Polo-Like Kinases in the Nervous System

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Oncogene (2005) 24, 292–298 & 2005 Nature Publishing Group All rights reserved 0950-9232/05 $30.00 www.nature.com/onc Polo-like kinases in the nervous system Daniel P Seeburg1, Daniel Pak1 and Morgan Sheng*,1 1The Picower Center for Learning and Memory, RIKEN-MIT Neuroscience Research Center, Howard Hughes Medical Institute, Massachusetts Institute of Technology, Cambridge, MA 02139, USA Polo like kinases (Plks) are key regulators of the cell Intriguingly, neuronal Plks are regulated by synaptic cycle, but little is known about their functions in activity and can interact with specific synaptic proteins, postmitotic cells such as neurons. Recent findings indicate resulting in loss of synapses. In this review, we briefly that Plk2 and Plk3are dynamically regulated in neurons summarize the roles of Plks in the cell cycle and then by synaptic activity at the mRNA and protein levels. In discuss developments on neuronal Plks and their COS cells, Plk2 and Plk3interact with spine-associated implications for the physiological role of these proteins Rap guanosine triphosphatase-activating protein (SPAR), in the nervous system. a regulator of actin dynamics and dendritic spine The Plks are characterized by a conserved architecture morphology, leading to its degradation through the consisting of an N-terminal kinase domain and a C- ubiquitin–proteasome system. Induction of Plk2 in terminal Polo box domain. The latter binds to phos- hippocampal neurons eliminates SPAR protein, depletes phoserine/threonine motifs and is believed to be a core postsynaptic scaffolding molecule (PSD-95), and important for the functional regulation of the protein causes loss of mature dendritic spines and synapses. These by targeting the kinase to specific subcellular locations findings implicate neuronal Plks as mediators of activity- and substrates (Lee et al., 1998; May et al., 2002; Elia dependent change in molecular composition and morphol- et al., 2003a, b; Ma et al., 2003b; Reynolds and Ohkura, ogy of synapses. Induction of Plks might provide a 2003; Lowery et al., 2004). Flies, budding yeast, and homeostatic mechanism for global dampening of synaptic fission yeast contain a single Plk, referred to as Polo, strength following heightened neuronal activity (‘synaptic Cdc5p, and Plo1, respectively. In mammals, frogs, and scaling’). Synapse-specific actions of induced Plks are also worms, there are three Plks, denoted Plk1, Plk2, and possible, particularly in light of the discovery of Plk3. (Plk in Xenopus laevis is also referred to as Plx. phosphoserine/threonine peptide motifs as binding targets Plk2 and Plk3 are also known as SNK/hSNK and FNK/ of the polo box domain, which could allow for ‘priming’ Prk in mice/humans, respectively.) Plk1 is thought to be phosphorylation by upstream kinases that could ‘tag’ Plk the functional homolog of Drosophila Polo and, substrates only in specific synapses. together with Cdc5p, is the most extensively studied of Oncogene (2005) 24, 292–298. doi:10.1038/sj.onc.1208277 the Plks. Plk1 plays a critical role in the timing of mitotic entry and exit through the activation of Cdc25C Keywords: SNK; Plk2; SPAR; immediate-early genes; and Cdc2-cyclin B at the G2–M transition (Roshak spines et al., 2000; Toyoshima-Morimoto et al., 2001; Toyoshi- ma-Morimoto et al., 2002) and through activation of the anaphase promoting complex (APC) in mitosis (Kotani et al., 1998; Golan et al., 2002; but see: Kraft et al., 2003). Plk1 also regulates the mechanics of mitotic Introduction processes such as centrosome assembly and separation (Lane and Nigg, 1996; do Carmo Avides et al., 2001; The study of Polo-like kinases (Plks) has focused Dai et al., 2002; Blagden and Glover, 2003), chromo- primarily on the critical role of these proteins in the some and sister chromatid separation during meiosis I cell cycle. Named after their first member in Drosophila and mitosis, respectively (Sumara et al., 2002; Clyne melanogaster (Polo) (Sunkel and Glover, 1988; Llama- et al., 2003; Lee and Amon, 2003), fragmentation of zares et al., 1991), this family of serine/threonine kinases Golgi membranes (Carmena et al., 1998; Song and Lee, has emerged as a key regulator during all stages of 2001; Sutterlin et al., 2001; Colanzi et al., 2003), and mitosis and the cell cycle checkpoint response to cytokinesis (Carmena et al., 1998; Song and Lee, 2001; genotoxic stress (Glover et al., 1998; Nigg, 1998; Xie Neef et al., 2003). et al., 2002). Despite their well-characterized roles in Plk3 is less well understood, although recent investi- dividing cells, recent studies suggest that Plks have roles gations have revealed diverse roles, both in the cell cycle in terminally differentiated cells of the nervous system. and beyond. Like Plk1, Plk3 activates Cdc25C at the onset of mitosis (Ouyang et al., 1997; Ouyang et al., *Correspondence: M Sheng, The Picower Center for Learning and 1999; Bahassi el et al., 2004), participates in breakdown Memory, MIT, 77 Massachusetts Avenue (E18-215), Cambridge, MA of the Golgi (Ruan et al., 2004; Xie et al., 2004), and is 02139, USA; E-mail: [email protected] important for cytokinesis (Conn et al., 2000). In Plks in the nervous system DP Seeburg et al 293 addition, Plk3 regulates microtubule dynamics and differential screens for activity-regulated genes, it is centrosomal function (Wang et al., 2002), and has been estimated that somewhere between 15 and 300 of the reported to function in cellular adhesion (Holtrich et al., thousands of genes expressed in the nervous system are 2000). Following genotoxic stress, Plk3 is activated by rapidly regulated by activity (Hevroni et al., 1998; Chk2 and helps to mediate the stress response, at least in Lanahan and Worley, 1998; Nedivi, 1999). Activity- part by activating p53 (Xie et al., 2001; Bahassi el et al., induced gene expression is believed to be critical for 2002; Xie et al., 2002). In contrast, Plk1 is inhibited formation of long-term synaptic changes (synaptic following DNA damage (Smits et al., 2000; van Vugt plasticity) in the brain, which might underlie learning et al., 2001) and its mRNA expression is repressed by and memory. Based on the timescale over which BRCA-1 (Ree et al., 2003) and p53 (Kho et al., 2004). synaptic change persists, several forms of synaptic Plk2 is the least studied of the Plks. Unlike Plk1 and plasticity can be delineated, each with different under- Plk3, Plk2 seems to lack a prominent role in the cell lying molecular mechanisms and dependence on gene cycle. Plk2 is expressed in the brain, but is notably expression. Short-term synaptic alterations are mediated absent from proliferating tissue such as thymus, liver, or largely by post-translational modification and regula- intestine (Simmons et al., 1992). Moreover, Plk2 was not tion of existing proteins and are thus independent of detected in nocodazole-treated cells arrested at M phase, new protein synthesis (Izquierdo et al., 2002). However, but was restricted to G1, indicating that Plk2 likely does for long-term synaptic changes to take place, new gene not function during mitosis (Ma et al., 2003b). Its transcription and protein synthesis are required (e.g. expression during G1, however, implicates a role for Frey et al., 1988; Steward and Schuman, 2001; Bozon Plk2 in the cell cycle, and Plk2À/À fibroblasts grew slower et al., 2003). Thus, the expression profile of neuronal in culture and showed delayed entry into S phase (Ma Plks would make them well suited to participate in et al., 2003a). Plk2À/À mice, although smaller at birth, longer lasting forms of synaptic plasticity. had similar postnatal growth rates compared to The time course of activity-dependent Plk induction controls, consistent with a physiological role in the cell was studied in the brains of rats following drug-induced cycle restricted to the embryonic period (Ma et al., seizures. After 1 h, the mRNA levels of Plk2 and Plk3 2003a). were increased B1.6-fold. The fold-induction was Beyond their key role in cell division, Plks are also similar at 4 h, and mRNA levels returned to baseline found in postmitotic cells such as neurons, but the by 10 h. Similarly, protein levels of Plk2 and -3 were neuronal functions of Plks are poorly understood. potently induced and enriched in somata and dendrites Interestingly, several cell cycle regulators are now of activated neurons (Kauselmann et al., 1999). Elec- known to have additional activities in neurons. One trical stimulation sufficient to induce long-term poten- example is the APC, a multisubunit complex with E3 tiation (LTP) in the hippocampus, a brain region critical ubiquitin-ligase activity that coordinates cell cycle for learning and memory, also induced Plk2 and Plk3 transitions, including exit from mitosis (Morgan, 1999; mRNAs. On the other hand, low frequency electrical Harper et al., 2002). Activity of the APC is stimulated in stimulation failed to induce Plk2 or Plk3 and did not early mitosis by the regulatory protein Cdc20 and in late change synaptic strength (Kauselmann et al., 1999). mitosis/G1 by Cdh1. Intriguingly, Cdh1 and core Thus, a threshold of synaptic activation is required to components of the APC are also expressed in post- upregulate expression of Plk2 and -3. mitotic neurons (Gieffers et al., 1999; Peters, 2002), Based on pharmacological inhibition experiments, a where the Cdh1–APC has recently been shown to play a number of signaling proteins are required for the role in axonal growth and patterning in the developing induction of Plk2 in neurons. Thus, antagonists of L- brain (Konishi et al., 2004). Similarly, Aurora kinases type voltage-gated calcium channels (VGCCs), or that are involved in chromosome segregation and blockers of postsynaptic glutamate receptors (NMDA cytokinesis during mitosis (Glover et al., 1995; Terada receptors and AMPA receptors), were sufficient to et al., 1998; Blagden and Glover, 2003) have now been prevent activity-induced expression of Plk2 (Pak and shown to phosphorylate and activate cytoplasmic Sheng, 2003).
Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
  • Polo-Like Kinases Mediate Cell Survival in Mitochondrial Dysfunction

    Polo-Like Kinases Mediate Cell Survival in Mitochondrial Dysfunction

    Polo-like kinases mediate cell survival in mitochondrial dysfunction Takumi Matsumotoa,1, Ping-yuan Wanga,1, Wenzhe Maa, Ho Joong Sunga, Satoaki Matobab, and Paul M. Hwanga,2 aTranslational Medicine Branch, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD 20892; and bCardiovascular Medicine, Kyoto Prefectural University of Medicine, Kyoto 602-8566, Japan Edited by Solomon H. Snyder, Johns Hopkins University School of Medicine, Baltimore, MD, and approved July 10, 2009 (received for review April 16, 2009) Cancer cells often display defects in mitochondrial respiration, thus significant respiration (Fig. S1). For the described in vitro the identification of pathways that promote cell survival under this experiments, one representative SCO2-/- cell line was used. metabolic state may have therapeutic implications. Here, we report However, all significant findings were reproduced or confirmed that the targeted ablation of mitochondrial respiration markedly using at least one additional SCO2-/- cell line that was obtained increases expression of Polo-like kinase 2 (PLK2) and that it is by an independent homologous recombination event to rule out required for the in vitro growth of these nonrespiring cells. clonal variability. Furthermore, we identify PLK2 as a kinase that phosphorylates In an attempt to identify genes associated with the cell cycle Ser-137 of PLK1, which is sufficient to mediate this survival signal. that may enable the survival of SCO2-/- cells after disruption of In vivo, knockdown of PLK2 in an isogenic human cell line with a respiration, we compared microarray gene expression of respir- modest defect in mitochondrial respiration eliminates xenograft ing SCO2ϩ/ϩ and nonrespiring SCO2-/- HCT116 human colon formation, indicating that PLK2 activity is necessary for growth of cancer cells (Table S1).
  • Application of a MYC Degradation

    Application of a MYC Degradation

    SCIENCE SIGNALING | RESEARCH ARTICLE CANCER Copyright © 2019 The Authors, some rights reserved; Application of a MYC degradation screen identifies exclusive licensee American Association sensitivity to CDK9 inhibitors in KRAS-mutant for the Advancement of Science. No claim pancreatic cancer to original U.S. Devon R. Blake1, Angelina V. Vaseva2, Richard G. Hodge2, McKenzie P. Kline3, Thomas S. K. Gilbert1,4, Government Works Vikas Tyagi5, Daowei Huang5, Gabrielle C. Whiten5, Jacob E. Larson5, Xiaodong Wang2,5, Kenneth H. Pearce5, Laura E. Herring1,4, Lee M. Graves1,2,4, Stephen V. Frye2,5, Michael J. Emanuele1,2, Adrienne D. Cox1,2,6, Channing J. Der1,2* Stabilization of the MYC oncoprotein by KRAS signaling critically promotes the growth of pancreatic ductal adeno- carcinoma (PDAC). Thus, understanding how MYC protein stability is regulated may lead to effective therapies. Here, we used a previously developed, flow cytometry–based assay that screened a library of >800 protein kinase inhibitors and identified compounds that promoted either the stability or degradation of MYC in a KRAS-mutant PDAC cell line. We validated compounds that stabilized or destabilized MYC and then focused on one compound, Downloaded from UNC10112785, that induced the substantial loss of MYC protein in both two-dimensional (2D) and 3D cell cultures. We determined that this compound is a potent CDK9 inhibitor with a previously uncharacterized scaffold, caused MYC loss through both transcriptional and posttranslational mechanisms, and suppresses PDAC anchorage- dependent and anchorage-independent growth. We discovered that CDK9 enhanced MYC protein stability 62 through a previously unknown, KRAS-independent mechanism involving direct phosphorylation of MYC at Ser .
  • Mithramycin Represses Basal and Cigarette Smoke–Induced Expression of ABCG2 and Inhibits Stem Cell Signaling in Lung and Esophageal Cancer Cells

    Mithramycin Represses Basal and Cigarette Smoke–Induced Expression of ABCG2 and Inhibits Stem Cell Signaling in Lung and Esophageal Cancer Cells

    Cancer Therapeutics, Targets, and Chemical Biology Research Mithramycin Represses Basal and Cigarette Smoke–Induced Expression of ABCG2 and Inhibits Stem Cell Signaling in Lung and Esophageal Cancer Cells Mary Zhang1, Aarti Mathur1, Yuwei Zhang1, Sichuan Xi1, Scott Atay1, Julie A. Hong1, Nicole Datrice1, Trevor Upham1, Clinton D. Kemp1, R. Taylor Ripley1, Gordon Wiegand2, Itzak Avital2, Patricia Fetsch3, Haresh Mani6, Daniel Zlott4, Robert Robey5, Susan E. Bates5, Xinmin Li7, Mahadev Rao1, and David S. Schrump1 Abstract Cigarette smoking at diagnosis or during therapy correlates with poor outcome in patients with lung and esophageal cancers, yet the underlying mechanisms remain unknown. In this study, we observed that exposure of esophageal cancer cells to cigarette smoke condensate (CSC) led to upregulation of the xenobiotic pump ABCG2, which is expressed in cancer stem cells and confers treatment resistance in lung and esophageal carcinomas. Furthermore, CSC increased the side population of lung cancer cells containing cancer stem cells. Upregulation of ABCG2 coincided with increased occupancy of aryl hydrocarbon receptor, Sp1, and Nrf2 within the ABCG2 promoter, and deletion of xenobiotic response elements and/or Sp1 sites markedly attenuated ABCG2 induction. Under conditions potentially achievable in clinical settings, mithramycin diminished basal as well as CSC- mediated increases in AhR, Sp1, and Nrf2 levels within the ABCG2 promoter, markedly downregulated ABCG2, and inhibited proliferation and tumorigenicity of lung and esophageal cancer cells. Microarray analyses revealed that mithramycin targeted multiple stem cell–related pathways in vitro and in vivo. Collectively, our findings provide a potential mechanistic link between smoking status and outcome of patients with lung and esophageal cancers, and support clinical use of mithramycin for repressing ABCG2 and inhibiting stem cell signaling in thoracic malignancies.
  • Non-Random Aneuploidy Specifies Subgroups of Pilocytic Astrocytoma and Correlates with Older Age

    Non-Random Aneuploidy Specifies Subgroups of Pilocytic Astrocytoma and Correlates with Older Age

    www.impactjournals.com/oncotarget/ Oncotarget, Vol. 6, No. 31 Non-random aneuploidy specifies subgroups of pilocytic astrocytoma and correlates with older age Adam M. Fontebasso1,*, Margret Shirinian2,*, Dong-Anh Khuong-Quang3, Denise Bechet3, Tenzin Gayden3, Marcel Kool4, Nicolas De Jay3, Karine Jacob3, Noha Gerges3, Barbara Hutter5, Huriye Şeker-Cin4, Hendrik Witt4,6, Alexandre Montpetit7, Sébastien Brunet7, Pierre Lepage7, Geneviève Bourret7, Almos Klekner8, László Bognár8, Peter Hauser9, Miklós Garami9, Jean-Pierre Farmer10, Jose-Luis Montes10, Jeffrey Atkinson10, Sally Lambert11, Tony Kwan7, Andrey Korshunov12, Uri Tabori13, V. Peter Collins11, Steffen Albrecht14, Damien Faury3, Stefan M. Pfister4,6, Werner Paulus15, Martin Hasselblatt15, David T.W. Jones4 and Nada Jabado1,3 1 Division of Experimental Medicine, McGill University and McGill University Health Centre, Montreal, Quebec, Canada 2 Department of Experimental Pathology, Immunology and Microbiology, American University Of Beirut, Beirut, Lebanon 3 Departments of Pediatrics and Human Genetics, McGill University and McGill University Health Centre, Montreal, Quebec, Canada 4 Division of Pediatric Neurooncology, German Cancer Research Centre (DKFZ), Heidelberg, Germany 5 Division of Theoretical Bioinformatics, German Cancer Research Centre (DKFZ), Heidelberg, Germany 6 Department of Pediatric Oncology, Hematology and Immunology, University of Heidelberg, Heidelberg, Germany 7 McGill University and Genome Quebec Innovation Centre, Montreal, Quebec, Canada 8 Department of Neurosurgery,
  • Regulation and Function of ERK3/MK5-Mediated Signaling

    Regulation and Function of ERK3/MK5-Mediated Signaling

    Medizinische Hochschule Hannover Institut für Physiologische Chemie Regulation and Function of ERK3/MK5-mediated Signaling INAUGURAL – DISSERTATION Zur Erlangung des Grades eines Doktors der Naturwissenschaften - Doctor rerum naturalium – (Dr. rer. nat.) vorgelegt von Frank Brand geboren am 19.11.1982 in Hoyerswerda Hannover 2012 Angenommen vom Senat der Medizinischen Hochschule Hannover am 12.04.2012 Gedruckt mit Genehmigung der Medizinischen Hochschule Hannover Präsident: Prof. Dr. med Dieter Bitter-Suermann Betreuer: Prof. Dr. rer. nat. Matthias Gaestel Kobetreuer: Prof. Dr. rer. nat. Ernst Ungewickell 1. Gutachter: Prof. Dr. rer. nat. Matthias Gaestel 2. Gutachter: Prof. Dr. rer. nat. Ernst Ungewickell 3. Gutachter: Prof. Dr. rer. nat. Andreas Kispert Tag der mündlichen Prüfung vor der Prüfungskommission: 12.04.2012 Prof. Dr. rer. nat. Matthias Gaestel Prof. Dr. rer. nat. Matthias Gaestel Prof. Dr. rer. nat. Ernst Ungewickell Prof. Dr. rer. nat. Andreas Kispert Abstract Frank Brand Title of dissertation: ‘Regulation and Function of ERK3/MK5-mediated Signaling’ The family of mitogen-activated protein kinase (MAPK)-activated kinases (MKs, or MAPKAPKs), including the three distinct kinases MK2, MK3, and MK5, are downstream targets of the cytokine- and stress-induced p38 MAP kinases. Interaction and activation of MKs by p38 MAP kinases have been demonstrated in vitro and in vivo. The physiological relevance of the MK5/p38-interaction is doubtful, since its activity could not be triggered by any of the known MAP kinase stimuli. An interaction screen using MK5 revealed a strong binding to the atypical member of MAPKs ERK3. From previous studies, it has been concluded that MK5 is the first ‘bona fide’ substrate of ERK3, thus forming a stable complex promoting their protein stability and kinase activation.
  • Androgen Receptor

    Androgen Receptor

    RALTITREXED Dihydrofolate reductase BORTEZOMIB IsocitrateCannabinoid dehydrogenase CB1EPIRUBICIN receptor HYDROCHLORIDE [NADP] cytoplasmic VINCRISTINE SULFATE Hypoxia-inducible factor 1 alpha DOXORUBICINAtaxin-2 HYDROCHLORIDENIFENAZONEFOLIC ACID PYRIMETHAMINECellular tumor antigen p53 Muscleblind-likeThyroidVINBURNINEVINBLASTINETRIFLURIDINE protein stimulating 1 DEQUALINIUM SULFATEhormone receptor CHLORIDE Menin/Histone-lysine N-methyltransferasePHENELZINE MLLLANATOSIDE SULFATE C MELATONINDAUNORUBICINBETAMETHASONEGlucagon-like HYDROCHLORIDEEndonuclease peptide 4 1 receptor NICLOSAMIDEDIGITOXINIRINOTECAN HYDROCHLORIDE HYDRATE BISACODYL METHOTREXATEPaired boxAZITHROMYCIN protein Pax-8 ATPase family AAA domain-containing proteinLIPOIC 5 ACID, ALPHA Nuclear receptorCLADRIBINEDIGOXIN ROR-gammaTRIAMTERENE CARMUSTINEEndoplasmic reticulum-associatedFLUOROURACIL amyloid beta-peptide-binding protein OXYPHENBUTAZONEORLISTAT IDARUBICIN HYDROCHLORIDE 6-phospho-1-fructokinaseHeat shockSIMVASTATIN protein beta-1 TOPOTECAN HYDROCHLORIDE AZACITIDINEBloom syndromeNITAZOXANIDE protein Huntingtin Human immunodeficiency virus typeTIPRANAVIR 1 protease VitaminCOLCHICINE D receptorVITAMIN E FLOXURIDINE TAR DNA-binding protein 43 BROMOCRIPTINE MESYLATEPACLITAXEL CARFILZOMIBAnthrax lethalFlap factorendonucleasePrelamin-A/C 1 CYTARABINE Vasopressin V2 receptor AMITRIPTYLINEMicrotubule-associated HYDROCHLORIDERetinoidTRIMETHOPRIM proteinMothers X receptor tau against alpha decapentaplegic homolog 3 Histone-lysine N-methyltransferase-PODOFILOX H3 lysine-9OXYQUINOLINE
  • Phosphorylation Signaling in APP Processing in Alzheimer's Disease

    Phosphorylation Signaling in APP Processing in Alzheimer's Disease

    International Journal of Molecular Sciences Review Phosphorylation Signaling in APP Processing in Alzheimer’s Disease Tao Zhang, Dongmei Chen and Tae Ho Lee * Fujian Key Laboratory for Translational Research in Cancer and Neurodegenerative Diseases, Institute for Translational Medicine, School of Basic Medical Sciences, Fujian Medical University, Fuzhou 350122, China; [email protected] (T.Z.); [email protected] (D.C.) * Correspondence: [email protected] or [email protected]; Tel.: +86-591-2286-2498 Received: 9 December 2019; Accepted: 24 December 2019; Published: 27 December 2019 Abstract: The abnormal accumulation of amyloid-β (Aβ) in the central nervous system is a hallmark of Alzheimer’s disease (AD). The regulation of the processing of the single- transmembrane amyloid precursor protein (APP) plays an important role in the generation of Aβ in the brain. The phosphorylation of APP and key enzymes involved in the proteolytic processing of APP has been demonstrated to be critical for modulating the generation of Aβ by either altering the subcellular localization of APP or changing the enzymatic activities of the secretases responsible for APP processing. In addition, the phosphorylation may also have an impact on the physiological function of these proteins. In this review, we summarize the kinases and signaling pathways that may participate in regulating the phosphorylation of APP and secretases and how this further affects the function and processing of APP and Aβ pathology. We also discuss the potential of approaches that modulate these phosphorylation-signaling pathways or kinases as interventions for AD pathology. Keywords: Alzheimer’s disease; APP processing; phosphorylation; amyloid-β; kinase 1. Introduction Current epidemiological studies estimate that there are approximately 45 million people suffering from dementia [1].
  • Proteome Analysis in a Mammalian Cell Line Reveals That PLK2 Is Involved in Avian Metapneumovirus Type C (Ampv/C)-Induced Apoptosis

    Proteome Analysis in a Mammalian Cell Line Reveals That PLK2 Is Involved in Avian Metapneumovirus Type C (Ampv/C)-Induced Apoptosis

    viruses Article Proteome Analysis in a Mammalian Cell Line Reveals that PLK2 Is Involved in Avian Metapneumovirus Type C (aMPV/C)-Induced Apoptosis Rong Quan y, Li Wei y, Lei Hou, Jing Wang, Shanshan Zhu, Zixuan Li, Moran Lv and Jue Liu * Beijing Key Laboratory for Prevention and Control of Infectious Diseases in Livestock and Poultry, Institute of Animal Husbandry and Veterinary Medicine, Beijing Academy of Agriculture and Forestry Sciences, No. 9 Shuguang Garden Middle Road, Haidian District, Beijing 100097, China; [email protected] (R.Q.); [email protected] (L.W.); [email protected] (L.H.); [email protected] (J.W.); [email protected] (S.Z.); [email protected] (Z.L.); [email protected] (M.L.) * Correspondence: [email protected]; Tel.: +86-10-51503671; Fax: +86-10-51503498 These authors contributed equally to this work. y Received: 24 December 2019; Accepted: 26 March 2020; Published: 28 March 2020 Abstract: Avian metapneumovirus subtype C (aMPV/C) causes an acute respiratory disease that has caused serious economic losses in the Chinese poultry industry. In the present study, we first explored the protein profile in aMPV/C-infected Vero cells using iTRAQ quantitative proteomics. A total of 921 of 7034 proteins were identified as significantly altered by aMPV/C infection. Three selected proteins were confirmed by Western blot analysis. Bioinformatics GO analysis revealed multiple signaling pathways involving cell cycle, endocytosis, and PI3K-Akt, mTOR, MAPK and p53 signaling pathways, which might participate in viral infection. In this analysis, we found that PLK2 expression was upregulated by aMPV/C infection and investigated whether it contributed to aMPV/C-mediated cellular dysfunction.
  • PLK2, Active Full Length Recombinant Protein Expressed in Sf9 Cells

    PLK2, Active Full Length Recombinant Protein Expressed in Sf9 Cells

    Catalog # Aliquot Size P42-10G-05 5 µg P42-10G-10 10 µg PLK2, Active Full length recombinant protein expressed in Sf9 cells Catalog # P42-10G Lot # U1534-6 Product Description Specific Activity Full length recombinant human PLK2 was expressed by baculovirus in Sf9 insect cells using an N-terminal GST tag. 64,000 The gene accession number is NM_006622. 48,000 Gene Aliases 32,000 SNK 16,000 Activity (cpm) Formulation 0 0 100 200 300 400 Recombinant protein stored in 50mM Tris-HCl, pH 7.5, Protein (ng) 150mM NaCl, 10mM glutathione, 0.1mM EDTA, 0.25mM The specific activity of PLK2 was determined to be 11 nmol DTT, 0.1mM PMSF, 25% glycerol. /min/mg as per activity assay protocol. Storage and Stability Purity Store product at –70oC. For optimal storage, aliquot target into smaller quantities after centrifugation and store at recommended temperature. For most favorable performance, avoid repeated handling and multiple The purity of PLK2 was freeze/thaw cycles. determined to be >80% by densitometry, approx. MW Scientific Background ~106kDa. PLK2 or Polo-like kinase 2 is a serum-inducible kinase that is a member of the Polo family of serine/threonine protein kinases which play an essential role in normal cell division (1). PLK2 phosphorylates the P4.1-associated protein (CPAP), a human homologue of SAS-4, in procentriole PLK2, Active formation during the centrosome cycle (2). PLK2 may also Full length human recombinant protein expressed in Sf9 cells play a role as a tumor suppressor since it interacts with TSC1 protein which in turn inhibits mTOR signaling, tumor Catalog # P42-10G growth and chemosensitivity under hypoxic conditions.
  • Inhibition of ERK 1/2 Kinases Prevents Tendon Matrix Breakdown Ulrich Blache1,2,3, Stefania L

    Inhibition of ERK 1/2 Kinases Prevents Tendon Matrix Breakdown Ulrich Blache1,2,3, Stefania L

    www.nature.com/scientificreports OPEN Inhibition of ERK 1/2 kinases prevents tendon matrix breakdown Ulrich Blache1,2,3, Stefania L. Wunderli1,2,3, Amro A. Hussien1,2, Tino Stauber1,2, Gabriel Flückiger1,2, Maja Bollhalder1,2, Barbara Niederöst1,2, Sandro F. Fucentese1 & Jess G. Snedeker1,2* Tendon extracellular matrix (ECM) mechanical unloading results in tissue degradation and breakdown, with niche-dependent cellular stress directing proteolytic degradation of tendon. Here, we show that the extracellular-signal regulated kinase (ERK) pathway is central in tendon degradation of load-deprived tissue explants. We show that ERK 1/2 are highly phosphorylated in mechanically unloaded tendon fascicles in a vascular niche-dependent manner. Pharmacological inhibition of ERK 1/2 abolishes the induction of ECM catabolic gene expression (MMPs) and fully prevents loss of mechanical properties. Moreover, ERK 1/2 inhibition in unloaded tendon fascicles suppresses features of pathological tissue remodeling such as collagen type 3 matrix switch and the induction of the pro-fbrotic cytokine interleukin 11. This work demonstrates ERK signaling as a central checkpoint to trigger tendon matrix degradation and remodeling using load-deprived tissue explants. Tendon is a musculoskeletal tissue that transmits muscle force to bone. To accomplish its biomechanical function, tendon tissues adopt a specialized extracellular matrix (ECM) structure1. Te load-bearing tendon compart- ment consists of highly aligned collagen-rich fascicles that are interspersed with tendon stromal cells. Tendon is a mechanosensitive tissue whereby physiological mechanical loading is vital for maintaining tendon archi- tecture and homeostasis2. Mechanical unloading of the tissue, for instance following tendon rupture or more localized micro trauma, leads to proteolytic breakdown of the tissue with severe deterioration of both structural and mechanical properties3–5.
  • PRODUCTS and SERVICES Target List

    PRODUCTS and SERVICES Target List

    PRODUCTS AND SERVICES Target list Kinase Products P.1-11 Kinase Products Biochemical Assays P.12 "QuickScout Screening Assist™ Kits" Kinase Protein Assay Kits P.13 "QuickScout Custom Profiling & Panel Profiling Series" Targets P.14 "QuickScout Custom Profiling Series" Preincubation Targets Cell-Based Assays P.15 NanoBRET™ TE Intracellular Kinase Cell-Based Assay Service Targets P.16 Tyrosine Kinase Ba/F3 Cell-Based Assay Service Targets P.17 Kinase HEK293 Cell-Based Assay Service ~ClariCELL™ ~ Targets P.18 Detection of Protein-Protein Interactions ~ProbeX™~ Stable Cell Lines Crystallization Services P.19 FastLane™ Structures ~Premium~ P.20-21 FastLane™ Structures ~Standard~ Kinase Products For details of products, please see "PRODUCTS AND SERVICES" on page 1~3. Tyrosine Kinases Note: Please contact us for availability or further information. Information may be changed without notice. Expression Protein Kinase Tag Carna Product Name Catalog No. Construct Sequence Accession Number Tag Location System HIS ABL(ABL1) 08-001 Full-length 2-1130 NP_005148.2 N-terminal His Insect (sf21) ABL(ABL1) BTN BTN-ABL(ABL1) 08-401-20N Full-length 2-1130 NP_005148.2 N-terminal DYKDDDDK Insect (sf21) ABL(ABL1) [E255K] HIS ABL(ABL1)[E255K] 08-094 Full-length 2-1130 NP_005148.2 N-terminal His Insect (sf21) HIS ABL(ABL1)[T315I] 08-093 Full-length 2-1130 NP_005148.2 N-terminal His Insect (sf21) ABL(ABL1) [T315I] BTN BTN-ABL(ABL1)[T315I] 08-493-20N Full-length 2-1130 NP_005148.2 N-terminal DYKDDDDK Insect (sf21) ACK(TNK2) GST ACK(TNK2) 08-196 Catalytic domain