MAP3K1) Integrates Developmental Signals for Eyelid Closure

Total Page:16

File Type:pdf, Size:1020Kb

MAP3K1) Integrates Developmental Signals for Eyelid Closure Mitogen-activated protein kinase kinase kinase 1 (MAP3K1) integrates developmental signals for eyelid closure Esmond Geha,1, Qinghang Menga,1, Maureen Mongana, Jingcai Wanga,b, Atsushi Takatoric, Yi Zhengd, Alvaro Pugaa, Richard A. Lange,f, and Ying Xiaa,e,2 Departments of aEnvironmental Health and eOphthalmology, University of Cincinnati Medical Center, Cincinnati, OH 45267; bSouthern Medical University, Guangzhou 510515, China; cChiba Cancer Center, Chiba 260-8717, Japan; and dExperimental Hematology and Cancer Biology and fVisual Systems Group, Cincinnati Children’s Hospital Medical Center, Cincinnati, OH 45229 Edited* by Michael Karin, San Diego School of Medicine, University of California, La Jolla, CA, and approved September 16, 2011 (received for review February 10, 2011) Developmental eyelid closure is an evolutionarily conserved consequence of epithelial cell apoptosis at the fusion junction, morphogenetic event requiring proliferation, differentiation, cy- resulting in open eyelids. Mice are normally born with their toskeleton reorganization, and migration of epithelial cells at the eyelid closed, but those impaired in embryonic eyelid closure are tip of the developing eyelid. Many signaling events take place born with eye open-at-birth (EOB) phenotype. during eyelid closure, but how the signals converge to regulate Based on genetic mutations in mice that lead to EOB, it has the morphogenetic process remains an open and intriguing qu- become clear that complex signal transduction processes are estion. Here we show that mitogen-activated protein kinase involved in the regulation of eyelid closure. So far, whether kinase kinase 1 (MAP3K1) highly expressed in the developing eye- embryonic eyelid closure is shown depends on signals derived lid epithelium, forms with c-Jun, a regulatory axis that orches- from WNT, Sonic hedgehog, BMP/Activin, FGF, and EGF (5– trates morphogenesis by integrating two different networks of 8). In addition, eyelid closure requires the participation of eyelid closure signals. A TGF-α/EGFR-RhoA module initiates one a number of intracellular signaling kinases, such as MAP3K1, BIOLOGY of these networks by inducing c-Jun expression which, in a phos- JNK, ROCK, and CDH1, and nuclear transcription factors, such DEVELOPMENTAL phorylation-independent manner, binds to the Map3k1 promoter as c-Jun, Fra-2, FOXL2, SMAD, and GRHL3 (9–17). Molecular and causes an increase in MAP3K1 expression. RhoA knockout in and genetic analyses of the knockout mice have shown that the the ocular surface epithelium disturbs this network by decreasing eyelid closure factors are organized into distinct signal trans- Map3k1 MAP3K1 expression, and causes delayed eyelid closure in duction cascades, but how the different pathways crosstalk to or- hemizygotes. The second network is initiated by the enzymatic chestrate the closure of the eyelid has remained largely unknown. activity of MAP3K1, which phosphorylates and activates a JNK-c- One of the well-characterized eyelid closure pathways is me- Jun module, leading to AP-1 transactivation and induction of its diated through the EGFR. Activation of EGFR is necessary for Pai-1 downstream genes, such as . MAP3K1 inactivation reduces the epithelial cells at the developing eyelid tip to migrate, leading AP-1 activity and PAI-1 expression both in cells and developing to embryonic eyelid closure. Consequently, defective EGFR eyelids. MAP3K1 is therefore the nexus of an intracrine regulatory signaling in mice with genetic knockout of the EGFR itself or its loop connecting the TGF-α/EGFR/RhoA-c-Jun and JNK-c-Jun-AP-1 ligands, TGF-α and HB-EGF, or of factors, such as FGF10, c- pathways in developmental eyelid closure. Jun, and GRHL3 that regulate ligand expression, impairs mi- gration, resulting in the EOB phenotype. Another eyelid-closure he mitogen-activated protein kinases (MAPKs) are activated pathway is mediated by MAP3K1 (9). Specifically, MAP3K1 was Tthrough an evolutionarily conserved three-component signal shown to active the JNK MAPKs, which in turn phosphorylate transduction cascade, composed of a mitogen-activated protein the transcription factor c-Jun in epithelial cells at the developing kinase kinase kinase 1 (MAP3K1), a MAP2K. and a MAPK (1). eyelid tip. Activation of the MAP3K1-JNK-c-Jun cascade pro- In the cascade, the MAP3Ks receive signals from upstream cues motes epithelial cell migration and hence, embryonic eyelid and pass them downstream by phosphorylating and activating the closure (9, 18). As far as embryonic eyelid closure is concerned, MAP2Ks, which in turn activate the MAPKs by phosphorylation. the EGFR and MAP3K1 signaling pathways appear to regulate a The MAPKs can modulate transcription factor activity and gene common cell activity, but the point of convergence of these expression, thereby regulating diverse cellular functions. MAP3K1, pathways has not been identified (3). also known as MEKK1, is a member of the MAP3K superfamily, In the course of previous work, we found that MAP3K1 was highly fi known to have highly cell type-speci c roles. In vivo studies using expressed in the developing eyelid tip epithelial cells before eyelid mice lacking either the full-length protein (MAP3K1-null or closure (9). By investigating the molecular mechanisms that control Map3k1−/− Map3k1ΔKD/ΔKD ) or its kinase domain ( ) have shown MAP3K1 expression, we find that TGF-α/EGFR signals, acting that MAP3K1 is involved in immune system development and through RhoA and ROCK, induce c-Jun and the c-Jun–mediated function, injury repair, vasculature remodeling, and tumor pro- activation of the Map3k1 promoter. Once induced, MAP3K1 is re- gression (2). However, the most obvious function of MAP3K1 is the control of eyelid closure during fetal development (3). Mammalian eye development involves a transient closure and Author contributions: A.P. and Y.X. designed research; E.G., Q.M., M.M., J.W., and A.T. reopening of the eyelid (4). In mice, eyelid development begins performed research; Y.Z. and R.A.L. contributed new reagents/analytic tools; E.G., Q.M., at embryonic day 13 (E13), when the surface ectoderm folds into M.M., J.W., A.T., A.P., and Y.X. analyzed data; and Y.X. wrote the paper. the lid buds. The eyelid buds continue to grow toward the center The authors declare no conflict of interest. of the ocular surface and by E15 to E16.5, the epithelial cells at *This Direct Submission article had a prearranged editor. the tip of the eyelid start to elongate and migrate. Ultimately, the 1E.G. and Q.M. contributed equally to this work. epithelium of upper and lower eyelid fuses to form a closed 2To whom correspondence should be addressed. E-mail: [email protected]. eyelid. Mouse eyelids remain closed between E16.5 and post- This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. natal day 12, and thereafter the lid fusion breaks down as a 1073/pnas.1102297108/-/DCSupplemental. www.pnas.org/cgi/doi/10.1073/pnas.1102297108 PNAS Early Edition | 1of6 Downloaded by guest on September 28, 2021 quired for activation of the JNK-c-Jun pathway and induce AP-1 responsive genes. Thus, MAP3K1 is the nexus of an intracrine reg- ulatory loop connecting the TGF-α/EGFR/RhoA-c-Jun and JNK-c- Jun-AP-1 pathways in the control of eyelid morphogenesis. Results Activation of the EGF Receptor Leads to MAP3K1 Induction. The ΔKD Map3k1 allele contains a bacterial β-galactosidase gene knocked-in into the Map3k1 locus, replacing the exons coding for the MAP3K1 kinase domain (19). As a result, this allele pro- duces a MAP3K1-ΔKD-β-gal fusion protein that lacks kinase but retains β-galactosidase activity. Using fibroblasts derived from heterozygous and knockout fetuses, we established that β-gal expression in genetically modified fibroblasts can be used as a surrogate to measure endogenous Map3k1 promoter directed gene expression (Fig. S1 A and B). Before eyelid closure, MAP3K1 is highly expressed in the leading edge of the developing eyelid, which consists of clumps of rounded periderm cells covering the elongated epithelium (20) (Fig. S1C). Concomitantly, several eyelid morphogens are also abundantly expressed in the protruding tip of the developing eyelids, raising the possibility that some of the morphogenic signals induce MAP3K1 expression (5, 21, 22). To test this ΔKD/ΔKD possibility, we treated the Map3k1 cells with morphoge- netic factors, including: TGF-α and EGF, which activate EGFR; activin B and TGF-β1, which act through receptors of the TGF-β superfamily; FGF10, which act through a FGF receptor; and retinoic acid, which acts through RXR, and measured β-gal ac- Δ Δ Fig. 1. Induction of MAP3K1 expression in fibroblasts. The Map3k1 KD/ KD tivity (Fig. 1A and Fig. S2A). Although both EGFR ligands, fi α fi β broblasts treated with various agents for 24 h or as indicated were (A) TGF- and EGF, signi cantly increased -gal expression, none examined for the relative β-gal activities based on protein concentration, of the other agents had an effect. Correspondingly, TGF-α and (C and D) analyzed by Western blotting with antibodies for (C)anti–p- caused a clear induction of Map3k1 mRNA in wild-type cells, EGFR and (D) β-gal and β-actin. The intensity of the β-gal was compared with ΔKD/ΔKD paralleled by that of β-gal mRNA in Map3k1 cells, that of β-actin. (B) Total RNA isolated from wild-type (solid bars) and Δ Δ reaching a maximum level at 2 h and diminishing to a baseline Map3k1 KD/ KD fibroblasts (white bars) treated with TGF-α for different level by 6 h (Fig. 1B). In addition, TGF-α increased luciferase times were subjected to real-time RT-PCR for Map3k1 and β-Gal transcripts. Δ expression of pMap3k1-luc, a luciferase reporter driven by a 1.9- The fold-induction was calculated based on cycle differences ( Ct) in com- kb fragment of the Map3k1 promoter (Fig.
Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • 1 Tumor Suppressor PLK2 May Serve As a Biomarker in Triple-Negative Breast Cancer for Improved Response to PLK1 Therapeutics
    bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448722; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Tumor suppressor PLK2 may serve as a biomarker in triple-negative breast cancer for improved response to PLK1 therapeutics Yang Gao1, 2, 3, Elena B. Kabotyanski1, 2, Elizabeth Villegas7, Jonathan H. Shepherd8, Deanna Acosta1, 2, Clark Hamor1, 2, Tingting Sun2,4,5, Celina Montmeyor-Garcia9, Xiaping He8, Lacey E. Dobrolecki1, 2, 3, Thomas F. Westbrook2, 4, 5, Michael T. Lewis1, 2, 3, Susan G. Hilsenbeck2, 3, Xiang H.-F. Zhang1, 2, 3, 6, Charles M. Perou8 and Jeffrey M. Rosen1, 2 1Department of Molecular and Cellular Biology 2Dan L. Duncan Cancer Center 3Lester and Sue Smith Breast Center 4Department of Molecular and Human Genetics 5Verna & Marrs McLean Department of Biochemistry and Molecular Biology 6McNair Medical Institute Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030, USA 7University of Houston-Downtown, Houston, TX 77002, USA 8The University of North Carolina at Chapel Hill, Chapel Hill, NC 27599, USA 9 Canadian Blood Services, Toronto, ON M5G 2M1, Canada Correspondence to Jeffrey M. Rosen (Mail Stop: BCM130, Room: BCM-M638a, Baylor College of Medicine, 1 Baylor Plaza, Houston, TX 77030. Office: 713-798-6210. Fax: 713-898-8012. Email: [email protected]) 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448722; this version posted June 16, 2021.
    [Show full text]
  • Genome-Wide Association Study to Identify Genomic Regions And
    www.nature.com/scientificreports OPEN Genome‑wide association study to identify genomic regions and positional candidate genes associated with male fertility in beef cattle H. Sweett1, P. A. S. Fonseca1, A. Suárez‑Vega1, A. Livernois1,2, F. Miglior1 & A. Cánovas1* Fertility plays a key role in the success of calf production, but there is evidence that reproductive efciency in beef cattle has decreased during the past half‑century worldwide. Therefore, identifying animals with superior fertility could signifcantly impact cow‑calf production efciency. The objective of this research was to identify candidate regions afecting bull fertility in beef cattle and positional candidate genes annotated within these regions. A GWAS using a weighted single‑step genomic BLUP approach was performed on 265 crossbred beef bulls to identify markers associated with scrotal circumference (SC) and sperm motility (SM). Eight windows containing 32 positional candidate genes and fve windows containing 28 positional candidate genes explained more than 1% of the genetic variance for SC and SM, respectively. These windows were selected to perform gene annotation, QTL enrichment, and functional analyses. Functional candidate gene prioritization analysis revealed 14 prioritized candidate genes for SC of which MAP3K1 and VIP were previously found to play roles in male fertility. A diferent set of 14 prioritized genes were identifed for SM and fve were previously identifed as regulators of male fertility (SOD2, TCP1, PACRG, SPEF2, PRLR). Signifcant enrichment results were identifed for fertility and body conformation QTLs within the candidate windows. Gene ontology enrichment analysis including biological processes, molecular functions, and cellular components revealed signifcant GO terms associated with male fertility.
    [Show full text]
  • Kinase Profiling Book
    Custom and Pre-Selected Kinase Prof iling to f it your Budget and Needs! As of July 1, 2021 19.8653 mm 128 196 12 Tyrosine Serine/Threonine Lipid Kinases Kinases Kinases Carna Biosciences, Inc. 2007 Carna Biosciences, Inc. Profiling Assays available from Carna Biosciences, Inc. As of July 1, 2021 Page Kinase Name Assay Platform Page Kinase Name Assay Platform 4 ABL(ABL1) MSA 21 EGFR[T790M/C797S/L858R] MSA 4 ABL(ABL1)[E255K] MSA 21 EGFR[T790M/L858R] MSA 4 ABL(ABL1)[T315I] MSA 21 EPHA1 MSA 4 ACK(TNK2) MSA 21 EPHA2 MSA 4 AKT1 MSA 21 EPHA3 MSA 5 AKT2 MSA 22 EPHA4 MSA 5 AKT3 MSA 22 EPHA5 MSA 5 ALK MSA 22 EPHA6 MSA 5 ALK[C1156Y] MSA 22 EPHA7 MSA 5 ALK[F1174L] MSA 22 EPHA8 MSA 6 ALK[G1202R] MSA 23 EPHB1 MSA 6 ALK[G1269A] MSA 23 EPHB2 MSA 6 ALK[L1196M] MSA 23 EPHB3 MSA 6 ALK[R1275Q] MSA 23 EPHB4 MSA 6 ALK[T1151_L1152insT] MSA 23 Erk1(MAPK3) MSA 7 EML4-ALK MSA 24 Erk2(MAPK1) MSA 7 NPM1-ALK MSA 24 Erk5(MAPK7) MSA 7 AMPKα1/β1/γ1(PRKAA1/B1/G1) MSA 24 FAK(PTK2) MSA 7 AMPKα2/β1/γ1(PRKAA2/B1/G1) MSA 24 FER MSA 7 ARG(ABL2) MSA 24 FES MSA 8 AurA(AURKA) MSA 25 FGFR1 MSA 8 AurA(AURKA)/TPX2 MSA 25 FGFR1[V561M] MSA 8 AurB(AURKB)/INCENP MSA 25 FGFR2 MSA 8 AurC(AURKC) MSA 25 FGFR2[V564I] MSA 8 AXL MSA 25 FGFR3 MSA 9 BLK MSA 26 FGFR3[K650E] MSA 9 BMX MSA 26 FGFR3[K650M] MSA 9 BRK(PTK6) MSA 26 FGFR3[V555L] MSA 9 BRSK1 MSA 26 FGFR3[V555M] MSA 9 BRSK2 MSA 26 FGFR4 MSA 10 BTK MSA 27 FGFR4[N535K] MSA 10 BTK[C481S] MSA 27 FGFR4[V550E] MSA 10 BUB1/BUB3 MSA 27 FGFR4[V550L] MSA 10 CaMK1α(CAMK1) MSA 27 FGR MSA 10 CaMK1δ(CAMK1D) MSA 27 FLT1 MSA 11 CaMK2α(CAMK2A) MSA 28
    [Show full text]
  • Modulation of NF-Κb Signalling by Microbial Pathogens
    REVIEWS Modulation of NF‑κB signalling by microbial pathogens Masmudur M. Rahman and Grant McFadden Abstract | The nuclear factor-κB (NF‑κB) family of transcription factors plays a central part in the host response to infection by microbial pathogens, by orchestrating the innate and acquired host immune responses. The NF‑κB proteins are activated by diverse signalling pathways that originate from many different cellular receptors and sensors. Many successful pathogens have acquired sophisticated mechanisms to regulate the NF‑κB signalling pathways by deploying subversive proteins or hijacking the host signalling molecules. Here, we describe the mechanisms by which viruses and bacteria micromanage the host NF‑κB signalling circuitry to favour the continued survival of the pathogen. The nuclear factor-κB (NF-κB) family of transcription Signalling targets upstream of NF‑κB factors regulates the expression of hundreds of genes that NF-κB proteins are tightly regulated in both the cyto- are associated with diverse cellular processes, such as pro- plasm and the nucleus6. Under normal physiological liferation, differentiation and death, as well as innate and conditions, NF‑κB complexes remain inactive in the adaptive immune responses. The mammalian NF‑κB cytoplasm through a direct interaction with proteins proteins are members of the Rel domain-containing pro- of the inhibitor of NF-κB (IκB) family, including IκBα, tein family: RELA (also known as p65), RELB, c‑REL, IκBβ and IκBε (also known as NF-κBIα, NF-κBIβ and the NF-κB p105 subunit (also known as NF‑κB1; which NF-κBIε, respectively); IκB proteins mask the nuclear is cleaved into the p50 subunit) and the NF-κB p100 localization domains in the NF‑κB complex, thus subunit (also known as NF‑κB2; which is cleaved into retaining the transcription complex in the cytoplasm.
    [Show full text]
  • Comparing Signaling Networks Between Normal and Transformed Hepatocytes Using Discrete Logical Models
    Published OnlineFirst July 8, 2011; DOI: 10.1158/0008-5472.CAN-10-4453 Cancer Integrated Systems and Technologies: Mathematical Oncology Research Comparing Signaling Networks between Normal and Transformed Hepatocytes Using Discrete Logical Models Julio Saez-Rodriguez1,2, Leonidas G. Alexopoulos1,2, MingSheng Zhang1, Melody K. Morris2, Douglas A. Lauffenburger2, and Peter K. Sorger1,2 Abstract Substantial effort in recent years has been devoted to constructing and analyzing large-scale gene and protein networks on the basis of "omic" data and literature mining. These interaction graphs provide valuable insight into the topologies of complex biological networks but are rarely context specific and cannot be used to predict the responses of cell signaling proteins to specific ligands or drugs. Conversely, traditional approaches to analyzing cell signaling are narrow in scope and cannot easily make use of network-level data. Here, we combine network analysis and functional experimentation by using a hybrid approach in which graphs are converted into simple mathematical models that can be trained against biochemical data. Specifically, we created Boolean logic models of immediate-early signaling in liver cells by training a literature-based prior knowledge network against biochemical data obtained from primary human hepatocytes and 4 hepatocellular carcinoma cell lines exposed to combinations of cytokines and small-molecule kinase inhibitors. Distinct families of models were recovered for each cell type, and these families clustered topologically into normal and diseased sets. Cancer Res; 71(16); 5400–11. Ó2011 AACR. Introduction Major Findings The availability of high-throughput interaction data has led Clustering arises from systematic differences in signaling to the creation of methods for summarizing and exploring logic in three regions of the network.
    [Show full text]
  • Inhibition of ERK 1/2 Kinases Prevents Tendon Matrix Breakdown Ulrich Blache1,2,3, Stefania L
    www.nature.com/scientificreports OPEN Inhibition of ERK 1/2 kinases prevents tendon matrix breakdown Ulrich Blache1,2,3, Stefania L. Wunderli1,2,3, Amro A. Hussien1,2, Tino Stauber1,2, Gabriel Flückiger1,2, Maja Bollhalder1,2, Barbara Niederöst1,2, Sandro F. Fucentese1 & Jess G. Snedeker1,2* Tendon extracellular matrix (ECM) mechanical unloading results in tissue degradation and breakdown, with niche-dependent cellular stress directing proteolytic degradation of tendon. Here, we show that the extracellular-signal regulated kinase (ERK) pathway is central in tendon degradation of load-deprived tissue explants. We show that ERK 1/2 are highly phosphorylated in mechanically unloaded tendon fascicles in a vascular niche-dependent manner. Pharmacological inhibition of ERK 1/2 abolishes the induction of ECM catabolic gene expression (MMPs) and fully prevents loss of mechanical properties. Moreover, ERK 1/2 inhibition in unloaded tendon fascicles suppresses features of pathological tissue remodeling such as collagen type 3 matrix switch and the induction of the pro-fbrotic cytokine interleukin 11. This work demonstrates ERK signaling as a central checkpoint to trigger tendon matrix degradation and remodeling using load-deprived tissue explants. Tendon is a musculoskeletal tissue that transmits muscle force to bone. To accomplish its biomechanical function, tendon tissues adopt a specialized extracellular matrix (ECM) structure1. Te load-bearing tendon compart- ment consists of highly aligned collagen-rich fascicles that are interspersed with tendon stromal cells. Tendon is a mechanosensitive tissue whereby physiological mechanical loading is vital for maintaining tendon archi- tecture and homeostasis2. Mechanical unloading of the tissue, for instance following tendon rupture or more localized micro trauma, leads to proteolytic breakdown of the tissue with severe deterioration of both structural and mechanical properties3–5.
    [Show full text]
  • The Landscape of MAP3K1/MAP2K4 Alterations in Gastrointestinal (GI) Malignancies
    The landscape of MAP3K1/MAP2K4 alterations in gastrointestinal (GI) malignancies. Matthew K. Stein1,2, Andrew Elliott3, Jimmy J. Hwang4, Emil Lou5, Moh’d M. Khushman6, Aaron James Scott7, John L. Marshall8, Davendra Sohal9, Benjamin A. Weinberg8, Richard M. Goldberg10, Mohamed E. Salem4, W. Michael Korn3,11, Axel Grothey2 1. West Cancer Center, Germantown, TN; 2. University of Tennessee Health Science Center, Memphis, TN; 3. CARIS Life Sciences, Irving, TX; 4. Levine Cancer Institute, Charlotte, NC; 5. University of Minnesota School of Medicine, Minneapolis, MN; 6. Medical Oncology, The University of South Alabama, Mitchell Cancer Institute, Mobile, AL; 7. Banner-University of Arizona Cancer Center, Division of Hematology and Oncology, Tucson, AZ; 8. Georgetown Lombardi Comprehensive Cancer Center, Washington, DC; 9. University of Cincinnati, Cincinnati, OH; 10. West Virginia University Cancer Institute, Morgantown, WV; 11. University of California San Francisco, San Francisco, CA; 2. West Cancer Center, Germantown, TN Results Table 2. – Frequency of MAP3K1/MAP2K4-MT by GI malignancy site. Results, continued Background Table 1. – Patient characteristics MAP3K1 % MAP3K1 and/or and/or Figure 4. – Comparison of selected co-mutation rates of MAP3K1/MAP2K4-MT versus WT • Inactivating alterations in MAP3K1/MAP2K4 occur in various solid CRC CRC Non-CRC Non-CRC Total MAP2K4- MAP2K4- non-CRC patients (all MSS except as noted). All GI MAP3K1/ MAP3K1/ MAP3K1/ MAP3K1/ Characteristic Cancer Type cases mutated mutated 70.0% tumors, sensitize cancer
    [Show full text]
  • PRODUCTS and SERVICES Target List
    PRODUCTS AND SERVICES Target list Kinase Products P.1-11 Kinase Products Biochemical Assays P.12 "QuickScout Screening Assist™ Kits" Kinase Protein Assay Kits P.13 "QuickScout Custom Profiling & Panel Profiling Series" Targets P.14 "QuickScout Custom Profiling Series" Preincubation Targets Cell-Based Assays P.15 NanoBRET™ TE Intracellular Kinase Cell-Based Assay Service Targets P.16 Tyrosine Kinase Ba/F3 Cell-Based Assay Service Targets P.17 Kinase HEK293 Cell-Based Assay Service ~ClariCELL™ ~ Targets P.18 Detection of Protein-Protein Interactions ~ProbeX™~ Stable Cell Lines Crystallization Services P.19 FastLane™ Structures ~Premium~ P.20-21 FastLane™ Structures ~Standard~ Kinase Products For details of products, please see "PRODUCTS AND SERVICES" on page 1~3. Tyrosine Kinases Note: Please contact us for availability or further information. Information may be changed without notice. Expression Protein Kinase Tag Carna Product Name Catalog No. Construct Sequence Accession Number Tag Location System HIS ABL(ABL1) 08-001 Full-length 2-1130 NP_005148.2 N-terminal His Insect (sf21) ABL(ABL1) BTN BTN-ABL(ABL1) 08-401-20N Full-length 2-1130 NP_005148.2 N-terminal DYKDDDDK Insect (sf21) ABL(ABL1) [E255K] HIS ABL(ABL1)[E255K] 08-094 Full-length 2-1130 NP_005148.2 N-terminal His Insect (sf21) HIS ABL(ABL1)[T315I] 08-093 Full-length 2-1130 NP_005148.2 N-terminal His Insect (sf21) ABL(ABL1) [T315I] BTN BTN-ABL(ABL1)[T315I] 08-493-20N Full-length 2-1130 NP_005148.2 N-terminal DYKDDDDK Insect (sf21) ACK(TNK2) GST ACK(TNK2) 08-196 Catalytic domain
    [Show full text]
  • TLR Activation Pathways in HIV-1–Exposed Seronegative Individuals
    TLR Activation Pathways in HIV-1−Exposed Seronegative Individuals Mara Biasin, Luca Piacentini, Sergio Lo Caputo, Valentina Naddeo, Piera Pierotti, Manuela Borelli, Daria Trabattoni, This information is current as Francesco Mazzotta, Gene M. Shearer and Mario Clerici of September 29, 2021. J Immunol 2010; 184:2710-2717; Prepublished online 1 February 2010; doi: 10.4049/jimmunol.0902463 http://www.jimmunol.org/content/184/5/2710 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2010/01/29/jimmunol.090246 Material 3.DC1 http://www.jimmunol.org/ References This article cites 35 articles, 12 of which you can access for free at: http://www.jimmunol.org/content/184/5/2710.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision by guest on September 29, 2021 • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2010 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology TLR Activation Pathways in HIV-1–Exposed Seronegative Individuals Mara Biasin,* Luca Piacentini,* Sergio Lo Caputo,† Valentina Naddeo,* Piera Pierotti,† Manuela Borelli,* Daria Trabattoni,* Francesco Mazzotta,† Gene M.
    [Show full text]
  • An Exploration of Mutation Status of Cancer Genes in Breast Cancers
    on: Sequ ati en er c n in e g G & t x A e p Journal of Next Generation p N l f i c o Wang, Next Generat Sequenc & Applic 2014, 1:1 a l t a i o n r ISSN: 2469-9853n u s o DOI: 10.4172/2469-9853.1000103 J Sequencing & Applications Research Article Open Access An Exploration of Mutation Status of Cancer Genes in Breast Cancers Xiaosheng Wang* Department of Genetics, Cell Biology and Anatomy, University of Nebraska Medical Center, Omaha, USA *Corresponding author: Xiaosheng Wang, Department of Genetics, Cell Biology and Anatomy, University of Nebraska Medical Center, Omaha, USA, Tel: 402-559-4813; E-mail: [email protected] Rec date: Jan 21, 2014, Acc date: Apr 26, 2014, Pub date: Apr 28, 2014 Copyright: © 2014 Wang X. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction H2O in any medium, provided the original author and source are credited. Abstract Breast cancer is the most common cancer in women in US, and has the second highest mortality rate that accounts for about 25% of all cancer deaths. It has been recognized that genetic biomarkers for cancer are useful for estimating the cancer recurrence risk, and guiding targeted treatment of cancer. Since breast cancers carry a wide spectrum of gene mutations in their genomes, identification of these mutations would be promising in improving diagnosis and treatment of breast cancers. The rapid advances in Next-Generation Sequencing (NGS) technology have generated a large amount of NGS data on breast cancer genomes that makes detection and application of mutant biomarkers for breast cancer a reality.
    [Show full text]
  • Map2k7 Map3k1
    MAP2K7 Assay platform : Mobility Shift Assay Product code 07-148 Substrate : JNK2 Full-length human MAP2K7 [1-419(end) amino acids of accession Cascade Assay* number NP_660186.1] was co-expressed as N-terminal GST-fusion Metal : Mg protein (75 kDa) with human His-tagged MAP3K3 [1-626(end) amino acids of accession number NP_002392.2] using baculovirus Reference compound : Staurosporine expression system. GST-MAP2K7 was purified by using glutathione IC50 at 1 mM ATP (nM) : 1100 sepharose chromatography. *JNK2/Modified Erktide MAP3K1 Assay platform : Mobility Shift Assay Product code 07-103 Substrate : MAP2K1 Human MAP3K1, catalytic domain [1327-1646(end) amino acids of Cascade Assay* accession number XP_042066.8] was expressed as N-terminal Metal : Mg GST-fusion protein (62 kDa) using baculovirus expression system. GST-MAP3K1 was purified by using glutathione sepharose Reference compound : Staurosporine chromatography and anion exchange chromatography. IC50 at 1 mM ATP (nM) : 160 *MAP2K1/Erk2/Modified Erktide MAP3K2 Assay platform : Mobility Shift Assay Product code 07-104 Substrate : MAP2K4/MAP2K7 Human MAP3K2, catalytic domain [337-620(end) amino acids of Cascade Assay* accession number NP_006600.3] was expressed as N-terminal Metal : Mg GST-fusion protein (59 kDa) using baculovirus expression system. GST-MAP3K2 was purified by using glutathione sepharose Reference compound : Staurosporine chromatography. IC50 at 1 mM ATP (nM) : 45 *(MAP2K4/MAP2K7)/JNK2/Modified Erktide MAP3K3 Assay platform : Mobility Shift Assay Product code 07-105 Substrate : MAP2K6 Full-length human MAP3K3 [1-626(end) amino acids of accession Cascade Assay* number NP_002392.2] was expressed as N-terminal GST-fusion Metal : Mg protein (98 kDa) using baculovirus expression system.
    [Show full text]