomo- Soil, humans the former, as this was the oldest validly described spe- var IX) cies. The same year, Jonsson (1970) proposed the name B. sacchari Soil B. stabilis (B. cepacia genomovar Soil, humans Pseudomonas kingii for CDC group EO-1 (eugonic oxi- IV) dizer group 1), an opportunistic human pathogen. Sub- B. thailandensis Soil, humans sequent taxonomic analysis by Snell et al. (1972) and B. ubonensis Soil, humans Samuels et al. (1973) again revealed that the novel or- B. vietnamiensis (B. cepacia ge- Plants, soil, humans nomovar V) ganism was the same as P. cepacia. The taxonomic heterogeneity of the genus Pseudomo- a Including Pseudomonas woodsii. b Including B. cocovenenans and Pseudomonas antimicrobica. nas was revealed by the work of Palleroni et al. (1973) c Including B. vandii. and led to the gradual dissection of the genus over the following decades (Kersterts et al., 1996). In 1992, P. oli, another well-known plant pathogen (Simpson et al., cepacia and several other species of rRNA group II sensu 1994). These data, together with the striking differ- Palleroni et al. were transferred to the new genus Burk- ences in clinical outcome, transmissibility, plant patho- holderia (Yabuuchi et al., 1992). During the past 10 genic or biocontrol properties, might all have con- years, the clinical and biotechnological interest in B. cerned strain-specific differences but could also have cepacia-like organisms led to the discovery and descrip- pointed to an underlying taxonomic problem. A poly- tion of a multitude of novel species. The genus now phasic taxonomic study was initiated in 1992 and in- contains 26 species: Burkholderia andropogonis, B. ambi- cluded comparative 16S rDNA and recA sequence analy- faria,
Load more

Recommended publications
  • Crystal Structures of the Burkholderia Multivorans Hopanoid Transporter Hpnn
    Crystal structures of the Burkholderia multivorans hopanoid transporter HpnN Nitin Kumara,1, Chih-Chia Sub,1, Tsung-Han Choub, Abhijith Radhakrishnana, Jared A. Delmarb, Kanagalaghatta R. Rajashankarc,d, and Edward W. Yua,b,2 aDepartment of Chemistry, Iowa State University, Ames, IA 50011; bDepartment of Physics and Astronomy, Iowa State University, IA 50011; cNortheastern Collaborative Access Team, Argonne National Laboratory, Argonne, IL 60439; and dDepartment of Chemistry and Chemical Biology, Cornell University, Ithaca, NY 14850 Edited by Eric Gouaux, Oregon Health and Science University, Portland, OR, and approved May 15, 2017 (received for review November 30, 2016) Strains of the Burkholderia cepacia complex (Bcc) are Gram-negative critical line of defense against antimicrobial agents in Burkholderia opportunisitic bacteria that are capable of causing serious diseases, species is the permeability barrier of the outer membrane. Most of mainly in immunocompromised individuals. Bcc pathogens are in- these species contain a modified lipopolysaccharide, which results in trinsically resistant to multiple antibiotics, including β-lactams, ami- polymyxin resistance (13). In addition, the permeability of the major noglycosides, fluoroquinolones, and polymyxins. They are major outer membrane porin channel Omp38 appears to be low for an- pathogens in patients with cystic fibrosis (CF) and can cause severe tibiotics (14). The presence of a large number of multidrug efflux necrotizing pneumonia, which is often fatal. Hopanoid biosynthesis pumps, belonging to the resistance-nodulation-cell division (RND) is one of the major mechanisms involved in multiple antimicrobial superfamily, also plays a major role in the intrinsic resistance to a resistance of Bcc pathogens. The hpnN gene of B.
    [Show full text]
  • Transfer of Pseudomonas Plantarii and Pseudomonas Glumae to Burkholderia As Burkholderia Spp
    INTERNATIONALJOURNAL OF SYSTEMATICBACTERIOLOGY, Apr. 1994, p. 235-245 Vol. 44, No. 2 0020-7713/94/$04.00+0 Copyright 0 1994, International Union of Microbiological Societies Transfer of Pseudomonas plantarii and Pseudomonas glumae to Burkholderia as Burkholderia spp. and Description of Burkholderia vandii sp. nov. TEIZI URAKAMI, ’ * CHIEKO ITO-YOSHIDA,’ HISAYA ARAKI,’ TOSHIO KIJIMA,3 KEN-ICHIRO SUZUKI,4 AND MU0KOMAGATA’T Biochemicals Division, Mitsubishi Gas Chemical Co., Shibaura, Minato-ku, Tokyo 105, Niigata Research Laboratory, Mitsubishi Gas Chemical Co., Tayuhama, Niigatu 950-31, ’Plant Pathological Division of Biotechnology, Tochigi Agricultural Experiment Station, Utsunomiya 320, Japan Collection of Microorganisms, The Institute of Physical and Chemical Research, Wako-shi, Saitama 351-01,4 and Institute of Molecular Cell and Biology, The University of Tokyo, Bunkyo-ku, Tokyo 113,’ Japan Plant-associated bacteria were characterized and are discussed in relation to authentic members of the genus Pseudomonas sensu stricto. Bacteria belonging to Pseudomonas rRNA group I1 are separated clearly from members of the genus Pseudomonas sensu stricto (Pseudomonasfluorescens rRNA group) on the basis of plant association characteristics, chemotaxonomic characteristics, DNA-DNA hybridization data, rRNA-DNA hy- bridization data, and the sequences of 5s and 16s rRNAs. The transfer of Pseudomonas cepacia, Pseudomonas mallei, Pseudomonas pseudomallei, Pseudomonas caryophylli, Pseudomonas gladioli, Pseudomonas pickettii, and Pseudomonas solanacearum to the new genus Burkholderia is supported; we also propose that Pseudomonas plantarii and Pseudomonas glumae should be transferred to the genus Burkholderia. Isolate VA-1316T (T = type strain) was distinguished from Burkholderia species on the basis of physiological characteristics and DNA-DNA hybridization data. A new species, Burkholderia vandii sp.
    [Show full text]
  • Table S1. Primers Used for PCR Amplification
    Table S1. Primers used for PCR amplification Name Primer Sequence (5’-3’) Gene target Taxon target Reference First PCR round DGGE analysis FGPH19 TACGGCAARGGTGGNATHG nifH Diazotrophic (Simonet et al. 1991) POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) 799F AACMGGATTAGATACCCKG 16S rRNA Bacteria (Chelius and Triplett 2001) 1492R TACGGYTACCTTGTTACGACTT 16S rRNA Bacteria (Chelius and Triplett 2001) F203α CCGCATACGCCCTACGGGGGAAAGATTTAT 16S rRNA Alphaproteobacteria (Gomes et al. 2001) F948β CGCACAAGCGGTGGATGA 16S rRNA Betaproteobacteria (Gomes et al. 2001) F243HCG GGATGAGCCCGCGGCCTA 16S rRNA Actinobacteria (Heuer et al. 1997) BACF GGGAAACCGGGGCTAATACCGGAT 16S rRNA Firmicutes (Garbeva et al. 2003) Second PCR round DGGE analysis POLF-GC CGCCCGCCGCGCCCCGCGCCCGGCCCGCCCCCG nifH Diazotrophic (Poly et al. 2001) CCCCTGCGAYCCSAARGCBGACTC AQER GACGATGTAGATITCCTG nifH Diazotrophic (Poly et al. 2001) F968-GC CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGC 16S rRNA Bacteria (Heuer et al. 1999) ACGGGGGGAACGAAGAACCTTAC R1401 CGGTGTGTACAAGACCC 16S rRNA Bacteria (Heuer et al. 1997) qPCR analysis POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) POLF TGCGAYCCSAARGCBGACTC nifH Diazotrophic (Poly et al. 2001) 6S-27F AGAGTTTGATCCTGGCTCAG 16S rRNA Bacteria Bulgari et al., 2014 338R GCTGCCTCCCGTAGGAGT 16S rRNA Bacteria Bulgari et al., 2014 Table 2. Primers used for Ion Torrent pyrosequencing analysis. Primer Primer sequence (5´-3´) Reference 967F-PP CNACGCGAAGAACCTTANC (Jünemann et al. 2012) 967F-UC1 CAACGCGAAAAACCTTACC (Jünemann et al. 2012) 967F-UC2 CAACGCGCAGAACCTTACC (Jünemann et al. 2012) 967F-UC3 ATACGCGARGAACCTTACC (Jünemann et al. 2012) 967F-AQ CTAACCGANGAACCTYACC (Jünemann et al. 2012) 1046R CGACAGCCATGCANCACCT (Jünemann et al. 2012) 1046R-PP CGACAACCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ1 CGACGGCCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ2 CGACGACCATGCANCACCT (Jünemann et al. 2012) Table S3. Alpha diversity indices. Statistical analysis of the total endophytic and diazotrophic endophytic bacterial community associated with sweet sorghum cv.
    [Show full text]
  • Phenotypic and Genomic Analyses of Burkholderia Stabilis Clinical Contamination, Switzerland Helena M.B
    RESEARCH Phenotypic and Genomic Analyses of Burkholderia stabilis Clinical Contamination, Switzerland Helena M.B. Seth-Smith, Carlo Casanova, Rami Sommerstein, Dominik M. Meinel,1 Mohamed M.H. Abdelbary,2 Dominique S. Blanc, Sara Droz, Urs Führer, Reto Lienhard, Claudia Lang, Olivier Dubuis, Matthias Schlegel, Andreas Widmer, Peter M. Keller,3 Jonas Marschall, Adrian Egli A recent hospital outbreak related to premoistened gloves pathogens that generally fall within the B. cepacia com- used to wash patients exposed the difficulties of defining plex (Bcc) (1). Burkholderia bacteria have large, flexible, Burkholderia species in clinical settings. The outbreak strain multi-replicon genomes, a large metabolic repertoire, vari- displayed key B. stabilis phenotypes, including the inabil- ous virulence factors, and inherent resistance to many anti- ity to grow at 42°C; we used whole-genome sequencing to microbial drugs (2,3). confirm the pathogen was B. stabilis. The outbreak strain An outbreak of B. stabilis was identified among hos- genome comprises 3 chromosomes and a plasmid, shar- ing an average nucleotide identity of 98.4% with B. stabilis pitalized patients across several cantons in Switzerland ATCC27515 BAA-67, but with 13% novel coding sequenc- during 2015–2016 (4). The bacterium caused bloodstream es. The genome lacks identifiable virulence factors and has infections, noninvasive infections, and wound contamina- no apparent increase in encoded antimicrobial drug resis- tions. The source of the infection was traced to contaminat- tance, few insertion sequences, and few pseudogenes, ed commercially available, premoistened washing gloves suggesting this outbreak was an opportunistic infection by used for bedridden patients. After hospitals discontinued an environmental strain not adapted to human pathogenic- use of these gloves, the outbreak resolved.
    [Show full text]
  • Product Information Sheet for NR-705
    Product Information Sheet for NR-705 Burkholderia multivorans, Strain LMG stored at -60°C or colder immediately upon arrival. For ® long-term storage, the vapor phase of a liquid nitrogen 13010 (ATCC BAA-247) freezer is recommended. Freeze-thaw cycles should be avoided. Catalog No. NR-705 (Derived from ATCC® BAA-247) Growth Conditions: Media: Tryptic Soy broth or equivalent For research only. Not for human use. Tryptic Soy agar or equivalent Incubation: Contributor: ® Temperature: 30°C ATCC Atmosphere: Aerobic Propagation: Manufacturer: 1. Keep vial frozen until ready for use; then thaw. BEI Resources 2. Transfer the entire thawed aliquot into a single tube of broth. Product Description: 3. Use several drops of the suspension to inoculate an Bacteria Classification: Burkholderiaceae, Burkholderia agar slant and/or plate. Species: Burkholderia multivorans (formerly Burkholderia 4. Incubate the tube, slant and/or plate for 24 to 48 hours. cepacia genomovar II)1 ® Strain: Type strain, LMG 13010 (ATCC BAA-247, CCUG Citation: 34080, Lauwers Cepa 002, CIP 105495, DSM 13243, Acknowledgment for publications should read “The following NCTC 13007) reagent was obtained through BEI Resources, NIAID, NIH: Original Source: Burkholderia multivorans (B. multivorans), Burkholderia multivorans, Strain LMG 13010 (ATCC® BAA- strain LMG 13010 was isolated in 1992 from the sputum of 1 247), NR-705.” a cystic fibrosis patient in Belgium. Comments: B. multivorans, strain LMG 13010 was deposited ® Biosafety Level: 2 at the ATCC in 2001 by Dr. D. Janssens from Appropriate safety procedures should always be used with BCCM/LMG Bacteria Collection, Ghent University, Ghent, this material. Laboratory safety is discussed in the following Belgium.
    [Show full text]
  • Cystic Fibrosis Mice Develop Spontaneouschronic Bordetella
    ISSN 2470-3176 SciO p Forschene n HUB for Sc i e n t i f i c R e s e a r c h Journal of Infectious Pulmonary Diseases Research Article Volume: 3.2 Open Access Received date: 11 Oct 2017; Accepted date: 28 Cystic Fibrosis Mice Develop Spontaneous Oct 2017; Published date: 02 Nov 2017. Chronic Bordetella Airway Infections Citation: Darrah R, Bonfield T, LiPuma JJ, Litman P, Hodges CA, et al. (2017) Cystic Fibrosis Mice Darrah R1*, Bonfield T2, LiPuma JJ3, Litman P1, Hodges CA4, Jacono F5 and Develop Spontaneous Chronic Bordetella Airway Drumm M6 Infections. J Infect Pulm Dis 3(2): doi http://dx.doi. org/10.16966/2470-3176.128 1Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA 2Department of Pediatrics, Case Western Reserve University, Cleveland Ohio, USA Copyright: © 2017 Darrah R, et al. This is an 3Department of Pediatrics and Communicable Diseases, University of Michigan Medical School, Ann open-access article distributed under the terms Arbor, Michigan, USA of the Creative Commons Attribution License, 4Departments of Radiology, Biomedical Engineering, and Pediatrics, Case Western Reserve University, which permits unrestricted use, distribution, and Cleveland Ohio, USA reproduction in any medium, provided the original 5Department of Medicine, Case Western Reserve University, and Louis Stokes VA Cleveland Medical author and source are credited. Center, USA 6Departments of Pediatrics and Genetics Genome Sciences, Case Western Reserve University, Cleveland Ohio, USA *Corresponding author: Rebecca Darrah, Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA, Tel: 216-368-4911; E-mail: [email protected] Abstract Chronic pulmonary disease and infection is the primary cause of morbidity and mortality in people with cystic fibrosis (CF).
    [Show full text]
  • Bordetella Petrii Clinical Isolate Isolates of This Species Have Been Previously Reported from 4
    routine laboratory protocols. Initial susceptibility testing Bordetella petrii using disk diffusion indicated apparent susceptibility of the isolate to erythromycin, gentamicin, ceftriaxone, and Clinical Isolate piperacillin/tazobactam. The isolate was resistant to amox- icillin, co-amoxiclav, tetracycline, clindamycin, ciproflo- Norman K. Fry,* John Duncan,* Henry Malnick,* xacin, and metronidazole. After initial sensitivity results, a Marina Warner,* Andrew J. Smith,† 6-week course of oral clarithromycin (500 mg, 8 hourly) Margaret S. Jackson,† and Ashraf Ayoub† was begun. We describe the first clinical isolate of Bordetella petrii At follow-up appointments 3 months and 6 months from a patient with mandibular osteomyelitis. The only pre- after antimicrobial drug therapy ceased, clinical and radi- viously documented isolation of B. petrii occurred after the ographic findings were not unusual, and the infected area initial culture of a single strain from an environmental healed successfully. Despite the successful clinical out- source. come, the isolate was subsequently shown to be resistant to clarithromycin in vitro (Table). Improvement of the 67-year-old man visited an emergency dental clinic, osteomyelitis may also have been facilitated by the biopsy Awhere he complained of toothache in the lower right procedure, during which a sequestrum of bone was mandibular quadrant. Examination showed a root-filled removed. lower right canine tooth that was mobile and tender to per- The gram-negative bacillus (designated strain cussion. The tooth was extracted uneventfully under local GDH030510) was submitted to the Health Protection anesthesia. The patient returned after several days with Agency, Centre for Infections, London, for identification. pain at the extraction site. A localized alveolar osteitis was Preliminary tests results were consistent with those diagnosed, and local debridement measures were institut- described for members of the genus Bordetella.
    [Show full text]
  • Biocontrol of Sclerotinia Stem Rot of Canola by Bacterial Antagonists and Study of Biocontrol Mechanisms Involved
    BIOCONTROL OF SCLEROTINIA STEM ROT OF CANOLA BY BACTERIAL ANTAGONISTS AND STUDY OF BIOCONTROL MECHANISMS INVOLVED by Yilan Zhang A Thesis Submitted to the Faculty of Graduate Studies In Partial Fulfillment of the Requirements for the Degree of MASTER OF SCIENCE Department of Plant Science University of Manitoba Winnipeg, Manitoba, Canada © Yilan Zhang 2004 THE UNIVERSITY OF MANITOBA FACULTY OF GRADUATE STUDIES ***** COPYRIGHT PERMISSION PAGE Biocontrol of Sclerotinia Stem Rot of Canola by Bacterial Antagonists and Study of Biocontrol Mechanisms Involved By Yilan Zhang A Thesis/Practicum submitted to the Faculty of Graduate Studies of the University of Manitoba in partial fulfillment of the requirements of the degree of Master of Science Yilan Zhang © 2004 Permission has been granted to the Library of the University of Manitoba to lend or sell copies of the this thesis/practicum, to the National Library of Canada to microfilm this thesis and to lend or sell copies of the film, and to the Univesity Microfilm Inc. to publish an abstract of this thesis/practicum. The author reserves other publication rights, and neither this thesis/practicum nor extensive extracts from it may be printed or otherwise reproduced without the author’s written permission. ACKNOWLEGEMENTS Fist of all, I would like to express my appreciation to my supervisor Dr. Dilantha Fernando for his guidance in my experiments, and support given at conference presentations and applying for several travel awards. Only with your patience, kindness and encouragement I could grow as a student and plant pathologist. I also appreciate the help of my co-supervisor Dr. Fouad Daayf, for the advice and support for my project during my Masters program.
    [Show full text]
  • Vitek®2 Id & Ast Cards
    ® VITEK 2 ID & AST CARDS Reliable • safe • rapid RESULTS YOU CAN TRUST FOCUS The VITEK 2 ADVANCED EXPERT SYSTEM™ software lets you focus your time where it is most required in ® the lab. The ADVANCED EXPERT SYSTEM™ validates VITEK 2 ID & AST CARDS ON WHAT every result and quickly identi es those truly needing a Microbiologist’s valuable time and attention. This allows the majority of results to be quickly and con dently reported to clinicians without need for MATTERS 2,8,11,13,15 review Rapid, Flexible, E cient EFFICIENCY THROUGH AUTOMATION VITEK 2 cards o er the shortest preparation time in the industry, considerably reducing labor Each self-contained, costs1,3,7,9,10,14. They also have the least contaminated waste, o ering up to 64% cost savings for disposal disposable test card compared to other systems6,10,12.The cards provide provides rapid and INNOVATIVE AND FLEXIBLE DESIGN increased standardization and automated, same-day accurate species- results helping clinicians to optimise antibiotic level identi cation or • Each card contains microwells with biochemicals or antimicrobials therapy sooner2,3. susceptibility results with • Ready and simple to use accurate MICs* based on • Pre-applied barcodes for maximum traceability • EUCAST and CLSI compliant AST formulations available Designed for VITEK 2 automated systems, VITEK 2 reference CLSI** and identi cation (ID) and susceptibility (AST) cards provide ISO *** MIC methods UP TO 50% FEWER PREPARATION STEPS THAN and EUCAST****, OTHER SYSTEMS,3,9,10: reliable and accurate results for clinically important US FDA*****, bacteria and yeasts1,2,4,5 or CLSI® breakpoint • Inoculation with a simple, standardised suspension of organism in saline interpretations1,3,4,5,7,8,10.
    [Show full text]
  • Which Organisms Are Used for Anti-Biofouling Studies
    Table S1. Semi-systematic review raw data answering: Which organisms are used for anti-biofouling studies? Antifoulant Method Organism(s) Model Bacteria Type of Biofilm Source (Y if mentioned) Detection Method composite membranes E. coli ATCC25922 Y LIVE/DEAD baclight [1] stain S. aureus ATCC255923 composite membranes E. coli ATCC25922 Y colony counting [2] S. aureus RSKK 1009 graphene oxide Saccharomycetes colony counting [3] methyl p-hydroxybenzoate L. monocytogenes [4] potassium sorbate P. putida Y. enterocolitica A. hydrophila composite membranes E. coli Y FESEM [5] (unspecified/unique sample type) S. aureus (unspecified/unique sample type) K. pneumonia ATCC13883 P. aeruginosa BAA-1744 composite membranes E. coli Y SEM [6] (unspecified/unique sample type) S. aureus (unspecified/unique sample type) graphene oxide E. coli ATCC25922 Y colony counting [7] S. aureus ATCC9144 P. aeruginosa ATCCPAO1 composite membranes E. coli Y measuring flux [8] (unspecified/unique sample type) graphene oxide E. coli Y colony counting [9] (unspecified/unique SEM sample type) LIVE/DEAD baclight S. aureus stain (unspecified/unique sample type) modified membrane P. aeruginosa P60 Y DAPI [10] Bacillus sp. G-84 LIVE/DEAD baclight stain bacteriophages E. coli (K12) Y measuring flux [11] ATCC11303-B4 quorum quenching P. aeruginosa KCTC LIVE/DEAD baclight [12] 2513 stain modified membrane E. coli colony counting [13] (unspecified/unique colony counting sample type) measuring flux S. aureus (unspecified/unique sample type) modified membrane E. coli BW26437 Y measuring flux [14] graphene oxide Klebsiella colony counting [15] (unspecified/unique sample type) P. aeruginosa (unspecified/unique sample type) graphene oxide P. aeruginosa measuring flux [16] (unspecified/unique sample type) composite membranes E.
    [Show full text]
  • Burkholderia Pyrrocinia JK-SH007 Enhanced Seed Germination, Cucumber Seedling Growth and Tomato Fruit Via Catecholate- Siderophore-Mediation
    INTERNATIONAL JOURNAL OF AGRICULTURE & BIOLOGY ISSN Print: 1560–8530; ISSN Online: 1814–9596 19F–065/2019/22–4–779–786 DOI: 10.17957/IJAB/15.1130 http://www.fspublishers.org Full Length Article Burkholderia pyrrocinia JK-SH007 Enhanced Seed Germination, Cucumber Seedling Growth and Tomato Fruit via Catecholate- Siderophore-Mediation Li-Jing Min1,2, Xiao-Qin Wu1, De-Wei Li1,3, Ke Chen4, Lu Guo5 and Jian-Ren Ye1* 1Southern China Collaborative Innovation Center of Sustainable Forestry, College of Forestry, Nanjing Forestry University, Nanjing, Jiangsu 210037, China 2College of Life Science, Huzhou University, Huzhou, Zhejiang 313000, China 3The Connecticut Agricultural Experiment Station Valley Laboratory, Windsor, CT 06095, USA 4Huzhou Institute for Food and Drug Control, Huzhou, Zhejiang 313000, China 5Huzhou First People’s Hospital, Huzhou University, Huzhou, Zhejiang 313000, China *For correspondence: [email protected] Abstract Plant growth-promoting bacteria (PGPB), both endophytic and rhizotrophic bacteria, can play a beneficial role for the biocontrol of phytopathogens and promotion of plant growth. Burkholderia pyrrocinia JK-SH007, as a poplar endophyte, showed strong antagonistic ability to poplar canker disease. A Siderophore involved in the transport of iron in plants and antifungal activities, inferred that siderophore may be the key factor of JK-SH007 biological control of poplar canker disease and plant-growth-promoting even in non-host plant. The siderophore-producing characteristics and conditions of B. pyrrocinia JK-SH007 were investigated, and the impact of JK-SH007-siderophore on plant growth was examined. Chemical analysis indicated that JK-SH007-siderophore was of catecholate-type, as confirmed by HPLC and LC/MS.
    [Show full text]
  • Insights Into the Pathogenicity of Burkholderia Pseudomallei
    REVIEWS Melioidosis: insights into the pathogenicity of Burkholderia pseudomallei W. Joost Wiersinga*, Tom van der Poll*, Nicholas J. White‡§, Nicholas P. Day‡§ and Sharon J. Peacock‡§ Abstract | Burkholderia pseudomallei is a potential bioterror agent and the causative agent of melioidosis, a severe disease that is endemic in areas of Southeast Asia and Northern Australia. Infection is often associated with bacterial dissemination to distant sites, and there are many possible disease manifestations, with melioidosis septic shock being the most severe. Eradication of the organism following infection is difficult, with a slow fever-clearance time, the need for prolonged antibiotic therapy and a high rate of relapse if therapy is not completed. Mortality from melioidosis septic shock remains high despite appropriate antimicrobial therapy. Prevention of disease and a reduction in mortality and the rate of relapse are priority areas for future research efforts. Studying how the disease is acquired and the host–pathogen interactions involved will underpin these efforts; this review presents an overview of current knowledge in these areas, highlighting key topics for evaluation. Melioidosis is a serious disease caused by the aerobic, rifamycins, colistin and aminoglycosides), but is usually Gram-negative soil-dwelling bacillus Burkholderia pseu- susceptible to amoxicillin-clavulanate, chloramphenicol, domallei and is most common in Southeast Asia and doxycycline, trimethoprim-sulphamethoxazole, ureido- Northern Australia. Melioidosis is responsible for 20% of penicillins, ceftazidime and carbapenems2,4. Treatment all community-acquired septicaemias and 40% of sepsis- is required for 20 weeks and is divided into intravenous related mortality in northeast Thailand. Reported cases are and oral phases2,4. Initial intravenous therapy is given likely to represent ‘the tip of the iceberg’1,2, as confirmation for 10–14 days; ceftazidime or a carbapenem are the of disease depends on bacterial isolation, a technique that drugs of choice.
    [Show full text]