DOCSLIB.ORG

Polo-Like Kinases Mediate Cell Survival in Mitochondrial Dysfunction

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Polo-Like Kinases Mediate Cell Survival in Mitochondrial Dysfunction Polo-like kinases mediate cell survival in mitochondrial dysfunction Takumi Matsumotoa,1, Ping-yuan Wanga,1, Wenzhe Maa, Ho Joong Sunga, Satoaki Matobab, and Paul M. Hwanga,2 aTranslational Medicine Branch, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD 20892; and bCardiovascular Medicine, Kyoto Prefectural University of Medicine, Kyoto 602-8566, Japan Edited by Solomon H. Snyder, Johns Hopkins University School of Medicine, Baltimore, MD, and approved July 10, 2009 (received for review April 16, 2009) Cancer cells often display defects in mitochondrial respiration, thus significant respiration (Fig. S1). For the described in vitro the identification of pathways that promote cell survival under this experiments, one representative SCO2-/- cell line was used. metabolic state may have therapeutic implications. Here, we report However, all significant findings were reproduced or confirmed that the targeted ablation of mitochondrial respiration markedly using at least one additional SCO2-/- cell line that was obtained increases expression of Polo-like kinase 2 (PLK2) and that it is by an independent homologous recombination event to rule out required for the in vitro growth of these nonrespiring cells. clonal variability. Furthermore, we identify PLK2 as a kinase that phosphorylates In an attempt to identify genes associated with the cell cycle Ser-137 of PLK1, which is sufficient to mediate this survival signal. that may enable the survival of SCO2-/- cells after disruption of In vivo, knockdown of PLK2 in an isogenic human cell line with a respiration, we compared microarray gene expression of respir- modest defect in mitochondrial respiration eliminates xenograft ing SCO2ϩ/ϩ and nonrespiring SCO2-/- HCT116 human colon formation, indicating that PLK2 activity is necessary for growth of cancer cells (Table S1). PLK2 was the most highly expressed cells with compromised respiration. Our findings delineate a mi- gene in the SCO2-/- cells (Table S1), and two features made it tochondrial dysfunction responsive cell cycle pathway critical for stand out as a potential stress-responsive gene for cell survival determining cancer cell outcome. signaling. PLK2 is essential for cell viability in the setting of DNA damage but not under normal conditions (15), and interestingly, cell cycle ͉ respiration ͉ sco2 it had also been reported to be regulated by calcium in a model of synaptic plasticity (16). Because calcium is a well-established itochondrial dysfunction with increased dependence on mitochondrial retrograde signal (17, 18), PLK2 appeared to be Mglycolysis is frequently observed in cancer cells, and a strong candidate gene that could mediate cell survival signaling significant advances have been made to clarify the genetic basis in mitochondrial dysfunction. for this metabolic phenomenon (1, 2). This increase in glycolysis The increased expression of PLK2 in the SCO2-/- cell was may represent a compensatory mechanism responding to the confirmed by both mRNA and protein levels (Fig. 1 A and B). bioenergetic stress of decreased oxidative phosphorylation as We stably re-expressed SCO2 cDNA in SCO2-/- cells to rescue initially described by Warburg (3). Analogous to the importance respiration (Fig. S1B) and observed a concomitant decrease in of cell cycle checkpoints in determining cell fate after DNA PLK2 expression (Fig. 1 A and B). To test whether PLK2 is damage, the regulation of the cell cycle by signals initiated by generally inducible by disruption of respiration, we added block- ϩ ϩ mitochondrial dysfunction may similarly govern outcome (4, 5). ers of mitochondrial complex I, III, or IV to SCO2 / cells and Thus, insights into the mediators that enable cell growth after observed increased PLK2 mRNA in response to each agent disruption of respiration may help advance our understanding of compared to control (Fig. 1A). We next considered how dis- cancer biology with potential therapeutic applications. ruption of respiration might trigger PLK2 expression. Because of To investigate the adaptive changes associated with mitochon- the previous association between PLK2 expression and calcium drial dysfunction, we disrupted SCO2, a metallochaperone gene in neurons (16), we measured cytosolic-free calcium in SCO2-/- essential for cytochrome c oxidase (complex IV) assembly and cells using the Fluo-4 a.m. calcium indicator. Compared to respiration (6), in a human colon cancer cell line (SCO2-/- wild-type cells, nonrespiring SCO2-/- cells had significantly HCT116 cell line). Unlike mitochondrial dysfunction induced by elevated calcium levels (Fig. S2A). When the intracellular the depletion of the entire mitochondrial genome (mtDNA), calcium was lowered using a membrane-permeable calcium somatic cell homologous recombination allowed us to selectively chelator BAPTA/AM, PLK2 mRNA expression decreased in a ablate respiration through disruption of a single nuclear gene, dose-dependent manner (Fig. S2B). Thus, our data indicate that providing us with paired isogenic cell lines for comparison. In elevated intracellular calcium associated with the disruption of this respiration-deficient context, Polo-like kinase 2 (PLK2) was mitochondrial function in SCO2-/- cells is a major trigger for the most highly expressed gene in SCO2-/- cells compared to PLK2 expression. respiring wild-type SCO2ϩ/ϩ cells. PLK2 belongs to a family of cell cycle Ser/Thr kinases represented by PLK1, the prototypical PLK2 Preferentially Phosphorylates PLK1 Ser-137. To identify down- member overexpressed in many human cancers (7–9). Here, we stream mediators of PLK2 signaling, we performed a kinase identify PLK2 as a kinase for PLK1 and report that the phos- substrate screen using purified PLK2. Unexpectedly, the optimal phorylation of PLK1 Ser-137 is sufficient to mediate the signal necessary for survival of cells with compromised respiration. Author contributions: T.M., P.-y.W., and P.M.H. designed research; T.M., P.-y.W., W.M., and H.J.S. performed research; T.M., P.-y.W., and S.M. contributed new reagents/analytic tools; Results T.M., P.-y.W., W.M., H.J.S., and P.M.H. analyzed data; and P.-y.W. and P.M.H. wrote the Mitochondrial Dysfunction Induces PLK2 Expression. Using the so- paper. matic cell homologous recombination technique (10–13), we The authors declare no conflict of interest. disrupted the remaining wild-type allele of the SCO2 gene, This article is a PNAS Direct Submission. known to be essential for mitochondrial respiration (6), using the 1T.M. and P.-y.W. contributed equally to this work. human colon cancer HCT116 SCO2ϩ/- cell line that we had 2To whom correspondence should be addressed. E-mail: [email protected]. previously reported (14). We confirmed disruption of both This article contains supporting information online at www.pnas.org/cgi/content/full/ copies of SCO2 allele by genomic PCR and by the absence of 0904229106/DCSupplemental. 14542–14546 ͉ PNAS ͉ August 25, 2009 ͉ vol. 106 ͉ no. 34 www.pnas.org͞cgi͞doi͞10.1073͞pnas.0904229106 Downloaded by guest on October 1, 2021 SCO2 +/+ SCO2 +/- SCO2 -/- A P<0.01 8 A 8 * 6 NS 6 shRNA 4 4 * * 2 PLK2 2 shRNA Relative PLK2 mRNA PLK2 Relative 0 0 SCO2: +/+ -/- -/- CTL I III IV (+SCO2) Inhibited complex B P<0.01 P<0.02 100 (+SCO2) Kinase assay BCSCO2: +/+ -/- -/- PLK2: SCO2 - - + 80 ATP: - + + PLK2 PLK1- 60 PLK1 S137-P 40 PLK1-S137-P PLK1- T210-P number Colony % of NS shRNA % 20 PLK1-T210-P PLK1 Actin 0 shRNA: NS PLK2 NS PLK2 NS PLK2 D SCO2 -/- SCO2 +/+ SCO2 +/+ SCO2 +/- SCO2 -/- shRNA Over- knockdown expression L C SCO2: +/+ -/- +/- T NS PLK2 GFP PLK2 C e v PLK2 shRNA - + - + - + - + - + i t PLK2 i Time (d) 4 4 0 2 4 os P 37 PLK1 Pro- caspase 3 PLK1-S137-P 26 Cleaved- 19 PLK1-T210-P caspase 3 15 HMGB1 Actin in medium Fig. 1. Disruption of mitochondrial respiration increases expression of PLK2 Fig. 2. PLK2 promotes the survival of cells with mitochondrial dysfunction. that phosphorylates Ser-137 of PLK1. (A) PLK2 mRNA expression analyzed by (A) After being transduced with control nonspecific (NS) or PLK2-specific RT-PCR in cells with genetic and pharmacologic disruption of respiration. shRNA lentivirus to knockdown PLK2, equal numbers of cells were cultured SCO2ϩ/ϩ cell respiration was inhibited by complex I, III, or IV blockers: and then visualized by crystal violet staining. (B) Quantification of colony Rotenone (100 nM); antimycin A (100 ng/mL); or sodium azide (500 ␮M), formation following PLK2 knockdown in SCO2ϩ/ϩ, SCO2ϩ/-, and SCO2-/- respectively. (*) denotes P Ͻ 0.01 versus control (CTL). Mean Ϯ SD, n ϭ 4. (B) cells. Mean Ϯ SD, n ϭ 3. (C) Cells transduced with the indicated shRNA Confirmation of SCO2 and PLK2 protein expression in SCO2ϩ/ϩ, SCO2-/-, and lentivirus were subcultured in fresh medium. After the indicated culture times, after rescue of respiration by re-expression of SCO2 (ϩSCO2) in SCO2-/- cells. equivalent amounts of culture media and cell lysates were measured for (C) In vitro phosphorylation of PLK1 by PLK2 (slot blot). (D) Effect on PLK1 HMGB1 release (representing necrosis) and caspase 3 cleavage products (rep- phosphorylation by PLK2-specific or control nonspecific (NS) shRNA lentiviral resenting apoptosis), respectively, by western blotting. SCO2ϩ/ϩ cells were knockdown of PLK2 in SCO2-/- cells. Conversely, the effect of PLK2 or control treated for 24 h with 5-fluorouracil as positive control (CTL) for apoptosis. GFP lentivirus overexpression in SCO2ϩ/ϩ cells. To further confirm that PLK2 phosphorylates PLK1-S137 in peptide substrate belonged to another PLK family member, cells, we examined the effect of depleting PLK2 in SCO2-/- cells specifically, Ser-137 in the catalytic domain of PLK1 (PLK1- by using shRNA lentivirus or the effect of overexpressing PLK2 S137) (Table S2). Our in vitro phosphorylation result was in SCO2ϩ/ϩ cells by using PLK2 lentivirus. We observed good supported by higher PLK1-S137-P levels despite lower total concordance between PLK2 and PLK1-S137-P levels but not to PLK1 protein in SCO2-/- cells compared to SCO2ϩ/ϩ cells (Fig.
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Application of a MYC Degradation
    SCIENCE SIGNALING | RESEARCH ARTICLE CANCER Copyright © 2019 The Authors, some rights reserved; Application of a MYC degradation screen identifies exclusive licensee American Association sensitivity to CDK9 inhibitors in KRAS-mutant for the Advancement of Science. No claim pancreatic cancer to original U.S. Devon R. Blake1, Angelina V. Vaseva2, Richard G. Hodge2, McKenzie P. Kline3, Thomas S. K. Gilbert1,4, Government Works Vikas Tyagi5, Daowei Huang5, Gabrielle C. Whiten5, Jacob E. Larson5, Xiaodong Wang2,5, Kenneth H. Pearce5, Laura E. Herring1,4, Lee M. Graves1,2,4, Stephen V. Frye2,5, Michael J. Emanuele1,2, Adrienne D. Cox1,2,6, Channing J. Der1,2* Stabilization of the MYC oncoprotein by KRAS signaling critically promotes the growth of pancreatic ductal adeno- carcinoma (PDAC). Thus, understanding how MYC protein stability is regulated may lead to effective therapies. Here, we used a previously developed, flow cytometry–based assay that screened a library of >800 protein kinase inhibitors and identified compounds that promoted either the stability or degradation of MYC in a KRAS-mutant PDAC cell line. We validated compounds that stabilized or destabilized MYC and then focused on one compound, Downloaded from UNC10112785, that induced the substantial loss of MYC protein in both two-dimensional (2D) and 3D cell cultures. We determined that this compound is a potent CDK9 inhibitor with a previously uncharacterized scaffold, caused MYC loss through both transcriptional and posttranslational mechanisms, and suppresses PDAC anchorage- dependent and anchorage-independent growth. We discovered that CDK9 enhanced MYC protein stability 62 through a previously unknown, KRAS-independent mechanism involving direct phosphorylation of MYC at Ser .
    [Show full text]
  • Mithramycin Represses Basal and Cigarette Smoke–Induced Expression of ABCG2 and Inhibits Stem Cell Signaling in Lung and Esophageal Cancer Cells
    Cancer Therapeutics, Targets, and Chemical Biology Research Mithramycin Represses Basal and Cigarette Smoke–Induced Expression of ABCG2 and Inhibits Stem Cell Signaling in Lung and Esophageal Cancer Cells Mary Zhang1, Aarti Mathur1, Yuwei Zhang1, Sichuan Xi1, Scott Atay1, Julie A. Hong1, Nicole Datrice1, Trevor Upham1, Clinton D. Kemp1, R. Taylor Ripley1, Gordon Wiegand2, Itzak Avital2, Patricia Fetsch3, Haresh Mani6, Daniel Zlott4, Robert Robey5, Susan E. Bates5, Xinmin Li7, Mahadev Rao1, and David S. Schrump1 Abstract Cigarette smoking at diagnosis or during therapy correlates with poor outcome in patients with lung and esophageal cancers, yet the underlying mechanisms remain unknown. In this study, we observed that exposure of esophageal cancer cells to cigarette smoke condensate (CSC) led to upregulation of the xenobiotic pump ABCG2, which is expressed in cancer stem cells and confers treatment resistance in lung and esophageal carcinomas. Furthermore, CSC increased the side population of lung cancer cells containing cancer stem cells. Upregulation of ABCG2 coincided with increased occupancy of aryl hydrocarbon receptor, Sp1, and Nrf2 within the ABCG2 promoter, and deletion of xenobiotic response elements and/or Sp1 sites markedly attenuated ABCG2 induction. Under conditions potentially achievable in clinical settings, mithramycin diminished basal as well as CSC- mediated increases in AhR, Sp1, and Nrf2 levels within the ABCG2 promoter, markedly downregulated ABCG2, and inhibited proliferation and tumorigenicity of lung and esophageal cancer cells. Microarray analyses revealed that mithramycin targeted multiple stem cell–related pathways in vitro and in vivo. Collectively, our findings provide a potential mechanistic link between smoking status and outcome of patients with lung and esophageal cancers, and support clinical use of mithramycin for repressing ABCG2 and inhibiting stem cell signaling in thoracic malignancies.
    [Show full text]
  • Polo-Like Kinases in the Nervous System
    Oncogene (2005) 24, 292–298 & 2005 Nature Publishing Group All rights reserved 0950-9232/05 $30.00 www.nature.com/onc Polo-like kinases in the nervous system Daniel P Seeburg1, Daniel Pak1 and Morgan Sheng*,1 1The Picower Center for Learning and Memory, RIKEN-MIT Neuroscience Research Center, Howard Hughes Medical Institute, Massachusetts Institute of Technology, Cambridge, MA 02139, USA Polo like kinases (Plks) are key regulators of the cell Intriguingly, neuronal Plks are regulated by synaptic cycle, but little is known about their functions in activity and can interact with specific synaptic proteins, postmitotic cells such as neurons. Recent findings indicate resulting in loss of synapses. In this review, we briefly that Plk2 and Plk3are dynamically regulated in neurons summarize the roles of Plks in the cell cycle and then by synaptic activity at the mRNA and protein levels. In discuss developments on neuronal Plks and their COS cells, Plk2 and Plk3interact with spine-associated implications for the physiological role of these proteins Rap guanosine triphosphatase-activating protein (SPAR), in the nervous system. a regulator of actin dynamics and dendritic spine The Plks are characterized by a conserved architecture morphology, leading to its degradation through the consisting of an N-terminal kinase domain and a C- ubiquitin–proteasome system. Induction of Plk2 in terminal Polo box domain. The latter binds to phos- hippocampal neurons eliminates SPAR protein, depletes phoserine/threonine motifs and is believed to be a core postsynaptic scaffolding molecule (PSD-95), and important for the functional regulation of the protein causes loss of mature dendritic spines and synapses.
    [Show full text]
  • Non-Random Aneuploidy Specifies Subgroups of Pilocytic Astrocytoma and Correlates with Older Age
    www.impactjournals.com/oncotarget/ Oncotarget, Vol. 6, No. 31 Non-random aneuploidy specifies subgroups of pilocytic astrocytoma and correlates with older age Adam M. Fontebasso1,*, Margret Shirinian2,*, Dong-Anh Khuong-Quang3, Denise Bechet3, Tenzin Gayden3, Marcel Kool4, Nicolas De Jay3, Karine Jacob3, Noha Gerges3, Barbara Hutter5, Huriye Şeker-Cin4, Hendrik Witt4,6, Alexandre Montpetit7, Sébastien Brunet7, Pierre Lepage7, Geneviève Bourret7, Almos Klekner8, László Bognár8, Peter Hauser9, Miklós Garami9, Jean-Pierre Farmer10, Jose-Luis Montes10, Jeffrey Atkinson10, Sally Lambert11, Tony Kwan7, Andrey Korshunov12, Uri Tabori13, V. Peter Collins11, Steffen Albrecht14, Damien Faury3, Stefan M. Pfister4,6, Werner Paulus15, Martin Hasselblatt15, David T.W. Jones4 and Nada Jabado1,3 1 Division of Experimental Medicine, McGill University and McGill University Health Centre, Montreal, Quebec, Canada 2 Department of Experimental Pathology, Immunology and Microbiology, American University Of Beirut, Beirut, Lebanon 3 Departments of Pediatrics and Human Genetics, McGill University and McGill University Health Centre, Montreal, Quebec, Canada 4 Division of Pediatric Neurooncology, German Cancer Research Centre (DKFZ), Heidelberg, Germany 5 Division of Theoretical Bioinformatics, German Cancer Research Centre (DKFZ), Heidelberg, Germany 6 Department of Pediatric Oncology, Hematology and Immunology, University of Heidelberg, Heidelberg, Germany 7 McGill University and Genome Quebec Innovation Centre, Montreal, Quebec, Canada 8 Department of Neurosurgery,
    [Show full text]
  • Regulation and Function of ERK3/MK5-Mediated Signaling
    Medizinische Hochschule Hannover Institut für Physiologische Chemie Regulation and Function of ERK3/MK5-mediated Signaling INAUGURAL – DISSERTATION Zur Erlangung des Grades eines Doktors der Naturwissenschaften - Doctor rerum naturalium – (Dr. rer. nat.) vorgelegt von Frank Brand geboren am 19.11.1982 in Hoyerswerda Hannover 2012 Angenommen vom Senat der Medizinischen Hochschule Hannover am 12.04.2012 Gedruckt mit Genehmigung der Medizinischen Hochschule Hannover Präsident: Prof. Dr. med Dieter Bitter-Suermann Betreuer: Prof. Dr. rer. nat. Matthias Gaestel Kobetreuer: Prof. Dr. rer. nat. Ernst Ungewickell 1. Gutachter: Prof. Dr. rer. nat. Matthias Gaestel 2. Gutachter: Prof. Dr. rer. nat. Ernst Ungewickell 3. Gutachter: Prof. Dr. rer. nat. Andreas Kispert Tag der mündlichen Prüfung vor der Prüfungskommission: 12.04.2012 Prof. Dr. rer. nat. Matthias Gaestel Prof. Dr. rer. nat. Matthias Gaestel Prof. Dr. rer. nat. Ernst Ungewickell Prof. Dr. rer. nat. Andreas Kispert Abstract Frank Brand Title of dissertation: ‘Regulation and Function of ERK3/MK5-mediated Signaling’ The family of mitogen-activated protein kinase (MAPK)-activated kinases (MKs, or MAPKAPKs), including the three distinct kinases MK2, MK3, and MK5, are downstream targets of the cytokine- and stress-induced p38 MAP kinases. Interaction and activation of MKs by p38 MAP kinases have been demonstrated in vitro and in vivo. The physiological relevance of the MK5/p38-interaction is doubtful, since its activity could not be triggered by any of the known MAP kinase stimuli. An interaction screen using MK5 revealed a strong binding to the atypical member of MAPKs ERK3. From previous studies, it has been concluded that MK5 is the first ‘bona fide’ substrate of ERK3, thus forming a stable complex promoting their protein stability and kinase activation.
    [Show full text]
  • Androgen Receptor
    RALTITREXED Dihydrofolate reductase BORTEZOMIB IsocitrateCannabinoid dehydrogenase CB1EPIRUBICIN receptor HYDROCHLORIDE [NADP] cytoplasmic VINCRISTINE SULFATE Hypoxia-inducible factor 1 alpha DOXORUBICINAtaxin-2 HYDROCHLORIDENIFENAZONEFOLIC ACID PYRIMETHAMINECellular tumor antigen p53 Muscleblind-likeThyroidVINBURNINEVINBLASTINETRIFLURIDINE protein stimulating 1 DEQUALINIUM SULFATEhormone receptor CHLORIDE Menin/Histone-lysine N-methyltransferasePHENELZINE MLLLANATOSIDE SULFATE C MELATONINDAUNORUBICINBETAMETHASONEGlucagon-like HYDROCHLORIDEEndonuclease peptide 4 1 receptor NICLOSAMIDEDIGITOXINIRINOTECAN HYDROCHLORIDE HYDRATE BISACODYL METHOTREXATEPaired boxAZITHROMYCIN protein Pax-8 ATPase family AAA domain-containing proteinLIPOIC 5 ACID, ALPHA Nuclear receptorCLADRIBINEDIGOXIN ROR-gammaTRIAMTERENE CARMUSTINEEndoplasmic reticulum-associatedFLUOROURACIL amyloid beta-peptide-binding protein OXYPHENBUTAZONEORLISTAT IDARUBICIN HYDROCHLORIDE 6-phospho-1-fructokinaseHeat shockSIMVASTATIN protein beta-1 TOPOTECAN HYDROCHLORIDE AZACITIDINEBloom syndromeNITAZOXANIDE protein Huntingtin Human immunodeficiency virus typeTIPRANAVIR 1 protease VitaminCOLCHICINE D receptorVITAMIN E FLOXURIDINE TAR DNA-binding protein 43 BROMOCRIPTINE MESYLATEPACLITAXEL CARFILZOMIBAnthrax lethalFlap factorendonucleasePrelamin-A/C 1 CYTARABINE Vasopressin V2 receptor AMITRIPTYLINEMicrotubule-associated HYDROCHLORIDERetinoidTRIMETHOPRIM proteinMothers X receptor tau against alpha decapentaplegic homolog 3 Histone-lysine N-methyltransferase-PODOFILOX H3 lysine-9OXYQUINOLINE
    [Show full text]
  • Phosphorylation Signaling in APP Processing in Alzheimer's Disease
    International Journal of Molecular Sciences Review Phosphorylation Signaling in APP Processing in Alzheimer’s Disease Tao Zhang, Dongmei Chen and Tae Ho Lee * Fujian Key Laboratory for Translational Research in Cancer and Neurodegenerative Diseases, Institute for Translational Medicine, School of Basic Medical Sciences, Fujian Medical University, Fuzhou 350122, China; [email protected] (T.Z.); [email protected] (D.C.) * Correspondence: [email protected] or [email protected]; Tel.: +86-591-2286-2498 Received: 9 December 2019; Accepted: 24 December 2019; Published: 27 December 2019 Abstract: The abnormal accumulation of amyloid-β (Aβ) in the central nervous system is a hallmark of Alzheimer’s disease (AD). The regulation of the processing of the single- transmembrane amyloid precursor protein (APP) plays an important role in the generation of Aβ in the brain. The phosphorylation of APP and key enzymes involved in the proteolytic processing of APP has been demonstrated to be critical for modulating the generation of Aβ by either altering the subcellular localization of APP or changing the enzymatic activities of the secretases responsible for APP processing. In addition, the phosphorylation may also have an impact on the physiological function of these proteins. In this review, we summarize the kinases and signaling pathways that may participate in regulating the phosphorylation of APP and secretases and how this further affects the function and processing of APP and Aβ pathology. We also discuss the potential of approaches that modulate these phosphorylation-signaling pathways or kinases as interventions for AD pathology. Keywords: Alzheimer’s disease; APP processing; phosphorylation; amyloid-β; kinase 1. Introduction Current epidemiological studies estimate that there are approximately 45 million people suffering from dementia [1].
    [Show full text]
  • Proteome Analysis in a Mammalian Cell Line Reveals That PLK2 Is Involved in Avian Metapneumovirus Type C (Ampv/C)-Induced Apoptosis
    viruses Article Proteome Analysis in a Mammalian Cell Line Reveals that PLK2 Is Involved in Avian Metapneumovirus Type C (aMPV/C)-Induced Apoptosis Rong Quan y, Li Wei y, Lei Hou, Jing Wang, Shanshan Zhu, Zixuan Li, Moran Lv and Jue Liu * Beijing Key Laboratory for Prevention and Control of Infectious Diseases in Livestock and Poultry, Institute of Animal Husbandry and Veterinary Medicine, Beijing Academy of Agriculture and Forestry Sciences, No. 9 Shuguang Garden Middle Road, Haidian District, Beijing 100097, China; [email protected] (R.Q.); [email protected] (L.W.); [email protected] (L.H.); [email protected] (J.W.); [email protected] (S.Z.); [email protected] (Z.L.); [email protected] (M.L.) * Correspondence: [email protected]; Tel.: +86-10-51503671; Fax: +86-10-51503498 These authors contributed equally to this work. y Received: 24 December 2019; Accepted: 26 March 2020; Published: 28 March 2020 Abstract: Avian metapneumovirus subtype C (aMPV/C) causes an acute respiratory disease that has caused serious economic losses in the Chinese poultry industry. In the present study, we first explored the protein profile in aMPV/C-infected Vero cells using iTRAQ quantitative proteomics. A total of 921 of 7034 proteins were identified as significantly altered by aMPV/C infection. Three selected proteins were confirmed by Western blot analysis. Bioinformatics GO analysis revealed multiple signaling pathways involving cell cycle, endocytosis, and PI3K-Akt, mTOR, MAPK and p53 signaling pathways, which might participate in viral infection. In this analysis, we found that PLK2 expression was upregulated by aMPV/C infection and investigated whether it contributed to aMPV/C-mediated cellular dysfunction.
    [Show full text]
  • PLK2, Active Full Length Recombinant Protein Expressed in Sf9 Cells
    Catalog # Aliquot Size P42-10G-05 5 µg P42-10G-10 10 µg PLK2, Active Full length recombinant protein expressed in Sf9 cells Catalog # P42-10G Lot # U1534-6 Product Description Specific Activity Full length recombinant human PLK2 was expressed by baculovirus in Sf9 insect cells using an N-terminal GST tag. 64,000 The gene accession number is NM_006622. 48,000 Gene Aliases 32,000 SNK 16,000 Activity (cpm) Formulation 0 0 100 200 300 400 Recombinant protein stored in 50mM Tris-HCl, pH 7.5, Protein (ng) 150mM NaCl, 10mM glutathione, 0.1mM EDTA, 0.25mM The specific activity of PLK2 was determined to be 11 nmol DTT, 0.1mM PMSF, 25% glycerol. /min/mg as per activity assay protocol. Storage and Stability Purity Store product at –70oC. For optimal storage, aliquot target into smaller quantities after centrifugation and store at recommended temperature. For most favorable performance, avoid repeated handling and multiple The purity of PLK2 was freeze/thaw cycles. determined to be >80% by densitometry, approx. MW Scientific Background ~106kDa. PLK2 or Polo-like kinase 2 is a serum-inducible kinase that is a member of the Polo family of serine/threonine protein kinases which play an essential role in normal cell division (1). PLK2 phosphorylates the P4.1-associated protein (CPAP), a human homologue of SAS-4, in procentriole PLK2, Active formation during the centrosome cycle (2). PLK2 may also Full length human recombinant protein expressed in Sf9 cells play a role as a tumor suppressor since it interacts with TSC1 protein which in turn inhibits mTOR signaling, tumor Catalog # P42-10G growth and chemosensitivity under hypoxic conditions.
    [Show full text]
  • Inhibition of ERK 1/2 Kinases Prevents Tendon Matrix Breakdown Ulrich Blache1,2,3, Stefania L
    www.nature.com/scientificreports OPEN Inhibition of ERK 1/2 kinases prevents tendon matrix breakdown Ulrich Blache1,2,3, Stefania L. Wunderli1,2,3, Amro A. Hussien1,2, Tino Stauber1,2, Gabriel Flückiger1,2, Maja Bollhalder1,2, Barbara Niederöst1,2, Sandro F. Fucentese1 & Jess G. Snedeker1,2* Tendon extracellular matrix (ECM) mechanical unloading results in tissue degradation and breakdown, with niche-dependent cellular stress directing proteolytic degradation of tendon. Here, we show that the extracellular-signal regulated kinase (ERK) pathway is central in tendon degradation of load-deprived tissue explants. We show that ERK 1/2 are highly phosphorylated in mechanically unloaded tendon fascicles in a vascular niche-dependent manner. Pharmacological inhibition of ERK 1/2 abolishes the induction of ECM catabolic gene expression (MMPs) and fully prevents loss of mechanical properties. Moreover, ERK 1/2 inhibition in unloaded tendon fascicles suppresses features of pathological tissue remodeling such as collagen type 3 matrix switch and the induction of the pro-fbrotic cytokine interleukin 11. This work demonstrates ERK signaling as a central checkpoint to trigger tendon matrix degradation and remodeling using load-deprived tissue explants. Tendon is a musculoskeletal tissue that transmits muscle force to bone. To accomplish its biomechanical function, tendon tissues adopt a specialized extracellular matrix (ECM) structure1. Te load-bearing tendon compart- ment consists of highly aligned collagen-rich fascicles that are interspersed with tendon stromal cells. Tendon is a mechanosensitive tissue whereby physiological mechanical loading is vital for maintaining tendon archi- tecture and homeostasis2. Mechanical unloading of the tissue, for instance following tendon rupture or more localized micro trauma, leads to proteolytic breakdown of the tissue with severe deterioration of both structural and mechanical properties3–5.
    [Show full text]
  • PRODUCTS and SERVICES Target List
    PRODUCTS AND SERVICES Target list Kinase Products P.1-11 Kinase Products Biochemical Assays P.12 "QuickScout Screening Assist™ Kits" Kinase Protein Assay Kits P.13 "QuickScout Custom Profiling & Panel Profiling Series" Targets P.14 "QuickScout Custom Profiling Series" Preincubation Targets Cell-Based Assays P.15 NanoBRET™ TE Intracellular Kinase Cell-Based Assay Service Targets P.16 Tyrosine Kinase Ba/F3 Cell-Based Assay Service Targets P.17 Kinase HEK293 Cell-Based Assay Service ～ClariCELL™ ～ Targets P.18 Detection of Protein-Protein Interactions ～ProbeX™～ Stable Cell Lines Crystallization Services P.19 FastLane™ Structures ～Premium～ P.20-21 FastLane™ Structures ～Standard～ Kinase Products For details of products, please see "PRODUCTS AND SERVICES" on page 1～3. Tyrosine Kinases Note: Please contact us for availability or further information. Information may be changed without notice. Expression Protein Kinase Tag Carna Product Name Catalog No. Construct Sequence Accession Number Tag Location System HIS ABL(ABL1) 08-001 Full-length 2-1130 NP_005148.2 N-terminal His Insect (sf21) ABL(ABL1) BTN BTN-ABL(ABL1) 08-401-20N Full-length 2-1130 NP_005148.2 N-terminal DYKDDDDK Insect (sf21) ABL(ABL1) [E255K] HIS ABL(ABL1)[E255K] 08-094 Full-length 2-1130 NP_005148.2 N-terminal His Insect (sf21) HIS ABL(ABL1)[T315I] 08-093 Full-length 2-1130 NP_005148.2 N-terminal His Insect (sf21) ABL(ABL1) [T315I] BTN BTN-ABL(ABL1)[T315I] 08-493-20N Full-length 2-1130 NP_005148.2 N-terminal DYKDDDDK Insect (sf21) ACK(TNK2) GST ACK(TNK2) 08-196 Catalytic domain
    [Show full text]