DOCSLIB.ORG

Androgen Receptor

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Androgen Receptor RALTITREXED Dihydrofolate reductase BORTEZOMIB IsocitrateCannabinoid dehydrogenase CB1EPIRUBICIN receptor HYDROCHLORIDE [NADP] cytoplasmic VINCRISTINE SULFATE Hypoxia-inducible factor 1 alpha DOXORUBICINAtaxin-2 HYDROCHLORIDENIFENAZONEFOLIC ACID PYRIMETHAMINECellular tumor antigen p53 Muscleblind-likeThyroidVINBURNINEVINBLASTINETRIFLURIDINE protein stimulating 1 DEQUALINIUM SULFATEhormone receptor CHLORIDE Menin/Histone-lysine N-methyltransferasePHENELZINE MLLLANATOSIDE SULFATE C MELATONINDAUNORUBICINBETAMETHASONEGlucagon-like HYDROCHLORIDEEndonuclease peptide 4 1 receptor NICLOSAMIDEDIGITOXINIRINOTECAN HYDROCHLORIDE HYDRATE BISACODYL METHOTREXATEPaired boxAZITHROMYCIN protein Pax-8 ATPase family AAA domain-containing proteinLIPOIC 5 ACID, ALPHA Nuclear receptorCLADRIBINEDIGOXIN ROR-gammaTRIAMTERENE CARMUSTINEEndoplasmic reticulum-associatedFLUOROURACIL amyloid beta-peptide-binding protein OXYPHENBUTAZONEORLISTAT IDARUBICIN HYDROCHLORIDE 6-phospho-1-fructokinaseHeat shockSIMVASTATIN protein beta-1 TOPOTECAN HYDROCHLORIDE AZACITIDINEBloom syndromeNITAZOXANIDE protein Huntingtin Human immunodeficiency virus typeTIPRANAVIR 1 protease VitaminCOLCHICINE D receptorVITAMIN E FLOXURIDINE TAR DNA-binding protein 43 BROMOCRIPTINE MESYLATEPACLITAXEL CARFILZOMIBAnthrax lethalFlap factorendonucleasePrelamin-A/C 1 CYTARABINE Vasopressin V2 receptor AMITRIPTYLINEMicrotubule-associated HYDROCHLORIDERetinoidTRIMETHOPRIM proteinMothers X receptor tau against alpha decapentaplegic homolog 3 Histone-lysine N-methyltransferase-PODOFILOX H3 lysine-9OXYQUINOLINE specific 3 Vasopressin V1a receptor VINPOCETINE Nuclear factor erythroid 2-relatedTubulin factor 2 CytochromeDRONABINOL P450 51 NORTRIPTYLINE HYDROCHLORIDEDACTINOMYCINMYCOPHENOLICDESLANOSIDE ACID DIPHENHYDRAMINENeuropeptide HYDROCHLORIDE METHYLENES receptor BLUE CHLORIDE HYDRATE RIMONABANT Geminin INDOPROFENStreptokinase A Solute carrier organic anionThyroid transporterhormone receptor beta-1 family memberTANESPIMYCIN 1B1 LOPINAVIR Alpha-synuclein Aldehyde dehydrogenase 1A1 Solute carrierAMSACRINEPROMETHAZINE organicITRACONAZOLE anionPeroxisome HYDROCHLORIDE transporterNuclear proliferator-activatedDEXAMETHASONE factor familyTHIRAM NF-kappa-B memberTHIOGUANINE receptor 1B3p105gamma subunit SPIRONOLACTONEMITOXANTRONE MEBENDAZOLEDIHYDROCHLORIDE Proto-oncogeneGlucocorticoid c-JUN receptor SORAFENIB TOSYLATE NORDIHYDROGUAIARETICLIOTHYRONINE ACIDMEGESTROL ACETATE Acetylcholinesterase Bile acidDNA-(apurinicTHIOTEPA receptor FXRor apyrimidinicBENZBROMARONE site) lyase SAQUINAVIRCytochrome P450 1A2 FELODIPINE PIPERINE PARAOXON ThrombopoietinUbiquitin carboxyl-terminal hydrolase 1 RITONAVIRNuclear receptor subfamily Regulator1 group I memberof G-protein 2 signaling 4 LORATADINE PeroxisomeThioredoxin reductase proliferator-activated 1- cytoplasmicDIPYRIDAMOLEATOVAQUONE receptor delta MultidrugEFAVIRENZ resistance-associatedLOVASTATIN protein 1 RIFAMPICINAndrogenTAZOBACTAM Receptor SODIUM DISULFIRAMHeat shockBUTOCONAZOLETAMOXIFEN protein HSP CITRATE Chromobox90-alpha NITRATE Luciferin protein homolog 4-monooxygenase 1 ALPROSTADIL Cytochrome P450 2C9 Interleukin-8 QUIZARTINIB Neurokinin 2 receptor Estrogen receptorDICUMAROL alpha DNA polymerase kappa Solute carrier organic anion IMIPRAMINEtransporterPregnane family HYDROCHLORIDE X receptor member 2B1 HYDROQUINONERETINOL DACTOLISIB IVERMECTIN Cerebroside-sulfataseCytochromeMIFEPRISTONE P450 19A1 FORETINIB Muscarinic acetylcholineTOLTERODINE receptor M1 RESERPINE TESTOSTERONE CLOTRIMAZOLEMelanocortinSolute carrier receptor family 4 22 memberCytochrome 1 P450 2C8OLEIC ACID DINOPROSTONE Kappa opioid receptor Cytochrome P450CytochromeBile 2C19 saltTIBOLONE export P450 2B6pump Cytochrome P450P-glycoprotein 2D6 3 MEDROXYPROGESTERONEAldose MineralocorticoidreductasePeripheral receptor myelin ACETATE protein 22 StemNILOTINIB cell growth factor receptor SCOPOLAMINE AdenosineIndoleamine A1 receptor 2-3-dioxygenase 2 INDOCYANINE GREEN SODIUM KETOCONAZOLE ERYTHROMYCINProgesterone FULVESTRANTreceptor ETHACRYNIC ACID TACROLIMUS Serine/threonine-protein kinase PLK1 ALK tyrosine kinase receptorTyrosine-proteinTANDUTINIB kinase receptor FLT3 ATROPINE GENTIANThromboxane-A VIOLET synthase Tyrosine-proteinNT-3 Platelet-derivedgrowth kinase factor JAK3 receptor growth factor receptor alpha BERBERINEDOMPERIDONE CHLORIDE Cytochrome P450 3A4M-phase phosphoprotein 8 GATIFLOXACIN LINIFANIB P-glycoproteinLACIDIPINE 1 Multidrug resistance-associated protein 4 Serine/threonine-protein kinase mTOR Dual specificityNINTEDANIB mitogen-activatedAdaptor-associated protein kinase kinase kinase 2 Serotonin 4 (5-HT4) receptorGANAXOLONE CARMOFUR Tyrosine-protein kinaseMacrophage ABL colony stimulating factor receptor TROPISETRON FLUSPIRILENENISOLDIPINE VALPROIC ACID Cyclin-dependent kinase 7NERATINIBAXITINIB BUPRENORPHINE LEFLUNOMIDE Serine/threonine-proteinVascular endothelialSerine/threonine-proteinNeurotrophic growth kinase factor Aurora-A tyrosine receptorTyrosine-protein kinase kinase 2 Aurora-B receptor kinase type ITK/TSK2 Muscarinic acetylcholineDopamine receptor M3 D1MICONAZOLE receptor HERG MultidrugNIFEDIPINETROGLITAZONE resistance-associatedCYCLOSPORINE protein 7 Hepatocyte growth Cellfactor ALVOCIDIBdivision receptorPlatelet-derived protein kinase growthBMP-2-inducible 8 factor receptor protein beta kinase Muscarinic acetylcholine receptor M2 CanalicularNILUTAMIDE multispecific PROGESTERONEorganic anion transporter 1 Dual specificity mitogen-activatedMitogen-activatedTyrosine-protein protein protein kinase kinase kinase kinase TIE-2kinase 1 kinase kinase 5 ENOXOLONE Ribosomal protein S6Tyrosine kinaseSerine/threonine-protein 1 kinase Mitogen-activatednon-receptor protein kinase protein 2 PLK4 kinase kinase kinase 4 AdenosinePIMOZIDE A3 receptor Serine/threonine-protein kinase AKT NerveDual growth specificty factor proteinEphrin receptorSerine/threonine-protein kinasetype-A Trk-A CLK1receptorSPS1/STE20-relatedTyrosine-protein 4 kinase 16 kinase protein TYK2 kinase YSK4 Muscarinic acetylcholine receptor M5 Mu opioid receptorDANAZOL ETHINYL TELMISARTANESTRADIOL Estrogen receptor Serine/threonine-proteinMixedTyrosine-protein lineageEphrin kinase type-A kinase7 kinase receptor YES MST2 5 Muscarinic acetylcholine receptorPAROXETINE M4 DIFLUNISAL Mitogen-activatedFibroblast growth Tyrosine-protein proteinfactorTubulinTRAF2- receptor kinase alpha-1Ephrin andkinase 1 type-Achain kinase NCK-interacting kinase receptor receptorEphrin kinase 8 type-B RET kinase 2 receptor 6 AMOXAPINE Voltage-gated L-type calciumDelta opioidchannel receptor alpha-1CCytochrome subunitSolute P450 carrier 2J2 familyNIFLUMIC 22 member ACID 2 MILRINONE Discoidin domain-containingTyrosine-protein receptor 2 kinase ABL2 PIZOTYLINE Arachidonate 15-lipoxygenase ADAPALENEPREDNISOLONE Tyrosine-protein kinaseLeucine-rich SRCTyrosine-proteinDualReceptor repeat specificityHomeodomain-interactingTyrosine-protein serine/threonine-protein kinaseprotein-tyrosine mitogen-activated FGR kinase kinase proteinBLK erbB-4kinase protein kinase 2 kinase 4 kinase 5 Dopamine D4 receptor ESTRADIOLTRICLOSAN GAMOLENIC ACID Serine/threonine-proteinSerine/threonine-proteinTyrosine-protein kinaseEpithelial SRPK1kinaseMitogen-activated kinase discoidin ReceptorMST1 receptor domain-containing tyrosine-protein UFO protein kinase kinasereceptor erbB-3kinase 1 12 OLANZAPINESerotonin 3 (5-HT3)DIETHYLSTILBESTROL receptor CIMETIDINE Tyrosine-proteinMaternal embryonic kinase LCK leucine zipper kinaseSerine/threonine-proteinEphrin kinase type-B PCTAIRE-1 receptor 2 DopamineOXYBUTYNIN D2 receptor TERBINAFINE CaM-kinaseFibroblastTyrosine-protein growth kinaseSerine/threonine-protein factorbetaTyrosine-protein receptor kinase 2CTK kinase kinaseMisshapen-like Srms 2 kinase 1 Muscarinic acetylcholineEBASTINE receptorSerotonin 3a (5-HT3a) receptor Testis-specificZAFIRLUKAST androgen-bindingFENRETINIDE protein Dual specificityEphrin proteinc-Jun type-A kinaseN-terminal receptorTyrosine-protein CLK4 kinase3 Serine/threonine-protein3 Mitogen-activatedkinase CSKSerine/threonine-protein protein kinase kinase pknB kinasekinase SIK1kinase 2 c-Jun N-terminalLIM domain kinase kinase 1 1 NUAKMitogen-activated Caseinfamily SNF1-like kinase II alpha proteinkinase (prime) kinase2 kinase kinase kinase 3 HistamineDopamine H1 receptor D3 FLUOXETINEreceptorDopamineBeta-1 adrenergicTERFENADINE transporterMultidrug receptorAURANOFIN and toxin extrusion protein 1 Proto-oncogene Tyrosine-proteintyrosine-proteinEphrinMitogen-activated type-A kinase kinase receptor ROS Lyn Mitogen-activated protein2 kinase kinase protein kinase kinase 11 kinase kinase kinase 1 ZOTEPINEDESLORATADINEBOPINDOLOLCHLORPROMAZINE Estrogen receptor beta TRETINOIN Interferon-induced-Serine/threonine-protein double-stranded kinase RNA-activated 17B protein kinase DOXORUBICIN Receptor protein-tyrosine kinase erbB-2 ProteinPhosphatidylinositol-4-phosphate kinaseMitogen-activated N2EukaryoticMyotonin-protein protein translation kinase 5-kinase initiation kinase type-1 factorkinase alpha 2-alpha 15 kinase 1 ASTEMIZOLE Monoamine oxidase A INDOMETHACIN Epidermal growth factor receptor erbB1 MAP kinase p38 alpha AFATINIB ChaperoneSerine/threonine-protein activity of bc1 kinase complex-like- PCTAIRE-3 mitochondrial TERCONAZOLESerotoninCLEMASTINE 1b BROMOCRIPTINE(5-HT1b) receptor VERAPAMIL Transthyretin MyosinReceptor-interacting lightCasein chain kinase-kinase serine/threonine-protein I smoothepsilon muscle kinase 4 NAFTOPIDILDopamine receptor ATP-binding cassette sub-family G member 2 MAP kinase ERK2 Homeodomain-interactingSerine/threonine-protein
Load more

Recommended publications
  • Deregulated Gene Expression Pathways in Myelodysplastic Syndrome Hematopoietic Stem Cells
    Leukemia (2010) 24, 756–764 & 2010 Macmillan Publishers Limited All rights reserved 0887-6924/10 $32.00 www.nature.com/leu ORIGINAL ARTICLE Deregulated gene expression pathways in myelodysplastic syndrome hematopoietic stem cells A Pellagatti1, M Cazzola2, A Giagounidis3, J Perry1, L Malcovati2, MG Della Porta2,MJa¨dersten4, S Killick5, A Verma6, CJ Norbury7, E Hellstro¨m-Lindberg4, JS Wainscoat1 and J Boultwood1 1LRF Molecular Haematology Unit, NDCLS, John Radcliffe Hospital, Oxford, UK; 2Department of Hematology Oncology, University of Pavia Medical School, Fondazione IRCCS Policlinico San Matteo, Pavia, Italy; 3Medizinische Klinik II, St Johannes Hospital, Duisburg, Germany; 4Division of Hematology, Department of Medicine, Karolinska Institutet, Stockholm, Sweden; 5Department of Haematology, Royal Bournemouth Hospital, Bournemouth, UK; 6Albert Einstein College of Medicine, Bronx, NY, USA and 7Sir William Dunn School of Pathology, University of Oxford, Oxford, UK To gain insight into the molecular pathogenesis of the the World Health Organization.6,7 Patients with refractory myelodysplastic syndromes (MDS), we performed global gene anemia (RA) with or without ringed sideroblasts, according to expression profiling and pathway analysis on the hemato- poietic stem cells (HSC) of 183 MDS patients as compared with the the French–American–British classification, were subdivided HSC of 17 healthy controls. The most significantly deregulated based on the presence or absence of multilineage dysplasia. In pathways in MDS include interferon signaling, thrombopoietin addition, patients with RA with excess blasts (RAEB) were signaling and the Wnt pathways. Among the most signifi- subdivided into two categories, RAEB1 and RAEB2, based on the cantly deregulated gene pathways in early MDS are immuno- percentage of bone marrow blasts.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Overexpression of DCLK1-AL Increases Tumor Cell Invasion, Drug Resistance, and KRAS Activation and Can Be Targeted to Inhibit Tumorigenesis in Pancreatic Cancer
    Hindawi Journal of Oncology Volume 2019, Article ID 6402925, 11 pages https://doi.org/10.1155/2019/6402925 Research Article Overexpression of DCLK1-AL Increases Tumor Cell Invasion, Drug Resistance, and KRAS Activation and Can Be Targeted to Inhibit Tumorigenesis in Pancreatic Cancer Dongfeng Qu ,1,2,3 Nathaniel Weygant,1 Jiannan Yao ,4 Parthasarathy Chandrakesan,1,2,3 William L. Berry,5 Randal May ,1,2 Kamille Pitts,1 Sanam Husain,6 Stan Lightfoot,6 Min Li,1 Timothy C. Wang,7 Guangyu An ,4 Cynthia Clendenin,8 Ben Z. Stanger,8 and Courtney W. Houchen 1,2,3 Department of Medicine, University of Oklahoma Health Sciences Center, Oklahoma City, OK, USA Department of Veterans Affairs Medical Center, Oklahoma City, OK, USA Peggy and Charles Stephenson Cancer Center, Oklahoma City, OK, USA Department of Oncology, Beijing Chaoyang Hospital, Capital Medical University, Beijing, China Department of Cell Biology, University of Oklahoma Health Sciences Center, Oklahoma City, OK, USA Department of Pathology, University of Oklahoma Health Sciences Center, Oklahoma City, OK, USA Department of Digestive and Liver Diseases, Columbia University Medical Center, New York, NY, USA Department of Medicine, University of Pennsylvania Perelman School of Medicine, Philadelphia, PA, USA Correspondence should be addressed to Dongfeng Qu; [email protected] and Courtney W. Houchen; [email protected] Received 24 January 2019; Revised 10 May 2019; Accepted 27 May 2019; Published 5 August 2019 Academic Editor: Francesca De Felice Copyright © 2019 Dongfeng Qu et al. Tis is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
    [Show full text]
  • Selective Targeting of Cyclin E1-Amplified High-Grade Serous Ovarian Cancer by Cyclin-Dependent Kinase 2 and AKT Inhibition
    Published OnlineFirst September 23, 2016; DOI: 10.1158/1078-0432.CCR-16-0620 Biology of Human Tumors Clinical Cancer Research Selective Targeting of Cyclin E1-Amplified High-Grade Serous Ovarian Cancer by Cyclin- Dependent Kinase 2 and AKT Inhibition George Au-Yeung1,2, Franziska Lang1, Walid J. Azar1, Chris Mitchell1, Kate E. Jarman3, Kurt Lackovic3,4, Diar Aziz5, Carleen Cullinane1,6, Richard B. Pearson1,2,7, Linda Mileshkin2,8, Danny Rischin2,8, Alison M. Karst9, Ronny Drapkin10, Dariush Etemadmoghadam1,2,5, and David D.L. Bowtell1,2,7,11 Abstract Purpose: Cyclin E1 (CCNE1) amplification is associated with Results: We validate CDK2 as a therapeutic target by demon- primary treatment resistance and poor outcome in high-grade strating selective sensitivity to gene suppression. However, we found serous ovarian cancer (HGSC). Here, we explore approaches to that dinaciclib did not trigger amplicon-dependent sensitivity in a target CCNE1-amplified cancers and potential strategies to over- panel of HGSC cell lines. A high-throughput compound screen come resistance to targeted agents. identified synergistic combinations in CCNE1-amplified HGSC, Experimental Design: To examine dependency on CDK2 in including dinaciclib and AKT inhibitors. Analysis of genomic data CCNE1-amplified HGSC, we utilized siRNA and conditional from TCGA demonstrated coamplification of CCNE1 and AKT2. shRNA gene suppression, and chemical inhibition using dina- Overexpression of Cyclin E1 and AKT isoforms, in addition to ciclib, a small-molecule CDK2 inhibitor. High-throughput mutant TP53, imparted malignant characteristics in untransformed compound screening was used to identify selective synergistic fallopian tube secretory cells, the dominant site of origin of HGSC.
    [Show full text]
  • Hidden Targets in RAF Signalling Pathways to Block Oncogenic RAS Signalling
    G C A T T A C G G C A T genes Review Hidden Targets in RAF Signalling Pathways to Block Oncogenic RAS Signalling Aoife A. Nolan 1, Nourhan K. Aboud 1, Walter Kolch 1,2,* and David Matallanas 1,* 1 Systems Biology Ireland, School of Medicine, University College Dublin, Belfield, Dublin 4, Ireland; [email protected] (A.A.N.); [email protected] (N.K.A.) 2 Conway Institute of Biomolecular & Biomedical Research, University College Dublin, Belfield, Dublin 4, Ireland * Correspondence: [email protected] (W.K.); [email protected] (D.M.) Abstract: Oncogenic RAS (Rat sarcoma) mutations drive more than half of human cancers, and RAS inhibition is the holy grail of oncology. Thirty years of relentless efforts and harsh disappointments have taught us about the intricacies of oncogenic RAS signalling that allow us to now get a pharma- cological grip on this elusive protein. The inhibition of effector pathways, such as the RAF-MEK-ERK pathway, has largely proven disappointing. Thus far, most of these efforts were aimed at blocking the activation of ERK. Here, we discuss RAF-dependent pathways that are regulated through RAF functions independent of catalytic activity and their potential role as targets to block oncogenic RAS signalling. We focus on the now well documented roles of RAF kinase-independent functions in apoptosis, cell cycle progression and cell migration. Keywords: RAF kinase-independent; RAS; MST2; ASK; PLK; RHO-α; apoptosis; cell cycle; cancer therapy Citation: Nolan, A.A.; Aboud, N.K.; Kolch, W.; Matallanas, D. Hidden Targets in RAF Signalling Pathways to Block Oncogenic RAS Signalling.
    [Show full text]
  • Polo-Like Kinases Mediate Cell Survival in Mitochondrial Dysfunction
    Polo-like kinases mediate cell survival in mitochondrial dysfunction Takumi Matsumotoa,1, Ping-yuan Wanga,1, Wenzhe Maa, Ho Joong Sunga, Satoaki Matobab, and Paul M. Hwanga,2 aTranslational Medicine Branch, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD 20892; and bCardiovascular Medicine, Kyoto Prefectural University of Medicine, Kyoto 602-8566, Japan Edited by Solomon H. Snyder, Johns Hopkins University School of Medicine, Baltimore, MD, and approved July 10, 2009 (received for review April 16, 2009) Cancer cells often display defects in mitochondrial respiration, thus significant respiration (Fig. S1). For the described in vitro the identification of pathways that promote cell survival under this experiments, one representative SCO2-/- cell line was used. metabolic state may have therapeutic implications. Here, we report However, all significant findings were reproduced or confirmed that the targeted ablation of mitochondrial respiration markedly using at least one additional SCO2-/- cell line that was obtained increases expression of Polo-like kinase 2 (PLK2) and that it is by an independent homologous recombination event to rule out required for the in vitro growth of these nonrespiring cells. clonal variability. Furthermore, we identify PLK2 as a kinase that phosphorylates In an attempt to identify genes associated with the cell cycle Ser-137 of PLK1, which is sufficient to mediate this survival signal. that may enable the survival of SCO2-/- cells after disruption of In vivo, knockdown of PLK2 in an isogenic human cell line with a respiration, we compared microarray gene expression of respir- modest defect in mitochondrial respiration eliminates xenograft ing SCO2ϩ/ϩ and nonrespiring SCO2-/- HCT116 human colon formation, indicating that PLK2 activity is necessary for growth of cancer cells (Table S1).
    [Show full text]
  • 'Stress–Response' Kinase Pathways in Alzheimer's Disease Progression
    Available online at www.sciencedirect.com ScienceDirect Involvement of ‘stress–response’ kinase pathways in Alzheimer’s disease progression 1 Georges Mairet-Coello and Franck Polleux Alzheimer’s disease (AD) is the most prevalent cause of oligomers of Ab are causal to synaptic toxicity [2], trigger dementia, affecting more than 25 million people worldwide. synaptic dysfunction, synapse loss and impaired long- Current models of the pathophysiological mechanisms of AD term potentiation (LTP) [3]. The exact nature of the suggest that the accumulation of soluble oligomeric forms of Ab species (dimers, trimers, Ab*56, protofibrils) respon- amyloid-b (Ab) peptides causes early loss of excitatory sible for this early synaptotoxicity is still under investi- synapses and impairs synaptic plasticity. The signaling gation [4]. Most experimental designs use a mixture of pathways mediating Ab oligomer-induced impairment of various forms of synthetic Ab oligomers, or natural Ab synaptic plasticity and loss of excitatory synapses are only oligomers isolated from the brain of AD subjects, to beginning to be unraveled. Here, we review recent evidence induce rapid loss of excitatory synapses in hippocampal supporting the critical contribution of conserved ‘stress– and cortical neurons in vitro [5–10]. Transgenic mouse response’ kinase pathways in AD progression. models of AD engineered to overexpress human mutant forms of Amyloid Precursor Protein (hAPP), with or with- Addresses out overexpression of mutant presenilins (PS), produce The Scripps Research Institute, Dorris Neuroscience Center, Department of Molecular and Cellular Neuroscience, La Jolla, CA 92037- high levels of Ab1–40 and Ab1–42 peptides and oligo- 1000, USA mers, recapitulate the reduction of excitatory synapses, exhibit neuronal network dysfunction and cognitive def- Corresponding author: Polleux, Franck ([email protected]) 1 icits in spatial learning [6,11].
    [Show full text]
  • AGC Kinases in Mtor Signaling, in Mike Hall and Fuyuhiko Tamanoi: the Enzymes, Vol
    Provided for non-commercial research and educational use only. Not for reproduction, distribution or commercial use. This chapter was originally published in the book, The Enzymes, Vol .27, published by Elsevier, and the attached copy is provided by Elsevier for the author's benefit and for the benefit of the author's institution, for non-commercial research and educational use including without limitation use in instruction at your institution, sending it to specific colleagues who know you, and providing a copy to your institution’s administrator. All other uses, reproduction and distribution, including without limitation commercial reprints, selling or licensing copies or access, or posting on open internet sites, your personal or institution’s website or repository, are prohibited. For exceptions, permission may be sought for such use through Elsevier's permissions site at: http://www.elsevier.com/locate/permissionusematerial From: ESTELA JACINTO, AGC Kinases in mTOR Signaling, In Mike Hall and Fuyuhiko Tamanoi: The Enzymes, Vol. 27, Burlington: Academic Press, 2010, pp.101-128. ISBN: 978-0-12-381539-2, © Copyright 2010 Elsevier Inc, Academic Press. Author's personal copy 7 AGC Kinases in mTOR Signaling ESTELA JACINTO Department of Physiology and Biophysics UMDNJ-Robert Wood Johnson Medical School, Piscataway New Jersey, USA I. Abstract The mammalian target of rapamycin (mTOR), a protein kinase with homology to lipid kinases, orchestrates cellular responses to growth and stress signals. Various extracellular and intracellular inputs to mTOR are known. mTOR processes these inputs as part of two mTOR protein com- plexes, mTORC1 or mTORC2. Surprisingly, despite the many cellular functions that are linked to mTOR, there are very few direct mTOR substrates identified to date.
    [Show full text]
  • Investigating the Role of Cdk11in Animal Cytokinesis
    Investigating the Role of CDK11 in Animal Cytokinesis by Thomas Clifford Panagiotou A thesis submitted in conformity with the requirements for the degree of Master of Science Department of Molecular Genetics University of Toronto © Copyright by Thomas Clifford Panagiotou (2020) Investigating the Role of CDK11 in Animal Cytokinesis Thomas Clifford Panagiotou Master of Science Department of Molecular Genetics University of Toronto 2020 Abstract Finely tuned spatio-temporal regulation of cell division is required for genome stability. Cytokinesis constitutes the final stages of cell division, from chromosome segregation to the physical separation of cells, abscission. Abscission is tightly regulated to ensure it occurs after earlier cytokinetic events, like the maturation of the stem body, the regulatory platform for abscission. Active Aurora B kinase enforces the abscission checkpoint, which blocks abscission until chromosomes have been cleared from the cytokinetic machinery. Currently, it is unclear how this checkpoint is overcome. Here, I demonstrate that the cyclin-dependent kinase CDK11 is required for cytokinesis. Both inhibition and depletion of CDK11 block abscission. Furthermore, the mitosis-specific CDK11p58 kinase localizes to the stem body, where its kinase activity rescues the defects of CDK11 depletion and inhibition. These results suggest a model whereby CDK11p58 antagonizes Aurora B kinase to overcome the abscission checkpoint to allow for successful completion of cytokinesis. ii Acknowledgments I am very grateful for the support of my family and friends throughout my studies. I would also like to express my deep gratitude to Wilde Lab members, both past and present, for their advice and collaboration. In particular, I am very grateful to Matthew Renshaw, whose work comprises part of this thesis.
    [Show full text]
  • Identifying Novel Actionable Targets in Colon Cancer
    biomedicines Review Identifying Novel Actionable Targets in Colon Cancer Maria Grazia Cerrito and Emanuela Grassilli * Department of Medicine and Surgery, University of Milano-Bicocca, Via Cadore 48, 20900 Monza, Italy; [email protected] * Correspondence: [email protected] Abstract: Colorectal cancer is the fourth cause of death from cancer worldwide, mainly due to the high incidence of drug-resistance toward classic chemotherapeutic and newly targeted drugs. In the last decade or so, the development of novel high-throughput approaches, both genome-wide and chemical, allowed the identification of novel actionable targets and the development of the relative specific inhibitors to be used either to re-sensitize drug-resistant tumors (in combination with chemotherapy) or to be synthetic lethal for tumors with specific oncogenic mutations. Finally, high- throughput screening using FDA-approved libraries of “known” drugs uncovered new therapeutic applications of drugs (used alone or in combination) that have been in the clinic for decades for treating non-cancerous diseases (re-positioning or re-purposing approach). Thus, several novel actionable targets have been identified and some of them are already being tested in clinical trials, indicating that high-throughput approaches, especially those involving drug re-positioning, may lead in a near future to significant improvement of the therapy for colon cancer patients, especially in the context of a personalized approach, i.e., in defined subgroups of patients whose tumors carry certain mutations. Keywords: colon cancer; drug resistance; target therapy; high-throughput screen; si/sh-RNA screen; CRISPR/Cas9 knockout screen; drug re-purposing; drug re-positioning Citation: Cerrito, M.G.; Grassilli, E.
    [Show full text]
  • Phosphatidylinositol-3-Kinase Related Kinases (Pikks) in Radiation-Induced Dna Damage
    Mil. Med. Sci. Lett. (Voj. Zdrav. Listy) 2012, vol. 81(4), p. 177-187 ISSN 0372-7025 DOI: 10.31482/mmsl.2012.025 REVIEW ARTICLE PHOSPHATIDYLINOSITOL-3-KINASE RELATED KINASES (PIKKS) IN RADIATION-INDUCED DNA DAMAGE Ales Tichy 1, Kamila Durisova 1, Eva Novotna 1, Lenka Zarybnicka 1, Jirina Vavrova 1, Jaroslav Pejchal 2, Zuzana Sinkorova 1 1 Department of Radiobiology, Faculty of Health Sciences in Hradec Králové, University of Defence in Brno, Czech Republic 2 Centrum of Advanced Studies, Faculty of Health Sciences in Hradec Králové, University of Defence in Brno, Czech Republic. Received 5 th September 2012. Revised 27 th November 2012. Published 7 th December 2012. Summary This review describes a drug target for cancer therapy, family of phosphatidylinositol-3 kinase related kinases (PIKKs), and it gives a comprehensive review of recent information. Besides general information about phosphatidylinositol-3 kinase superfamily, it characterizes a DNA-damage response pathway since it is monitored by PIKKs. Key words: PIKKs; ATM; ATR; DNA-PK; Ionising radiation; DNA-repair ABBREVIATIONS therapy and radiation play a pivotal role. Since cancer is one of the leading causes of death worldwide, it is DSB - double stand breaks, reasonable to invest time and resources in the enligh - IR - ionising radiation, tening of mechanisms, which underlie radio-resis - p53 - TP53 tumour suppressors, tance. PI - phosphatidylinositol. The aim of this review is to describe the family INTRODUCTION of phosphatidyinositol 3-kinases (PI3K) and its func - tional subgroup - phosphatidylinositol-3-kinase rela - An efficient cancer treatment means to restore ted kinases (PIKKs) and their relation to repairing of controlled tissue growth via interfering with cell sig - radiation-induced DNA damage.
    [Show full text]
  • Establishment and Genomic Characterization of a Sporadic Malignant Peripheral Nerve Sheath Tumor Cell Line Jody Fromm Longo1, Stephanie N
    www.nature.com/scientificreports OPEN Establishment and genomic characterization of a sporadic malignant peripheral nerve sheath tumor cell line Jody Fromm Longo1, Stephanie N. Brosius3,5,7, Iya Znoyko1, Victoria A. Alers1, Dorea P. Jenkins1, Robert C. Wilson1,2, Andrew J. Carroll4, Daynna J. Wolf1, Kevin A. Roth6 & Steven L. Carroll1,2,3* Malignant peripheral nerve sheath tumors (MPNSTs) are aggressive Schwann cell-derived neoplasms that occur sporadically or in patients with neurofbromatosis type 1 (NF1). Preclinical research on sporadic MPNSTs has been limited as few cell lines exist. We generated and characterized a new sporadic MPNST cell line, 2XSB, which shares the molecular and genomic features of the parent tumor. These cells have a highly complex karyotype with extensive chromothripsis. 2XSB cells show robust invasive 3-dimensional and clonogenic culture capability and form solid tumors when xenografted into immunodefcient mice. High-density single nucleotide polymorphism array and whole exome sequencing analyses indicate that, unlike NF1-associated MPNSTs, 2XSB cells have intact, functional NF1 alleles with no evidence of mutations in genes encoding components of Polycomb Repressor Complex 2. However, mutations in other genes implicated in MPNST pathogenesis were identifed in 2XSB cells including homozygous deletion of CDKN2A and mutations in TP53 and PTEN. We also identifed mutations in genes not previously associated with MPNSTs but associated with the pathogenesis of other human cancers. These include DNMT1, NUMA1, NTRK1, PDE11A, CSMD3, LRP5 and ACTL9. This sporadic MPNST-derived cell line provides a useful tool for investigating the biology and potential treatment regimens for sporadic MPNSTs. Malignant peripheral nerve sheath tumors (MPNSTs) are aggressive neoplasms derived from the Schwann cell lineage1,2.
    [Show full text]