Bibliography

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Bibliography Aa, K. and R.A. Olsen. 1996. The use of various substrates and substrate caulis Poindexter by a polyphasic analysis. Int. J. Syst. Evol. Microbiol. concentrations by a Hyphomicrobium sp. isolated from soil: effect on 51: 27–34. growth rate and growth yield. Microb. Ecol. 31: 67–76. Abram, D., J. Castro e Melo and D. Chou. 1974. Penetration of Bdellovibrio Aalen, R.B. and W.B. Gundersen. 1985. Polypeptides encoded by cryptic bacteriovorus into host cells. J. Bacteriol. 118: 663–680. plasmids from Neisseria gonorrhoeae. Plasmid 14: 209–216. Abramochkina, F.N., L.V. Bezrukova, A.V. Koshelev, V.F. Gal’chenko and Aamand, J., T. Ahl and E. Spieck. 1996. Monoclonal antibodies recog- M.V. Ivanov. 1987. Microbial methane oxidation in a fresh-water res- nizing nitrite oxidoreductase of Nitrobacter hamburgensis, N. winograd- ervoir. Mikrobiologiya 56: 464–471. skyi, and N. vulgaris. Appl. Environ. Microbiol. 62: 2352–2355. Achenbach, L.A., U. Michaelidou, R.A. Bruce, J. Fryman and J.D. Coates. Aarestrup, F.M., E.M. Nielsen, M. Madsen and J. Engberg. 1997. Anti- 2001. Dechloromonas agitata gen. nov., sp. nov. and Dechlorosoma suillum microbial susceptibility patterns of thermophilic Campylobacter spp. gen. nov., sp. nov., two novel environmentally dominant from humans, pigs, cattle, and broilers in Denmark. Antimicrob. (per)chlorate-reducing bacteria and their phylogenetic position. Int. Agents Chemother. 41: 2244–2250. J. Syst. Evol. Microbiol. 51: 527–533. Abadie, M. 1967. Formations intracytoplasmique du type “me´some” chez Achouak, W., R. Christen, M. Barakat, M.H. Martel and T. Heulin. 1999. Chondromyces crocatus Berkeley et Curtis. C.R. Acad. Sci. Paris 265: Burkholderia caribensis sp. nov., an exopolysaccharide-producing bac- 2132–2134. terium isolated from vertisol microaggregates in Martinique. Int. J. Abadie, M. 1968. Sur l’organisation des masses cellulaires ve´ge´tatives chez Syst. Bacteriol. 49: 787–794. les Chondromyces: Importance de la “matrice” initiale et de la trame Adams, G.A. and A.S. Chaudhari. 1972. Galactosamine polymer isolated muqueuse re´siduelle. C.R. Acad. Sci. Paris 267: 2037–2040. from the cell wall of Neisseria sicca. Can. J. Biochem. 50: 345–351. Abadie, M. 1971. Contribution a la connaissance des myxobacte´ries su- Adams, L.F. and W.C. Ghiorse. 1986. Physiology and ultrastructure of Leptothrix discophora SS-1. Arch. Microbiol. 145: 126–135. pe´rieures. II. Donne´es ultrastructurales et morphoge´ne´tiques sur le Adams, L.F. and W.C. Ghiorse. 1987. Characterization of extracellular Chondromyces crocatus. Ann. Sci. Nat. Bot. Biol. Veg. 12: 345–428. oxidizing activity and isolation of manganese-oxidizing protein-םMn2 Abalain, J.H., S. Di Stefano, M.L. Abalain-Colloc and H.H. Floch. 1995. from Leptothrix discophora SS-1. J. Bacteriol. 169: 1279–1285. Cloning, sequencing and expression of Pseudomonas testosteroni gene Adler, O. 1904. U¨ ber Eisenbakterien in ihrer Beziehung zu den thera- encoding 3-␣-hydroxysteroid dehydrogenase. J. Steroid Biochem. peutisch verwendteten natu¨rlichen Eisenwa¨sser. Zentbl. Bakteriol. Mol. Biol. 55: 233–238. 215: 277. Abdala, A.A., E. Pipano, D.H. Aguirre, A.B. Gaido, M.A. Zurbriggen, A.J. Afinogenova, A.V., S.M. Konovalova and V.A. Lambina. 1986. The loss Mangold and A.A. Guglielmone. 1990. Frozen and fresh Anaplasma of monospecificity of exoparasitic bacteria of the Micavibrio genus. centrale vaccines in the protection of cattle against Anaplasma marginale Mikrobiologiya 55: 487–489. infection. Rev. Elev. Med. Vet. Pays. Trop. 43: 155–158. Agathos, S.N., E. Hellin, H. Ali-Khodja, S. Deseveaux, F. Vandermesse Abe, M., R. Kawamura, S. Higashi, S. Mori, M. Shibata and T. Uchiumi. and H. Naveau. 1997. Gas-phase methyl ethyl ketone biodegradation 1998. Transfer of the symbiotic plasmid from Rhizobium leguminosarum in a tubular biofilm reactor: microbiological and bioprocess aspects. biovar trifolii to Agrobacterium tumefaciens. J. Gen. Appl. Microbiol. 44: Biodegradation 8: 251–264. 65–74. Agnihothrudu, V., G.C.S. Barua and K.C. Barua. 1959. Occurrence of Abe, M. and T. Nakazawa. 1994. Characterization of hemolytic and an- Chondromyces in the rhizosphere of plants. Indian Phytopathol. 12: tifungal substance, cepalycin, from Pseudomonas cepacia. Microbiol. Im- 158–160. munol. 38: 1–9. Aguero-Rosenfeld, M., H.W. Horowitz, G.P. Wormser, D.F. McKenna, J. Abe, M., M. Tsuda, M. Kimoto, S. Inouye, A. Nakazawa and T. Nakazawa. Nowakowski, J. Munoz and J.S. Dumler. 1996. Human granulocytic 1996. A genetic analysis system of Burkholderia cepacia: construction ehrlichiosis (HGE): A series from a single medical center in New York of mobilizable transposons and a cloning vector. Gene 174: 191–194. State. Ann. Int. Med. 125: 904–908. Abraham, W.R., H. Meyer, S. Lindholst, M. Vancanneyt and J. Smit. 1997. Aguilar, O.M., H. Reila´nder, W. Arnold and A. Pu¨hler. 1987. Rhizobium Phospho- and sulfolipids as biomarkers of Caulobacter sensu lato, Bre- meliloti nifN (fixF) gene is part of an operon regulated by a nifA- vundimonas and Hyphomonas. Syst. Appl. Microbiol. 20: 522–539. dependent promoter and codes for a polypeptide homologous to the Abraham, W.R., C. Stro¨mpl, H. Meyer, S. Lindholst, E.R. Moore, R. Christ, nifK gene product. J. Bacteriol. 169: 5393–5400. M. Vancanneyt, B.J. Tindall, A. Bennasar, J. Smit and M. Tesar. 1999. Ahamed, N.M., H. Mayer, H. Biebl and J. Weckesser. 1982. Lipopolysac- Phylogeny and polyphasic taxonomy of Caulobacter species. Proposal charide with 2,3-diamino-2,3-dideoxyglucose containing lipid-A in of Maricaulis gen. nov. with Maricaulis maris (Poindexter) comb. nov. Rhodopseudomonas sulfoviridis. FEMS Microbiol. Lett. 14: 27–30. as the type species, and emended description of the genera Brevun- Ahlers, B., W. Ko¨nig and E. Bock. 1990. Nitrite reductase activity in dimonas and Caulobacter. Int. J. Syst. Bacteriol. 49: 1053–1073. Nitrobacter vulgaris. FEMS Microbiol. Lett. 67: 121–126. Abraham, W.R., C. Stro¨mpl, M. Vancanneyt, H. Lu¨nsdorf and E.R. Moore. Ahmad, D., J. Fraser, M. Sylvestre, A. Larose, A. Kahn, J. Bergeron, J.M. 2001. Determination of the systematic position of the genus Asticca- Juteau and M. Sondossi. 1995. Sequence of the bphD gene encoding 1195 1196 BIBLIOGRAPHY 2-hydroxy-6-oxo-(phenyl/chlorophenyl)hexa-2,4 dienoic acid (HOP/ the growth and asparaginase production of Vibrio succinogenes. Appl. cPDA) hydrolase involved in the biphenyl/polychlorinated biphenyl Environ. Microbiol. 36: 25–30. degradation pathway in Comamonas testosteroni: evidence suggesting Albrecht, H. and A. Ghon. 1901. U¨ ber die Aetiologie und pathologische involvement of Ser112 in catalytic activity. Gene 156: 69–74. Anatomie der Meningitis cerebrospinalis epidemica. Wein. Klin. Ahmann, D., A.L. Roberts, L.R. Krumholz and F.M. Morel. 1994. Microbe Wochenschr. 14: 984–996. grows by reducing arsenic. Nature 371: 750. Albritton, W.L., J.K. Setlow, M.L. Thomas and F.O. Sottnek. 1986. Relat- Aho, E.L. and J.G. Cannon. 1988. Characterization of a silent pilin gene edness within the family Pasteurellaceae as determined by genetic trans- locus from Neisseria meningitidis strain FAM18. Microb. Pathog. 5: 391– formation. Int. J. Syst. Bacteriol. 36: 103–106. 398. Albuquerque, L., J. Santos, P. Travassos, M.F. Nobre, F.A. Rainey, R. Wait, Aho, E.L., A.M. Keating and S.M. McGillivray. 2000. A comparative anal- N. Empadinhas, M.T. Silva and M.S. da Costa. 2002. Albidovulum inex- ysis of pilin genes from pathogenic and nonpathogenic Neisseria spe- pectatum gen. nov., sp nov., a nonphotosynthetic and slightly ther- cies. Microb. Pathog. 28: 81–88. mophilic bacterium from a marine hot spring that is very closely Aho, E.L., G.L. Murphy and J.G. Cannon. 1987. Distribution of specific related to members of the photosynthetic genus Rhodovulum. Appl. DNA sequences among pathogenic and commensal Neisseria species. Environ. Microbiol. 68: 4266–4273. Infect. Immun. 55: 1009–1013. Alderton, M.R., V. Korolik, P.J. Coloe, F.E. Dewhirst and B.J. Paster. 1995. Ahrens, A., A. Lipski, S. Klatte, H.J. Busse, G. Auling and K. Altendorf. Campylobacter hyoilei sp. nov., associated with porcine proliferative en- 1997. Polyphasic classification of Proteobacteria isolated from biofilters. teritis. Int. J. Syst. Bacteriol. 45: 61–66. Syst. Appl. Microbiol. 20: 255–267. Aldon, D., B. Brito, C. Boucher and S. Genin. 2000. A bacterial sensor Ahrens, R. 1968. Taxonomische Untersuchungen an sternbildenden of plant cell contact controls the transcriptional induction of Ralstonia Agrobacterium-Arten aus der westlichen Ostsee. Kiel. Meeresforsch. solanacearum pathogenicity genes. EMBO. 19: 2304–2314. 24: 147–173. Aldrich, H.C., L. McDowell, M.F. Barbosa, L.P. Yomano, R.K. Scopes and L.O. Ingram. 1992. Immunocytochemical localization of glycolytic Ahrens, R. and G. Rheinheimer. 1967. U¨ ber einige sternbildende Bak- and fermentative enzymes in Zymomonas mobilis. J. Bacteriol. 174: terien aus der Ostsee. Kiel. Meeresforsch. 23: 127–136. 4504–4508. Ahring, B.K., N. Christiansen, I. Mathrani, H.V. Hendriksen, A.J.L. Ma- Aldridge, K.E., G.T. Valainis and C.V. Sanders. 1988. Comparison of the cario and E. Conway De Macario. 1992. Introduction of a de novo in vitro activity of ciprofloxacin and 24 other antimicrobial agents bioremediation ability, aryl reductive dechlorination, into anaerobic against clinical strains of Chromobacterium violaceum. Diagn. Microbiol. granular sludge by inoculation of sludge with Desulfomonile tiedjei. Infect. Dis. 10: 31–39. Appl. Environ. Microbiol. 58: 3677–3682. Alkan, S., M.B. Morgan, R.L. Sandin, L.C. Moscinski and C.W. Ross. 1995. Akagawa, M. and K. Yamasato. 1989. Synonymy of Alcaligenes aquamarinus, Dual role for Afipia felis and Rochalimaea henselae in cat-scratch disease. Alcaligenes faecalis subsp. homari, and Deleya aesta: Deleya aquamarina Lancet 345: 385. comb. nov. as the type species of the genus Deleya. Int. J. Syst. Bacteriol. Allaker, R.P., K.A. Young and J.M. Hardie. 1994.
Recommended publications
  • Investigation of Bacteria Associated with Australian Wine Grapes Using Cultural and Molecular Methods

    Investigation of Bacteria Associated with Australian Wine Grapes Using Cultural and Molecular Methods

    Investigation of bacteria associated with Australian wine grapes using cultural and molecular methods Sung Sook Bae A thesis submitted in fulfilment of the requirements for the degree of Doctor of Philosophy University of New South Wales Food Science and Technology School of Chemical Engineering and Industrial Chemistry Sydney, Australia 2005 i DECLARATION I hereby declare that this submission is my own work and to the best of my knowledge it contains no materials previously published or written by another person, or substantial proportions of materials which have been accepted for the award of any other degree or diploma at UNSW or any other education institution, except where due acknowledgement is made in the thesis. Any contribution made to the research by others, with whom I have worked at UNSW or elsewhere, is explicitly acknowledged in the thesis. I also declare that the intellectual content of this thesis is the product of my own work, except to the extent that assistance from others in the project’s design and conception or in style, presentation and linguistic expression is acknowledged. Sung Sook Bae ii ACKNOWLEDGEMENTS I owe a tremendous debt of gratitude to numerous individuals who have contributed to the completion of this work, and I wish to thank them for their contribution. Firstly and foremost, my sincere appreciation goes to my supervisor, Professor Graham Fleet. He has given me his time, expertise, constant guidance and inspiration throughout my study. I also would like to thank my co-supervisor, Dr. Gillian Heard for her moral support and words of encouragement. I am very grateful to the Australian Grape and Wine Research Development and Corporation (GWRDC) for providing funds for this research.
  • Phylogenetic Analysis Reveals an Ancient Gene Duplication As The

    Phylogenetic Analysis Reveals an Ancient Gene Duplication As The

    1 Phylogenetic analysis reveals an ancient gene duplication as 2 the origin of the MdtABC efflux pump. 3 4 Kamil Górecki1, Megan M. McEvoy1,2,3 5 1Institute for Society & Genetics, 2Department of MicroBiology, Immunology & Molecular 6 Genetics, and 3Molecular Biology Institute, University of California, Los Angeles, CA 90095, 7 United States of America 8 Corresponding author: [email protected] (M.M.M.) 9 1 10 Abstract 11 The efflux pumps from the Resistance-Nodulation-Division family, RND, are main 12 contributors to intrinsic antibiotic resistance in Gram-negative bacteria. Among this family, the 13 MdtABC pump is unusual by having two inner membrane components. The two components, 14 MdtB and MdtC are homologs, therefore it is evident that the two components arose by gene 15 duplication. In this paper, we describe the results obtained from a phylogenetic analysis of the 16 MdtBC pumps in the context of other RNDs. We show that the individual inner membrane 17 components (MdtB and MdtC) are conserved throughout the Proteobacterial species and that their 18 existence is a result of a single gene duplication. We argue that this gene duplication was an ancient 19 event which occurred before the split of Proteobacteria into Alpha-, Beta- and Gamma- classes. 20 Moreover, we find that the MdtABC pumps and the MexMN pump from Pseudomonas aeruginosa 21 share a close common ancestor, suggesting the MexMN pump arose by another gene duplication 22 event of the original Mdt ancestor. Taken together, these results shed light on the evolution of the 23 RND efflux pumps and demonstrate the ancient origin of the Mdt pumps and suggest that the core 24 bacterial efflux pump repertoires have been generally stable throughout the course of evolution.
  • Biofilm Formation and Cellulose Expression by Bordetella Avium 197N, the Causative Agent of Bordetellosis in Birds and an Opportunistic Respiratory Pathogen in Humans

    Biofilm Formation and Cellulose Expression by Bordetella Avium 197N, the Causative Agent of Bordetellosis in Birds and an Opportunistic Respiratory Pathogen in Humans

    Accepted Manuscript Biofilm formation and cellulose expression by Bordetella avium 197N, the causative agent of bordetellosis in birds and an opportunistic respiratory pathogen in humans Kimberley McLaughlin, Ayorinde O. Folorunso, Yusuf Y. Deeni, Dona Foster, Oksana Gorbatiuk, Simona M. Hapca, Corinna Immoor, Anna Koza, Ibrahim U. Mohammed, Olena Moshynets, Sergii Rogalsky, Kamil Zawadzki, Andrew J. Spiers PII: S0923-2508(17)30017-7 DOI: 10.1016/j.resmic.2017.01.002 Reference: RESMIC 3563 To appear in: Research in Microbiology Received Date: 17 November 2016 Revised Date: 16 January 2017 Accepted Date: 16 January 2017 Please cite this article as: K. McLaughlin, A.O. Folorunso, Y.Y. Deeni, D. Foster, O. Gorbatiuk, S.M. Hapca, C. Immoor, A. Koza, I.U. Mohammed, O. Moshynets, S. Rogalsky, K. Zawadzki, A.J. Spiers, Biofilm formation and cellulose expression by Bordetella avium 197N, the causative agent of bordetellosis in birds and an opportunistic respiratory pathogen in humans, Research in Microbiologoy (2017), doi: 10.1016/j.resmic.2017.01.002. This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. Page 1 of 25 ACCEPTED MANUSCRIPT 1 For Publication 2 Biofilm formation and cellulose expression by Bordetella avium 197N, 3 the causative agent of bordetellosis in birds and an opportunistic 4 respiratory pathogen in humans 5 a* a*** a b 6 Kimberley McLaughlin , Ayorinde O.
  • Table of Contents

    Table of Contents

    MARCH 2013 • VOLUME 51 • NO. 3 TABLE OF CONTENTS PHOTO QUIZ Bacteremia in a Patient with Hepatic Encephalopathy Benjamin H. Hinrichs, Robert C. Jerris, 739 Eileen M. Burd Answer to Photo Quiz Benjamin H. Hinrichs, Robert C. Jerris, 1062–1063 Eileen M. Burd POINT-COUNTERPOINT Quantitative Cultures of Bronchoscopically Obtained Vickie Baselski, J. Stacey Klutts 740–744 Specimens Should Be Performed for Optimal Management of Ventilator-Associated Pneumonia BACTERIOLOGY Pan-PCR, a Computational Method for Designing Bacterium- Joy Y. Yang, Shelise Brooks, Jennifer A. 752–758 Typing Assays Based on Whole-Genome Sequence Data Meyer, Robert R. Blakesley, Adrian M. Zelazny, Julia A. Segre, Evan S. Snitkin Identification of Anaerobic Bacteria by Bruker Biotyper Matrix- Bryan H. Schmitt, Scott A. 782–786 Assisted Laser Desorption Ionization–Time of Flight Mass Cunningham, Aaron L. Dailey, Spectrometry with On-Plate Formic Acid Preparation Daniel R. Gustafson, Robin Patel Use of Universal 16S rRNA Gene PCR as a Diagnostic Tool for M. Guembe, M. Marín, P. Martín- 799–804 Venous Access Port-Related Bloodstream Infections Rabadán, A. Echenagusia, F. Camúñez, G. Rodríguez-Rosales, G. Simó, M. Echenagusia, E. Bouza, on behalf of the GEIDI Study Group Rapid Identification of Bacteria and Yeasts from Positive-Blood- Amy Fothergill, Vyjayanti Kasinathan, 805–809 Culture Bottles by Using a Lysis-Filtration Method and Matrix- Jay Hyman, John Walsh, Tim Drake, Assisted Laser Desorption Ionization–Time of Flight Mass Yun F. (Wayne) Wang Spectrum Analysis with the SARAMIS Database Pseudo-Outbreak of Vancomycin-Resistant-Enterococcus Rita M. Gander, Dominick Cavuoti, 810–813 (VRE) Colonization in a Neonatal Intensive Care Unit Using Adnan Alatoom, Paul Southern, Jr., Spectra VRE Surveillance Medium Debra Grant, Kathleen Salinas, Donna Gaffney, Jennifer MacKenzie, Linda Byrd Changes in Molecular Epidemiology of Streptococcus Bruno Pichon, Shamez N.
  • Table S1. Primers Used for PCR Amplification

    Table S1. Primers Used for PCR Amplification

    Table S1. Primers used for PCR amplification Name Primer Sequence (5’-3’) Gene target Taxon target Reference First PCR round DGGE analysis FGPH19 TACGGCAARGGTGGNATHG nifH Diazotrophic (Simonet et al. 1991) POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) 799F AACMGGATTAGATACCCKG 16S rRNA Bacteria (Chelius and Triplett 2001) 1492R TACGGYTACCTTGTTACGACTT 16S rRNA Bacteria (Chelius and Triplett 2001) F203α CCGCATACGCCCTACGGGGGAAAGATTTAT 16S rRNA Alphaproteobacteria (Gomes et al. 2001) F948β CGCACAAGCGGTGGATGA 16S rRNA Betaproteobacteria (Gomes et al. 2001) F243HCG GGATGAGCCCGCGGCCTA 16S rRNA Actinobacteria (Heuer et al. 1997) BACF GGGAAACCGGGGCTAATACCGGAT 16S rRNA Firmicutes (Garbeva et al. 2003) Second PCR round DGGE analysis POLF-GC CGCCCGCCGCGCCCCGCGCCCGGCCCGCCCCCG nifH Diazotrophic (Poly et al. 2001) CCCCTGCGAYCCSAARGCBGACTC AQER GACGATGTAGATITCCTG nifH Diazotrophic (Poly et al. 2001) F968-GC CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGC 16S rRNA Bacteria (Heuer et al. 1999) ACGGGGGGAACGAAGAACCTTAC R1401 CGGTGTGTACAAGACCC 16S rRNA Bacteria (Heuer et al. 1997) qPCR analysis POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) POLF TGCGAYCCSAARGCBGACTC nifH Diazotrophic (Poly et al. 2001) 6S-27F AGAGTTTGATCCTGGCTCAG 16S rRNA Bacteria Bulgari et al., 2014 338R GCTGCCTCCCGTAGGAGT 16S rRNA Bacteria Bulgari et al., 2014 Table 2. Primers used for Ion Torrent pyrosequencing analysis. Primer Primer sequence (5´-3´) Reference 967F-PP CNACGCGAAGAACCTTANC (Jünemann et al. 2012) 967F-UC1 CAACGCGAAAAACCTTACC (Jünemann et al. 2012) 967F-UC2 CAACGCGCAGAACCTTACC (Jünemann et al. 2012) 967F-UC3 ATACGCGARGAACCTTACC (Jünemann et al. 2012) 967F-AQ CTAACCGANGAACCTYACC (Jünemann et al. 2012) 1046R CGACAGCCATGCANCACCT (Jünemann et al. 2012) 1046R-PP CGACAACCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ1 CGACGGCCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ2 CGACGACCATGCANCACCT (Jünemann et al. 2012) Table S3. Alpha diversity indices. Statistical analysis of the total endophytic and diazotrophic endophytic bacterial community associated with sweet sorghum cv.
  • A Focus on Protein Glycosylation in Lactobacillus

    A Focus on Protein Glycosylation in Lactobacillus

    International Journal of Molecular Sciences Review How Sweet Are Our Gut Beneficial Bacteria? A Focus on Protein Glycosylation in Lactobacillus Dimitrios Latousakis and Nathalie Juge * Quadram Institute Bioscience, The Gut Health and Food Safety Institute Strategic Programme, Norwich Research Park, Norwich NR4 7UA, UK; [email protected] * Correspondence: [email protected]; Tel.: +44-(0)-160-325-5068; Fax: +44-(0)-160-350-7723 Received: 22 November 2017; Accepted: 27 December 2017; Published: 3 January 2018 Abstract: Protein glycosylation is emerging as an important feature in bacteria. Protein glycosylation systems have been reported and studied in many pathogenic bacteria, revealing an important diversity of glycan structures and pathways within and between bacterial species. These systems play key roles in virulence and pathogenicity. More recently, a large number of bacterial proteins have been found to be glycosylated in gut commensal bacteria. We present an overview of bacterial protein glycosylation systems (O- and N-glycosylation) in bacteria, with a focus on glycoproteins from gut commensal bacteria, particularly Lactobacilli. These emerging studies underscore the importance of bacterial protein glycosylation in the interaction of the gut microbiota with the host. Keywords: protein glycosylation; gut commensal bacteria; Lactobacillus; glycoproteins; adhesins; lectins; O-glycosylation; N-glycosylation; probiotics 1. Introduction Protein glycosylation, i.e., the covalent attachment of a carbohydrate moiety onto a protein, is a highly ubiquitous protein modification in nature, and considered to be one of the post-translational modifications (PTM) targeting the most diverse group of proteins [1]. Although it was originally believed to be restricted to eukaryotic systems and later to archaea, it has become apparent nowadays that protein glycosylation is a common feature in all three domains of life.
  • Cystic Fibrosis Mice Develop Spontaneouschronic Bordetella

    Cystic Fibrosis Mice Develop Spontaneouschronic Bordetella

    ISSN 2470-3176 SciO p Forschene n HUB for Sc i e n t i f i c R e s e a r c h Journal of Infectious Pulmonary Diseases Research Article Volume: 3.2 Open Access Received date: 11 Oct 2017; Accepted date: 28 Cystic Fibrosis Mice Develop Spontaneous Oct 2017; Published date: 02 Nov 2017. Chronic Bordetella Airway Infections Citation: Darrah R, Bonfield T, LiPuma JJ, Litman P, Hodges CA, et al. (2017) Cystic Fibrosis Mice Darrah R1*, Bonfield T2, LiPuma JJ3, Litman P1, Hodges CA4, Jacono F5 and Develop Spontaneous Chronic Bordetella Airway Drumm M6 Infections. J Infect Pulm Dis 3(2): doi http://dx.doi. org/10.16966/2470-3176.128 1Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA 2Department of Pediatrics, Case Western Reserve University, Cleveland Ohio, USA Copyright: © 2017 Darrah R, et al. This is an 3Department of Pediatrics and Communicable Diseases, University of Michigan Medical School, Ann open-access article distributed under the terms Arbor, Michigan, USA of the Creative Commons Attribution License, 4Departments of Radiology, Biomedical Engineering, and Pediatrics, Case Western Reserve University, which permits unrestricted use, distribution, and Cleveland Ohio, USA reproduction in any medium, provided the original 5Department of Medicine, Case Western Reserve University, and Louis Stokes VA Cleveland Medical author and source are credited. Center, USA 6Departments of Pediatrics and Genetics Genome Sciences, Case Western Reserve University, Cleveland Ohio, USA *Corresponding author: Rebecca Darrah, Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA, Tel: 216-368-4911; E-mail: [email protected] Abstract Chronic pulmonary disease and infection is the primary cause of morbidity and mortality in people with cystic fibrosis (CF).
  • Abstract Pultorak, Elizabeth Lauren

    Abstract Pultorak, Elizabeth Lauren

    ABSTRACT PULTORAK, ELIZABETH LAUREN. The Epidemiology of Lyme Disease and Bartonellosis in Humans and Animals. (Under the direction of Edward B. Breitschwerdt). The expansion of vector borne diseases in humans, a variety of mammalian hosts, and arthropod vectors draws attention to the need for enhanced diagnostic techniques for documenting infection in hosts, effective vector control, and treatment of individuals with associated diseases. Through improved diagnosis of vector-borne disease in both humans and animals, epidemiological studies to elucidate clinical associations or spatio-temporal relationships can be assessed. Veterinarians, through the use of the C6 peptide in the SNAP DX test kit, may be able to evaluate the changing epidemiology of borreliosis through their canine population. We developed a survey to evaluate the practices and perceptions of veterinarians in North Carolina regarding borreliosis in dogs across different geographic regions of the state. We found that veterinarians’ perception of the risk of borreliosis in North Carolina was consistent with recent scientific reports pertaining to geographic expansion of borreliosis in the state. Veterinarians should promote routine screening of dogs for Borrelia burgdorferi exposure as a simple, inexpensive form of surveillance in this transitional geographic region. We next conducted two separate studies to evaluate Bartonella spp. bacteremia or presence of antibodies against B. henselae, B. koehlerae, or B. vinsonii subsp. berkhoffii in 296 patients examined by a rheumatologist and 192 patients with animal exposure (100%) and recent animal bites and scratches (88.0%). Among 296 patients examined by a rheumatologist, prevalence of antibodies (185 [62%]) and Bartonella spp. bacteremia (122 [41.1%]) was high.
  • Beating Chronic LYME

    Beating Chronic LYME

    Section 1 Beating Chronic LYME Dr. Kevin Conners Fellowship in Integrative Cancer Therapy Fellowship in Anti-Aging, Regenerative, and Functional Medicine American Academy of Anti-Aging Medicine www.ConnersClinic.com From left to right: Larvae, Nymph, Female, Male Tick Tick in Nymph stage is the size of a poppy seed. Beating Chronic LYME Forward I used to live in the woods. My wife and four children at the time purchased 280 acres in Wisconsin and basically lived off the land. We grew most of our own food, were ‘off grid’ as we produced our own electricity through solar panels, and had to pump our water by hand. It was certainly a different way of life that prepared us for missionary work in Mexico. It was 1997 and at the time I had begun hearing about Lyme disease being a tick- born disorder. I had never seen a deer tick before moving to our ‘little house in the big woods’ but one thing was for certain – we had plenty of deer. They were as populous as the mosquitoes. To make a long story short, both my oldest daughter and I had contracted Lyme during our three year stay. I experienced the violent sickness of acute Lyme as well as a beautiful bulls-eye rash that made the diagnosis easy. I took just 3 days of antibiotics and since that was just the second time that I had ever taken a prescription medication in my life, they eradicated the disease effectively. My daughter on the other hand wasn’t so fortunate. She never had an acute illness and we never saw any rash therefore we didn’t catch the disease until it had advanced to Chronic Lyme Disease (CLD).
  • Polyamine Profiles of Some Members of the Alpha Subclass of the Class Proteobacteria: Polyamine Analysis of Twenty Recently Described Genera

    Polyamine Profiles of Some Members of the Alpha Subclass of the Class Proteobacteria: Polyamine Analysis of Twenty Recently Described Genera

    Microbiol. Cult. Coll. June 2003. p. 13 ─ 21 Vol. 19, No. 1 Polyamine Profiles of Some Members of the Alpha Subclass of the Class Proteobacteria: Polyamine Analysis of Twenty Recently Described Genera Koei Hamana1)*,Azusa Sakamoto1),Satomi Tachiyanagi1), Eri Terauchi1)and Mariko Takeuchi2) 1)Department of Laboratory Sciences, School of Health Sciences, Faculty of Medicine, Gunma University, 39 ─ 15 Showa-machi 3 ─ chome, Maebashi, Gunma 371 ─ 8514, Japan 2)Institute for Fermentation, Osaka, 17 ─ 85, Juso-honmachi 2 ─ chome, Yodogawa-ku, Osaka, 532 ─ 8686, Japan Cellular polyamines of 41 newly validated or reclassified alpha proteobacteria belonging to 20 genera were analyzed by HPLC. Acetic acid bacteria belonging to the new genus Asaia and the genera Gluconobacter, Gluconacetobacter, Acetobacter and Acidomonas of the alpha ─ 1 sub- group ubiquitously contained spermidine as the major polyamine. Aerobic bacteriochlorophyll a ─ containing Acidisphaera, Craurococcus and Paracraurococcus(alpha ─ 1)and Roseibium (alpha-2)contained spermidine and lacked homospermidine. New Rhizobium species, including some species transferred from the genera Agrobacterium and Allorhizobium, and new Sinorhizobium and Mesorhizobium species of the alpha ─ 2 subgroup contained homospermidine as a major polyamine. Homospermidine was the major polyamine in the genera Oligotropha, Carbophilus, Zavarzinia, Blastobacter, Starkeya and Rhodoblastus of the alpha ─ 2 subgroup. Rhodobaca bogoriensis of the alpha ─ 3 subgroup contained spermidine. Within the alpha ─ 4 sub- group, the genus Sphingomonas has been divided into four clusters, and species of the emended Sphingomonas(cluster I)contained homospermidine whereas those of the three newly described genera Sphingobium, Novosphingobium and Sphingopyxis(corresponding to clusters II, III and IV of the former Sphingomonas)ubiquitously contained spermidine.
  • Detection and Partial Molecular Characterization of Rickettsia and Bartonella from Southern African Bat Species

    Detection and Partial Molecular Characterization of Rickettsia and Bartonella from Southern African Bat Species

    Detection and partial molecular characterization of Rickettsia and Bartonella from southern African bat species by Tjale Mabotse Augustine (29685690) Submitted in partial fulfillment of the requirements for the degree MAGISTER SCIENTIAE (MICROBIOLOGY) in the Department of Microbiology and Plant Pathology Faculty of Natural and Agricultural Sciences University of Pretoria Pretoria, South Africa Supervisor: Dr Wanda Markotter Co-supervisors: Prof Louis H. Nel Dr Jacqueline Weyer May, 2012 I declare that the thesis, which I hereby submit for the degree MSc (Microbiology) at the University of Pretoria, South Africa, is my own work and has not been submitted by me for a degree at another university ________________________________ Tjale Mabotse Augustine i Acknowledgements I would like send my sincere gratitude to the following people: Dr Wanda Markotter (University of Pretoria), Dr Jacqueline Weyer (National Institute for Communicable Diseases-National Health Laboratory Service) and Prof Louis H Nel (University of Pretoria) for their supervision and guidance during the project. Dr Jacqueline Weyer (Centre for Zoonotic and Emerging diseases (Previously Special Pathogens Unit), National Institute for Communicable Diseases (National Heath Laboratory Service), for providing the positive control DNA for Rickettsia and Dr Jenny Rossouw (Special Bacterial Pathogens Reference Unit, National Institute for Communicable Diseases-National Health Laboratory Service), for providing the positive control DNA for Bartonella. Dr Teresa Kearney (Ditsong Museum of Natural Science), Gauteng and Northern Region Bat Interest Group, Kwa-Zulu Natal Bat Interest Group, Prof Ara Monadjem (University of Swaziland), Werner Marias (University of Johannesburg), Dr Francois du Rand (University of Johannesburg) and Prof David Jacobs (University of Cape Town) for collection of blood samples.
  • Genomics of Helicobacter Species 91

    Genomics of Helicobacter Species 91

    Genomics of Helicobacter Species 91 6 Genomics of Helicobacter Species Zhongming Ge and David B. Schauer Summary Helicobacter pylori was the first bacterial species to have the genome of two independent strains completely sequenced. Infection with this pathogen, which may be the most frequent bacterial infec- tion of humanity, causes peptic ulcer disease and gastric cancer. Other Helicobacter species are emerging as causes of infection, inflammation, and cancer in the intestine, liver, and biliary tract, although the true prevalence of these enterohepatic Helicobacter species in humans is not yet known. The murine pathogen Helicobacter hepaticus was the first enterohepatic Helicobacter species to have its genome completely sequenced. Here, we consider functional genomics of the genus Helico- bacter, the comparative genomics of the genus Helicobacter, and the related genera Campylobacter and Wolinella. Key Words: Cytotoxin-associated gene; H-Proteobacteria; gastric cancer; genomic evolution; genomic island; hepatobiliary; peptic ulcer disease; type IV secretion system. 1. Introduction The genus Helicobacter belongs to the family Helicobacteriaceae, order Campylo- bacterales, and class H-Proteobacteria, which is also known as the H subdivision of the phylum Proteobacteria. The H-Proteobacteria comprise of a relatively small and recently recognized line of descent within this extremely large and phenotypically diverse phy- lum. Other genera that colonize and/or infect humans and animals include Campylobac- ter, Arcobacter, and Wolinella. These organisms are all microaerophilic, chemoorgano- trophic, nonsaccharolytic, spiral shaped or curved, and motile with a corkscrew-like motion by means of polar flagella. Increasingly, free living H-Proteobacteria are being recognized in a wide range of environmental niches, including seawater, marine sedi- ments, deep-sea hydrothermal vents, and even as symbionts of shrimp and tubeworms in these environments.