Mammalian Atypical E2fs Link Endocycle Control to Cancer
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis
bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Screening and identification of key biomarkers in clear cell renal cell carcinoma based on bioinformatics analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Clear cell renal cell carcinoma (ccRCC) is one of the most common types of malignancy of the urinary system. The pathogenesis and effective diagnosis of ccRCC have become popular topics for research in the previous decade. In the current study, an integrated bioinformatics analysis was performed to identify core genes associated in ccRCC. An expression dataset (GSE105261) was downloaded from the Gene Expression Omnibus database, and included 26 ccRCC and 9 normal kideny samples. Assessment of the microarray dataset led to the recognition of differentially expressed genes (DEGs), which was subsequently used for pathway and gene ontology (GO) enrichment analysis. -
Reproductionreview
REPRODUCTIONREVIEW Forkhead transcription factors in ovarian function Nina Henriette Uhlenhaut and Mathias Treier Max Delbru¨ck Center for Molecular Medicine, Robert Ro¨ssle Straße 10, 13125 Berlin-Buch, Germany Correspondence should be addressed to N H Uhlenhaut; Email: [email protected] Abstract Since the discovery of the conserved forkhead (Fkh) DNA binding domain more than 20 years ago, members of the Fkh or forkhead box (FOX) family of transcription factors have been shown to act as important regulators of numerous developmental and homeostatic processes. The human genome contains 44 Fkh genes, several of which have recently been reported to be essential for female fertility. In this review, we highlight the roles of specific FOX proteins in ovarian folliculogenesis and present our current understanding of their molecular function. In particular, we describe what we have learned from loss-of-function studies using mouse models as well as human genetics and illustrate how different stages of folliculogenesis, both in oocytes and in somatic granulosa and theca cells, are regulated by FOXC1, FOXL2, and FOXO subfamily members. Reproduction (2011) 142 489–495 Introduction stages of folliculogenesis. This transition is marked by oocyte growth and proliferation of the adjacent granu- Female fertility depends on a delicate balance of losa cells that become cuboidal. Antral follicles are hormonal stimuli and cellular interactions, which formed when fluid-filled spaces develop between the ultimately enable conception and a successful preg- multi-layered granulosa cells. During preantral to antral nancy. Current estimates state that 10–15% of couples transition, the oocyte resumes meiosis, and after worldwide remain childless due to infertility, with stimulation by pituitary gonadotropins, FSH, and LH, genetic etiology making up a significant proportion the mature oocyte is expelled from the follicle and moves (Matzuk & Lamb 2002). -
Specific Functions of the Wnt Signaling System in Gene Regulatory Networks
Specific functions of the Wnt signaling system in PNAS PLUS gene regulatory networks throughout the early sea urchin embryo Miao Cui, Natnaree Siriwon1, Enhu Li2, Eric H. Davidson3, and Isabelle S. Peter3 Division of Biology and Biological Engineering, California Institute of Technology, Pasadena, CA 91125 Contributed by Eric H. Davidson, October 9, 2014 (sent for review September 12, 2014; reviewed by Robert D. Burke and Randall T. Moon) Wnt signaling affects cell-fate specification processes throughout Fig. 1A. Cells located at the vegetal pole will become skeleto- embryonic development. Here we take advantage of the well-studied genic mesodermal cells. These cells are surrounded by the veg2 gene regulatory networks (GRNs) that control pregastrular sea urchin cell lineage. This lineage consists of veg2 mesodermal cells, lo- embryogenesis to reveal the gene regulatory functions of the entire cated adjacent to skeletogenic cells and giving rise to all other Wnt-signaling system. Five wnt genes, three frizzled genes, two se- mesodermal cell fates such as esophageal muscle cells, blasto- creted frizzled-related protein 1 genes, and two Dickkopf genes are coelar cells, and pigment cells, and of veg2 endoderm cells, expressed in dynamic spatial patterns in the pregastrular embryo of which will form the foregut and parts of the midgut. At a further Strongylocentrotus purpuratus. We present a comprehensive analysis distance from the vegetal pole, but still within the vegetal half of of these genes in each embryonic domain. Total functions of the the embryo, is the veg1 lineage, consisting of veg1 endoderm, Wnt-signaling system in regulatory gene expression throughout the located adjacent to veg2 endoderm and giving rise to the other embryo were studied by use of the Porcupine inhibitor C59, which parts of the midgut and the hindgut, and of veg1 ectoderm, the interferes with zygotic Wnt ligand secretion. -
G2 Phase Cell Cycle Regulation by E2F4 Following Genotoxic Stress
G2 Phase Cell Cycle Regulation by E2F4 Following Genotoxic Stress by MEREDITH ELLEN CROSBY Submitted in partial fulfillment of the requirements for the Degree of Doctor of Philosophy Thesis Advisor: Dr. Alex Almasan Department of Environmental Health Sciences CASE WESTERN RESERVE UNIVERSITY May, 2006 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the dissertation of ______________________________________________________ candidate for the Ph.D. degree *. (signed)_______________________________________________ (chair of the committee) ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ (date) _______________________ *We also certify that written approval has been obtained for any proprietary material contained therein. TABLE OF CONTENTS TABLE OF CONTENTS………………………………………………………………….1 LIST OF FIGURES……………………………………………………………………….5 LIST OF TABLES………………………………………………………………………...7 ACKNOWLEDGEMENTS……………………………………………………………….8 LIST OF ABBREVIATIONS……………………………………………………………10 ABSTRACT……………………………………………………………………………...15 CHAPTER 1. INTRODUCTION 1.1. CELL CYCLE REGULATION: HISTORICAL OVERVIEW………………...17 1.2. THE E2F FAMILY OF TRANSCRIPTION FACTORS……………………….22 1.3. E2F AND CELL CYCLE CONTROL 1.3.1. G0/G1 Phase Transition………………………………………………….28 1.3.2. S Phase…………………………………………………………………...28 1.3.3. G2/M Phase Transition…………………………………………………..30 1.4. -
Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. -
The Role of E2F7 and E2F8 in Squamous Differentiation, UV- and Chemotherapy-Induced Responses in Keratinocytes
The role of E2F7 and E2F8 in squamous differentiation, UV- and chemotherapy-induced responses in keratinocytes Mehlika Hazar Rethinam MScBiotech (Hons) A thesis submitted for the degree of Doctor of Philosophy at The University of Queensland in 2014 UQ Diamantina Institute i Abstract Among keratinocyte-derived squamous cell carcinoma (SCC), cutaneous SCC (CSCC) is the second most common cutaneous cancer type and the most common of the potentially fatal skin cancers. Approximately 90% of head and neck cancers are SCC (HNSCC) and HNSCC worldwide is the sixth most common cancer type afflicting mankind. While resectable disease may be treated by surgery with radiation or chemoradiation, there are still no curative options for advanced, unresectable disease. However, chemotherapy alone may offer a hope for unresectable, disseminated SCC, where 50-60% of patients have disease recurrence within 2 years and approximately 30% of these develop metastatic disease. The mainstay of chemotherapeutic treatment in SCC is the platinum-based drug, cisplatin, 5-fluorouracil (5- FU), taxanes, and anti-EGFR monoclonal antibody such as Cetuximab. Nonetheless, despite advances in treatment techniques, the 5-year survival rate still remains at around 55%. Therefore, there remains a lack of options for recurrent or metastatic disease. The E2F family of transcription factors has emerged as key regulators of proliferation, differentiation and response to stress and apoptotic stimuli in keratinocytes. Consistent with these roles, dysregulation of E2F expression/activity is a common occurrence in cancer and SCC in particular. Thus, better understanding of the E2F family of proteins is essential to establish how these processes are disrupted during SCC genesis. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
E2f8 Mediates Tumor Suppression in Postnatal Liver Development
Downloaded from http://www.jci.org on January 18, 2017. https://doi.org/10.1172/JCI85506 The Journal of Clinical Investigation RESEARCH ARTICLE E2f8 mediates tumor suppression in postnatal liver development Lindsey N. Kent,1,2,3 Jessica B. Rakijas,1,2,3 Shusil K. Pandit,4 Bart Westendorp,4 Hui-Zi Chen,1,2,3,5 Justin T. Huntington,1,2,3,6 Xing Tang,1,2,3 Sooin Bae,1,2,3 Arunima Srivastava,1,2,3,7 Shantibhusan Senapati,1,2,3 Christopher Koivisto,1,2,3 Chelsea K. Martin,1,2,3 Maria C. Cuitino,1,2,3 Miguel Perez,1,2,3 Julian M. Clouse,1,2,3 Veda Chokshi,1,2,3 Neelam Shinde,1,2,3 Raleigh Kladney,1,2,3 Daokun Sun,1,2,3 Antonio Perez-Castro,1,2,3 Ramadhan B. Matondo,4 Sathidpak Nantasanti,4 Michal Mokry,8 Kun Huang,9 Raghu Machiraju,7 Soledad Fernandez,9 Thomas J. Rosol,10 Vincenzo Coppola,1,3 Kamal S. Pohar,11 James M. Pipas,12 Carl R. Schmidt,6 Alain de Bruin,4,13 and Gustavo Leone1,2,3 1Department of Cancer Biology and Genetics, College of Medicine, 2Department of Molecular Genetics, College of Biological Sciences, and 3Comprehensive Cancer Center, The Ohio State University, Columbus, Ohio, USA. 4Department of Pathobiology, Faculty of Veterinary Medicine, Utrecht University, Utrecht, Netherlands. 5Division of Medical Oncology, Department of Internal Medicine, 6Department of Surgery, College of Medicine, and 7Department of Computer Science and Engineering, College of Engineering, The Ohio State University, Columbus, Ohio, USA. 8Department of Pediatrics, Wilhelmina Children’s Hospital, University Medical Center Utrecht, Utrecht, Netherlands. -
The Capacity of Long-Term in Vitro Proliferation of Acute Myeloid
The Capacity of Long-Term in Vitro Proliferation of Acute Myeloid Leukemia Cells Supported Only by Exogenous Cytokines Is Associated with a Patient Subset with Adverse Outcome Annette K. Brenner, Elise Aasebø, Maria Hernandez-Valladares, Frode Selheim, Frode Berven, Ida-Sofie Grønningsæter, Sushma Bartaula-Brevik and Øystein Bruserud Supplementary Material S2 of S31 Table S1. Detailed information about the 68 AML patients included in the study. # of blasts Viability Proliferation Cytokine Viable cells Change in ID Gender Age Etiology FAB Cytogenetics Mutations CD34 Colonies (109/L) (%) 48 h (cpm) secretion (106) 5 weeks phenotype 1 M 42 de novo 241 M2 normal Flt3 pos 31.0 3848 low 0.24 7 yes 2 M 82 MF 12.4 M2 t(9;22) wt pos 81.6 74,686 low 1.43 969 yes 3 F 49 CML/relapse 149 M2 complex n.d. pos 26.2 3472 low 0.08 n.d. no 4 M 33 de novo 62.0 M2 normal wt pos 67.5 6206 low 0.08 6.5 no 5 M 71 relapse 91.0 M4 normal NPM1 pos 63.5 21,331 low 0.17 n.d. yes 6 M 83 de novo 109 M1 n.d. wt pos 19.1 8764 low 1.65 693 no 7 F 77 MDS 26.4 M1 normal wt pos 89.4 53,799 high 3.43 2746 no 8 M 46 de novo 26.9 M1 normal NPM1 n.d. n.d. 3472 low 1.56 n.d. no 9 M 68 MF 50.8 M4 normal D835 pos 69.4 1640 low 0.08 n.d. -
The E–Id Protein Axis Modulates the Activities of the PI3K–AKT–Mtorc1
Downloaded from genesdev.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press The E–Id protein axis modulates the activities of the PI3K–AKT–mTORC1– Hif1a and c-myc/p19Arf pathways to suppress innate variant TFH cell development, thymocyte expansion, and lymphomagenesis Masaki Miyazaki,1,8 Kazuko Miyazaki,1,8 Shuwen Chen,1 Vivek Chandra,1 Keisuke Wagatsuma,2 Yasutoshi Agata,2 Hans-Reimer Rodewald,3 Rintaro Saito,4 Aaron N. Chang,5 Nissi Varki,6 Hiroshi Kawamoto,7 and Cornelis Murre1 1Department of Molecular Biology, University of California at San Diego, La Jolla, California 92093, USA; 2Department of Biochemistry and Molecular Biology, Shiga University of Medical School, Shiga 520-2192, Japan; 3Division of Cellular Immunology, German Cancer Research Center, D-69120 Heidelberg, Germany; 4Department of Medicine, University of California at San Diego, La Jolla, California 92093, USA; 5Center for Computational Biology, Institute for Genomic Medicine, University of California at San Diego, La Jolla, California 92093, USA; 6Department of Pathology, University of California at San Diego, La Jolla, California 92093, USA; 7Department of Immunology, Institute for Frontier Medical Sciences, Kyoto University, Kyoto 606-8507, Japan It is now well established that the E and Id protein axis regulates multiple steps in lymphocyte development. However, it remains unknown how E and Id proteins mechanistically enforce and maintain the naı¨ve T-cell fate. Here we show that Id2 and Id3 suppressed the development and expansion of innate variant follicular helper T (TFH) cells. Innate variant TFH cells required major histocompatibility complex (MHC) class I-like signaling and were associated with germinal center B cells. -
Ccnf (NM 007634) Mouse Tagged ORF Clone – MR210593 | Origene
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR210593 Ccnf (NM_007634) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Ccnf (NM_007634) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Ccnf Synonyms: CycF; Fbxo1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 Ccnf (NM_007634) Mouse Tagged ORF Clone – MR210593 ORF Nucleotide >MR210593 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGAGCGGCGGTGTGATCCATTGTAGGTGTGCCAAGTGTTTCTGTTATCCTACTAAACGAAGAATCA AAAGAAGACCCAGAAACTTAACCATCTTGAGTCTCCCAGAAGATGTACTCTTTCATATCCTGAAATGGCT TTCTGTTGGGGACATCCTTGCTGTCCGAGCTGTCCACTCCCACCTCAAGTACCTGGTGGACAACCATGCC AGTGTGTGGGCATCCGCCAGCTTCCAGGAGCTGTGGCCTTCTCCACAGAACCTGAAGCTCTTTGAAAGGG CTGCTGAAAAGGGAAATTTTGAAGCTGCTGTGAAGTTGGGGATTGCCTACCTCTACAATGAAGGCCTGTC TGTGTCAGATGAGGCCTGCGCAGAAGTGAACGGCTTGAAGGCCTCTCGCTTCTTCAGCATGGCTGAGAGA CTGAATACGGGTTCTGAGCCCTTCATTTGGCTCTTCATCCGCCCACCGTGGTCAGTGTCCGGAAGCTGCT GCAAGGCTGTGGTTCATGACAGCCTCCGAGCGGAGTGTCAGTTACAGAGAAGTCATAAAGCTTCCATACT ACACTGCTTGGGAAGGGTGCTAAATCTTTTTGAGGACGAAGAGAAAAGGAAGCAGGCGCGTAGCCTTTTG -
Mithramycin Represses Basal and Cigarette Smoke–Induced Expression of ABCG2 and Inhibits Stem Cell Signaling in Lung and Esophageal Cancer Cells
Cancer Therapeutics, Targets, and Chemical Biology Research Mithramycin Represses Basal and Cigarette Smoke–Induced Expression of ABCG2 and Inhibits Stem Cell Signaling in Lung and Esophageal Cancer Cells Mary Zhang1, Aarti Mathur1, Yuwei Zhang1, Sichuan Xi1, Scott Atay1, Julie A. Hong1, Nicole Datrice1, Trevor Upham1, Clinton D. Kemp1, R. Taylor Ripley1, Gordon Wiegand2, Itzak Avital2, Patricia Fetsch3, Haresh Mani6, Daniel Zlott4, Robert Robey5, Susan E. Bates5, Xinmin Li7, Mahadev Rao1, and David S. Schrump1 Abstract Cigarette smoking at diagnosis or during therapy correlates with poor outcome in patients with lung and esophageal cancers, yet the underlying mechanisms remain unknown. In this study, we observed that exposure of esophageal cancer cells to cigarette smoke condensate (CSC) led to upregulation of the xenobiotic pump ABCG2, which is expressed in cancer stem cells and confers treatment resistance in lung and esophageal carcinomas. Furthermore, CSC increased the side population of lung cancer cells containing cancer stem cells. Upregulation of ABCG2 coincided with increased occupancy of aryl hydrocarbon receptor, Sp1, and Nrf2 within the ABCG2 promoter, and deletion of xenobiotic response elements and/or Sp1 sites markedly attenuated ABCG2 induction. Under conditions potentially achievable in clinical settings, mithramycin diminished basal as well as CSC- mediated increases in AhR, Sp1, and Nrf2 levels within the ABCG2 promoter, markedly downregulated ABCG2, and inhibited proliferation and tumorigenicity of lung and esophageal cancer cells. Microarray analyses revealed that mithramycin targeted multiple stem cell–related pathways in vitro and in vivo. Collectively, our findings provide a potential mechanistic link between smoking status and outcome of patients with lung and esophageal cancers, and support clinical use of mithramycin for repressing ABCG2 and inhibiting stem cell signaling in thoracic malignancies.