Effects of Simultaneous Knockdown of HER2 and PTK6 on Malignancy and Tumor Progression in Human Breast Cancer Cells

Published OnlineFirst January 30, 2013; DOI: 10.1158/1541-7786.MCR-12-0378

Molecular Cancer Oncogenes and Tumor Suppressors Research

Natalie Ludyga1, Natasa Anastasov2, Michael Rosemann2, Jana Seiler1, Nadine Lohmann1, Herbert Braselmann3, Karin Mengele4, Manfred Schmitt4, Heinz Ho€ﬂer1,5, and Michaela Aubele1

Abstract Breast cancer is the most common malignancy in women of the Western world. One prominent feature of breast cancer is the co- and overexpression of HER2 and protein tyrosine kinase 6 (PTK6). According to the current clinical cancer therapy guidelines, HER2-overexpressing tumors are routinely treated with trastuzumab, a humanized monoclonal antibody targeting HER2. Approximately, 30% of HER2-overexpressing breast tumors at least initially respond to the anti-HER2 therapy, but a subgroup of these tumors develops resistance shortly after the administration of trastuzumab. A PTK6-targeted therapy does not yet exist. Here, we show for the first time that the simultaneous knockdown in vitro, compared with the single knockdown of HER2 and PTK6, in particular in the trastuzumab-resistant JIMT-1 cells, leads to a significantly decreased phosphorylation of crucial signaling proteins: mitogen-activated protein kinase 1/3 (MAPK 1/3, ERK 1/2) and p38 MAPK, and (phosphatase and tensin homologue deleted on chromosome ten) PTEN that are involved in tumorigenesis. In addition, dual knockdown strongly reduced the migration and invasion of the JIMT-1 cells. Moreover, the downregulation of HER2 and PTK6 led to an induction of p27, and the dual knockdown significantly diminished cell proliferation in JIMT-1 and T47D cells. In vivo experiments showed significantly reduced levels of tumor growth following HER2 or PTK6 knockdown. Our results indicate a novel strategy also for the treatment of trastuzumab resistance in tumors. Thus, the inhibition of these two signaling proteins may lead to a more effective control of breast cancer. Mol Cancer Res; 11(4); 381–92. 2013 AACR.

Introduction significance. Regarding its clinical relevance, HER2 is over- HER2 is a member of the HER (EGFR/ErbB) receptor expressed in 25% to 30% of patients with breast cancer and family encompassing the 4 HER receptors (HER1–HER4) is associated with a poor prognosis (3). In addition to surgery that are involved in signal transduction (1). Each of these and hormonal and chemo- or radiotherapy, an antibody- receptors contains an extracellular, a trans-membrane, and based immunotherapy for HER2-positive tumors has been an intracellular domain. In response to extracellular stimuli, successfully administered in the last decade (4, 5). However, only a third of breast tumors highly overexpress HER2 and the HER receptors form a homo- or heterodimer via autop- – hosphorylation of the intracellular domains of the receptors therefore may be considered for the anti-HER2 targeted (2). Subsequently, the HERs activate many signaling pro- antibody (trastuzumab). Moreover, trastuzumab therapy teins that are linked to cell proliferation and tumor malig- causes side effects (cardiotoxicity; ref. 6), and after approx- nancy. The HER receptors are highly involved in breast imately one year of application, the development of resistance cancer progression, and for HER2 in particular, there is a is not uncommon (7, 8). Combinations of trastuzumab with large body of experimental and clinical data underlining its the small-molecule tyrosine kinase inhibitor lapatinib targeting EGF receptor (EGFR) and HER2 seem to provide remedy to some extent. Still, also lapatinib, either as a single agent, or in combination with various chemotherapeutic Authors' Affiliations: 1Institute of Pathology, 2Institute of Radiation fi Biology, 3Department of Radiation Cytogenetics, Helmholtz Zentrum agents, or trastuzumab, could not ful ll the high expectations Munchen,€ German Research Center for Environmental Health, Neuherberg; as initially hoped for (5). HER2 knockdown in vitro led to 4Clinical Research Unit, Department of Obstetrics and Gynecology; and reduced proliferation and induced apoptosis of HER2-over- 5Institute of Pathology, Klinikum rechts der Isar, Technische Universitat€ Munchen,€ Munchen,€ Germany expressing breast cancer cell lines (9). In addition, the simultaneous knockdown of HER2 and uPAR (urokinase Corresponding Author: Michaela Aubele, Institut fur€ Pathologie, Helm- holtz Zentrum Munchen,€ Ingolstaedter Landstrasse 1, 85764 Neuherberg, plasminogen activator receptor) resulted in a higher induc- Germany. Phone: 49-89-3187-4132; Fax: 49-89-3187-3360; E-mail: tion of apoptosis and a stronger inhibition of cell proliferation [email protected] than the single knockdown of either HER2 or uPAR (10). doi: 10.1158/1541-7786.MCR-12-0378 Another factor with relevance in tumor progression is 2013 American Association for Cancer Research. PTK6, also known as Brk (breast tumor kinase). This

www.aacrjournals.org 381

Ludyga et al.

nonreceptor Src-related tyrosine kinase is highly expressed in T47D cell line (HTB-133) was acquired from American up to 80% of breast cancers, as well as in colon and prostate Type Culture Collection. It was maintained in RPMI-1640 tumors (11, 12). PTK6 was also shown to be expressed in with GlutaMAX (Life Technologies GmbH) and trastuzu- several cancer cell lines (11–13). In the last decade, we and mab-resistant cell line JIMT-1 (ACC 589) was acquired others have identified several interaction partners of PTK6, from the German Collection of Microorganisms and Cell such as STAT3, (p38) MAPK, Paxillin, and PTEN (14–17). Cultures. The last cell line authentication was conducted in Therefore, PTK6 seems to be involved in several cellular spring 2012. Therefore, genetic profiles were generated by processes, such as proliferation, migration and invasion. the company Eurofins (MWG Operon). For this, the Power- PTK6 was also shown to regulate the cell cycle (18). PTK6 Plex 16 System, a multiplex short tandem repeat (STR) knockdown led to a diminished phosphorylation of STAT3, system, was conducted. Subsequently, the obtained profiles (p38) MAPK, and PTEN, as well as to a reduced migration were introduced into the online STR matching analysis of breast cancer cells (15, 19). database that is provided by the DSMZ. The cells were Studies conducted by our group and others showed that maintained in Dulbecco's modified Eagle's medium with HER2 and PTK6 are coexpressed and colocalized, and they GlutaMAX (Life Technologies GmbH). Both media were directly interact with each other in breast cancer tissue. supplemented with human insulin (10 mg/mL, Sigma, St. Furthermore, the HER2 and PTK6 mRNA and protein Louis), 10% FBS (Life Technologies GmbH), 0.25% each levels are positively correlated, emphasizing their role as of penicillin and streptomycin (Life Technologies GmbH), crucial molecules in breast cancer (17, 20–22). In 2004, and also with 0.1% FBS when the serum-independent Tanner and colleagues identified a novel HER2-overexpres- effects [in the migration, invasion assays, and matrix metal- sing cell line that is intrinsically resistant to trastuzumab and loproteinase (MMP) activation, as described below] were named it JIMT-1 (23). Since then, an appropriate experi- analyzed and the cells were maintained at 37 Cin5%CO2. mental model system has been established to study the The medium for JIMT-1 cells was supplemented with possible causes of intrinsic and acquired trastuzumab resis- trastuzumab (10 mg/mL, Roche Diagnostics). tance. In the meantime, several mechanisms for trastuzumab For transient transfections, 1 106 breast cancer cells resistance have been hypothesized among others including were transfected with small-interfering RNAs (siRNA; 200 truncation of extracellular HER2, activation of alternative pmol) for PTK6 and HER2 knockdown and control siRNAs pathways, loss of the tumor suppressor PTEN, or an inter- [positive control: siRNAs for glyceraldehyde-3-phosphate action with Mucin-4 that potentially inhibits the binding of dehydrogenase (GAPDH) silencing, and negative control: a trastuzumab to HER2 (8, 24, 25). A recent study described non-targeting siRNA) as described; ref. 19]. All siRNAs were survivin (an inhibitor of apoptosis) as indispensable for the purchased from Thermo Scientific Dharmacon. Two inde- survival of HER2-overexpressing and trastuzumab-resistant pendent transfections were conducted. breast cancer cells (26). However, the underlying mechanisms for the development of resistance are not yet exactly Generation of lentiviral constructs for PTK6 and HER2 known, and additional therapeutic approaches in breast knockdown cancer are strongly needed. To date, no information exists Previously tested siRNAs leading to specific and efficient concerning the effects of the simultaneous inhibition of knockdown of PTK6 and HER2 were used as templates for HER2 and PTK6 on tumor cell biology and tumor pro- the generation of corresponding shRNAs. The 50-30 gression. In addition, in trastuzumab-resistant JIMT-1 cells, sequence of the forward primer for shRNA_PTK6 is: this information could give valuable hints towards strategies GATCCCCCCATTAAGGTGAT TTCTCGTTCAAGA- suited to circumvent the resistance to the clinical trastuzu- GACGAGAAATCACCTTAATGGTTTTTGGAAA, and mab-based regimens. the sequence of the respective reverse primer is: AGCTT- In our present study, we show for the first time the cell TTCCAAAAACCATTAAGGTG ATTTCTCGTCTCT- line-dependent effects on the deactivation of key proteins TGAACGAGAAATCACCTTAATGGGGG. The 50-30 and a reduction in migration, invasion, and cell proliferation sequence of the forward primer for shRNA_HER2 is: in vitro following the simultaneous knockdown of HER2 GATCCCCGCTCATCGCTCACAACCAATT CAAGA- and PTK6 in breast cancer cells. Subsequent xenograft GATTGGTTGTGAGCGATGAGCTTTTTGGAAA, the experiments revealed the effectiveness of silencing these sequence of the respective reverse primer is: AG- signaling proteins in vivo. Therefore, the inhibition of HER2 CTTTTCCAAAAAGCTCATCGCTCACAACCAATC and/or PTK6 may offer an attractive tool for targeted breast TCTTGAATTGGTTGTGAGCGATGAGCGGG. The cancer therapy, specifically in a subgroup of patients who construction of lentiviral vectors was conducted as pub- develop a resistance to trastuzumab during the course of lished previously (27). In addition to specificshRNAs,all treatment. of the vectors encoded the GFP gene for visualization and quantification of infections.

Materials and Methods Lentiviral transductions of breast cancer cells Cell culture and transient transfections A total of 2.5 105 T47D and JIMT-1 breast cancer cells The following 2 permanent human breast cancer cell lines were infected with lentiviral vectors encoding short hairpin were used: T47D and JIMT-1. The trastuzumab-sensitive RNAs (shRNA): shRNA_PTK6, shRNA_HER2, the

382 Mol Cancer Res; 11(4) April 2013 Molecular Cancer Research

Combined HER2 and PTK6 RNAi Reduce Breast Cancer Progression

shRNA_control (lacking the sequence for shRNA), and postinfection and then documented once a day with phase polybrene (Invitrogen) as described (27). The supernatants contrast microscopy on an inverted microscope Evos were removed 24 hours after infection. Fresh medium was (AMG). The quantification was conducted using TScratch added, and the cells were further maintained for several weeks. software (29). All open areas at time point 0 hours were set to The infected JIMT-1 cells were cultivated in parallel with or 100%, and the open areas at the later time points were without the addition of trastuzumab (10 mg/mL, Roche calculated in relation to the respective value at 0 hours. For Diagnostics) to ensure the maintenance of resistance. Once statistical analysis, the Student t test was used. per week, a defined fraction of infected cells was used for Western blot analysis to control for knockdown efficiency, Matrigel invasion assay whereas the residual fraction was further cultivated. As con- Control or infected JIMT-1 breast cancer cells were seeded trols, cells were infected only with the transduction reagents at a concentration of 5 104 cells in serum-reduced medium (mock) or with the lentiviral vectors lacking a shRNA onto BD BioCoat Matrigel Invasion Chambers (354480, sequence, but containing the GFP gene (control vector). The BD Biosciences), inserted in 24-well cell culture plates, and infections were conducted in triplicates. The infection effi- incubated for 24 hours at 37C. FBS (10%) was used as a ciency of T47D and JIMT-1 cells was measured by fluores- chemoattractant in the lower chamber, and the invasion cence-activated cell sorting as described previously (19). assay was conducted according to the manufacturer's instructions. After the incubation, noninvading cells were Western blot analysis removed with a cotton swab from the apical side of the For SDS-PAGE and the subsequent Western blot analysis, membrane, and then the invading cells were fixed with T47D and JIMT-1 breast cancer cells were treated as methanol and stained with toluidine blue. The invading described previously (19). The proteins were detected with cells were counted microscopically (Olympus). The assay primary antibodies targeting PTK6 (sc-1188), GAPDH (sc- was conducted after 2 independent infections. 25778) (Santa Cruz Biotechnology), HER2 (A0485) (DAKO), (phospho, 9554) PTEN (9559), (phospho In vivo experiments in female nude mice 4051) Akt (9272), (phospho, 4376) MAPK 1/3, (ERK 1/ The animal studies were conducted in accordance with the 2; 4695), (phospho 9211) p38MAPK (9212), MMP9 German and European laws on animal welfare. The treat- (3852), phospho-STAT3 (9134), PARP (9532; Cell Sig- ments were approved by the Bavarian authorities on veter- naling Technology), STAT3 (610190), p27 (610242; BD inary issues (file no. 55.2-1-54-2531-118-10). The female Transduction Laboratories), and tubulin as a loading control athymic nude mice (Crl:NU-Foxn1 nu; originating from (T5168, Sigma). The following peroxidase-conjugated sec- Charles River Laboratories) were maintained in a pathogen- ondary antibodies were used: anti-rabbit (NA934V) and free environment. Five-week-old female nude mice were anti-mouse (NA931V; GE Healthcare). All of the bands 6 fi inoculated once into the mammary fat pad with 1 10 showing changed intensities were quanti ed relative to the T47D or JIMT-1 cells in 50 mL. The cells were suspended in control bands using the Molecular Imager ChemiDoc XRS PBS and mixed with an equal volume of Matrigel (354234, and the analysis software Quantity One (Bio-Rad BD Matrigel, BD Biosciences). The tumor size was estimat- Laboratories). ed as the product of the length and width of the xenograft measured once a week with a caliper. The data were collected WST-1 cell proliferation assay between day 16 postinjection and day 56 postinjection. Cell proliferation was determined using the water-soluble Eight weeks postinjection, or when the xenograft reached tetrazolium WST-1 (4-[3-(4-Iodophenyl)-2-(4-nitrophe- approximately 1 cm3, the mice were euthanized. The nyl)-2H-5-tetrazolio]-1,3-benzene disulfonate) for the spec- increases in the tumor size over time were estimated by trophotometric assay according to the manufacturer's pro- ANOVA, and the individual size measurements from each tocol (05015944001, Roche Diagnostics\). T47D and 4 day were normalized to the average size on day 23 postin- JIMT-1 cells were seeded at a concentration of 1 10 jection for the JIMT-1 cell xenografts or on day 56 post- cells per well in a 96-well tissue culture plate. After 48 hours, injection for the T47D cell xenografts. These normalized the WST-1 reagent was added and the cells were incubated tumor sizes were tested for differences between the 4 injected for 0.5 to 4 hours at 37 C. The absorbance of the infected cell line approaches using the Mann–Whitney U test. P and the control cells was measured against a background values that were less than 0.05 were considered to be control using a microplate ELISA reader (Bio-Rad) at 450 statistically significant. The median and SEs of the normal- nm (reference wavelength at 655 nm). Five independent ized tumor sizes were calculated. experiments were carried out. For statistical analysis, the Student t test was used. Results Wound scratch migration assay The simultaneous knockdown of PTK6 and HER2 in The migration assay was conducted in triplicates under breast cancer cells led to stronger effects in the HER serum-reduced conditions to reduce proliferation (28) as receptor signaling pathway described previously (19) with minor modifications. The Before stably downregulating HER2 and PTK6, their wound was scratched into a confluent monolayer 5 weeks expression was transiently downregulated with siRNAs in

www.aacrjournals.org Mol Cancer Res; 11(4) April 2013 383

Ludyga et al.

the T47D and JIMT-1 cell lines to investigate the effect of controls, the phosphorylation of MAPK 1/3 (ERK 1/2) at simultaneous knockdown. As recently shown by us, spe- Thr202/Tyr204 in the JIMT-1 cell line was significantly cificandefficient siRNAs for PTK6 knockdown were reduced after HER2 (P < 0.001) or PTK6 (P < 0.001) identified as described (19). The siRNAs for HER2 silencing, and in both cell lines, it was significantly knockdown led to a specific and effective downregulation decreased due to the combined downregulation (Figs. 2B (Fig. 1A). The simultaneous knockdown of PTK6 and and 3B). Phosphorylated, and therefore activated, MAPK HER2 after 72 hours (using the most efficient siRNAs, mediates cellular processes such as proliferation, differen- respectively) shows that the phosphorylation of MAPK 1/ tiation, and migration by phosphorylation of its substrates 3 (ERK 1/2) at Thr202/Tyr204 and of STAT3 at Ser727 (15). In contrast, p38 MAPK is activated due to environ- is further reduced compared with the phosphorylation mental stress and is involved in regulating cell death (15). status following single HER2 or PTK6 downregulation The phosphorylation of p38 MAPK at Thr180/Tyr182 (Fig. 1B). leads to the activation of other MAPK and transcription On the basis of these results, for stable and simultaneous factors. In T47D and JIMT-1 cells, the simultaneous knockdown of HER2 and PTK6, the T47D and JIMT-1 cell downregulation of HER2 and PTK6 resulted in a further lines were efficiently infected with lentiviral particles encod- reduced phosphorylation of this kinase than single knock- ing sequences for shRNAs. Because of the stable integration down alone (Figs. 2A and 3A). However, in JIMT-1 cells, of the sequences into the host genome, the infections led to a the dual knockdown significantly reduced the phosphory- stable downregulation of the target proteins. We show the lation compared with single knockdowns (Fig. 2B). Con- effects of the stable and simultaneous knockdown of PTK6 sequently, antiapoptotic signaling via p38 MAPK may be and HER2 on selected signaling proteins downstream of reduced. HER2 and PTK6 (Figs. 2 and 3). Because the results from In addition, Akt is activated by phosphorylation at JIMT-1 cells that were incubated with and without trastu- Thr308 and Ser473, regulating survival and apoptosis by zumab were comparable, we only show the results obtained inhibiting the target proteins (30). The single and the from cells cultivated with trastuzumab (Fig. 2). In JIMT-1 simultaneous knockdowns of HER2 and PTK6 led to a and T47D cells, the protein expression levels of HER1, reduced phosphorylation of Akt at Ser473 in both cell lines HER3, HER4, were not changed (data not shown) fol- (Figs. 2 and 3). In particular, in T47D cells, compared with lowing the knockdown of HER2 and PTK6, but the PTK6-depleted cells, the dual knockdown significantly phosphorylation of HER receptor-dependent signaling reduced the phosphorylation (Fig. 3B). The phosphoryla- proteins was affected. Compared with the mock and vector tion status at Thr308 was not changed (data not shown).

Figure 1. The effective transient downregulation of HER2 and PTK6 in T47D and JIMT-1 breast cancer cells by siRNA. A, the protein expression levels of T47D cells after transfection with siRNA_HER2, si_GAPDH (positive control), a nontargeting siRNA (negative control), and mock (cells transfected with transfection reagents without siRNA). B, the protein expression levels of JIMT-1 and T47D cells after transfections with siRNA_HER2, siRNA_PTK6 and a combination of siRNAs against HER2, PTK6, and mock. The protein extracts were analyzed by immunoblotting using primary antibodies targeting HER2, PTK6, phospho-STAT3, phospho-MAPK 1/3 (ERK 1/2), and tubulin (loading control). For quantiﬁcation, the means of 2 independent transfections were calculated.

384 Mol Cancer Res; 11(4) April 2013 Molecular Cancer Research

Combined HER2 and PTK6 RNAi Reduce Breast Cancer Progression

Figure 2. The reduced phosphorylation of tumor-promoting signaling proteins following stable single and simultaneous knockdown of HER2 and PTK6 in the trastuzumab-resistant JIMT-1 cells. A, Western blot analysis of protein extracts using primary antibodies targeting HER2, PTK6, (phospho) STAT3, (phospho) Akt, (phospho) PTEN, (phospho) MAPK 1/3 (ERK 1/2), (phospho) p38 MAPK, and tubulin (loading control). For quantification, the means of 3 independent infections were calculated. B, the graphs show the quantifications of the phosphorylation status relative to mock control. The mean values of 3 independent infections, the SDs, and the significant P values of single and simultaneous knockdown in comparison are shown. 1: mock, 2: control vector, 3: shRNAHER2, 4: shRNAPTK6, 5: shRNAHER2 þ shRNAPTK6.

STAT3 is an additional signaling protein that mediates cell PTK6 significantly reduced the phosphorylation of PTEN growth, survival, differentiation, and gene expression via in comparison with controls and single knockdowns (Figs. 2 phosphorylation at Tyr705 followed by dimerization and and 3). translocation to the nucleus and DNA binding (31). STAT3 that is phosphorylated at Ser727 promotes gene expression. The simultaneous knockdown of PTK6 and HER2 Following combined downregulation in JIMT-1 cells, we enhanced p27 expression and significantly reduced cell observed a slightly diminished phosphorylation of STAT3 at proliferation Ser727 (Fig. 2). In T47D cells, the phosphorylation at this site The induction of apoptosis as a consequence of HER2 and was significantly reduced in HER2-depleted cells (P ¼ 0.002) PTK6 knockdown was investigated on the basis of PARP and also significantly decreased in cells depleted of both cleavage using Western blot analysis. PARP was only cleaved compared with the PTK6 knockdown alone (Fig. 3B). The when the breast cancer cells were incubated for 24 hours with phosphorylation of STAT3 at Tyr705 was not analyzed staurosporine, an unspecific kinase inhibitor that induces because this phosphorylation site was marginal detectable in apoptosis (positive control), and not after PTK6 and HER2 the cells. downregulation (Fig. 4A). The phosphatase PTEN is a tumor suppressor that neg- We also analyzed the expression of cell-cycle proteins atively regulates the phosphoinositide-3-kinase(PI3K)/Akt depending on HER2 and PTK6 protein levels. The pathway, and PTEN phosphorylation at Ser380/Thr382/ protein expression of cyclins and cdk2 following single 383 lessens its activity as a tumor suppressor (32). In both andsimultaneousknockdownofHER2andPTK6was cell lines, only the simultaneous silencing of HER2 and not affected in T47D and JIMT-1 cells (data not shown).

www.aacrjournals.org Mol Cancer Res; 11(4) April 2013 385

Ludyga et al.

Figure 3. The reduced phosphorylation of tumor-promoting signaling proteins following stable single and simultaneous knockdown of HER2 and PTK6 in T47D cells. A, Western blot analysis of protein extracts using primary antibodies targeting HER2, PTK6, (phospho) STAT3, (phospho) Akt, (phospho) PTEN, (phospho) MAPK 1/3 (ERK 1/2), (phospho) p38 MAPK, and tubulin (loading control). For quantification, the means of 3 independent infections were calculated. B, the graphs show the quantifications of the phosphorylation status relative to mock control. The mean values of 3 independent infections, the SDs, and the significant P values of single and simultaneous knockdown in comparison are shown. 1: mock, 2: control vector, 3: shRNAHER2, 4: shRNAPTK6, 5: shRNAHER2 þ shRNAPTK6.

However, compared with the mock and vector controls, in and cells depleted of both proteins (T47D cells: P < 0.001, both cell lines, an induction of the cell-cycle inhibitor p27 JIMT-1 cells: P ¼ 0.04), were also statistically significant was observed because of HER2 and PTK6 knockdown (Fig. 4C). (Fig. 4B). We examined the proliferation of T47D and JIMT-1 cells Stronger reduced migration and invasion of breast cancer by analyzing the enzymatic cleavage of tetrazolium salts into cells due to the simultaneous knockdown of PTK6 and formazan (WST-1 assay). This reaction can be proceeded in HER2 metabolically active cells, and the amount of formazan dye is To further determine the effects of HER2 and PTK6 directly associated with the amount of viable cells (33). silencing in breast cancer cells, the migration and invasion of Compared with control cells (mock), the number of cells the cells were analyzed in vitro. JIMT-1 cells were seeded into following HER2 knockdown is significantly reduced (T47D 6-well plates, then a wound was scratched into the confluent cells: P < 0.008, JIMT-1 cells: P ¼ 0.004; Fig. 4C). It is also monolayer and the cells were observed for the following 72 reduced when PTK6 is silenced (T47D and JIMT-1 cells: P hours under serum-reduced conditions, as exemplarily < 0.001, respectively), and following simultaneous knock- shown (Fig. 5A). Although the control JIMT-1 cells almost down, the number of metabolically active cells is additively overgrow the open area [mock (6%) and control vector diminished (T47D cells and JIMT-1 cells: P < 0.001, (5%); Fig. 5B), the open area of HER2-depleted cells was at respectively). The differences between HER2-depleted cells 39% (P ¼ 0.037), of PTK6-depleted cells was at 42% (P ¼ and cells depleted of both proteins (T47D and JIMT-1 cells: 0.008) indicating a significantly reduced migration. More- P < 0.001, respectively), or between PTK6-depleted cells over, the simultaneous HER2 and PTK6 knockdown

386 Mol Cancer Res; 11(4) April 2013 Molecular Cancer Research

Combined HER2 and PTK6 RNAi Reduce Breast Cancer Progression

Figure 4. The simultaneous knockdown of HER2 and PTK6 does not induce apoptosis, but it elevates the protein expression of p27 and leads to significantly reduced cell proliferation. A, Western blot analysis of JIMT-1 and T47D cell extracts using primary antibodies targeting full-length (116 kDa) and cleaved (89 kDa) PARP and tubulin (loading control). B, Western blot analysis of JIMT-1 and T47D cell extracts using primary antibodies targeting HER2, PTK6, p27, and tubulin (loading control). For quantification, the mean values of 3 independent infections were calculated. C, JIMT-1 and T47D cells were seeded at a concentration of 1 104 cells per well and incubated for 48 hours. The WST-1 reagent was added and the absorbance measured after 1 hour is shown. The graph represents the amount of viable cells in relation to the mock control. The mean values of 5 independent experiments and the SDs are shown. The differences between the mock control and cells depleted of HER2 (T47D cells P < 0.008, JIMT-1 cells: P ¼ 0.004), of PTK6 (T47D and JIMT-1 cells: P < 0.001, respectively), and of both (T47D and JIMT-1 cells: P < 0.001, respectively), as well as between HER2-depleted cells and cells depleted of both proteins (T47D and JIMT-1 cells: P < 0.001, respectively), and PTK6-depleted cells and cells depleted of both proteins (T47D cells: P < 0.001, JIMT-1 cells: P ¼ 0.04) were statistically significant. , P < 0.001; , P 0.05. further reduced the cell migration, as indicated by an area invasive cells was approximately 60%, 40%, and 20%, that remained more than 52% opened (P ¼ 0.003, Fig. 5B) respectively (Fig. 6A). but it is not significant compared with single knockdowns. To confirm the outcome of reduced invasion, we analyzed Because of a very strong HER2 knockdown effect in the the cleavage, and therefore the activation, of MMP9 by T47D cell line, these cells (approaches with HER2-depleted immunoblotting using supernatants of JIMT-1 cells that and cells depleted of both: HER2 and PTK6) did not were cultivated in serum-reduced medium. MMPs mediate become confluent and as this is a prerequisite for the scratch the digestion of the extracellular matrix and play an impor- assay, the cells could not be used for the migration assay. tant role in wound healing, tumor invasion, angiogenesis, Furthermore, the invasion of JIMT-1 cells was also reduced and carcinogenesis (34). The cleavage of the precursor in vitro due to the combined silencing of HER2 and PTK6 protein into the active MMP is required for invasion when compared with single downregulation of the respective (34). In comparison with controls (mock and control vec- proteins (Fig. 6A). Indeed, the values were statistically not tor), the cleavage, and thus the activation of MMP9 (illus- significant, but a clear tendency was observed. In the control trated by the band at 84 kDa), is diminished when PTK6 and experiments, the amount of invasive cells was approximately both proteins are downregulated (Fig. 6B). Here, we only 100% (mock) or 90% (empty vector), respectively. Follow- show the results obtained with JIMT-1 cells because T47D ing HER2, PTK6, or simultaneous silencing, the amount of cells are less invasive and express lower levels of MMP9.

www.aacrjournals.org Mol Cancer Res; 11(4) April 2013 387

Ludyga et al.

Figure 5. The simultaneous knockdown of HER2 and PTK6 additively reduces JIMT-1 cell migration. A, representative ﬁgures illustrating the migration of JIMT- 1 mock, cells infected with empty vector, vectors for HER2 and PTK6 single knockdown, respectively, and both vectors simultaneously. The percentagesof the open area were calculated using the TScratch software. B, the graph shows the mean values, the SDs, and respective P values of 3 independent experiments. The scale bars are 400 mm.

Significantly reduced in vivo tumor growth following depleted of both were reduced to approximately 6.4 HER2 and PTK6 knockdown mm2 (37%). Female nude mice were inoculated with control cells (T47D cells and JIMT-1 cells infected with the control vector), and with T47D or JIMT-1 cells that were depleted Discussion of HER2, PTK6, and with cells containing the combined A possible approach for a targeted therapy for breast knockdown. The median tumor size (normalized to the cancer is the anti-HER2 treatment by means of using the average on day 23 postinjection) in JIMT-1 xenografts was humanized antibody trastuzumab in HER2-overexpressing significantly reduced following PTK6 knockdown (32.7– tumors. However, a percentage of them become resistant 25.9 mm2 ¼21%; P ¼ 0.0003), HER2 knockdown within a year of administration of the antibody (7, 8). (32.7–29.4 mm2 ¼10.2%; P ¼ 0.0008), and the com- Therefore, novel biomarkers and targets are needed for bined PTK6 and HER2 knockdown (32.7–29.3 mm2 ¼ additional tailored therapies in breast cancer. One expedi- 10.4%, P ¼ 0.0007; Fig. 7). Concerning T47D cell ent concept to circumvent the development of resistance to xenografts, the median tumor size was estimated at the end breast cancer therapy would be simultaneous targeting of of the experiment (day 56 postinjection) due to a slower different, but physiologically related, targets within already proliferation of the T47D cells. In all approaches, the validated cancer-related signaling pathways. Nevertheless, reduction of xenograft size of HER2- and PTK6-depleted to date, studies that examine and confirm the advantageous T47D cells was statistically significant (P 0.0001; Fig. 7). effects of simultaneous knockdown of such target pairs are In comparison with control xenografts (10.2 mm2), the size still scarce, although some groups have reported stronger or of HER2-depleted xenografts was reduced to approximately synergistic effects following the simultaneous knockdown 5.2 mm2 (49%), of PTK6-depleted xenografts to approx- of uPAR and HER2, uPAR and MMP9, or uPA and uPAR imately 8.7 mm2 (15%) and the size of xenografts (10, 35, 36).

388 Mol Cancer Res; 11(4) April 2013 Molecular Cancer Research

Combined HER2 and PTK6 RNAi Reduce Breast Cancer Progression

15, 30, 32). Consequently, the tumor cell growth regulated by these proteins may be reduced. In the JIMT-1 cell line, the effects concerning reduced phosphorylation of MAPK 1/ 3 (ERK 1/2) were the most extensive and compared with single knockdowns, the simultaneous silencing of both proteins resulted in a further statistically signiﬁcant reduction of phosphorylation. Our results are in agreement with previous studies showing decreased phosphorylations of (p38) MAPK (MAPK 1/3, ERK 1/2) following PTK6 knockdown (15). Regarding the STAT3 activation at Ser727, we observed a slightly reduced phosphorylation after simultaneous knockdown in JIMT-1 cells, whereas in T47D cells, a HER2 knockdown-dependent phosphorylation was observed. Usu- ally, PTK6 is involved in the phosphorylation of STAT3 at Tyr705 (31), but phosphorylation at this site was not detectable in JIMT-1 and T47D cells. Because the phosphorylation of STAT3 at Ser727 is affected by the MAPK pathway (37), we assume that there is an indirect regulation of STAT3 at Ser727 via the MAPK that was explicitly reduced following the combined silencing. Interestingly, due to siRNA-mediated downregulation, the phosphorylation of STAT3 at Ser727 was already reduced following the single HER2 or PTK6 knockdown. We hypothesize that the

Figure 6. The simultaneous knockdown of HER2 and PTK6 and reduced JIMT-1 cell invasion. A, control (mock) and infected with empty vector, and vectors for HER2 and PTK6 single knockdown, respectively, and both vectors simultaneously were seeded at a concentration of 5 104 cells onto invasion chambers in 24-well cell culture plates and were incubated for 24 hours at 37C. Invasive cells were stained and counted. The graph shows the means and the SDs of 2 independent infections. B, Western blot analysis of the extracts from JIMT-1 cells (mock, infected with the empty vector, and vectors for HER2 and PTK6 single knockdown, respectively, and both vectors simultaneously) using primary antibodies targeting HER2, PTK6, and cleaved (84 kDa) MMP9. For quantiﬁcations, the means of 3 independent infections were calculated.

In previous studies, we have shown the association of HER2 with PTK6 in breast cancer (19, 20, 22). These studies led us to investigate the effects of simultaneous knockdown of HER2 and PTK6. To show stronger effects in regards to the reduction of tumor progression, we simultaneously knocked down HER2 and PTK6 in T47D cells and in trastuzumab-resistant JIMT-1 cells. This inhibition may offer an attractive approach for directed therapy of resistant breast tumors. Prompted by preliminary results in which the transient and simultaneous downregulation of HER2 and PTK6 revealed to be more efﬁcient involving the reduced phosphorylation of HER2-associated signaling proteins, we stably silenced HER2 and PTK6 in 2 human breast cancer cell lines. MAPKs, STAT3, Akt, and PTEN are involved in Figure 7. The knockdown of HER2 or PTK6 signiﬁcantly reduces tumor growth in vivo. Nude mice were orthotopically inoculated with JIMT-1 and tumorigenic processes, and reduced phosphorylations of T47D cells carrying a control vector, cells depleted of HER2, PTK6, or of these signaling proteins may more strongly inhibit cell both proteins. The median and SE of the normalized tumor sizes are proliferation, migration, and antiapoptotic pathways (14, plotted, (n ¼ 11 animals per group).

www.aacrjournals.org Mol Cancer Res; 11(4) April 2013 389

Ludyga et al.

long-term downregulation causes a time-dependent adap- The stronger effects due to simultaneous RNAi were also tation of the cells and compensates for the absent phosphor- underpinned by reduced migration and invasion of JIMT-1 ylation at Ser727 by activation of alternative kinases. The cells in vitro, correlated with a reduced activation of MAPK reduced phosphorylation of Akt at Ser473 in particular after 1/3 (ERK 1/2), and MMP9. Both proteins are also involved HER2 and simultaneous silencing suggests a HER2-depen- in cell motility, wound healing, and invasion (15, 34). dent regulation. This result correlates with a study presented Migration and invasion are complex processes, and both by Knuefermann and colleagues (38), showing Akt activa- highly contribute to the malignancy of tumor cells (42). tion through the HER2/PI-3K pathway in breast adenocar- Although each single silencing statistically reduced JIMT-1 cinoma cells. In addition, study conducted by Ostrander and cell migration and the simultaneous approach further dimin- colleagues showed no change in the phosphorylation of Akt ished the migration, in comparison with single knockdowns, following PTK6 knockdown (15). The phosphorylation, it was not statistically significant. We suggest that the single and therefore the inactivation of the tumor suppressor silencing effect, in particular the PTK6 RNAi, was so strong PTEN, was significantly reduced only when both proteins that the dual knockdown does not lead to significant changes were silenced in combination. Here, we also assume a time- anymore. However, the migration and invasion of JIMT-1 dependent compensation regulated by other kinases when cells seemed to be more affected by the depletion of PTK6 HER2 or PTK6 were stably knocked down. According to than of HER2. our observations, the effects following the dual knockdown To show the effect of HER2 and PTK6 silencing in vivo, may be based on the inhibition of HER2-associated path- we carried out animal experiments with female immuno- ways, and additionally, by diminished PTK6-regulated sig- suppressed nude mice. The tumor growth was significantly naling involved in EGFR and insulin-like growth factor-1 reduced following HER2, PTK6, and simultaneous knock- receptor pathways (e.g., refs. 21, 39). down. Interestingly, in JIMT-1 cells, PTK6 downregulation Although the simultaneous knockdown led to a reduced seemed to have a greater impact on reducing tumor growth activation of several signaling proteins involved in tumor- than HER2 RNAi, whereas in T47D cells, the HER2 igenesis, an induction of apoptosis was not observed. It knockdown stronger impaired the cells in vivo. These results seems that even a combined knockdown of HER2 and partly reflect our observations from the previously conducted PTK6 was not powerful enough to induce apoptosis neither in vitro assays. This outcome might be related to the different in T47D nor in JIMT-1 cells. Our results regarding the genotypic features of the respective cell line, namely that the additive effects due to simultaneous knockdown are in survival of the JIMT-1 cells is not as strongly regulated by agreement with previous studies showing stronger effects HER2 protein expression, as it may be in other HER2- following combined silencing of other target proteins overexpressing and HER2-dependent cell lines, for example, (10, 35, 36, 40). However, RNAi of HER2 and uPAR SKBR-3 or BT474 (9, 10, 43). In addition, the strong effect together, with the addition of trastuzumab, induced apo- of PTK6 knockdown may also be associated with the fact ptosis in breast cancer cells (10). This outcome may be that PTK6 is expressed in approximately 80% of breast explained by the application of different cell lines, for tissues (13), and therefore, it may be an additional target in example, SKBR-3 or BT474, which are sensitive to trastu- particular considering the therapy of trastuzumab-resistant zumab in contrast to JIMT-1 cells, and by the fact that the breast cancers. Furthermore, although the HER2 expres- proliferation in these cell lines is more dependent on HER2 sion in T47D cells is not very high, the HER2 knockdown expression levels than in JIMT-1 cells (9, 10). in this cell line has a greater impact than the PTK6 RNAi. While the cell-cycle protein expression (cyclin A, cyclin This indicates a highly HER2-dependent proliferation D1, cyclin, E and cdk2; data not shown) was not affected which may also be correlated with the trastuzumab-sensi- following downregulation, the expression of the cell-cycle tivity of T47D cells (data not shown). Consistent with our inhibitor p27 was clearly elevated in T47D and JIMT-1 cells findings, some research groups showed that overexpression when HER2, PTK6, and both were knocked down. This of HER2 and PTK6 in vitro and in vivo increases breast may result in a G1 arrest and therefore in a reduced cell-cycle cancer tumorigenesis (21, 44, 45). Accordingly, when progression. This outcome corresponds to the significantly HER2 was downregulated, the cell proliferation of pronounced decrease in the percentage of viable cells fol- JIMT-1 breast cancer cells was also reduced in vivo lowing the combined downregulation of HER2 and PTK6. (9, 46). Concerning PTK6 knockdown in vivo only, inves- Our results are in accordance with a previous study showing tigations in the murine small intestine are described and regulation of p27 expression by PTK6 in MDA-MB-231 show a contrary role compared with its role in breast cancer breast cancer cells through the activity of its transcription (47, 48). factor FoxO3a (18). Another study reported an epigalloca- Unexpectedly, although the reduction of tumor growth in techin-3 gallate-induced inhibition of growth in HER2- vivo following single PTK6 or HER2 knockdown was positive breast cancer cells via repression of FoxO3a and significantly reduced in both cell line xenografts, the com- induction of p27 (41). However, PTK6 silencing seemed to bined approach led to an intermediate reduction of the influence the trastuzumab-resistant JIMT-1 cell prolifera- tumor size and not to an additive one. Here, we hypothesize tion more than HER2 knockdown. In T47D cells, the that in contrast to the positively infected cells of the com- HER2 knockdown impaired the cell proliferation more than bined knockdown approach (which significantly reduced the the PTK6 downregulation. cell proliferation), the minimal number of noninfected cells,

390 Mol Cancer Res; 11(4) April 2013 Molecular Cancer Research

Combined HER2 and PTK6 RNAi Reduce Breast Cancer Progression

which have a survival benefit, may strongely proliferate Analysis and interpretation of data (e.g., statistical analysis, biostatistics, compu- tational analysis): N. Ludyga, N. Anastasov, M. Rosemann, J. Seiler, N. Lohmann, during the experiment duration of upto 8 weeks. H. Braselmann, M. Schmitt In summary, our experiments for the first time provide Writing, review, and/or revision of the manuscript: N. Ludyga, N. Anastasov, M. Rosemann, K. Mengele, M. Schmitt, M. Aubele evidence that the knockdown of HER2 and/or PTK6 can Administrative, technical, or material support (i.e., reporting or organizing data, stronger inhibit tumor progression through the significantly constructing databases): M. Rosemann reduced activation of key proteins that are linked to tumor- Study supervision: M. Schmitt, H. H€ofler, M. Aubele igenesis, and via diminished migration, invasion, and cell fi Acknowledgments proliferation leading to signi cantly decreased tumor The authors thank Michaela H€ausler, Katrin Lindner, and Stefanie Winkler for growth. Consequently, our results show that the inhibition high technical expertise. The authors also thank Boris Sch€on for animal care and of HER2 and/or PTK6 proteins represent an attractive tool Elenore Samson and Jacqueline Muller€ for assistance related to animal treatment. in targeted breast cancer therapy. Grant support Disclosure of Potential Conflicts of Interest This work was supported by the Deutsche Forschungsgemeinschaft (DFG, grant no. 1671/1-1; to N. Ludyga). No potential conflicts of interest were disclosed. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with Authors' Contributions 18 U.S.C. Section 1734 solely to indicate this fact. Conception and design: N. Ludyga, M. Schmitt, H. H€ofler Acquisition of data (provided animals, acquired and managed patients, provided Received June 25, 2012; revised December 11, 2012; accepted December 28, 2012; facilities, etc.): N. Anastasov, K. Mengele, H. H€ofler published OnlineFirst January 30, 2013.

References 1. Moasser MM. Targeting the function of the HER2 oncogene in human tion of ERK5 and p38 MAP kinases in breast cancer cells. Cancer Res cancer therapeutics. Oncogene 2007;26:6577–92. 2007;67:4199–209. 2. Sergina NV, Moasser MM. The HER family and cancer: emerging 16. Chen HY, Shen CH, Tsai YT, Lin FC, Huang YP, Chen RH. Brk activates molecular mechanisms and therapeutic targets. Trends Mol Med rac1 and promotes cell migration and invasion by phosphorylating 2007;13:527–34. paxillin. Mol Cell Biol 2004;24:10558–72. 3. Ross JS, Fletcher JA, Bloom KJ, Linette GP, Stec J, Clark E, et al. HER- 17. Aubele M, Walch AK, Ludyga N, Braselmann H, Atkinson MJ, Luber 2/neu testing in breast cancer. Am J Clin Pathol 2003;120:53–71. B, et al. Prognostic value of protein tyrosine kinase 6 (PTK6) for long- 4. Menard S, Pupa SM, Campiglio M, Tagliabue E. Biologic and thera- term survival of breast cancer patients. Br J Cancer 2008;99: peutic role of HER2 in cancer. Oncogene 2003;22:6570–8. 1089–95. 5. Awada A, Bozovic-Spasojevic I, Chow L. New therapies in HER2- 18. Chan E, Nimnual AS. Deregulation of the cell cycle by breast tumor positive breast cancer: a major step towards a cure of the disease? kinase (Brk). Int J Cancer 2010;127:2723–31. Cancer Treat Rev 2012;38:494–504 19. Ludyga N, Anastasov N, Gonzalez-Vasconcellos I, Ram M, Ho€fler H, 6. Sparano JA. Cardiac toxicity of trastuzumab (Herceptin): implications Aubele M. Impact of protein tyrosine kinase 6 (PTK6) on human for the design of adjuvant trials. Semin Oncol 2001;28:20–7. epidermal growth factor receptor (HER) signalling in breast cancer. 7. Kopper L. Lapatinib: a sword with two edges. Pathol Oncol Res Mol Biosyst 2011;7:1603–12. 2008;14:1–8. 20. Born M, Quintanilla-Fend L, Braselmann H, Reich U, Richter M, Hutzler 8. Nagy P, Friedlander€ E, Tanner M, Kapanen AI, Carraway KL, Isola J, P, et al. Simultaneous over-expression of the Her2/neu and PTK6 et al. Decreased accessibility and lack of activation of ErbB2 in JIMT-1, tyrosine kinases in archival invasive ductal breast carcinomas. J Pathol a herceptin-resistant, MUC4-expressing breast cancer cell line. Can- 2005;205:592–6. cer Res 2005;65:473–82. 21. Xiang B, Chatti K, Qiu H, Lakshmi B, Krasnitz A, Hicks J, et al. Brk is 9. Faltus T, Yuan J, Zimmer B, Kramer€ A, Loibl S, Kaufmann M, et al. coamplified with ErbB2 to promote proliferation in breast cancer. Proc Silencing of the HER2/neu gene by siRNA inhibits proliferation and Natl Acad Sci U S A 2008;105:12463–8. induces apoptosis in HER2/neu-overexpressing breast cancer cells. 22. Aubele M, Spears M, Ludyga N, Braselmann H, Feuchtinger A, Taylor Neoplasia 2004;6:786–95. KJ, et al. In situ quantification of HER2-protein tyrosine kinase 6 (PTK6) 10. Li C, Cao S, Liu Z, Ye X, Chen L, Meng S. RNAi-mediated down- protein-protein complexes in paraffin sections from breast cancer regulation of uPAR synergizes with targeting of HER2 through the tissues. Br J Cancer 2010;103:663–7. ERK pathway in breast cancer cells. Int J Cancer 2010;127: 23. Tanner M, Kapanen AI, Junttila T, Raheem O, Grenman S, Elo J, et al. 1507–16. Characterization of a novel cell line established from a patient with 11. Llor X, Serfas W, Bie V, Vasioukhin M, Polonskaia J, Derry J, et al. BRK/ Herceptin-resistant breast cancer. Mol Cancer Ther 2004;3:1585–92. Sik expression in the gastrointestinal tract and in colon tumours, Clin 24. Valabrega G, Montemurro F, Aglietta M. Trastuzumab: mechanism of Cancer Res 1999;5:1767–77. action, resistance and future perspectives in HER2-overexpressing 12. Derry JJ, Rins GS, Ray V, Tyner AL. Altered localization and activity of breast cancer. Ann Oncol 2007;18:977–84. the intracellular tyrosine kinase BRK/Sik in prostate tumour cells. 25. Nagata Y, Lan KH, Zhou X, Tan M, Esteva FJ, Sahin AA, et al. PTEN Oncogene 2003;22:4212–20. activation contributes to tumor inhibition by trastuzumab, and loss of 13. Mitchell PJ, Barker KT, Martindale JE, Kamalati T, Lowe PN, Page MJ, PTEN predicts trastuzumab resistance in patients. Cancer Cell et al. Cloning and characterisation of cDNAs encoding a novel non- 2004;6:117–27. receptor tyrosine kinase, brk, expressed in human breast tumours. 26. Oliveras-Ferraros C, Vazquez-Martin A, Cufí S, Torres-Garcia VZ, Oncogene 1994;9:2383–90. Sauri-Nadal T, Barco SD, et al. Inhibitor of Apoptosis (IAP) survivin is 14. Ikeda O, Miyasaka Y, Sekine Y, Mizushima A, Muromoto R, Nanbo A, indispensable for survival of HER2 gene-amplified breast cancer cells et al. STAP-2 is phosphorylated at tyrosine-250 by Brk and modulates with primary resistance to HER1/2-targeted therapies. Biochem Bio- Brk-mediated STAT3 activation. Biochem Biophys Res Commun phys Res Commun 2011;407:412–9. 2009;384:71–5. 27. Anastasov N, Klier M, Koch I, Angermeier D, Ho€fler H, Fend F, et al. 15. Ostrander JH, Daniel AR, Lofgren K, Kleer CG, Lange CA. Breast tumor Efficient shRNA delivery into B and T lymphoma cells using lentiviral kinase (protein tyrosine kinase 6) regulates heregulin-induced activa- vector-mediated transfer. J Hematop 2009;2:9–19.

www.aacrjournals.org Mol Cancer Res; 11(4) April 2013 391

Ludyga et al.

28. Liang CC, Park AY, Guan JL. In vitro scratch assay: a convenient and 39. Irie HY, Shrestha Y, Selfors LM, Frye F, Iida N, Wang Z, et al. PTK6 inexpensive method for analysis of cell migration in vitro. Nat Protoc regulates IGF-1-induced anchorage-independent survival. PLoS ONE 2007;2:329–33. 2010;5:e11729. 29. Geback€ T, Schulz MM, Koumoutsakos P, Detmar M. TScratch: a novel 40. Gondi CS, Rao JS. Therapeutic potential of siRNA-mediated targeting and simple software tool for automated analysis of monolayer wound of urokinase plasminogen activator, its receptor, and matrix metallo- healing assays. Biotechniques 2009;46:265–74. proteinases. Methods Mol Biol 2009;487:267–81 30. Songyang Z, Baltimore D, Cantley LC, Kaplan DR, Franke TF. Inter- 41. Eddy SF, Kane SE, Sonenshein GE. Trastuzumab-resistant HER2- leukin 3-dependent survival by the Akt protein kinase. Proc Natl Acad driven breast cancer cells are sensitive to epigallocatechin-3 gallate. Sci U S A 1997;94:11345–50. Cancer Res 2007;67:9018–23. 31. Liu L, Gao Y, Qiu H, Miller WT, Poli V, Reich NC. Identification of STAT3 42. Stetler-Stevenson WG, Aznavoorian S, Liotta LA. Tumor cell interac- as a specific substrate of breast tumor kinase. Oncogene 2006; tions with the extracellular matrix during invasion and metastasis. Annu 25:4904–12. Rev Cell Biol 1993;9:541–73. 32. Vazquez F, Ramaswamy S, Nakamura N, Sellers WR. Phosphorylation 43. Choudhury A, Charo J, Parapuram SK, Hunt RC, Hunt DM, Seliger B, of the PTEN tail regulates protein stability and function. Mol Cell Biol et al. Small interfering RNA (siRNA) inhibits the expression of the Her2/ 2000;20:5010–8. neu gene, upregulates HLA class I and induces apoptosis of Her2/neu 33. Berridge MV, Tan AS, McCoy KD, Wang R. The biochemical and positive tumor cell lines. Int J Cancer 2004;108:71–7. cellular basis of cell proliferation assays that use tetrazolium salts. 44. Shen CH, Chen HY, Lin MS, Li FY, Chang CC, Kuo ML, et al. Breast Biochemica 1996;4:15–9. tumor kinase phosphorylates p190RhoGAP to regulate rho and ras and 34. Egeblad M, Werb Z. New functions for the matrix metalloproteinases in promote breast carcinoma growth, migration, and invasion. Cancer cancer progression. Nat Rev Cancer 2002;2:161–74. Res 2008;68:7779–87. 35. Kunigal S, Lakka SS, Gondi CS, Estes N, Rao JS. RNAi-mediated 45. Lofgren KA, Ostrander JH, Housa D, Hubbard GK, Locatelli A, Bliss RL, downregulation of urokinase plasminogen activator receptor and et al. Mammary gland specific expression of Brk/PTK6 promotes matrix metalloprotease-9 in human breast cancer cells results in delayed involution and tumor formation associated with activation of decreased tumor invasion, angiogenesis and growth. Int J Cancer p38 MAPK. Breast Cancer Res 2011;13:R89. 2007;121:2307–16. 46. Hu X, Su F, Qin L, Jia W, Gong C, Yu F, et al. Stable RNA interference of 36. Subramanian R, Gondi CS, Lakka SS, Jutla A, Rao JS. siRNA-medi- ErbB-2 gene synergistic with epirubicin suppresses breast cancer ated simultaneous downregulation of uPA and its receptor inhibits growth in vitro and in vivo. Biochem Biophys Res Commun angiogenesis and invasiveness triggering apoptosis in breast cancer 2006;346:778–85. cells. Int J Oncol 2006;28:831–9. 47. Haegebarth A, Bie W, Yang R, Crawford SE, Vasioukhin V, Fuchs E, 37. Wen Z, Zhong Z, Darnell JE Jr. Maximal activation of transcription by et al. Protein tyrosine kinase 6 negatively regulates growth and pro- Stat1 and Stat3 requires both tyrosine and serine phosphorylation. Cell motes enterocyte differentiation in the small intestine. Mol Cell Biol 1995;82:241–50. 2006;26:4949–57. 38. Knuefermann C, Lu Y, Liu B, Jin W, Liang K, Wu L, et al. HER2/PI-3K/ 48. Palka-Hamblin HL, Gierut JJ, Bie W, Brauer PM, Zheng Y, Asara JM, Akt activation leads to a multidrug resistance in human breast ade- et al. Identification of beta-catenin as a target of the intracellular nocarcinoma cells. Oncogene 2003;22:3205–12. tyrosine kinase PTK6. J Cell Sci 2010;123:236–45.

392 Mol Cancer Res; 11(4) April 2013 Molecular Cancer Research

Effects of Simultaneous Knockdown of HER2 and PTK6 on Malignancy and Tumor Progression in Human Breast Cancer Cells

Natalie Ludyga, Natasa Anastasov, Michael Rosemann, et al.

Mol Cancer Res 2013;11:381-392. Published OnlineFirst January 30, 2013.

Updated version Access the most recent version of this article at: doi:10.1158/1541-7786.MCR-12-0378

Cited articles This article cites 48 articles, 12 of which you can access for free at: http://mcr.aacrjournals.org/content/11/4/381.full#ref-list-1

Citing articles This article has been cited by 2 HighWire-hosted articles. Access the articles at: http://mcr.aacrjournals.org/content/11/4/381.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://mcr.aacrjournals.org/content/11/4/381. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.