DOCSLIB.ORG

Mithramycin Represses Basal and Cigarette Smoke–Induced Expression of ABCG2 and Inhibits Stem Cell Signaling in Lung and Esophageal Cancer Cells

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mithramycin Represses Basal and Cigarette Smoke–Induced Expression of ABCG2 and Inhibits Stem Cell Signaling in Lung and Esophageal Cancer Cells Cancer Therapeutics, Targets, and Chemical Biology Research Mithramycin Represses Basal and Cigarette Smoke–Induced Expression of ABCG2 and Inhibits Stem Cell Signaling in Lung and Esophageal Cancer Cells Mary Zhang1, Aarti Mathur1, Yuwei Zhang1, Sichuan Xi1, Scott Atay1, Julie A. Hong1, Nicole Datrice1, Trevor Upham1, Clinton D. Kemp1, R. Taylor Ripley1, Gordon Wiegand2, Itzak Avital2, Patricia Fetsch3, Haresh Mani6, Daniel Zlott4, Robert Robey5, Susan E. Bates5, Xinmin Li7, Mahadev Rao1, and David S. Schrump1 Abstract Cigarette smoking at diagnosis or during therapy correlates with poor outcome in patients with lung and esophageal cancers, yet the underlying mechanisms remain unknown. In this study, we observed that exposure of esophageal cancer cells to cigarette smoke condensate (CSC) led to upregulation of the xenobiotic pump ABCG2, which is expressed in cancer stem cells and confers treatment resistance in lung and esophageal carcinomas. Furthermore, CSC increased the side population of lung cancer cells containing cancer stem cells. Upregulation of ABCG2 coincided with increased occupancy of aryl hydrocarbon receptor, Sp1, and Nrf2 within the ABCG2 promoter, and deletion of xenobiotic response elements and/or Sp1 sites markedly attenuated ABCG2 induction. Under conditions potentially achievable in clinical settings, mithramycin diminished basal as well as CSC- mediated increases in AhR, Sp1, and Nrf2 levels within the ABCG2 promoter, markedly downregulated ABCG2, and inhibited proliferation and tumorigenicity of lung and esophageal cancer cells. Microarray analyses revealed that mithramycin targeted multiple stem cell–related pathways in vitro and in vivo. Collectively, our findings provide a potential mechanistic link between smoking status and outcome of patients with lung and esophageal cancers, and support clinical use of mithramycin for repressing ABCG2 and inhibiting stem cell signaling in thoracic malignancies. Cancer Res; 72(16); 4178–92. Ó2012 AACR. Introduction In addition to being a significant risk factor for major Lung and esophageal cancers are leading causes of cancer- morbidity and mortality in individuals undergoing potentially related deaths worldwide (1). In 2011, these malignancies curative resections (6, 7), cigarette smoking diminishes accounted for an estimated 1.8 million deaths globally; in responses to chemo- and radiation therapy, enhances systemic the United States, nearly 160,000 deaths were attributed to metastases, and decreases survival of patients with locally – lung cancer, whereas 15,000 deaths were due to esophageal advanced or disseminated lung and esophageal cancers (8 carcinoma (2). Presently, 80% of lung cancers and 50% of 11); the mechanisms underlying these phenomena have not esophageal carcinomas are directly attributable to cigarette been fully established. Previously, we reported that under smoke (3, 4). Currently, more than 1.3 billion people smoke; clinically relevant exposure conditions, cigarette smoke hence, the global burden of tobacco-associated thoracic malig- enhances tumorigenicity of lung cancer cells via polycomb- Dickkopf-1 Dkk1 nancies will continue to increase, with particularly devastating mediated repression of ( ), which encodes an consequences in developing countries (5). antagonist of Wnt signaling (12). In unpublished studies, we observed a similar phenomenon in esophageal adenocarcino- ma cells following cigarette smoke exposure. In addition, we Authors' Affiliations: 1Thoracic Oncology Section, 2Gastrointestinal and have observed that cigarette smoke activates miR-31, targeting 3 Hepatobiliary Malignancies Section, Surgery Branch, Laboratory of Dkk1 as well as several other Wnt antagonists in lung cancer Pathology, 4Clinical Pharmacy Department, 5Experimental Therapeutics Section, Medical Oncology Branch, Center for Cancer Research, National cells; constitutive expression of this miRNA significantly Cancer Institute, Bethesda, Maryland; 6Department of Pathology, Penn enhanced proliferation of lung cancer cells in vitro and in vivo State Hershey Medical Center, Hershey, Pennsylvania; and 7Clinical Micro- array Core, University of California, Los Angeles, California (13). In more recent studies, we observed that cigarette smoke mediates epigenetic repression of miR-487b in lung cancer Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/). cells, resulting in overexpression of polycomb group proteins BMI1 and SUZ12, as well as Wnt5a, k-ras, and C-myc, all of Corresponding Author: David S. Schrump, Thoracic Oncology Section, Surgery Branch, National Cancer Institute, Building 10; 4-3942, 10 Center which have been implicated in modulating stem cell pluripo- Drive, Bethesda, MD 20892. Phone: 301-496-2128; Fax: 301-451-6934; tency (14–18); consistent with these observations, knockdown E-mail: [email protected] of miR-487b increases proliferation and tumorigenicity of lung doi: 10.1158/0008-5472.CAN-11-3983 cancer cells (Xi and colleagues; submitted). This study was Ó2012 American Association for Cancer Research. undertaken to examine if cigarette smoke activates additional 4178 Cancer Res; 72(16) August 15, 2012 Mithramycin and ABCG2 stem cell–associated genes, which enhance the malignant Murine xenograft experiments phenotype of lung and esophageal cancers in an effort to Athymic nude mice were injected in bilateral flanks with develop novel pharmacologic strategies for treatment of these 1 Â 106 parental A549 cells. Approximately 10 days later when neoplasms. palpable tumors were present, mice were randomly assigned to receive mithramycin at 1 or 2 mg/kg body weight or saline administered as intraperitoneal injections on Monday, Wed- Materials and Methods nesday, and Friday for 3 weeks. Tumor dimensions and mouse Cell lines and treatment conditions weights were measured twice weekly. When control tumors Unless otherwise specified, all cancer lines were obtained approached maximum allowable size, all mice were eutha- from American Type Culture Collection. Cells were validated nized, and tumors were excised, weighed, and processed for by periodic HLA typing of laboratory cultures relative to new additional studies. All mouse experiments were approved by cell aliquots from the repository. NCI-SB-EsC1 and NCI-SB- the National Cancer Institute Animal Care and Use Committee EsC2 (EsC1 and EsC2, respectively) were established in our and were in accordance with the NIH Guide for the Care and laboratory from 2 patients with esophageal adenocarcinoma Use of Laboratory Animals. who developed disease recurrence after undergoing induc- tion chemo/XRT and surgery on Institutional Review Board Chromatin immunoprecipitation approval protocols; these cell lines exhibit HLA as well as Quantitative chromatin immunoprecipitation (ChIP) was cytokeratin expression profiles identical to the respective carried out as described (20), with minor modifications. Full primary tumors. All cancer lines were maintained in RPMI methods are described in Supplementary Methods. Antibodies media supplemented with 10% FBS and 1% penicillin/strep- and primers for ChIP are listed in Supplementary Table S1. tomycin (normal media). Primary normal human small airway epithelial cells (SAEC) were obtained from Lonza, Luciferase promoter–reporter transient transfection Inc. and cultured per vendor instructions. Cigarette smoke experiments condensates (CSC) were generated as described (19). For Submitted as Supplementary Methods. smoke exposure experiments, cells were cultured in appro- priate normal media with or without varying concentrations Flow cytometry of CSC. Media and CSC were changed daily. Cells were Flow cytometry for ABCG2 surface expression and side subcultured as necessary and harvested at appropriate times population was carried out as described (21), with minor for further analysis. modifications. Full methods submitted as Supplementary Mithramycin was obtained from either Sigma or the Methods. Developmental Therapeutics Program (National Cancer Institute). For drug exposure treatments, cells were cultured Statistical analysis in normal media with or without CSC. Media was changed SEM is indicated by bars on figures and was calculated using and mithramycin was added at various concentrations for Microsoft Office Excel 2007. All experiments were conducted 24 hours; cells were harvested at indicated time points for with at a minimum of triplicate samples, and all P values were further analysis. calculated with 2-tailed t tests. RNA isolation, real-time quantitative reverse transcription PCR, and microarray analysis Results Total RNA was isolated and real-time quantitative reverse CSC induces ABCG2 expression in cultured cancer cells transcription PCR (qRT-PCR) was done as described (19), Affymetrix microarrays were used to identify gene expres- using primers and probes listed in Supplementary Table S1. sion profiles in cultured lung and esophageal cancer cells Full details are submitted as Supplementary Methods. mediated by CSC under clinically relevant exposure condi- tions. ABCG2 [also known as breast cancer resistance Immunoblotting and immunofluorescence protein (BCRP)], which encodes a xenobiotic pump protein Submitted as Supplementary Methods. highly expressed in cancer stem cells (22), was one of the most highly upregulated genes in Calu-6, A549, EsC1, and Generation of stable cells expressing shRNA constructs EsC2 cells exposed to CSC (data not shown). Subsequent A549 and EsC2 cells were transfected with validated short
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Polo-Like Kinases Mediate Cell Survival in Mitochondrial Dysfunction
    Polo-like kinases mediate cell survival in mitochondrial dysfunction Takumi Matsumotoa,1, Ping-yuan Wanga,1, Wenzhe Maa, Ho Joong Sunga, Satoaki Matobab, and Paul M. Hwanga,2 aTranslational Medicine Branch, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD 20892; and bCardiovascular Medicine, Kyoto Prefectural University of Medicine, Kyoto 602-8566, Japan Edited by Solomon H. Snyder, Johns Hopkins University School of Medicine, Baltimore, MD, and approved July 10, 2009 (received for review April 16, 2009) Cancer cells often display defects in mitochondrial respiration, thus significant respiration (Fig. S1). For the described in vitro the identification of pathways that promote cell survival under this experiments, one representative SCO2-/- cell line was used. metabolic state may have therapeutic implications. Here, we report However, all significant findings were reproduced or confirmed that the targeted ablation of mitochondrial respiration markedly using at least one additional SCO2-/- cell line that was obtained increases expression of Polo-like kinase 2 (PLK2) and that it is by an independent homologous recombination event to rule out required for the in vitro growth of these nonrespiring cells. clonal variability. Furthermore, we identify PLK2 as a kinase that phosphorylates In an attempt to identify genes associated with the cell cycle Ser-137 of PLK1, which is sufficient to mediate this survival signal. that may enable the survival of SCO2-/- cells after disruption of In vivo, knockdown of PLK2 in an isogenic human cell line with a respiration, we compared microarray gene expression of respir- modest defect in mitochondrial respiration eliminates xenograft ing SCO2ϩ/ϩ and nonrespiring SCO2-/- HCT116 human colon formation, indicating that PLK2 activity is necessary for growth of cancer cells (Table S1).
    [Show full text]
  • SPEN Induces Mir-4652-3P to Target HIPK2 in Nasopharyngeal Carcinoma
    Li et al. Cell Death and Disease (2020) 11:509 https://doi.org/10.1038/s41419-020-2699-2 Cell Death & Disease ARTICLE Open Access SPEN induces miR-4652-3p to target HIPK2 in nasopharyngeal carcinoma Yang Li1,YuminLv1, Chao Cheng2,YanHuang3,LiuYang1, Jingjing He1,XingyuTao1, Yingying Hu1,YutingMa1, Yun Su1,LiyangWu1,GuifangYu4, Qingping Jiang5,ShuLiu6,XiongLiu7 and Zhen Liu1 Abstract SPEN family transcriptional repressor (SPEN), also known as the SMART/HDAC1-associated repressor protein (SHARP), has been reported to modulate the malignant phenotypes of breast cancer, colon cancer, and ovarian cancer. However, its role and the detail molecular basis in nasopharyngeal carcinoma (NPC) remain elusive. In this study, the SPEN mRNA and protein expression was found to be increased in NPC cells and tissues compared with nonmalignant nasopharyngeal epithelial cells and tissues. Elevated SPEN protein expression was found to promote the pathogenesis of NPC and lead to poor prognosis. Knockdown of SPEN expression resulted in inactivation ofPI3K/AKT and c-JUN signaling, thereby suppressing NPC migration and invasion. In addition, miR-4652-3p was found to be a downstream inducer of SPEN by targeting the homeodomain interacting protein kinase 2 (HIPK2) gene, a potential tumor suppressor that reduces the activation of epithelial–mesenchymal transition (EMT) signaling, thereby reducing its expression and leading to increased NPC migration, invasion, and metastasis. In addition, SPEN was found to induce miR-4652-3p expression by activating PI3K/AKT/c-JUN signaling to target HIPK2. Our data provided a new molecular mechanism for SPEN as a metastasis promoter through activation of PI3K/AKT signaling, thereby stimulating the c-JUN/miR-4652-3p axis to target HIPK2 in NPC.
    [Show full text]
  • HIPK2–P53ser46 Damage Response Pathway Is Involved in Temozolomide-Induced Glioblastoma Cell Death Yang He, Wynand P
    Published OnlineFirst February 22, 2019; DOI: 10.1158/1541-7786.MCR-18-1306 Cell Fate Decisions Molecular Cancer Research The SIAH1–HIPK2–p53ser46 Damage Response Pathway is Involved in Temozolomide-Induced Glioblastoma Cell Death Yang He, Wynand P. Roos, Qianchao Wu, Thomas G. Hofmann, and Bernd Kaina Abstract Patients suffering from glioblastoma have a dismal prog- in chromatin-immunoprecipitation experiments, in which nosis, indicating the need for new therapeutic targets. Here p-p53ser46 binding to the Fas promotor was regulated by we provide evidence that the DNA damage kinase HIPK2 HIPK2. Other pro-apoptotic proteins such as PUMA, and its negative regulatory E3-ubiquitin ligase SIAH1 are NOXA, BAX, and PTEN were not affected in HIPK2kd, and critical factors controlling temozolomide-induced cell also double-strand breaks following temozolomide remain- death. We show that HIPK2 downregulation (HIPK2kd) ed unaffected. We further show that downregulation of significantly reduces the level of apoptosis. This was not the HIPK2 inactivator SIAH1 significantly ameliorates the case in glioblastoma cells expressing the repair protein temozolomide-induced apoptosis, suggesting that the MGMT, suggesting that the primary DNA lesion responsible ATM/ATR target SIAH1 together with HIPK2 plays a pro- 6 for triggering HIPK2-mediated apoptosis is O -methylguanine. apoptotic role in glioma cells exhibiting p53wt status. A Upon temozolomide treatment, p53 becomes phosphory- database analysis revealed that SIAH1, but not SIAH2, is lated whereby HIPK2kd had impact exclusively on ser46, significantly overexpressed in glioblastomas. but not ser15. Searching for the transcriptional target of p-p53ser46, we identified the death receptor FAS (CD95, Implications: The identification of a novel apoptotic APO-1) being involved.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Updates on HIPK2: a Resourceful Oncosuppressor for Clearing Cancer Gabriella D’Orazi1,2*, Cinzia Rinaldo2,3 and Silvia Soddu2*
    D’Orazi et al. Journal of Experimental & Clinical Cancer Research 2012, 31:63 http://www.jeccr.com/content/31/1/63 REVIEW Open Access Updates on HIPK2: a resourceful oncosuppressor for clearing cancer Gabriella D’Orazi1,2*, Cinzia Rinaldo2,3 and Silvia Soddu2* Abstract Homeodomain-interacting protein kinase 2 (HIPK2) is a multitalented protein that exploits its kinase activity to modulate key molecular pathways in cancer to restrain tumor growth and induce response to therapies. HIPK2 phosphorylates oncosuppressor p53 for apoptotic activation. In addition, also p53-independent apoptotic pathways are regulated by HIPK2 and can be exploited for anticancer purpose too. Therefore, HIPK2 activity is considered a central switch in targeting tumor cells toward apoptosis upon genotoxic damage and the preservation and/or restoration of HIPK2 function is crucial for an efficient tumor response to therapies. As a proof of principle, HIPK2 knockdown impairs p53 function, induces chemoresistance, angiogenesis, and tumor growth in vivo,onthe contrary, HIPK2 overexpression activates apoptotic pathways, counteracts hypoxia, inhibits angiogenesis, and induces chemosensitivity both in p53-dependent and -independent ways. The role of HIPK2 in restraining tumor development was also confirmed by studies with HIPK2 knockout mice. Recent findings demonstrated that HIPK2 inhibitions do exist in tumors and depend by several mechanisms including HIPK2 cytoplasmic localization, protein degradation, and loss of heterozygosity (LOH), recapitulating the biological outcome obtained by RNA interference studies in tumor cells, such as p53 inactivation, resistance to therapies, apoptosis inhibition, and tumor progression. These findings may lead to new diagnostic and therapeutic approaches for treating cancer patients. This review will focus on the last updates about HIPK2 contribution in tumorigenesis and cancer treatment.
    [Show full text]
  • Ccnf (NM 007634) Mouse Tagged ORF Clone – MR210593 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR210593 Ccnf (NM_007634) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Ccnf (NM_007634) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Ccnf Synonyms: CycF; Fbxo1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 Ccnf (NM_007634) Mouse Tagged ORF Clone – MR210593 ORF Nucleotide >MR210593 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGAGCGGCGGTGTGATCCATTGTAGGTGTGCCAAGTGTTTCTGTTATCCTACTAAACGAAGAATCA AAAGAAGACCCAGAAACTTAACCATCTTGAGTCTCCCAGAAGATGTACTCTTTCATATCCTGAAATGGCT TTCTGTTGGGGACATCCTTGCTGTCCGAGCTGTCCACTCCCACCTCAAGTACCTGGTGGACAACCATGCC AGTGTGTGGGCATCCGCCAGCTTCCAGGAGCTGTGGCCTTCTCCACAGAACCTGAAGCTCTTTGAAAGGG CTGCTGAAAAGGGAAATTTTGAAGCTGCTGTGAAGTTGGGGATTGCCTACCTCTACAATGAAGGCCTGTC TGTGTCAGATGAGGCCTGCGCAGAAGTGAACGGCTTGAAGGCCTCTCGCTTCTTCAGCATGGCTGAGAGA CTGAATACGGGTTCTGAGCCCTTCATTTGGCTCTTCATCCGCCCACCGTGGTCAGTGTCCGGAAGCTGCT GCAAGGCTGTGGTTCATGACAGCCTCCGAGCGGAGTGTCAGTTACAGAGAAGTCATAAAGCTTCCATACT ACACTGCTTGGGAAGGGTGCTAAATCTTTTTGAGGACGAAGAGAAAAGGAAGCAGGCGCGTAGCCTTTTG
    [Show full text]
  • Application of a MYC Degradation
    SCIENCE SIGNALING | RESEARCH ARTICLE CANCER Copyright © 2019 The Authors, some rights reserved; Application of a MYC degradation screen identifies exclusive licensee American Association sensitivity to CDK9 inhibitors in KRAS-mutant for the Advancement of Science. No claim pancreatic cancer to original U.S. Devon R. Blake1, Angelina V. Vaseva2, Richard G. Hodge2, McKenzie P. Kline3, Thomas S. K. Gilbert1,4, Government Works Vikas Tyagi5, Daowei Huang5, Gabrielle C. Whiten5, Jacob E. Larson5, Xiaodong Wang2,5, Kenneth H. Pearce5, Laura E. Herring1,4, Lee M. Graves1,2,4, Stephen V. Frye2,5, Michael J. Emanuele1,2, Adrienne D. Cox1,2,6, Channing J. Der1,2* Stabilization of the MYC oncoprotein by KRAS signaling critically promotes the growth of pancreatic ductal adeno- carcinoma (PDAC). Thus, understanding how MYC protein stability is regulated may lead to effective therapies. Here, we used a previously developed, flow cytometry–based assay that screened a library of >800 protein kinase inhibitors and identified compounds that promoted either the stability or degradation of MYC in a KRAS-mutant PDAC cell line. We validated compounds that stabilized or destabilized MYC and then focused on one compound, Downloaded from UNC10112785, that induced the substantial loss of MYC protein in both two-dimensional (2D) and 3D cell cultures. We determined that this compound is a potent CDK9 inhibitor with a previously uncharacterized scaffold, caused MYC loss through both transcriptional and posttranslational mechanisms, and suppresses PDAC anchorage- dependent and anchorage-independent growth. We discovered that CDK9 enhanced MYC protein stability 62 through a previously unknown, KRAS-independent mechanism involving direct phosphorylation of MYC at Ser .
    [Show full text]
  • Polo-Like Kinases in the Nervous System
    Oncogene (2005) 24, 292–298 & 2005 Nature Publishing Group All rights reserved 0950-9232/05 $30.00 www.nature.com/onc Polo-like kinases in the nervous system Daniel P Seeburg1, Daniel Pak1 and Morgan Sheng*,1 1The Picower Center for Learning and Memory, RIKEN-MIT Neuroscience Research Center, Howard Hughes Medical Institute, Massachusetts Institute of Technology, Cambridge, MA 02139, USA Polo like kinases (Plks) are key regulators of the cell Intriguingly, neuronal Plks are regulated by synaptic cycle, but little is known about their functions in activity and can interact with specific synaptic proteins, postmitotic cells such as neurons. Recent findings indicate resulting in loss of synapses. In this review, we briefly that Plk2 and Plk3are dynamically regulated in neurons summarize the roles of Plks in the cell cycle and then by synaptic activity at the mRNA and protein levels. In discuss developments on neuronal Plks and their COS cells, Plk2 and Plk3interact with spine-associated implications for the physiological role of these proteins Rap guanosine triphosphatase-activating protein (SPAR), in the nervous system. a regulator of actin dynamics and dendritic spine The Plks are characterized by a conserved architecture morphology, leading to its degradation through the consisting of an N-terminal kinase domain and a C- ubiquitin–proteasome system. Induction of Plk2 in terminal Polo box domain. The latter binds to phos- hippocampal neurons eliminates SPAR protein, depletes phoserine/threonine motifs and is believed to be a core postsynaptic scaffolding molecule (PSD-95), and important for the functional regulation of the protein causes loss of mature dendritic spines and synapses.
    [Show full text]
  • Non-Random Aneuploidy Specifies Subgroups of Pilocytic Astrocytoma and Correlates with Older Age
    www.impactjournals.com/oncotarget/ Oncotarget, Vol. 6, No. 31 Non-random aneuploidy specifies subgroups of pilocytic astrocytoma and correlates with older age Adam M. Fontebasso1,*, Margret Shirinian2,*, Dong-Anh Khuong-Quang3, Denise Bechet3, Tenzin Gayden3, Marcel Kool4, Nicolas De Jay3, Karine Jacob3, Noha Gerges3, Barbara Hutter5, Huriye Şeker-Cin4, Hendrik Witt4,6, Alexandre Montpetit7, Sébastien Brunet7, Pierre Lepage7, Geneviève Bourret7, Almos Klekner8, László Bognár8, Peter Hauser9, Miklós Garami9, Jean-Pierre Farmer10, Jose-Luis Montes10, Jeffrey Atkinson10, Sally Lambert11, Tony Kwan7, Andrey Korshunov12, Uri Tabori13, V. Peter Collins11, Steffen Albrecht14, Damien Faury3, Stefan M. Pfister4,6, Werner Paulus15, Martin Hasselblatt15, David T.W. Jones4 and Nada Jabado1,3 1 Division of Experimental Medicine, McGill University and McGill University Health Centre, Montreal, Quebec, Canada 2 Department of Experimental Pathology, Immunology and Microbiology, American University Of Beirut, Beirut, Lebanon 3 Departments of Pediatrics and Human Genetics, McGill University and McGill University Health Centre, Montreal, Quebec, Canada 4 Division of Pediatric Neurooncology, German Cancer Research Centre (DKFZ), Heidelberg, Germany 5 Division of Theoretical Bioinformatics, German Cancer Research Centre (DKFZ), Heidelberg, Germany 6 Department of Pediatric Oncology, Hematology and Immunology, University of Heidelberg, Heidelberg, Germany 7 McGill University and Genome Quebec Innovation Centre, Montreal, Quebec, Canada 8 Department of Neurosurgery,
    [Show full text]
  • The Tumor Suppressor Notch Inhibits Head and Neck Squamous Cell
    The Texas Medical Center Library DigitalCommons@TMC The University of Texas MD Anderson Cancer Center UTHealth Graduate School of The University of Texas MD Anderson Cancer Biomedical Sciences Dissertations and Theses Center UTHealth Graduate School of (Open Access) Biomedical Sciences 12-2015 THE TUMOR SUPPRESSOR NOTCH INHIBITS HEAD AND NECK SQUAMOUS CELL CARCINOMA (HNSCC) TUMOR GROWTH AND PROGRESSION BY MODULATING PROTO-ONCOGENES AXL AND CTNNAL1 (α-CATULIN) Shhyam Moorthy Shhyam Moorthy Follow this and additional works at: https://digitalcommons.library.tmc.edu/utgsbs_dissertations Part of the Biochemistry, Biophysics, and Structural Biology Commons, Cancer Biology Commons, Cell Biology Commons, and the Medicine and Health Sciences Commons Recommended Citation Moorthy, Shhyam and Moorthy, Shhyam, "THE TUMOR SUPPRESSOR NOTCH INHIBITS HEAD AND NECK SQUAMOUS CELL CARCINOMA (HNSCC) TUMOR GROWTH AND PROGRESSION BY MODULATING PROTO-ONCOGENES AXL AND CTNNAL1 (α-CATULIN)" (2015). The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access). 638. https://digitalcommons.library.tmc.edu/utgsbs_dissertations/638 This Dissertation (PhD) is brought to you for free and open access by the The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences at DigitalCommons@TMC. It has been accepted for inclusion in The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access) by an authorized administrator of DigitalCommons@TMC. For more information, please contact [email protected]. THE TUMOR SUPPRESSOR NOTCH INHIBITS HEAD AND NECK SQUAMOUS CELL CARCINOMA (HNSCC) TUMOR GROWTH AND PROGRESSION BY MODULATING PROTO-ONCOGENES AXL AND CTNNAL1 (α-CATULIN) by Shhyam Moorthy, B.S.
    [Show full text]
  • Regulation and Function of ERK3/MK5-Mediated Signaling
    Medizinische Hochschule Hannover Institut für Physiologische Chemie Regulation and Function of ERK3/MK5-mediated Signaling INAUGURAL – DISSERTATION Zur Erlangung des Grades eines Doktors der Naturwissenschaften - Doctor rerum naturalium – (Dr. rer. nat.) vorgelegt von Frank Brand geboren am 19.11.1982 in Hoyerswerda Hannover 2012 Angenommen vom Senat der Medizinischen Hochschule Hannover am 12.04.2012 Gedruckt mit Genehmigung der Medizinischen Hochschule Hannover Präsident: Prof. Dr. med Dieter Bitter-Suermann Betreuer: Prof. Dr. rer. nat. Matthias Gaestel Kobetreuer: Prof. Dr. rer. nat. Ernst Ungewickell 1. Gutachter: Prof. Dr. rer. nat. Matthias Gaestel 2. Gutachter: Prof. Dr. rer. nat. Ernst Ungewickell 3. Gutachter: Prof. Dr. rer. nat. Andreas Kispert Tag der mündlichen Prüfung vor der Prüfungskommission: 12.04.2012 Prof. Dr. rer. nat. Matthias Gaestel Prof. Dr. rer. nat. Matthias Gaestel Prof. Dr. rer. nat. Ernst Ungewickell Prof. Dr. rer. nat. Andreas Kispert Abstract Frank Brand Title of dissertation: ‘Regulation and Function of ERK3/MK5-mediated Signaling’ The family of mitogen-activated protein kinase (MAPK)-activated kinases (MKs, or MAPKAPKs), including the three distinct kinases MK2, MK3, and MK5, are downstream targets of the cytokine- and stress-induced p38 MAP kinases. Interaction and activation of MKs by p38 MAP kinases have been demonstrated in vitro and in vivo. The physiological relevance of the MK5/p38-interaction is doubtful, since its activity could not be triggered by any of the known MAP kinase stimuli. An interaction screen using MK5 revealed a strong binding to the atypical member of MAPKs ERK3. From previous studies, it has been concluded that MK5 is the first ‘bona fide’ substrate of ERK3, thus forming a stable complex promoting their protein stability and kinase activation.
    [Show full text]