DOCSLIB.ORG

Metastatic Breast Cancer: Overview for Oncology Clinical Practice

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Metastatic Breast Cancer: Overview for Oncology Clinical Practice Review PIK3CA Mutation Assessment in HR+/HER2− Metastatic Breast Cancer: Overview for Oncology Clinical Practice Carmen Criscitiello 1,2,* , Antonio Marra 1,2,3 and Giuseppe Curigliano 1,2 1 Division of Early Drug Development for Innovative Therapies, IEO, European Institute of Oncology IRCCS, Via Ripamonti, 435, 20141 Milan, Italy; [email protected] (A.M.); [email protected] (G.C.) 2 Department of Oncology and Haemato-Oncology, University of Milano, Via Ripamonti, 435, 20141 Milan, Italy 3 Memorial Sloan Kettering Cancer Center, Department of Pathology, 1275 York Avenue, New York, NY 10065, USA * Correspondence: [email protected]; Tel.: +39-0257489599 Abstract: Activation of the PI3K–AKT–mTOR pathway occurs in several human cancers, including hormone receptor (HR)-positive breast cancer (BC) where is associated with resistance to endocrine therapy and disease progression. In BC, the most common PI3K–AKT–mTOR pathway alteration is represented by PIK3CA oncogenic mutations. These mutations can occur throughout several domains of the p110α catalytic subunit, but the majority are found in the helical and kinase domains (exon 9 and 20) that represent the “hotspots”. Considering the central role of the PI3K–AKT–mTOR pathway in HR-positive BC, several inhibitors (both pan-PI3K and isoform-specific) have been developed and tested in clinical trials. Recently, the PI3Kα-selective inhibitor alpelisib was the first PI3K inhibitor approved for clinical use in HR-positive metastatic BC based on the results of the phase III SOLAR-1 trial. Several methods to assess PIK3CA mutational status in tumor samples have been developed and validated, including real-time polymerase chain reaction (PCR), digital Citation: Criscitiello, C.; Marra, A.; Curigliano, G. PIK3CA Mutation droplet PCR (ddPCR), BEAMing assays, Sanger sequencing, and next-generation sequencing (NGS) Assessment in HR+/HER2− panels. Several new challenges will be expected once alpelisib is widely available in a clinical Metastatic Breast Cancer: Overview setting, including the harmonization of testing procedures for the detection of PI3K–AKT–mTOR for Oncology Clinical Practice. J. Mol. pathway alterations. Herein, we provide an overview on PI3K–AKT–mTOR pathway alterations in Pathol. 2021, 2, 42–54. https:// HR-positive BC, discuss their role in determining prognosis and resistance to endocrine therapy and doi.org/10.3390/jmp2010005 highlight practical considerations about diagnostic methods for the detection of PI3K–AKT–mTOR pathway activation status. Academic Editor: Claudio Bellevicine Keywords: PIK3CA; breast cancer; alpelisib; diagnostic; PCR; next-generation sequencing Received: 2 February 2021 Accepted: 7 March 2021 Published: 11 March 2021 1. Introduction Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in The phosphatidylinositol-3-kinase (PI3K)-protein kinase B (AKT)-mammalian target published maps and institutional affil- of rapamycin (mTOR) cascade is one of the major downstream signaling pathways in iations. human cells and is involved in essential cell processes such as metabolism, survival, proliferation, growth, and motility [1]. The PI3K–AKT–mTOR pathway can be triggered by the activation of various tyrosine kinase receptors (TKRs) or G protein-coupled receptors. Mechanistically, PI3K phosphorylates phosphatidylinositol (4,5)-bisphosphate (PIP2) to phosphatidylinositol (3,4,5,)-trisphosphate (PIP3) at the plasma membrane. Consequently, Copyright: © 2021 by the authors. AKT kinases are activated by PIP3 being able to phosphorylate tuberous sclerosis protein Licensee MDPI, Basel, Switzerland. This article is an open access article 1 (TSC1) and TSC2, and thereby dissociate the TSC1–TSC2 complex. The TSC1–TSC2 distributed under the terms and complex negatively regulates the activity of the kinase mTOR. Therefore, AKT activity conditions of the Creative Commons results in the activation of mTOR complex 1 (mTORC1) and ultimately promotes cell Attribution (CC BY) license (https:// growth and proliferation. Notably, mTORC1 is involved in a negative feedback loop that creativecommons.org/licenses/by/ serves to prevent the overactivation of AKT. The cascade is also antagonized mainly by the 4.0/). tumor suppressor phosphatase and tensin homolog (PTEN), which converts PIP3 to PIP2. J. Mol. Pathol. 2021, 2, 42–54. https://doi.org/10.3390/jmp2010005 https://www.mdpi.com/journal/jmp J. Mol. Pathol. 2021, 2, FOR PEER REVIEW 2 J. Mol. Pathol. 2021, 2 43 that serves to prevent the overactivation of AKT. The cascade is also antagonized mainly by the tumor suppressor phosphatase and tensin homolog (PTEN), which converts PIP3 to PIP2. DysregulationDysregulation of of the the PI3K–AKT–mTOR PI3K–AKT–mTOR pathway pathway occurs occurs in in a largea large variety variety of of human human cancerscancers and and has has been been proven proven to to be be implicated implicated in in tumor tumor development development and and progression progression [2 [2].]. SuchSuch dysregulation dysregulation can can derive derive from from different different mechanisms mechanisms that that include include overactivation overactivation of of growthgrowth factor factor receptors, receptors, activating activating mutations mutations in in the the PI3K PI3K subunits, subunits, PTEN PTEN loss loss of of function, function, andand mutations mutations in in other other genesgenes including AKT. AKT. PI PI3K3K is is a aheterodimer heterodimer with with a regulatory a regulatory and anda catalytic a catalytic subunit. subunit. The Thefour four catalytic catalytic isoforms isoforms of class of classI PI3K I PI3Khave different have different tissue tissueexpres- α β expressionsion patterns. patterns. While While the α theand βand (PIK3CB(PIK3CB) isoforms) isoforms are ubiquitously are ubiquitously expressed expressed in human in γ PIK3CG δ PIK3CD humantissues, tissues, the expression the expression of γ (PIK3CG of ( ) and )δ and (PIK3CD( ) isoforms) isoforms is limited is limited to white to white blood blood cells [3]. PI3Kα is a heterodimeric protein complex comprising the catalytic subunit cells [3]. PI3Kα is a heterodimeric protein complex comprising the catalytic subunit p110a p110a (encoded by the PIK3CA gene located on chromosome 3) and the regulatory subunit (encoded by the PIK3CA gene located on chromosome 3) and the regulatory subunit p85a p85a (encoded by the PIK3R1 gene located on chromosome 5). Mechanistically, p110a binds (encoded by the PIK3R1 gene located on chromosome 5). Mechanistically, p110a binds to to the regulatory subunit p85a, which inhibits p110a, and catalyzes the phosphorylation of the regulatory subunit p85a, which inhibits p110a, and catalyzes the phosphorylation of PIP2 to PIP3 [1]. PI3Kα is the most frequently altered PI3K isoform in solid tumors, playing PIP2 to PIP3 [1]. PI3Kα is the most frequently altered PI3K isoform in solid tumors, play- a prominent role in the aberrant activation of the PI3K-AKT-mTOR pathway [4]. ing a prominent role in the aberrant activation of the PI3K-AKT-mTOR pathway [4]. In breast cancer (BC), aberrant activation of this pathway has been well-documented In breast cancer (BC), aberrant activation of this pathway has been well-documented in estrogen receptor (ER)-positive tumors, being associated with resistance to endocrine in estrogen receptor (ER)-positive tumors, being associated with resistance to endocrine therapy and disease progression [5]. Figure1 schematically summarizes the PI3K-AKT- therapy and disease progression [5]. Figure 1 schematically summarizes the PI3K-AKT- mTOR pathway in ER-positive BC. mTOR pathway in ER-positive BC. Figure 1. Phosphatidylinositol-3-kinase (PI3K)-protein kinase B (AKT)-mammalian target of ra- Figure 1. Phosphatidylinositol-3-kinase (PI3K)-protein kinase B (AKT)-mammalian target of ra- pamycin (mTOR) in ER-positive/HER2-negative breast cancer (ER+/HER2− BC). Abbreviations: pamycin (mTOR) in ER-positive/HER2-negative breast cancer (ER+/HER2− BC). Abbreviations: Akt, protein kinase B; B-RAF, murine sarcoma viral oncogene homolog; ER, estrogen receptor; Akt,ERK1/2, protein extracellular-signal kinase B; B-RAF, regulated murine sarcomakinase 1/2; viral GSK3A/B, oncogene glycogen homolog; synthase ER, estrogen kinase-3 receptor;α/β; HR, ERK1/2,hormone extracellular-signal receptor-positive; regulated MEK, Mitogen-activa kinase 1/2; GSK3A/B,ted protein glycogen kinase; mTOR(C), synthase kinase-3mammalianα/β ;target HR, hormoneof rapamycin receptor-positive; (complex); NF MEK,κB, nuclear Mitogen-activated factor κ-light-chain-enhancer protein kinase; mTOR(C), of activated mammalian B cells; PI3K, target ofphosphatidylinositol rapamycin (complex); 3-kinase; NFκB, PIP, nuclear phosphatidylinositol factor κ-light-chain-enhancer phosphate; PTEN, of activated phosphatase B cells; and PI3K, phosphatidylinositoltensin homolog; RTKs, 3-kinase; receptor PIP, tyrosine phosphatidylinositol kinases; SRC, phosphate;rous sarcoma. PTEN, phosphatase and tensin homolog; RTKs, receptor tyrosine kinases; SRC, rous sarcoma. 2 J. Mol. Pathol. 2021, 2 44 Considering the central role of the PI3K pathway in ER-positive BC, several inhibitors have been developed and tested in clinical trials. If the use of pan-PI3K inhibitors, such as buparlisib and pictilisib, may ensure broad activity with a range of molecular drivers, isoform-specific inhibitors, including taselisib and alpelisib, may reduce off-target toxi- city [6–8]. Indeed, high levels of treatment-related adverse events have been one
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • 1 Tumor Suppressor PLK2 May Serve As a Biomarker in Triple-Negative Breast Cancer for Improved Response to PLK1 Therapeutics
    bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448722; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Tumor suppressor PLK2 may serve as a biomarker in triple-negative breast cancer for improved response to PLK1 therapeutics Yang Gao1, 2, 3, Elena B. Kabotyanski1, 2, Elizabeth Villegas7, Jonathan H. Shepherd8, Deanna Acosta1, 2, Clark Hamor1, 2, Tingting Sun2,4,5, Celina Montmeyor-Garcia9, Xiaping He8, Lacey E. Dobrolecki1, 2, 3, Thomas F. Westbrook2, 4, 5, Michael T. Lewis1, 2, 3, Susan G. Hilsenbeck2, 3, Xiang H.-F. Zhang1, 2, 3, 6, Charles M. Perou8 and Jeffrey M. Rosen1, 2 1Department of Molecular and Cellular Biology 2Dan L. Duncan Cancer Center 3Lester and Sue Smith Breast Center 4Department of Molecular and Human Genetics 5Verna & Marrs McLean Department of Biochemistry and Molecular Biology 6McNair Medical Institute Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030, USA 7University of Houston-Downtown, Houston, TX 77002, USA 8The University of North Carolina at Chapel Hill, Chapel Hill, NC 27599, USA 9 Canadian Blood Services, Toronto, ON M5G 2M1, Canada Correspondence to Jeffrey M. Rosen (Mail Stop: BCM130, Room: BCM-M638a, Baylor College of Medicine, 1 Baylor Plaza, Houston, TX 77030. Office: 713-798-6210. Fax: 713-898-8012. Email: [email protected]) 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448722; this version posted June 16, 2021.
    [Show full text]
  • AGC Kinases in Mtor Signaling, in Mike Hall and Fuyuhiko Tamanoi: the Enzymes, Vol
    Provided for non-commercial research and educational use only. Not for reproduction, distribution or commercial use. This chapter was originally published in the book, The Enzymes, Vol .27, published by Elsevier, and the attached copy is provided by Elsevier for the author's benefit and for the benefit of the author's institution, for non-commercial research and educational use including without limitation use in instruction at your institution, sending it to specific colleagues who know you, and providing a copy to your institution’s administrator. All other uses, reproduction and distribution, including without limitation commercial reprints, selling or licensing copies or access, or posting on open internet sites, your personal or institution’s website or repository, are prohibited. For exceptions, permission may be sought for such use through Elsevier's permissions site at: http://www.elsevier.com/locate/permissionusematerial From: ESTELA JACINTO, AGC Kinases in mTOR Signaling, In Mike Hall and Fuyuhiko Tamanoi: The Enzymes, Vol. 27, Burlington: Academic Press, 2010, pp.101-128. ISBN: 978-0-12-381539-2, © Copyright 2010 Elsevier Inc, Academic Press. Author's personal copy 7 AGC Kinases in mTOR Signaling ESTELA JACINTO Department of Physiology and Biophysics UMDNJ-Robert Wood Johnson Medical School, Piscataway New Jersey, USA I. Abstract The mammalian target of rapamycin (mTOR), a protein kinase with homology to lipid kinases, orchestrates cellular responses to growth and stress signals. Various extracellular and intracellular inputs to mTOR are known. mTOR processes these inputs as part of two mTOR protein com- plexes, mTORC1 or mTORC2. Surprisingly, despite the many cellular functions that are linked to mTOR, there are very few direct mTOR substrates identified to date.
    [Show full text]
  • Genome-Wide Association Study to Identify Genomic Regions And
    www.nature.com/scientificreports OPEN Genome‑wide association study to identify genomic regions and positional candidate genes associated with male fertility in beef cattle H. Sweett1, P. A. S. Fonseca1, A. Suárez‑Vega1, A. Livernois1,2, F. Miglior1 & A. Cánovas1* Fertility plays a key role in the success of calf production, but there is evidence that reproductive efciency in beef cattle has decreased during the past half‑century worldwide. Therefore, identifying animals with superior fertility could signifcantly impact cow‑calf production efciency. The objective of this research was to identify candidate regions afecting bull fertility in beef cattle and positional candidate genes annotated within these regions. A GWAS using a weighted single‑step genomic BLUP approach was performed on 265 crossbred beef bulls to identify markers associated with scrotal circumference (SC) and sperm motility (SM). Eight windows containing 32 positional candidate genes and fve windows containing 28 positional candidate genes explained more than 1% of the genetic variance for SC and SM, respectively. These windows were selected to perform gene annotation, QTL enrichment, and functional analyses. Functional candidate gene prioritization analysis revealed 14 prioritized candidate genes for SC of which MAP3K1 and VIP were previously found to play roles in male fertility. A diferent set of 14 prioritized genes were identifed for SM and fve were previously identifed as regulators of male fertility (SOD2, TCP1, PACRG, SPEF2, PRLR). Signifcant enrichment results were identifed for fertility and body conformation QTLs within the candidate windows. Gene ontology enrichment analysis including biological processes, molecular functions, and cellular components revealed signifcant GO terms associated with male fertility.
    [Show full text]
  • Phosphatidylinositol-3-Kinase Related Kinases (Pikks) in Radiation-Induced Dna Damage
    Mil. Med. Sci. Lett. (Voj. Zdrav. Listy) 2012, vol. 81(4), p. 177-187 ISSN 0372-7025 DOI: 10.31482/mmsl.2012.025 REVIEW ARTICLE PHOSPHATIDYLINOSITOL-3-KINASE RELATED KINASES (PIKKS) IN RADIATION-INDUCED DNA DAMAGE Ales Tichy 1, Kamila Durisova 1, Eva Novotna 1, Lenka Zarybnicka 1, Jirina Vavrova 1, Jaroslav Pejchal 2, Zuzana Sinkorova 1 1 Department of Radiobiology, Faculty of Health Sciences in Hradec Králové, University of Defence in Brno, Czech Republic 2 Centrum of Advanced Studies, Faculty of Health Sciences in Hradec Králové, University of Defence in Brno, Czech Republic. Received 5 th September 2012. Revised 27 th November 2012. Published 7 th December 2012. Summary This review describes a drug target for cancer therapy, family of phosphatidylinositol-3 kinase related kinases (PIKKs), and it gives a comprehensive review of recent information. Besides general information about phosphatidylinositol-3 kinase superfamily, it characterizes a DNA-damage response pathway since it is monitored by PIKKs. Key words: PIKKs; ATM; ATR; DNA-PK; Ionising radiation; DNA-repair ABBREVIATIONS therapy and radiation play a pivotal role. Since cancer is one of the leading causes of death worldwide, it is DSB - double stand breaks, reasonable to invest time and resources in the enligh - IR - ionising radiation, tening of mechanisms, which underlie radio-resis - p53 - TP53 tumour suppressors, tance. PI - phosphatidylinositol. The aim of this review is to describe the family INTRODUCTION of phosphatidyinositol 3-kinases (PI3K) and its func - tional subgroup - phosphatidylinositol-3-kinase rela - An efficient cancer treatment means to restore ted kinases (PIKKs) and their relation to repairing of controlled tissue growth via interfering with cell sig - radiation-induced DNA damage.
    [Show full text]
  • Kinase Profiling Book
    Custom and Pre-Selected Kinase Prof iling to f it your Budget and Needs! As of July 1, 2021 19.8653 mm 128 196 12 Tyrosine Serine/Threonine Lipid Kinases Kinases Kinases Carna Biosciences, Inc. 2007 Carna Biosciences, Inc. Profiling Assays available from Carna Biosciences, Inc. As of July 1, 2021 Page Kinase Name Assay Platform Page Kinase Name Assay Platform 4 ABL(ABL1) MSA 21 EGFR[T790M/C797S/L858R] MSA 4 ABL(ABL1)[E255K] MSA 21 EGFR[T790M/L858R] MSA 4 ABL(ABL1)[T315I] MSA 21 EPHA1 MSA 4 ACK(TNK2) MSA 21 EPHA2 MSA 4 AKT1 MSA 21 EPHA3 MSA 5 AKT2 MSA 22 EPHA4 MSA 5 AKT3 MSA 22 EPHA5 MSA 5 ALK MSA 22 EPHA6 MSA 5 ALK[C1156Y] MSA 22 EPHA7 MSA 5 ALK[F1174L] MSA 22 EPHA8 MSA 6 ALK[G1202R] MSA 23 EPHB1 MSA 6 ALK[G1269A] MSA 23 EPHB2 MSA 6 ALK[L1196M] MSA 23 EPHB3 MSA 6 ALK[R1275Q] MSA 23 EPHB4 MSA 6 ALK[T1151_L1152insT] MSA 23 Erk1(MAPK3) MSA 7 EML4-ALK MSA 24 Erk2(MAPK1) MSA 7 NPM1-ALK MSA 24 Erk5(MAPK7) MSA 7 AMPKα1/β1/γ1(PRKAA1/B1/G1) MSA 24 FAK(PTK2) MSA 7 AMPKα2/β1/γ1(PRKAA2/B1/G1) MSA 24 FER MSA 7 ARG(ABL2) MSA 24 FES MSA 8 AurA(AURKA) MSA 25 FGFR1 MSA 8 AurA(AURKA)/TPX2 MSA 25 FGFR1[V561M] MSA 8 AurB(AURKB)/INCENP MSA 25 FGFR2 MSA 8 AurC(AURKC) MSA 25 FGFR2[V564I] MSA 8 AXL MSA 25 FGFR3 MSA 9 BLK MSA 26 FGFR3[K650E] MSA 9 BMX MSA 26 FGFR3[K650M] MSA 9 BRK(PTK6) MSA 26 FGFR3[V555L] MSA 9 BRSK1 MSA 26 FGFR3[V555M] MSA 9 BRSK2 MSA 26 FGFR4 MSA 10 BTK MSA 27 FGFR4[N535K] MSA 10 BTK[C481S] MSA 27 FGFR4[V550E] MSA 10 BUB1/BUB3 MSA 27 FGFR4[V550L] MSA 10 CaMK1α(CAMK1) MSA 27 FGR MSA 10 CaMK1δ(CAMK1D) MSA 27 FLT1 MSA 11 CaMK2α(CAMK2A) MSA 28
    [Show full text]
  • Modulation of NF-Κb Signalling by Microbial Pathogens
    REVIEWS Modulation of NF‑κB signalling by microbial pathogens Masmudur M. Rahman and Grant McFadden Abstract | The nuclear factor-κB (NF‑κB) family of transcription factors plays a central part in the host response to infection by microbial pathogens, by orchestrating the innate and acquired host immune responses. The NF‑κB proteins are activated by diverse signalling pathways that originate from many different cellular receptors and sensors. Many successful pathogens have acquired sophisticated mechanisms to regulate the NF‑κB signalling pathways by deploying subversive proteins or hijacking the host signalling molecules. Here, we describe the mechanisms by which viruses and bacteria micromanage the host NF‑κB signalling circuitry to favour the continued survival of the pathogen. The nuclear factor-κB (NF-κB) family of transcription Signalling targets upstream of NF‑κB factors regulates the expression of hundreds of genes that NF-κB proteins are tightly regulated in both the cyto- are associated with diverse cellular processes, such as pro- plasm and the nucleus6. Under normal physiological liferation, differentiation and death, as well as innate and conditions, NF‑κB complexes remain inactive in the adaptive immune responses. The mammalian NF‑κB cytoplasm through a direct interaction with proteins proteins are members of the Rel domain-containing pro- of the inhibitor of NF-κB (IκB) family, including IκBα, tein family: RELA (also known as p65), RELB, c‑REL, IκBβ and IκBε (also known as NF-κBIα, NF-κBIβ and the NF-κB p105 subunit (also known as NF‑κB1; which NF-κBIε, respectively); IκB proteins mask the nuclear is cleaved into the p50 subunit) and the NF-κB p100 localization domains in the NF‑κB complex, thus subunit (also known as NF‑κB2; which is cleaved into retaining the transcription complex in the cytoplasm.
    [Show full text]
  • Comparing Signaling Networks Between Normal and Transformed Hepatocytes Using Discrete Logical Models
    Published OnlineFirst July 8, 2011; DOI: 10.1158/0008-5472.CAN-10-4453 Cancer Integrated Systems and Technologies: Mathematical Oncology Research Comparing Signaling Networks between Normal and Transformed Hepatocytes Using Discrete Logical Models Julio Saez-Rodriguez1,2, Leonidas G. Alexopoulos1,2, MingSheng Zhang1, Melody K. Morris2, Douglas A. Lauffenburger2, and Peter K. Sorger1,2 Abstract Substantial effort in recent years has been devoted to constructing and analyzing large-scale gene and protein networks on the basis of "omic" data and literature mining. These interaction graphs provide valuable insight into the topologies of complex biological networks but are rarely context specific and cannot be used to predict the responses of cell signaling proteins to specific ligands or drugs. Conversely, traditional approaches to analyzing cell signaling are narrow in scope and cannot easily make use of network-level data. Here, we combine network analysis and functional experimentation by using a hybrid approach in which graphs are converted into simple mathematical models that can be trained against biochemical data. Specifically, we created Boolean logic models of immediate-early signaling in liver cells by training a literature-based prior knowledge network against biochemical data obtained from primary human hepatocytes and 4 hepatocellular carcinoma cell lines exposed to combinations of cytokines and small-molecule kinase inhibitors. Distinct families of models were recovered for each cell type, and these families clustered topologically into normal and diseased sets. Cancer Res; 71(16); 5400–11. Ó2011 AACR. Introduction Major Findings The availability of high-throughput interaction data has led Clustering arises from systematic differences in signaling to the creation of methods for summarizing and exploring logic in three regions of the network.
    [Show full text]
  • Diverse Mechanisms Activate the PI 3-Kinase/Mtor Pathway In
    Tran et al. BMC Cancer (2021) 21:136 https://doi.org/10.1186/s12885-021-07826-4 RESEARCH ARTICLE Open Access Diverse mechanisms activate the PI 3- kinase/mTOR pathway in melanomas: implications for the use of PI 3-kinase inhibitors to overcome resistance to inhibitors of BRAF and MEK Khanh B. Tran1,2,3, Sharada Kolekar1, Anower Jabed2, Patrick Jaynes2, Jen-Hsing Shih2, Qian Wang2, Jack U. Flanagan1,3, Gordon W. Rewcastle1,3, Bruce C. Baguley1,3 and Peter R. Shepherd1,2,3* Abstract Background: The PI 3-kinase (PI3K) pathway has been implicated as a target for melanoma therapy. Methods: Given the high degree of genetic heterogeneity in melanoma, we sought to understand the breadth of variation in PI3K signalling in the large NZM panel of early passage cell lines developed from metastatic melanomas. Results: We find the vast majority of lines show upregulation of this pathway, and this upregulation is achieved by a wide range of mechanisms. Expression of all class-IA PI3K isoforms was readily detected in these cell lines. A range of genetic changes in different components of the PI3K pathway was seen in different lines. Coding variants or amplification were identified in the PIK3CA gene, and amplification of the PK3CG gene was common. Deletions in the PIK3R1 and PIK3R2 regulatory subunits were also relatively common. Notably, no genetic variants were seen in the PIK3CD gene despite p110δ being expressed in many of the lines. Genetic variants were detected in a number of genes that encode phosphatases regulating the PI3K signalling, with reductions in copy number common in PTEN, INPP4B, INPP5J, PHLLP1 and PHLLP2 genes.
    [Show full text]
  • Role of Cyclin-Dependent Kinase 1 in Translational Regulation in the M-Phase
    cells Review Role of Cyclin-Dependent Kinase 1 in Translational Regulation in the M-Phase Jaroslav Kalous *, Denisa Jansová and Andrej Šušor Institute of Animal Physiology and Genetics, Academy of Sciences of the Czech Republic, Rumburska 89, 27721 Libechov, Czech Republic; [email protected] (D.J.); [email protected] (A.Š.) * Correspondence: [email protected] Received: 28 April 2020; Accepted: 24 June 2020; Published: 27 June 2020 Abstract: Cyclin dependent kinase 1 (CDK1) has been primarily identified as a key cell cycle regulator in both mitosis and meiosis. Recently, an extramitotic function of CDK1 emerged when evidence was found that CDK1 is involved in many cellular events that are essential for cell proliferation and survival. In this review we summarize the involvement of CDK1 in the initiation and elongation steps of protein synthesis in the cell. During its activation, CDK1 influences the initiation of protein synthesis, promotes the activity of specific translational initiation factors and affects the functioning of a subset of elongation factors. Our review provides insights into gene expression regulation during the transcriptionally silent M-phase and describes quantitative and qualitative translational changes based on the extramitotic role of the cell cycle master regulator CDK1 to optimize temporal synthesis of proteins to sustain the division-related processes: mitosis and cytokinesis. Keywords: CDK1; 4E-BP1; mTOR; mRNA; translation; M-phase 1. Introduction 1.1. Cyclin Dependent Kinase 1 (CDK1) Is a Subunit of the M Phase-Promoting Factor (MPF) CDK1, a serine/threonine kinase, is a catalytic subunit of the M phase-promoting factor (MPF) complex which is essential for cell cycle control during the G1-S and G2-M phase transitions of eukaryotic cells.
    [Show full text]
  • Role of Ataxia-Telangiectasia Mutated Kinase in Cardiac Autophagy and Glucose Metabolism Under Ischemic Conditions Patsy Thrasher East Tennessee State University
    East Tennessee State University Digital Commons @ East Tennessee State University Electronic Theses and Dissertations Student Works 8-2018 Role of Ataxia-Telangiectasia Mutated Kinase in Cardiac Autophagy and Glucose Metabolism Under Ischemic Conditions Patsy Thrasher East Tennessee State University Follow this and additional works at: https://dc.etsu.edu/etd Part of the Biology Commons, and the Physiology Commons Recommended Citation Thrasher, Patsy, "Role of Ataxia-Telangiectasia Mutated Kinase in Cardiac Autophagy and Glucose Metabolism Under Ischemic Conditions" (2018). Electronic Theses and Dissertations. Paper 3442. https://dc.etsu.edu/etd/3442 This Dissertation - Open Access is brought to you for free and open access by the Student Works at Digital Commons @ East Tennessee State University. It has been accepted for inclusion in Electronic Theses and Dissertations by an authorized administrator of Digital Commons @ East Tennessee State University. For more information, please contact [email protected]. Role of Ataxia-Telangiectasia Mutated Kinase in Cardiac Autophagy and Glucose Metabolism Under Ischemic Conditions ____________________________________ A dissertation presented to the faculty of the Department of Biomedical Sciences East Tennessee State University In partial fulfillment of the requirements for the degree Doctor of Philosophy in Biomedical Sciences __________________________________ by Patsy R. Thrasher August 2018 _________________________________ Krishna Singh, Ph.D., Chair Mahipal Singh, Ph.D. Chuanfu Li, M.D. Tom Ecay, Ph.D. Yue Zou, Ph.D. Douglas Thewke, Ph.D. Keywords: ATM, myocardial infarction, autophagy, ischemia, glucose, metabolism ABSTRACT Role of Ataxia-Telangiectasia Mutated Kinase in Cardiac Autophagy and Glucose Metabolism Under Ischemic Conditions by Patsy R. Thrasher Ataxia-telangiectasia mutated kinase (ATM), a serine/threonine kinase primarily located in the nucleus, is typically activated in response to DNA damage.
    [Show full text]
  • Characterization of the Small Molecule Kinase Inhibitor SU11248 (Sunitinib/ SUTENT in Vitro and in Vivo
    TECHNISCHE UNIVERSITÄT MÜNCHEN Lehrstuhl für Genetik Characterization of the Small Molecule Kinase Inhibitor SU11248 (Sunitinib/ SUTENT in vitro and in vivo - Towards Response Prediction in Cancer Therapy with Kinase Inhibitors Michaela Bairlein Vollständiger Abdruck der von der Fakultät Wissenschaftszentrum Weihenstephan für Ernährung, Landnutzung und Umwelt der Technischen Universität München zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften genehmigten Dissertation. Vorsitzender: Univ. -Prof. Dr. K. Schneitz Prüfer der Dissertation: 1. Univ.-Prof. Dr. A. Gierl 2. Hon.-Prof. Dr. h.c. A. Ullrich (Eberhard-Karls-Universität Tübingen) 3. Univ.-Prof. A. Schnieke, Ph.D. Die Dissertation wurde am 07.01.2010 bei der Technischen Universität München eingereicht und durch die Fakultät Wissenschaftszentrum Weihenstephan für Ernährung, Landnutzung und Umwelt am 19.04.2010 angenommen. FOR MY PARENTS 1 Contents 2 Summary ................................................................................................................................................................... 5 3 Zusammenfassung .................................................................................................................................................... 6 4 Introduction .............................................................................................................................................................. 8 4.1 Cancer ..............................................................................................................................................................
    [Show full text]