DOCSLIB.ORG

Supplementary Information Supplementary Table 1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Information Supplementary Table 1 Supplementary information Supplementary Table 1 Kinase Type Format N Average SD (IC50) ALK Y Lantha 6 > 10 n.d. AURORA_A S/T Caliper 6 > 10 n.d. AXL Y Lantha 3 > 10 n.d. BTK Y Caliper 6 > 10 n.d. cABL Y Caliper 4 2.0 0.38 cABLT315 Y Caliper 6 > 10 n.d. CaMK2 S/T Caliper 3 > 10 n.d. CDK2A S/T Caliper 6 > 10 n.d. CDK4D1 S/T Caliper 3 > 10 n.d. CK1 S/T Caliper 3 > 10 n.d. cKIT Y Lantha 6 > 10 n.d. cMET Y Lantha 7 > 10 n.d. COT1 S/T Caliper 4 > 10 n.d. CSK Y Lantha 2 > 10 n.d. cSRC Y Lantha 3 > 10 n.d. EphA4 Y Lantha 6 > 10 n.d. EphB4 Y Lantha 6 > 10 n.d. ERK2 S/T Caliper 6 > 10 n.d. FAK Y Lantha 3 > 10 n.d. FGFR-1 Y Lantha 3 > 10 n.d. FGFR-2 Y Lantha 3 > 10 n.d. FGFR-3 Y Lantha 3 > 10 n.d. FGFR3K650E Y Lantha 6 > 10 n.d. FGFR-4 Y Lantha 6 > 10 n.d. FLT3 Y Lantha 3 > 10 n.d. FYN Y Lantha 3 > 10 n.d. GSK3beta S/T Caliper 6 > 10 n.d. HCK Y Lantha 3 > 10 n.d. HER1 Y Lantha 6 > 10 n.d. HER2 Y Lantha 6 > 10 n.d. HER4 Y Lantha 3 > 10 n.d. IGF1R Y Lantha 6 > 10 n.d. INS1R Y Lantha 6 > 10 n.d. IRAK4 S/T Caliper 3 > 10 n.d. 1 JAK1 Y Caliper 6 > 10 n.d. JAK2 Y Caliper 6 > 10 n.d. JAK3 Y Caliper 6 > 10 n.d. KDR Y Lantha 6 > 10 n.d. LCK Y Lantha 6 > 10 n.d. LYN Y Lantha 3 > 10 n.d. MK2 S/T Caliper 6 > 10 n.d. MK5 S/T Caliper 6 > 10 n.d. MNK1 S/T Caliper 2 > 10 n.d. MNK2 S/T Caliper 2 > 10 n.d. p38a S/T Caliper 6 > 10 n.d. PAK2-ATPactivated S/T Caliper 3 > 10 n.d. PDGFRa Y Lantha 6 > 10 n.d. PDK1 S/T Caliper 4 > 10 n.d. PIM2 S/T Caliper 3 > 10 n.d. PKA S/T Caliper 6 > 10 n.d. PKBa S/T Caliper 6 > 10 n.d. PKCalpha S/T Caliper 2 > 10 n.d. PKCtheta S/T Caliper 2 > 10 n.d. PKN1 S/T Caliper 2 > 10 n.d. PKN2 S/T Caliper 2 > 10 n.d. PLK1 S/T Caliper 3 > 10 n.d. RET Y Lantha 6 > 10 n.d. ROCK2 S/T Caliper 3 > 10 n.d. RON Y Lantha 3 > 10 n.d. S6K S/T Caliper 3 > 10 n.d. SYK Y Lantha 6 > 10 n.d. TYK2 Y Caliper 6 > 10 n.d. WNK1 S/T Caliper 3 > 10 n.d. YES Y Lantha 2 > 10 n.d. ZAP70 Y Lantha 3 > 10 n.d. 2 Supplementary Table 2 Kinase Inh. Kinase Inh. Kinase Inh. (%) (%) (%) CAMK1 (CaMK1) 14 ERBB2 (HER2) 7 NEK9 -2 CDK7/cyclin H/MNAT1 -8 ERBB4 (HER4) 9 NTRK1 (TRKA) 9 CDK9/cyclin T1 -15 FER 3 NTRK2 (TRKB) 10 CHUK (IKK alpha) -6 FES (FPS) 8 NTRK3 (TRKC) 10 DAPK1 -13 FGFR1 3 PAK2 (PAK65) 29 LRRK2 86 FGFR2 -2 PAK3 4 LRRK2 G2019S 61 FGFR3 13 PAK4 -6 PI4KB (PI4K beta) 98 FGFR3 K650E 2 PAK6 -24 PIK3C3 (hVPS34) -11 FGFR4 0 PAK7 (KIAA1264) -19 PIK3CA/PIK3R1 (p110 alpha/p85 alpha) 100 FGR 13 PASK -12 PIK3CD/PIK3R1 (p110 delta/p85 alpha) 100 FLT1 (VEGFR1) -1 PDGFRA (PDGFR alpha) 3 PIK3CG (p110 gamma) 92 FLT3 7 PDGFRA D842V 10 SPHK1 9 FLT3 D835Y 9 PDGFRA T674I 23 ABL1 78 FLT4 (VEGFR3) 14 PDGFRA V561D 10 ABL1 E255K 54 FRAP1 (mTOR) 61 PDGFRB (PDGFR beta) 5 ABL1 G250E 27 FRK (PTK5) 12 PDK1 6 ABL1 T315I 1 FYN 2 PHKG1 13 ABL1 Y253F 20 GRK4 12 PHKG2 -15 ABL2 (Arg) 39 GRK5 -2 PIM1 -12 ACVR1B (ALK4) -2 GRK6 9 PIM2 -10 ADRBK1 (GRK2) 1 GRK7 6 PKN1 (PRK1) 8 ADRBK2 (GRK3) -2 GSK3A (GSK3 alpha) 1 PLK1 15 AKT1 (PKB alpha) -4 GSK3B (GSK3 beta) 1 PLK2 6 AKT2 (PKB beta) -8 HCK 5 PLK3 4 AKT3 (PKB gamma) 5 HIPK1 (Myak) 12 PRKACA (PKA) 2 ALK -5 HIPK2 4 PRKCA (PKC alpha) -5 AMPK A1/B1/G1 9 HIPK4 64 PRKCB1 (PKC beta I) -7 AMPK A2/B1/G1 15 IGF1R 5 PRKCB2 (PKC beta II) -18 AURKA (Aurora A) 4 IKBKB (IKK beta) 4 PRKCD (PKC delta) 3 AURKB (Aurora B) 9 IKBKE (IKK epsilon) -4 PRKCE (PKC epsilon) -10 AURKC (Aurora C) 11 INSR 9 PRKCG (PKC gamma) -10 AXL 2 INSRR (IRR) 3 PRKCH (PKC eta) -15 BLK 6 IRAK4 9 PRKCI (PKC iota) 4 BMX 11 ITK 6 PRKCN (PKD3) 5 BRAF 12 JAK1 -3 PRKCQ (PKC theta) 4 BRAF V599E 45 JAK2 -9 PRKCZ (PKC zeta) -7 3 Kinase Inh. Kinase Inh. Kinase Inh. (%) (%) (%) BRSK1 (SAD1) 10 JAK2 JH1 JH2 -7 PRKD1 (PKC mu) -1 BTK 10 JAK2 JH1 JH2 V617F -6 PRKD2 (PKD2) 8 CAMK1D (CaMKI delta) -4 JAK3 0 PRKG1 2 CAMK2A(CaMKII alpha) -2 KDR (VEGFR2) 13 PRKG2 (PKG2) 15 CAMK2B (CaMKII beta) 0 KIT 11 PRKX 10 CAMK2D (CaMKII delta) 6 KIT T670I 25 PTK2 (FAK) 3 CAMK4 (CaMKIV) 6 LCK 8 PTK2B (FAK2) 8 CDC42 BPA (MRCKA) 3 LTK (TYK1) 4 PTK6 (Brk) 11 CDC42 BPB (MRCKB) 13 LYN A -7 RAF1Y340D Y341D 47 CDK1/cyclin B 15 LYN B 0 RET -1 CDK2/cyclin A 8 MAP2K1 (MEK1) 18 RET V804L 0 CDK5/p25 5 MAP2K2 (MEK2) -2 RET Y791F -9 CDK5/p35 2 MAP2K6 (MKK6) 2 ROCK1 -7 CHEK1 (CHK1) 16 MAP3K8 (COT) 12 ROCK2 16 CHEK2 (CHK2) 0 MAP3K9 (MLK1) 0 ROS1 9 CLK1 10 MAP4K2 (GCK) -2 RPS6KA1 (RSK1) -3 CLK2 91 MAP4K4 (HGK) 20 RPS6KA2 (RSK3) 13 CLK3 62 MAP4K5 (KHS1) -14 RPS6KA3 (RSK2) 7 CSF1R (FMS) 13 MAPK1 (ERK2) 8 RPS6KA4 (MSK2) 0 CSK -5 MAPK10 (JNK3) -13 RPS6KA5 (MSK1) 5 CSNK1A1 (CK1 alpha 1) 11 MAPK11 (p38 beta) -3 RPS6KA6 (RSK4) -8 CSNK1D (CK1 delta) 26 MAPK12 (p38 gamma) 6 RPS6KB1 (p70S6K) 6 CSNK1E (CK1 epsilon) 7 MAPK13 (p38 delta) 3 SGK (SGK1) -2 CSNK1G1(CK1gamma1) 4 MAPK14 (p38 alpha) 25 SGK2 -2 CSNK1G2(CK1gamma2) 2 MAPK14 (p38 alpha) Direct 0 SGKL (SGK3) 11 CSNK1G3(CK1gamma3) 9 MAPK3 (ERK1) 14 SNF1LK2 15 CSNK2A1 (CK2 alpha 1) -4 MAPK8 (JNK1) 38 SRC 5 CSNK2A2 (CK2 alpha 2) 15 MAPK9 (JNK2) 15 SRC N1 -5 DAPK3 (ZIPK) 8 MAPKAPK2 3 SRMS (Srm) 3 DCAMKL2 (DCK2) 6 MAPKAPK3 14 SRPK1 5 DYRK1A 28 MAPKAPK5 (PRAK) 4 SRPK2 3 DYRK1B 22 MARK1 (MARK) 10 STK22B (TSSK2) -3 DYRK3 39 MARK2 2 STK22D (TSSK1) -5 DYRK4 5 MARK3 21 STK23 (MSSK1) 15 EEF2K 6 MARK4 11 STK24 (MST3) 14 EGFR (ErbB1) 5 MATK (HYL) 2 STK25 (YSK1) -4 EGFR (ErbB1) L858R 6 MELK -2 STK3 (MST2) -11 EGFR (ErbB1) L861Q 3 MERTK (cMER) 11 STK4 (MST1) -7 EGFR (ErbB1) T790M 6 MET (cMet) 5 SYK -1 EGFR T790M L858R 4 MET M1250T 9 TAOK2 (TAO1) -3 4 Kinase Inh. Kinase Inh. Kinase Inh. (%) (%) (%) EPHA1 6 MINK1 -8 TBK1 5 EPHA2 15 MST1R (RON) 7 TEK (Tie2) -1 EPHA3 5 MST4 -15 TYK2 2 EPHA4 0 MUSK -3 TYRO3 (RSE) 1 EPHA5 12 MYLK2 (skMLCK) 9 YES1 4 EPHA8 2 NEK1 43 ZAP70 11 EPHB1 -5 NEK2 -18 EPHB2 4 NEK4 -2 EPHB3 -2 NEK6 3 8 EPHB4 6 NEK7 Supplementary Table 3 Kinase target NVP-BYL719 (% Control) AAK1 10 CLK1 7.7 CLK2 2.3 GAK 5.6 HIPK4 6.8 PIK3C2B 4 PIK3CA 0.05 PIK3CA (C420R) 0 PIK3CA (E542K) 0 PIK3CA (E545K) 0 PIK3CA (H1047L) 2.4 PIK3CA (H1047Y) 0.6 PIK3CA (I800L) 0.4 PIK3CA (M1043I) 0 PIK3CA (Q546Q) 0 PIK3CD 5.9 PIK3CG 0 PIK4CB 0 5 Supplementary Table 4 Kinase target NVP-BYL719 Kd (nmol/L) AAK1 2‘800 CLK1 900 CLK2 1‘600 GAK 1‘100 HIPK4 540 PIK3C2B 510 PIK3CA 2.3 PIK3CB 2‘000 PIK3CD 510 PIK3CG 8 PIK4CB 120 6 Supplementary Table 5 Tumor xenografts Animal Dose Treatment T/C S473P-Akt PIK3CA species (mg/kg) duration (%) IC80 (μmol/L) Genetic (days) alterations A2780 mouse 50 21 0.34 n.d. WT A375 mouse 50 12 0.37 Not achieved WT BT474 mouse 12.5 14 0.31 15 MUT BT474 mouse 25 14 0.17 15 MUT BT474 mouse 50 14 0.04 15 MUT Colo 205 mouse 50 13 0.07 Not achieved WT DU145 mouse 50 21 0.15 13 WT EBC1 mouse 50 32 0.42 n.d. WT HCC1954 mouse 50 21 0.11 8 MUT HCT116 mouse 50 21 0.38 Not achieved MUT HGC-27 mouse 50 14 0.03 3 MUT KYSE-70 mouse 50 27 0.03 8 AMP MCF-7 mouse 50 23 0.01 22 MUT Mia PaCa-2 mouse 50 21 0.60 n.d. WT NCI-H596 mouse 50 18 -0.06 10 MUT NCI-H596 rat 20 12 0.25 10 MUT NCI-H596 rat 40 14 -0.35 10 MUT NCI-H596 rat 80 10 -0.80 10 MUT NCI-N87 mouse 50 14 -0.01 15 WT PANC-1 mouse 50 21 0.55 n.d. WT PC3 mouse 50 21 0.67 n.d. WT Rat1-myr-p110α rat 6.25 13 0.22 4 WT 7 Rat1-myr-p110α rat 12.5 13 0.05 4 WT Rat1-myr-p110α rat 25 13 -0.35 4 WT Rat1-myr-p110α rat 30 14 -0.60 4 WT Rat1-myr-p110α rat 50 14 -0.80 4 WT RT112 mouse 50 7 -0.01 n.d.
Load more

Recommended publications
  • IRAK4 Gene Interleukin 1 Receptor Associated Kinase 4
    IRAK4 gene interleukin 1 receptor associated kinase 4 Normal Function The IRAK4 gene provides instructions for making a protein that plays an important role in innate immunity, which is the body's early, nonspecific response to foreign invaders ( pathogens). The IRAK-4 protein is part of a signaling pathway that is involved in early recognition of pathogens and the initiation of inflammation to fight infection. In particular, the IRAK-4 protein relays signals from proteins called Toll-like receptors and IL-1 receptor-related proteins. As one of the first lines of defense against infection, Toll-like receptors recognize patterns that are common to many pathogens, rather than recognizing specific pathogens, and stimulate a quick immune response. The IL-1 receptor and related proteins recognize immune system proteins called cytokines that signal the need for an immune response. The resulting signaling pathway triggers inflammation, a nonspecific immune response that helps fight infection. Health Conditions Related to Genetic Changes IRAK-4 deficiency At least 20 mutations in the IRAK4 gene have been identified in people with IRAK-4 deficiency, an immune system disorder that leads to recurrent invasive bacterial infections. These gene mutations lead to an abnormally short, nonfunctional IRAK-4 protein or no protein at all. The loss of functional IRAK-4 protein blocks the initiation of inflammation in response to pathogens or cytokines that would normally help fight the infections. Because the early immune response is insufficient, bacterial
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • Anti-PRKCA / PKC-Alpha Antibody (Aa623-672) Rabbit Anti Human Polyclonal Antibody Catalog # ALS17942
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 Anti-PRKCA / PKC-Alpha Antibody (aa623-672) Rabbit Anti Human Polyclonal Antibody Catalog # ALS17942 Specification Anti-PRKCA / PKC-Alpha Antibody (aa623-672) - Product Information Application IHC-P, E Primary Accession P17252 Predicted Human, Mouse, Rat Host Rabbit Clonality Polyclonal Isotype IgG Calculated MW 76750 Anti-PRKCA / PKC-Alpha Antibody (aa623-672) - Additional Information Gene ID 5578 Alias Symbol PRKCA Other Names PRKCA, Aging-associated gene 6, AAG6, Alpha PKC, PKC-A, Pkcalpha, Protein kinase C alpha type, PKC Alpha, PKC-alpha, PKCA, Protein kinase c alpha, Protein kinase C, alpha Target/Specificity PRKCA Antibody detects endogenous levels of total PRKCA protein. Reconstitution & Storage Immunoaffinity purified Precautions Anti-PRKCA / PKC-Alpha Antibody (aa623-672) is for research use only and not for use in diagnostic or therapeutic procedures. Anti-PRKCA / PKC-Alpha Antibody (aa623-672) - Protein Information Name PRKCA Synonyms PKCA, PRKACA Function Page 1/4 10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 Calcium-activated, phospholipid- and diacylglycerol (DAG)- dependent serine/threonine-protein kinase that is involved in positive and negative regulation of cell proliferation, apoptosis, differentiation, migration and adhesion, tumorigenesis, cardiac hypertrophy, angiogenesis, platelet function and inflammation, by directly phosphorylating targets such as RAF1, BCL2, CSPG4, TNNT2/CTNT, or activating signaling cascade involving MAPK1/3 (ERK1/2) and RAP1GAP. Involved in cell proliferation and cell growth arrest by positive and negative regulation of the cell cycle. Can promote cell growth by phosphorylating and activating RAF1, which mediates the activation of the MAPK/ERK signaling cascade, and/or by up-regulating CDKN1A, which facilitates active cyclin-dependent kinase (CDK) complex formation in glioma cells.
    [Show full text]
  • Generation of the Catalytic Fragment of Protein Kinase C Alpha in Vasospastic Canine Basilar Artery
    Neurosurg Focus 3 (4):Article 4, 1997. Generation of the catalytic fragment of protein kinase C alpha in vasospastic canine basilar artery Motohiko Sato, M.D., Eiichi Tani, M.D., Tsuyoshi Matsumoto, M.D., Hirokazu Fujikawa, M.D., and Shinobu Imajoh-Ohmi, Ph.D. Department of Neurosurgery, Hyogo College of Medicine, Hyogo, Japan; and Institute of Medical Science, University of Tokyo, Tokyo, Japan In previous studies of topical application of calphostin C, a specific inhibitor of the regulatory domain of protein kinase C (PKC), and calpeptin, a selective inhibitor of calpain, to spastic canine basilar artery (BA) researchers have suggested that the catalytic fragment of PKC (known as PKM) is probably formed by a limited proteolysis of continuously activated µ-calpain, but there has been no direct evidence for PKM formation in vasospasm. The present immunoblot study with anti-PKC-alpha antibody shows a significant decrease in cytosolic 80-kD PKC-alpha and a concomitantly significant increase in membrane PKC-alpha in the spastic canine BA. In addition, an immunoblot study in which cleavage site­directed antibodies were used demonstrated a significant increase in immunoreactive 45-kD PKM. The changes in membrane PKC-alpha and PKM were enhanced with the lapse of time after subarachnoid hemorrhage. The cleavage site­directed antibodies distinguish the proteolyzed from the unproteolyzed forms of PKC for in situ analyses of enzyme regulation mediated by proteolysis. The data indicate that PKC-alpha in spastic canine BA is translocated to the cell membrane, where PKC-alpha is rapidly cleaved into PKM as a result of proteolysis of the isozyme by µ-calpain but not by m-calpain.
    [Show full text]
  • Polo-Like Kinases Mediate Cell Survival in Mitochondrial Dysfunction
    Polo-like kinases mediate cell survival in mitochondrial dysfunction Takumi Matsumotoa,1, Ping-yuan Wanga,1, Wenzhe Maa, Ho Joong Sunga, Satoaki Matobab, and Paul M. Hwanga,2 aTranslational Medicine Branch, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD 20892; and bCardiovascular Medicine, Kyoto Prefectural University of Medicine, Kyoto 602-8566, Japan Edited by Solomon H. Snyder, Johns Hopkins University School of Medicine, Baltimore, MD, and approved July 10, 2009 (received for review April 16, 2009) Cancer cells often display defects in mitochondrial respiration, thus significant respiration (Fig. S1). For the described in vitro the identification of pathways that promote cell survival under this experiments, one representative SCO2-/- cell line was used. metabolic state may have therapeutic implications. Here, we report However, all significant findings were reproduced or confirmed that the targeted ablation of mitochondrial respiration markedly using at least one additional SCO2-/- cell line that was obtained increases expression of Polo-like kinase 2 (PLK2) and that it is by an independent homologous recombination event to rule out required for the in vitro growth of these nonrespiring cells. clonal variability. Furthermore, we identify PLK2 as a kinase that phosphorylates In an attempt to identify genes associated with the cell cycle Ser-137 of PLK1, which is sufficient to mediate this survival signal. that may enable the survival of SCO2-/- cells after disruption of In vivo, knockdown of PLK2 in an isogenic human cell line with a respiration, we compared microarray gene expression of respir- modest defect in mitochondrial respiration eliminates xenograft ing SCO2ϩ/ϩ and nonrespiring SCO2-/- HCT116 human colon formation, indicating that PLK2 activity is necessary for growth of cancer cells (Table S1).
    [Show full text]
  • Supplementary Figure S1. Intracellular Ca2+ Levels Following Decursin Treatment in F11 Cells in the Presence of Menthol
    Supplementary Figure S1. Intracellular Ca2+ levels following decursin treatment in F11 cells in the presence of menthol (A) Intracellular Ca2+ levels after treatment with decursin every 3 s. The red arrow indicates the duration of treatment with 200 μM of menthol and decursin. NC: The negative control treated with DMSO only; PC: The positive control treated with 200 μM menthol without decursin. (B) Average intracellular Ca2+ levels after treatment with decursin. The average was quantified from the normalized Δ340/380 ratio for 10 cycles after treatment with the decursin solution at the 10th cycle, as shown in Fig. 1A. The normalized Δ340/380 ratio was calculated using the following for- mula: [ratio of fluorescence intensity at 510 nm (emission) to that at 340 nm (excitation)]/[ratio of fluorescence intensity at 510 nm (emission) to that at a wavelength of 380 nm (excitation)]. Cells 2021, 10, 547. https://doi.org/10.3390/cells10030547 www.mdpi.com/journal/cells Cells 2021, 10, 547 2 of 5 Table S1. List of protein targets of decursin detected by the SwissTargetPrediction web tool Common Target Uniprot ID ChEMBL ID Target Class Probability name Poly [ADP-ribose] polymerase-1 PARP1 P09874 CHEMBL3105 Enzyme 0.104671941 N-acylsphingosine-amidohydro- NAAA Q02083 CHEMBL4349 Enzyme 0.104671941 lase Acid ceramidase ASAH1 Q13510 CHEMBL5463 Enzyme 0.104671941 Family A G protein- Neuropeptide Y receptor type 5 NPY5R Q15761 CHEMBL4561 0.104671941 coupled receptor Family A G protein- Melatonin receptor 1A MTNR1A P48039 CHEMBL1945 0.104671941 coupled
    [Show full text]
  • Cytokine Signaling Through the Novel Tyrosine Kinase RAFTK in Kaposi's
    Cytokine Signaling Through the Novel Tyrosine Kinase RAFTK in Kaposi’s Sarcoma Cells Zhong-Ying Liu,* Ramesh K. Ganju,*Jian-Feng Wang,* Mel A. Ona,* William C. Hatch,* Tong Zheng,‡ Shalom Avraham,* Parkash Gill,‡ and Jerome E. Groopman* *Divisions of Experimental Medicine and Hematology/Oncology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts 02215; and ‡Division of Hematology/Oncology, Norris Cancer Center, University of Southern California, Los Angeles, California 90033 Abstract believed to be from the lymphatic endothelium (1–2). Etiolog- ical factors implicated in KS include the recently discovered A number of cytokines, including basic fibroblast growth human herpesvirus 8 (HHV-8)/Kaposi’s sarcoma herpesvirus factor (bFGF), vascular endothelial growth factor (VEGF), (KSHV) and TAT, the soluble transcriptional activator of oncostatin M (OSM), IL-6, and tumor necrosis factor alpha HIV (3–7). Considerable data indicate a role for endogenous (TNF-a), have been postulated to have a role in the patho- and exogenous cytokines in the pathogenesis of KS (8–16). genesis of Kaposi’s sarcoma (KS). The proliferative effects Growth factors such as basic fibroblast growth factor (bFGF) of bFGF and OSM may be via their reported activation of and vascular endothelial growth factor (VEGF), which are the c-Jun NH2-terminal kinase (JNK) signaling pathway in known to stimulate the mitogenesis of certain types of endo- KS cells. We now report that KS cells express a recently thelium, as well as Oncostatin M (OSM), IL-6, and tumor ne- identified focal adhesion kinase termed RAFTK which ap- crosis factor alpha (TNF-a) which are elaborated during in- pears in other cell systems to coordinate surface signals be- flammatory conditions, have been implicated in promoting KS tween cytokine and integrin receptors and the cytoskeleton cell growth (17–25).
    [Show full text]
  • Effects of Simultaneous Knockdown of HER2 and PTK6 on Malignancy and Tumor Progression in Human Breast Cancer Cells
    Published OnlineFirst January 30, 2013; DOI: 10.1158/1541-7786.MCR-12-0378 Molecular Cancer Oncogenes and Tumor Suppressors Research Effects of Simultaneous Knockdown of HER2 and PTK6 on Malignancy and Tumor Progression in Human Breast Cancer Cells Natalie Ludyga1, Natasa Anastasov2, Michael Rosemann2, Jana Seiler1, Nadine Lohmann1, Herbert Braselmann3, Karin Mengele4, Manfred Schmitt4, Heinz Ho€fler1,5, and Michaela Aubele1 Abstract Breast cancer is the most common malignancy in women of the Western world. One prominent feature of breast cancer is the co- and overexpression of HER2 and protein tyrosine kinase 6 (PTK6). According to the current clinical cancer therapy guidelines, HER2-overexpressing tumors are routinely treated with trastuzumab, a humanized monoclonal antibody targeting HER2. Approximately, 30% of HER2-overexpressing breast tumors at least initially respond to the anti-HER2 therapy, but a subgroup of these tumors develops resistance shortly after the administration of trastuzumab. A PTK6-targeted therapy does not yet exist. Here, we show for the first time that the simultaneous knockdown in vitro, compared with the single knockdown of HER2 and PTK6, in particular in the trastuzumab-resistant JIMT-1 cells, leads to a significantly decreased phosphorylation of crucial signaling proteins: mitogen-activated protein kinase 1/3 (MAPK 1/3, ERK 1/2) and p38 MAPK, and (phosphatase and tensin homologue deleted on chromosome ten) PTEN that are involved in tumorigenesis. In addition, dual knockdown strongly reduced the migration and invasion of the JIMT-1 cells. Moreover, the downregulation of HER2 and PTK6 led to an induction of p27, and the dual knockdown significantly diminished cell proliferation in JIMT-1 and T47D cells.
    [Show full text]
  • Profiling Data
    Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8
    [Show full text]
  • Itk Tyrosine Kinase Substrate Docking Is Mediated by a Nonclassical SH2 Domain Surface of PLC␥1
    Itk tyrosine kinase substrate docking is mediated by a nonclassical SH2 domain surface of PLC␥1 Lie Min, Raji E. Joseph, D. Bruce Fulton, and Amy H. Andreotti1 Department of Biochemistry, Biophysics, and Molecular Biology, Iowa State University, Ames, IA 50011 Edited by Susan S. Taylor, University of California at San Diego, La Jolla, CA, and approved October 20, 2009 (received for review October 1, 2009) Interleukin-2 tyrosine kinase (Itk) is a Tec family tyrosine kinase that We have previously shown that the PLC␥1 SH2C domain mediates signaling processes after T cell receptor engagement. Acti- (spanning residues 659–756 within full-length PLC␥1) binds di- vation of Itk requires recruitment to the membrane via its pleckstrin rectly to the Itk kinase domain and is required for efficient homology domain, phosphorylation of Itk by the Src kinase, Lck, and phosphorylation of Y783 by Itk (26). Fragments of PLC␥1 that binding of Itk to the SLP-76/LAT adapter complex. After activation, Itk contain Y783 but not the SH2C domain are not efficiently phos- phosphorylates and activates phospholipase C-␥1 (PLC-␥1), leading to phorylated by Itk. Moreover, phosphorylation of PLC␥1 substrate production of two second messengers, DAG and IP3. We have previ- fragments that contain both SH2C and Y783 (spanning 659–789, ously shown that phosphorylation of PLC-␥1 by Itk requires a direct, hereafter referred to as PLC␥1 SH2C-linker) can be inhibited by phosphotyrosine-independent interaction between the Src homol- titration with isolated PLC␥1 SH2C domain (26). The excess, free ogy 2 (SH2) domain of PLC-␥1 and the kinase domain of Itk.
    [Show full text]
  • Targeting Myddosome Signaling in Waldenström’S
    Author Manuscript Published OnlineFirst on August 20, 2018; DOI: 10.1158/1078-0432.CCR-17-3265 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. IRAK 1/4 Inhibition in Waldenström’s Ni, H. et al. Targeting Myddosome Signaling in Waldenström’s Macroglobulinemia with the Interleukin-1 Receptor- associated Kinase 1/4 Inhibitor R191 Haiwen Ni1,2,#, Fazal Shirazi2,#, Veerabhadran Baladandayuthapani3, Heather Lin3, Isere Kuiatse2, Hua Wang2, Richard J. Jones2, Zuzana Berkova2, Yasumichi Hitoshi4, Stephen M. Ansell5, Steven P. Treon6, Sheeba K. Thomas2, Hans C. Lee2, Zhiqiang Wang2, R. Eric Davis2, and Robert Z. Orlowski2,7,* 1Department of Hematology, The Affiliated Hospital of Nanjing University of Traditional Chinese Medicine, Nanjing, JangSu, China; 2Department of Lymphoma and Myeloma, The University of Texas MD Anderson Cancer Center, Houston, TX; 3Department of Biostatistics, The University of Texas MD Anderson Cancer Center, Houston, TX; 4Rigel, South San Francisco, CA; The 5Division of Hematology, Mayo Clinic, Rochester, MN; The 6Dana Farber Cancer Institute, Harvard Medical School, Boston, MA. 7Department of Experimental Therapeutics, The University of Texas MD Anderson Cancer Center, Houston, TX #Indicates that these authors contributed equally. Address correspondence to: Dr. Robert Z. Orlowski, The University of Texas MD Anderson Cancer Center, Department of Lymphoma and Myeloma, 1515 Holcombe Blvd., Unit 429, Houston, TX 77030-4009, E-mail: [email protected], Telephone 713-794-3234, Fax 713- 563-5067 Page 1 Downloaded from clincancerres.aacrjournals.org on September 24, 2021. © 2018 American Association for Cancer Research. Author Manuscript Published OnlineFirst on August 20, 2018; DOI: 10.1158/1078-0432.CCR-17-3265 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
    [Show full text]