DOCSLIB.ORG

TLR Activation Pathways in HIV-1–Exposed Seronegative Individuals

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
TLR Activation Pathways in HIV-1–Exposed Seronegative Individuals TLR Activation Pathways in HIV-1−Exposed Seronegative Individuals Mara Biasin, Luca Piacentini, Sergio Lo Caputo, Valentina Naddeo, Piera Pierotti, Manuela Borelli, Daria Trabattoni, This information is current as Francesco Mazzotta, Gene M. Shearer and Mario Clerici of September 29, 2021. J Immunol 2010; 184:2710-2717; Prepublished online 1 February 2010; doi: 10.4049/jimmunol.0902463 http://www.jimmunol.org/content/184/5/2710 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2010/01/29/jimmunol.090246 Material 3.DC1 http://www.jimmunol.org/ References This article cites 35 articles, 12 of which you can access for free at: http://www.jimmunol.org/content/184/5/2710.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision by guest on September 29, 2021 • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2010 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology TLR Activation Pathways in HIV-1–Exposed Seronegative Individuals Mara Biasin,* Luca Piacentini,* Sergio Lo Caputo,† Valentina Naddeo,* Piera Pierotti,† Manuela Borelli,* Daria Trabattoni,* Francesco Mazzotta,† Gene M. Shearer,‡ and Mario Clerici*,x TLRs trigger innate immunity that recognizes conserved motifs of invading pathogens, resulting in cellular activation and release of inflammatory factors. The influence of TLR activation on resistance to HIV-1 infection has not been investigated in HIV-1 exposed seronegative (ESN) individuals. PBMCs isolated from heterosexually ESN individuals were stimulated with agonists specific for TLR3 (poly I:C), TLR4 (LPS), TLR7 (imiquimod), and TLR7/8 (ssRNA40). We evaluated expression of factors in- volved in TLR signaling cascades, production of downstream effector immune mediators, and TLR-expression in CD4+ and CD14+ cells. Results were compared with those obtained in healthy controls (HCs). ESN individuals showed: 1) comparable Downloaded from percentages of CD14+/TLR4+ and CD4+/TLR8+ CD14+/TLR8+ cells; 2) higher responsiveness to poly I:C, LPS, imiquimod, and ssRNA40 stimulation, associated with significantly increased production of IL-1b,IL-6,TNF-a, and CCL3; 3) augmented expression of mRNA specific for other targets (CCL2, CSF3, CSF2, IL-1a, IL-8, IL-10, IL-12, cyclooxygenase 2) demonstrated by broader TLRs pathway expression analyses; and 4) increased MyD88/MyD88s(short) ratio, mainly following TLR7/8 stimulation. We also compared TLR–agonist-stimulated cytokine/chemokine production in CD14+ PBMCs and observed de- creased IFN-b production in ESN individuals compared with HCs upon TLR7/8-agonist stimulation. These data suggest that http://www.jimmunol.org/ TLR stimulation in ESN individuals results in a more robust release of immunologic factors that can influence the induction of stronger adaptive antiviral immune responses and might represent a virus-exposure–induced innate immune protective phe- notype against HIV-1. The Journal of Immunology, 2010, 184: 2710–2717. he concept of resistance to HIVinfection in individuals who cells to directly recognize pathogen-associated molecular patterns have been repeatedly exposed to HIV-1, but who do not of pathogens such as bacteria and viruses (9). TLR3, 7, 8, and 9 seroconvert (HIV-1–exposed seronegative [ESN]), and the have been implicated in antiviral defense (9, 10) and, in particular, T by guest on September 29, 2021 search for immune correlates of such protection against HIV in- ssRNA from HIV was found to trigger TLR7 and 8 in a MyD88- fection dates back 20 y to the first reports of this unexpected phe- dependent manner (11, 12). nomenon (1, 2). These early studies proposed an immunologic Despite reports that associate ESN individuals with adaptive im- advantage for these individuals, possibly conferring resistance mune responses (6–8), the initiating events leading to this state of against HIV-1 infection. The suggested multifactorial advantages resistance to HIV infection remain unknown. TLR activation repre- included favorable genetic (3, 4) and innate immunity (5), resulting sents the first line of defense against invading pathogens, and few in the generation of HIV-1–specific systemic and mucosal cell- reports describe a possible role for innate immunity on the modulation mediated immunity (6–8). of susceptibility to HIV infection (5, 13, 14). Therefore, we in- TLRs are a family of pattern-recognition receptors involved in vestigated the effects of engagement of four different TLRs on cy- the initiation of the immune response, allowing TLR-expressing tokine and chemokine expression profiles in PBMCs from a cohort of ESN individuals, and we compared those findings with data obtained from an equal number of healthy control (HC) blood donors. *Cattedra di Immunologia, Universita` degli Studi di Milano; xFondazione Don Gnocchi IRCCS, Milan; †Divisione Malattie Infettive, Ospedale S.M. Annunziata, Florence, Italy; and ‡Experimental Immunology Branch, Center for Cancer Research, National Materials and Methods Cancer Institute, National Institutes of Health, Bethesda, MD 20892 Study population and in vitro TLR stimulation Received for publication August 3, 2009. Accepted for publication December 11, 2009. The study was reviewed and approved by the institutional review boards of This work was supported by grants from the Istituto Superiore di Sanita Programma the S. M. Annunziata Hospital; written, informed consent was obtained Nazionale di Ricerca sull AIDS; the European Microbicides Project and AIDS Vac- from all subjects. Blood samples were collected from 30 ESN individuals. cine Integrated Project, European Community WP6 Projects; the Next Generation Inclusion criteria were a history of multiple unprotected sexual episodes for HIV-1 Immunogens inducing broadly reactive Neutralising antibodies European more than 4 y at the time of the enrollment, with at least three episodes of at- Community WP7 Project; the Japan Health Science Foundation; 2007 Ricerca Final- risk intercourse within 4 mo before study entry, and an average of 30 (range, izzata (Italian Ministry of Health); 2007 Ricerca Corrente (Italian Ministry of Health) 18 to .100) reported unprotected sexual contacts per year. Thirty age- and progetto Bando Futuro in Ricerca RETI, Rete Italiana Chimica Farmaceutica matched HCs, without known risk factor for HIV infection, were also Ricerca e Sviluppo del Farmaco (RBPR05NWWC). included in the study. Address correspondence and reprint requests to Prof. Mario Clerici, Universita degli Studi We have been following this cohort of individuals for the past 12 y (the di Milano, Facolta di Medicina e Chirugia, DISP LITAVialba, Via G. B. Grassi, 74, 20157 cohort was established in Tuscany at the beginning of 1997). This long Milan, Italy. E-mail: [email protected] period of time has allowed us to adopt stringent matching criteria between The online version of this article contains supplemental material. HC and ESN. Simply put, both our ESN and HC groups are involved in Abbreviation used in this paper: COX2, cyclooxygenase 2; ESN, HIV-1–exposed monogamous relationships, are part of long-lasting couples, and have seronegative; HC, healthy control; MFI, mean fluorescence intensity; pDC, plasma- similar sexual activities. HC and ESN individuals are from the same cytoid dendritic cell; poly I:C, polyinosic:polycytidylic acid. geographical area and share the same genetic background and the same www.jimmunol.org/cgi/doi/10.4049/jimmunol.0902463 The Journal of Immunology 2711 exposure to environmental factors. Part of the analyses performed on the retested by real-time PCR on each individual sample confirming the data individuals enrolled in this cohort are done by the Department of Obstetrics obtained in the super array (data not shown). and Gynecology, Santa Maria Annunziata Hospital (Florence, Italy). This allows us to exclude from the study ESN and HC patients in whom sexually Cytokine production transmitted diseases or any other pathologic conditions are reported. The IL-6, TNF-a, and IFN-g production was evaluated in the supernatants of follow-up includes biannual visits to the Department of Obstetrics and the cultured PBMCs, using commercial ELISA kits (R&D Systems, Gynecology, during which an accurate clinical history is collected and Minneapolis, MN) and following the procedures suggested by the manu- vaginal swabs are performed. facturer. Cytokine concentration was calculated from a standard curve of Whole blood was collected from all subjects by venupuncture in the corresponding recombinant human cytokine. Vacutainer tubes containing EDTA (BD Biosciences, San Jose, CA), and PBMCs were separated on lymphocyte separation medium (Organon TLR3, TLR4, and TLR8 expression in basal conditions and Teknica, Malvern, PA). after specific agonist stimulation Based on data derived from a kinetic study (data not shown), 2.5 3 105 freshlyisolatedPBMCswereincubatedfor6(mRNAanalyses)or24h
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • 1 Tumor Suppressor PLK2 May Serve As a Biomarker in Triple-Negative Breast Cancer for Improved Response to PLK1 Therapeutics
    bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448722; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Tumor suppressor PLK2 may serve as a biomarker in triple-negative breast cancer for improved response to PLK1 therapeutics Yang Gao1, 2, 3, Elena B. Kabotyanski1, 2, Elizabeth Villegas7, Jonathan H. Shepherd8, Deanna Acosta1, 2, Clark Hamor1, 2, Tingting Sun2,4,5, Celina Montmeyor-Garcia9, Xiaping He8, Lacey E. Dobrolecki1, 2, 3, Thomas F. Westbrook2, 4, 5, Michael T. Lewis1, 2, 3, Susan G. Hilsenbeck2, 3, Xiang H.-F. Zhang1, 2, 3, 6, Charles M. Perou8 and Jeffrey M. Rosen1, 2 1Department of Molecular and Cellular Biology 2Dan L. Duncan Cancer Center 3Lester and Sue Smith Breast Center 4Department of Molecular and Human Genetics 5Verna & Marrs McLean Department of Biochemistry and Molecular Biology 6McNair Medical Institute Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030, USA 7University of Houston-Downtown, Houston, TX 77002, USA 8The University of North Carolina at Chapel Hill, Chapel Hill, NC 27599, USA 9 Canadian Blood Services, Toronto, ON M5G 2M1, Canada Correspondence to Jeffrey M. Rosen (Mail Stop: BCM130, Room: BCM-M638a, Baylor College of Medicine, 1 Baylor Plaza, Houston, TX 77030. Office: 713-798-6210. Fax: 713-898-8012. Email: [email protected]) 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448722; this version posted June 16, 2021.
    [Show full text]
  • IL-12 Abrogates Calcineurin-Dependent Immune Evasion During Leukemia Progression
    Author Manuscript Published OnlineFirst on May 29, 2019; DOI: 10.1158/0008-5472.CAN-18-3800 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. IL-12 abrogates calcineurin-dependent immune evasion during leukemia progression Jennifer L. Rabe,1* Lori Gardner,2* Rae Hunter,3 Jairo A. Fonseca,3 Jodi Dougan,3 Christy M. Gearheart,2 Michael S. Leibowitz,2 Cathy Lee-Miller,2 Dmitry Baturin,2 Susan P. Fosmire,2 Susan E. Zelasko,2 Courtney L. Jones,2 Jill E. Slansky,4 Manali Rupji,5 Bhakti Dwivedi,5 Curtis J. Henry,3,5,6 and Christopher C. Porter3,5,6 Affiliations: 1Molecular Biology Program, University of Colorado Denver, Aurora, CO. 2Department of Pediatrics, University of Colorado, Aurora, CO 3Department of Pediatrics, Emory University School of Medicine, Atlanta, GA 4Integrated Department of Immunology, University of Colorado School of Medicine, Aurora, CO 5Winship Cancer Institute, Emory University, Atlanta, GA 6Aflac Cancer and Blood Disorders Center, Children’s Healthcare of Atlanta, GA JR and LAG contributed equally to this study. Corresponding Author: Christopher C. Porter, MD Emory University School of Medicine 1760 Haygood Drive, E370 Atlanta, GA 30322 Phone: 404-727-4881 Fax: 404-727-4455 [email protected] Running title: Leukemia-cell calcineurin drives immune evasion Conflict of interest statement The authors have declared that no conflicts of interest exist. Abstract: 199 words Main Text: 5797 words (excluding figure legends and references) Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2019 American Association for Cancer Research. Author Manuscript Published OnlineFirst on May 29, 2019; DOI: 10.1158/0008-5472.CAN-18-3800 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
    [Show full text]
  • Genome-Wide Association Study to Identify Genomic Regions And
    www.nature.com/scientificreports OPEN Genome‑wide association study to identify genomic regions and positional candidate genes associated with male fertility in beef cattle H. Sweett1, P. A. S. Fonseca1, A. Suárez‑Vega1, A. Livernois1,2, F. Miglior1 & A. Cánovas1* Fertility plays a key role in the success of calf production, but there is evidence that reproductive efciency in beef cattle has decreased during the past half‑century worldwide. Therefore, identifying animals with superior fertility could signifcantly impact cow‑calf production efciency. The objective of this research was to identify candidate regions afecting bull fertility in beef cattle and positional candidate genes annotated within these regions. A GWAS using a weighted single‑step genomic BLUP approach was performed on 265 crossbred beef bulls to identify markers associated with scrotal circumference (SC) and sperm motility (SM). Eight windows containing 32 positional candidate genes and fve windows containing 28 positional candidate genes explained more than 1% of the genetic variance for SC and SM, respectively. These windows were selected to perform gene annotation, QTL enrichment, and functional analyses. Functional candidate gene prioritization analysis revealed 14 prioritized candidate genes for SC of which MAP3K1 and VIP were previously found to play roles in male fertility. A diferent set of 14 prioritized genes were identifed for SM and fve were previously identifed as regulators of male fertility (SOD2, TCP1, PACRG, SPEF2, PRLR). Signifcant enrichment results were identifed for fertility and body conformation QTLs within the candidate windows. Gene ontology enrichment analysis including biological processes, molecular functions, and cellular components revealed signifcant GO terms associated with male fertility.
    [Show full text]
  • Human IL12A / NKSF1 Protein (His Tag)
    Human IL12A / NKSF1 Protein (His Tag) Catalog Number: 10021-H08H General Information SDS-PAGE: Gene Name Synonym: CLMF; IL-12A; NFSK; NKSF1; P35 Protein Construction: A DNA sequence encoding the p35 subunit of human IL12, termed as IL12A (P29459) (Met 1-Ser 219) was expressed, fused with a polyhistidine tag at the C-terminus. Source: Human Expression Host: HEK293 Cells QC Testing Purity: > 92 % as determined by SDS-PAGE Bio Activity： Protein Description Measured by its ability to bind Human IL12B-his in functional ELISA. Interleukin-12 subunit alpha (IL12A/IL-12p35) is also known as Cytotoxic lymphocyte maturation factor 35 kDa subunit, cytotoxic lymphocyte Endotoxin: maturation factor 1, p35, NK cell stimulatory factor chain 1, and interleukin- 12 alpha chain. IL12A/IL-12p35 is a subunit of a cytokine that acts on T < 1.0 EU per μg of the protein as determined by the LAL method and natural killer cells, and has a broad array of biological activities. The cytokine is a disulfide-linked heterodimer composed of the 35-kD subunit Stability: encoded by this gene, and a 40-kD subunit that is a member of the Samples are stable for up to twelve months from date of receipt at -70 ℃ cytokine receptor family. IL12A/IL-12p35 is required for the T-cell- independent induction of IFN-gamma, and is important for the Predicted N terminal: Arg 23 differentiation of both Th1 and Th2 cells. The responses of lymphocytes to this cytokine are mediated by the activator of transcription protein STAT4. Molecular Mass: Nitric oxide synthase 2A (NOS2A/NOS2) is found to be required for the signaling process of this cytokine in innate immunity.
    [Show full text]
  • Kinase Profiling Book
    Custom and Pre-Selected Kinase Prof iling to f it your Budget and Needs! As of July 1, 2021 19.8653 mm 128 196 12 Tyrosine Serine/Threonine Lipid Kinases Kinases Kinases Carna Biosciences, Inc. 2007 Carna Biosciences, Inc. Profiling Assays available from Carna Biosciences, Inc. As of July 1, 2021 Page Kinase Name Assay Platform Page Kinase Name Assay Platform 4 ABL(ABL1) MSA 21 EGFR[T790M/C797S/L858R] MSA 4 ABL(ABL1)[E255K] MSA 21 EGFR[T790M/L858R] MSA 4 ABL(ABL1)[T315I] MSA 21 EPHA1 MSA 4 ACK(TNK2) MSA 21 EPHA2 MSA 4 AKT1 MSA 21 EPHA3 MSA 5 AKT2 MSA 22 EPHA4 MSA 5 AKT3 MSA 22 EPHA5 MSA 5 ALK MSA 22 EPHA6 MSA 5 ALK[C1156Y] MSA 22 EPHA7 MSA 5 ALK[F1174L] MSA 22 EPHA8 MSA 6 ALK[G1202R] MSA 23 EPHB1 MSA 6 ALK[G1269A] MSA 23 EPHB2 MSA 6 ALK[L1196M] MSA 23 EPHB3 MSA 6 ALK[R1275Q] MSA 23 EPHB4 MSA 6 ALK[T1151_L1152insT] MSA 23 Erk1(MAPK3) MSA 7 EML4-ALK MSA 24 Erk2(MAPK1) MSA 7 NPM1-ALK MSA 24 Erk5(MAPK7) MSA 7 AMPKα1/β1/γ1(PRKAA1/B1/G1) MSA 24 FAK(PTK2) MSA 7 AMPKα2/β1/γ1(PRKAA2/B1/G1) MSA 24 FER MSA 7 ARG(ABL2) MSA 24 FES MSA 8 AurA(AURKA) MSA 25 FGFR1 MSA 8 AurA(AURKA)/TPX2 MSA 25 FGFR1[V561M] MSA 8 AurB(AURKB)/INCENP MSA 25 FGFR2 MSA 8 AurC(AURKC) MSA 25 FGFR2[V564I] MSA 8 AXL MSA 25 FGFR3 MSA 9 BLK MSA 26 FGFR3[K650E] MSA 9 BMX MSA 26 FGFR3[K650M] MSA 9 BRK(PTK6) MSA 26 FGFR3[V555L] MSA 9 BRSK1 MSA 26 FGFR3[V555M] MSA 9 BRSK2 MSA 26 FGFR4 MSA 10 BTK MSA 27 FGFR4[N535K] MSA 10 BTK[C481S] MSA 27 FGFR4[V550E] MSA 10 BUB1/BUB3 MSA 27 FGFR4[V550L] MSA 10 CaMK1α(CAMK1) MSA 27 FGR MSA 10 CaMK1δ(CAMK1D) MSA 27 FLT1 MSA 11 CaMK2α(CAMK2A) MSA 28
    [Show full text]
  • Modulation of NF-Κb Signalling by Microbial Pathogens
    REVIEWS Modulation of NF‑κB signalling by microbial pathogens Masmudur M. Rahman and Grant McFadden Abstract | The nuclear factor-κB (NF‑κB) family of transcription factors plays a central part in the host response to infection by microbial pathogens, by orchestrating the innate and acquired host immune responses. The NF‑κB proteins are activated by diverse signalling pathways that originate from many different cellular receptors and sensors. Many successful pathogens have acquired sophisticated mechanisms to regulate the NF‑κB signalling pathways by deploying subversive proteins or hijacking the host signalling molecules. Here, we describe the mechanisms by which viruses and bacteria micromanage the host NF‑κB signalling circuitry to favour the continued survival of the pathogen. The nuclear factor-κB (NF-κB) family of transcription Signalling targets upstream of NF‑κB factors regulates the expression of hundreds of genes that NF-κB proteins are tightly regulated in both the cyto- are associated with diverse cellular processes, such as pro- plasm and the nucleus6. Under normal physiological liferation, differentiation and death, as well as innate and conditions, NF‑κB complexes remain inactive in the adaptive immune responses. The mammalian NF‑κB cytoplasm through a direct interaction with proteins proteins are members of the Rel domain-containing pro- of the inhibitor of NF-κB (IκB) family, including IκBα, tein family: RELA (also known as p65), RELB, c‑REL, IκBβ and IκBε (also known as NF-κBIα, NF-κBIβ and the NF-κB p105 subunit (also known as NF‑κB1; which NF-κBIε, respectively); IκB proteins mask the nuclear is cleaved into the p50 subunit) and the NF-κB p100 localization domains in the NF‑κB complex, thus subunit (also known as NF‑κB2; which is cleaved into retaining the transcription complex in the cytoplasm.
    [Show full text]
  • Recombinant Human IL12 Protein,HEK293 Expressed Catalog # AMS.IL2-H4210 for Research and Further Cell Culture Manufacturing Use
    Recombinant Human IL12 Protein,HEK293 Expressed Catalog # AMS.IL2-H4210 For Research and Further Cell Culture Manufacturing Use Description Source Recombinant Human IL12 Protein,HEK293 Expressed (Human IL12B & IL12A heterodimer) Ile 23 - Ser 328 (Accession # (AAH67499,IL12B) and Arg 23 - Ser 219 (P29459,IL12A)) was produced in human 293 cells (HEK293) Predicted N‐terminus Ile 23 (IL12B) and Arg 23 (IL12A) Molecular Human IL12B & IL12A heterodimer contains no "tag", and has a calculated MW of 36.6 kDa (IL12B) and 23.8 kDa (IL12A). The Characterization predicted N-terminus is Ile 23 (IL12B) and Arg 23 (IL12A). DTT-reduced Protein migrates as 33-47 kDa in SDS-PAGE due to glycosylation. Endotoxin Less than 1.0 EU per μg of the Human IL12B & IL12A heterodimer by the LAL method. Purity >95% as determined by SDS-PAGE. Bioactivity The bio-activity was determined by the dose-dependent release of IFN-gamma from the human NK92 cell line in presence of 20 ng/mL rhIL-2 (Catalog # IL2-H4216). The ED50 < 0.2 ng/mL, corresponding to a specific activity of >5,000,000 Unit/mg. Formulation and Storage Formulation Lyophilized from 0.22 μm filtered solution in PBS, pH7.4. Normally Mannitol or Trehalose are added as protectants before lyophilization. Contact us for customized product form or formulation. Reconstitution See Certificate of Analysis for reconstitution instructions and specific concentrations. Storage Lyophilized Protein should be stored at -20℃ or lower for long term storage. Upon reconstitution, working aliquots should be stored at -20℃ or -70℃. Avoid repeated freeze-thaw cycles. No activity loss was observed after storage at: ● 4-8℃ for 12 months in lyophilized state; ● -70℃ for 3 months under sterile conditions after reconstitution.
    [Show full text]
  • Comparing Signaling Networks Between Normal and Transformed Hepatocytes Using Discrete Logical Models
    Published OnlineFirst July 8, 2011; DOI: 10.1158/0008-5472.CAN-10-4453 Cancer Integrated Systems and Technologies: Mathematical Oncology Research Comparing Signaling Networks between Normal and Transformed Hepatocytes Using Discrete Logical Models Julio Saez-Rodriguez1,2, Leonidas G. Alexopoulos1,2, MingSheng Zhang1, Melody K. Morris2, Douglas A. Lauffenburger2, and Peter K. Sorger1,2 Abstract Substantial effort in recent years has been devoted to constructing and analyzing large-scale gene and protein networks on the basis of "omic" data and literature mining. These interaction graphs provide valuable insight into the topologies of complex biological networks but are rarely context specific and cannot be used to predict the responses of cell signaling proteins to specific ligands or drugs. Conversely, traditional approaches to analyzing cell signaling are narrow in scope and cannot easily make use of network-level data. Here, we combine network analysis and functional experimentation by using a hybrid approach in which graphs are converted into simple mathematical models that can be trained against biochemical data. Specifically, we created Boolean logic models of immediate-early signaling in liver cells by training a literature-based prior knowledge network against biochemical data obtained from primary human hepatocytes and 4 hepatocellular carcinoma cell lines exposed to combinations of cytokines and small-molecule kinase inhibitors. Distinct families of models were recovered for each cell type, and these families clustered topologically into normal and diseased sets. Cancer Res; 71(16); 5400–11. Ó2011 AACR. Introduction Major Findings The availability of high-throughput interaction data has led Clustering arises from systematic differences in signaling to the creation of methods for summarizing and exploring logic in three regions of the network.
    [Show full text]
  • Generation of Novel IL-10 Mesenchymal Stem/Stromal Cells
    Mesenchymal Stem/Stromal Cells Induce the Generation of Novel IL-10 −Dependent Regulatory Dendritic Cells by SOCS3 Activation This information is current as of October 3, 2021. Xingxia Liu, Xuebin Qu, Yuan Chen, Lianming Liao, Kai Cheng, Changshun Shao, Martin Zenke, Armand Keating and Robert C. H. Zhao J Immunol 2012; 189:1182-1192; Prepublished online 2 July 2012; Downloaded from doi: 10.4049/jimmunol.1102996 http://www.jimmunol.org/content/189/3/1182 Supplementary http://www.jimmunol.org/content/suppl/2012/07/02/jimmunol.110299 http://www.jimmunol.org/ Material 6.DC1 References This article cites 50 articles, 18 of which you can access for free at: http://www.jimmunol.org/content/189/3/1182.full#ref-list-1 Why The JI? Submit online. by guest on October 3, 2021 • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2012 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Mesenchymal Stem/Stromal Cells Induce the Generation of Novel IL-10–Dependent Regulatory Dendritic Cells by SOCS3 Activation Xingxia Liu,*,1 Xuebin Qu,*,1 Yuan Chen,* Lianming Liao,† Kai Cheng,* Changshun Shao,‡ Martin Zenke,x Armand Keating,{,‖,# and Robert C.
    [Show full text]
  • EBI3 Regulates the NK Cell Response to Mouse Cytomegalovirus Infection
    EBI3 regulates the NK cell response to mouse cytomegalovirus infection Helle Jensena, Shih-Yu Chenb, Lasse Folkersenc, Garry P. Nolanb, and Lewis L. Laniera,d,1 aDepartment of Microbiology and Immunology, University of California, San Francisco, CA 94143; bDepartment of Microbiology and Immunology, Stanford University, Palo Alto, CA 94304; cDepartment of Systems Biology, Center for Biological Sequence Analysis, Technical University of Denmark, Lyngby DK-2800, Denmark; and dParker Institute for Cancer Immunotherapy, San Francisco, CA 94143 Contributed by Lewis L. Lanier, January 7, 2017 (sent for review November 1, 2016; reviewed by Michael A. Caligiuri and Daniel J. Cua) Natural killer (NK) cells are key mediators in the control of a role in shaping the subsequent adaptive immune responses. cytomegalovirus infection. Here, we show that Epstein–Barr virus- Crosstalk between NK cells and dendritic cells (DCs) early induced 3 (EBI3) is expressed by human NK cells after NKG2D or IL-12 during MCMV infection affects the outcome of the T-cell re- plus IL-18 stimulation and by mouse NK cells during mouse cytomeg- sponses. IL-10 secreted by various immune cells, including NK alovirus (MCMV) infection. The induction of EBI3 protein expression in cells, dampens the T-cell response by negatively affecting the mouse NK cells is a late activation event. Thus, early activation events maturation of DCs, and in the absence of IL-10 secretion of of NK cells, such as IFNγ production and CD69 expression, were not IFNγ and TNFα by NK cells enhances the maturation of DCs, −/− affected in EBI3-deficient (Ebi3 ) C57BL/6 (B6) mice during MCMV which boosts the T-cell response (11).
    [Show full text]
  • Evolutionary Divergence and Functions of the Human Interleukin (IL) Gene Family Chad Brocker,1 David Thompson,2 Akiko Matsumoto,1 Daniel W
    UPDATE ON GENE COMPLETIONS AND ANNOTATIONS Evolutionary divergence and functions of the human interleukin (IL) gene family Chad Brocker,1 David Thompson,2 Akiko Matsumoto,1 Daniel W. Nebert3* and Vasilis Vasiliou1 1Molecular Toxicology and Environmental Health Sciences Program, Department of Pharmaceutical Sciences, University of Colorado Denver, Aurora, CO 80045, USA 2Department of Clinical Pharmacy, University of Colorado Denver, Aurora, CO 80045, USA 3Department of Environmental Health and Center for Environmental Genetics (CEG), University of Cincinnati Medical Center, Cincinnati, OH 45267–0056, USA *Correspondence to: Tel: þ1 513 821 4664; Fax: þ1 513 558 0925; E-mail: [email protected]; [email protected] Date received (in revised form): 22nd September 2010 Abstract Cytokines play a very important role in nearly all aspects of inflammation and immunity. The term ‘interleukin’ (IL) has been used to describe a group of cytokines with complex immunomodulatory functions — including cell proliferation, maturation, migration and adhesion. These cytokines also play an important role in immune cell differentiation and activation. Determining the exact function of a particular cytokine is complicated by the influence of the producing cell type, the responding cell type and the phase of the immune response. ILs can also have pro- and anti-inflammatory effects, further complicating their characterisation. These molecules are under constant pressure to evolve due to continual competition between the host’s immune system and infecting organisms; as such, ILs have undergone significant evolution. This has resulted in little amino acid conservation between orthologous proteins, which further complicates the gene family organisation. Within the literature there are a number of overlapping nomenclature and classification systems derived from biological function, receptor-binding properties and originating cell type.
    [Show full text]