The Tumor Suppressor Notch Inhibits Head and Neck Squamous Cell
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Functional Proteomic Profiling of Secreted Serine Proteases In
www.nature.com/scientificreports OPEN Functional Proteomic Profling of Secreted Serine Proteases in Health and Infammatory Bowel Disease Received: 24 November 2017 Alexandre Denadai-Souza1, Chrystelle Bonnart1, Núria Solà Tapias1, Marlène Marcellin2, Accepted: 30 April 2018 Brendan Gilmore3, Laurent Alric4, Delphine Bonnet1, Odile Burlet-Schiltz2, Morley D. Hollenberg5, Published: xx xx xxxx Nathalie Vergnolle1,5 & Céline Deraison1 While proteases are essential in gastrointestinal physiology, accumulating evidence indicates that dysregulated proteolysis plays a pivotal role in the pathophysiology of infammatory bowel disease (IBD). Nonetheless, the identity of overactive proteases released by human colonic mucosa remains largely unknown. Studies of protease abundance have primarily investigated expression profles, not taking into account their enzymatic activity. Herein we have used serine protease-targeted activity- based probes (ABPs) coupled with mass spectral analysis to identify active forms of proteases secreted by the colonic mucosa of healthy controls and IBD patients. Profling of (Pro-Lys)-ABP bound proteases revealed that most of hyperactive proteases from IBD secretome are clustered at 28-kDa. We identifed seven active proteases: the serine proteases cathepsin G, plasma kallikrein, plasmin, tryptase, chymotrypsin-like elastase 3 A, and thrombin and the aminopeptidase B. Only cathepsin G and thrombin were overactive in supernatants from IBD patient tissues compared to healthy controls. Gene expression analysis highlighted the transcription of genes encoding these proteases into intestinal mucosae. The functional ABP-targeted proteomic approach that we have used to identify active proteases in human colonic samples bears directly on the understanding of the role these enzymes may play in the pathophysiology of IBD. Te degradome represents almost 2% of protein coding genes in the human genome, with at least 588 genes cod- ing for proteases. -
Identification of the Causative Gene for Simmental Arachnomelia Syndrome Using a Network-Based Disease Gene Prioritization Approach
Identification of the Causative Gene for Simmental Arachnomelia Syndrome Using a Network-Based Disease Gene Prioritization Approach Shihui Jiao1., Qin Chu2., Yachun Wang1*, Zhenquan Xie3, Shiyu Hou3, Airong Liu5, Hongjun Wu4, Lin Liu6, Fanjun Geng7, Congyong Wang7, Chunhua Qin8, Rui Tan9, Xixia Huang10, Shixin Tan11, Meng Wu12, Xianzhou Xu12, Xuan Liu1, Ying Yu1, Yuan Zhang1 1 Key Laboratory of Agricultural Animal and Breeding, National Engineering Laboratory for Animal Breeding, College of Animal Science and Technology, China Agricultural University, Beijing, China, 2 Institute of Animal Husbandry and Veterinary Medicine, Beijing Academy of Agriculture and Forestry Sciences, Beijing, China, 3 Anshan Hengli Dairy Farm, Anshan, Liaoning, China, 4 Xiertala Breeding Farm, Hailaer Farm Buro, Hailaer, Inner Mongolia, China, 5 Hailaer Farm Buro, Hailaer, Inner Mongolia, China, 6 Beijing Dairy Cattle Centre, Beijing, China, 7 Dingyuan Seedstock Bulls Breeding Ltd. Company, Zhengzhou, Henan, China, 8 Ningxia Sygen BioEngineering Research Center, Yinchuan, Ningxia, China, 9 Xinjiang General Livestock Service, Urumqi, Xinjiang, China, 10 College of Animal Science, Xinjiang Agriculture University, Urumqi, Xinjiang, China, 11 Xinjiang Tianshan Animal Husbandry Bio-engineering Co. Ltd, Urumqi, Xinjiang, China, 12 Dalian Xuelong Industry Limited Group, Dalian, Liaoning, China Abstract Arachnomelia syndrome (AS), mainly found in Brown Swiss and Simmental cattle, is a congenital lethal genetic malformation of the skeletal system. In this study, a network-based disease gene prioritization approach was implemented to rank genes in the previously reported ,7 Mb region on chromosome 23 associated with AS in Simmental cattle. The top 6 ranked candidate genes were sequenced in four German Simmental bulls, one known AS-carrier ROMEL and a pooled sample of three known non-carriers (BOSSAG, RIFURT and HIRMER). -
Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. -
Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo -
Environmental Influences on Endothelial Gene Expression
ENDOTHELIAL CELL GENE EXPRESSION John Matthew Jeff Herbert Supervisors: Prof. Roy Bicknell and Dr. Victoria Heath PhD thesis University of Birmingham August 2012 University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. ABSTRACT Tumour angiogenesis is a vital process in the pathology of tumour development and metastasis. Targeting markers of tumour endothelium provide a means of targeted destruction of a tumours oxygen and nutrient supply via destruction of tumour vasculature, which in turn ultimately leads to beneficial consequences to patients. Although current anti -angiogenic and vascular targeting strategies help patients, more potently in combination with chemo therapy, there is still a need for more tumour endothelial marker discoveries as current treatments have cardiovascular and other side effects. For the first time, the analyses of in-vivo biotinylation of an embryonic system is performed to obtain putative vascular targets. Also for the first time, deep sequencing is applied to freshly isolated tumour and normal endothelial cells from lung, colon and bladder tissues for the identification of pan-vascular-targets. Integration of the proteomic, deep sequencing, public cDNA libraries and microarrays, delivers 5,892 putative vascular targets to the science community. -
Mediator of DNA Damage Checkpoint 1 (MDC1) Is a Novel Estrogen Receptor Co-Regulator in Invasive 6 Lobular Carcinoma of the Breast 7 8 Evelyn K
bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423142; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 1 Running Title: MDC1 co-regulates ER in ILC 2 3 Research article 4 5 Mediator of DNA damage checkpoint 1 (MDC1) is a novel estrogen receptor co-regulator in invasive 6 lobular carcinoma of the breast 7 8 Evelyn K. Bordeaux1+, Joseph L. Sottnik1+, Sanjana Mehrotra1, Sarah E. Ferrara2, Andrew E. Goodspeed2,3, James 9 C. Costello2,3, Matthew J. Sikora1 10 11 +EKB and JLS contributed equally to this project. 12 13 Affiliations 14 1Dept. of Pathology, University of Colorado Anschutz Medical Campus 15 2Biostatistics and Bioinformatics Shared Resource, University of Colorado Comprehensive Cancer Center 16 3Dept. of Pharmacology, University of Colorado Anschutz Medical Campus 17 18 Corresponding author 19 Matthew J. Sikora, PhD.; Mail Stop 8104, Research Complex 1 South, Room 5117, 12801 E. 17th Ave.; Aurora, 20 CO 80045. Tel: (303)724-4301; Fax: (303)724-3712; email: [email protected]. Twitter: 21 @mjsikora 22 23 Authors' contributions 24 MJS conceived of the project. MJS, EKB, and JLS designed and performed experiments. JLS developed models 25 for the project. EKB, JLS, SM, and AEG contributed to data analysis and interpretation. SEF, AEG, and JCC 26 developed and performed informatics analyses. MJS wrote the draft manuscript; all authors read and revised the 27 manuscript and have read and approved of this version of the manuscript. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS
Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen, -
A Gene Expression Resource Generated by Genome-Wide Lacz
© 2015. Published by The Company of Biologists Ltd | Disease Models & Mechanisms (2015) 8, 1467-1478 doi:10.1242/dmm.021238 RESOURCE ARTICLE A gene expression resource generated by genome-wide lacZ profiling in the mouse Elizabeth Tuck1,**, Jeanne Estabel1,*,**, Anika Oellrich1, Anna Karin Maguire1, Hibret A. Adissu2, Luke Souter1, Emma Siragher1, Charlotte Lillistone1, Angela L. Green1, Hannah Wardle-Jones1, Damian M. Carragher1,‡, Natasha A. Karp1, Damian Smedley1, Niels C. Adams1,§, Sanger Institute Mouse Genetics Project1,‡‡, James N. Bussell1, David J. Adams1, Ramiro Ramırez-Soliś 1, Karen P. Steel1,¶, Antonella Galli1 and Jacqueline K. White1,§§ ABSTRACT composite of RNA-based expression data sets. Strong agreement was observed, indicating a high degree of specificity in our data. Knowledge of the expression profile of a gene is a critical piece of Furthermore, there were 1207 observations of expression of a information required to build an understanding of the normal and particular gene in an anatomical structure where Bgee had no essential functions of that gene and any role it may play in the data, indicating a large amount of novelty in our data set. development or progression of disease. High-throughput, large- Examples of expression data corroborating and extending scale efforts are on-going internationally to characterise reporter- genotype-phenotype associations and supporting disease gene tagged knockout mouse lines. As part of that effort, we report an candidacy are presented to demonstrate the potential of this open access adult mouse expression resource, in which the powerful resource. expression profile of 424 genes has been assessed in up to 47 different organs, tissues and sub-structures using a lacZ reporter KEY WORDS: Gene expression, lacZ reporter, Mouse, Resource gene. -
Primary Driver Mutations in GTF2I Specific to the Development Of
cancers Article Primary Driver Mutations in GTF2I Specific to the Development of Thymomas Rumi Higuchi 1, Taichiro Goto 1,* , Yosuke Hirotsu 2 , Yujiro Yokoyama 1, Takahiro Nakagomi 1, Sotaro Otake 1, Kenji Amemiya 2,3, Toshio Oyama 3, Hitoshi Mochizuki 2 and Masao Omata 2,4 1 Lung Cancer and Respiratory Disease Center, Yamanashi Central Hospital, Yamanashi 400-8506, Japan; [email protected] (R.H.); [email protected] (Y.Y.); [email protected] (T.N.); [email protected] (S.O.) 2 Genome Analysis Center, Yamanashi Central Hospital, Yamanashi 400-8506, Japan; [email protected] (Y.H.); [email protected] (K.A.); [email protected] (H.M.); [email protected] (M.O.) 3 Department of Pathology, Yamanashi Central Hospital, Yamanashi 400-8506, Japan; [email protected] 4 Department of Gastroenterology, The University of Tokyo Hospital, Tokyo 113-8655, Japan * Correspondence: [email protected]; Tel.: +81-55-253-7111 Received: 16 June 2020; Accepted: 22 July 2020; Published: 24 July 2020 Abstract: Thymomas are rare mediastinal tumors that are difficult to treat and pose a major public health concern. Identifying mutations in target genes is vital for the development of novel therapeutic strategies. Type A thymomas possess a missense mutation in GTF2I (chromosome 7 c.74146970T>A) with high frequency. However, the molecular pathways underlying the tumorigenesis of other thymomas remain to be elucidated. We aimed to detect this missense mutation in GTF2I in other thymoma subtypes (types B). This study involved 22 patients who underwent surgery for thymomas between January 2014 and August 2019. -
Ccnf (NM 007634) Mouse Tagged ORF Clone – MR210593 | Origene
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR210593 Ccnf (NM_007634) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Ccnf (NM_007634) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Ccnf Synonyms: CycF; Fbxo1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 Ccnf (NM_007634) Mouse Tagged ORF Clone – MR210593 ORF Nucleotide >MR210593 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGAGCGGCGGTGTGATCCATTGTAGGTGTGCCAAGTGTTTCTGTTATCCTACTAAACGAAGAATCA AAAGAAGACCCAGAAACTTAACCATCTTGAGTCTCCCAGAAGATGTACTCTTTCATATCCTGAAATGGCT TTCTGTTGGGGACATCCTTGCTGTCCGAGCTGTCCACTCCCACCTCAAGTACCTGGTGGACAACCATGCC AGTGTGTGGGCATCCGCCAGCTTCCAGGAGCTGTGGCCTTCTCCACAGAACCTGAAGCTCTTTGAAAGGG CTGCTGAAAAGGGAAATTTTGAAGCTGCTGTGAAGTTGGGGATTGCCTACCTCTACAATGAAGGCCTGTC TGTGTCAGATGAGGCCTGCGCAGAAGTGAACGGCTTGAAGGCCTCTCGCTTCTTCAGCATGGCTGAGAGA CTGAATACGGGTTCTGAGCCCTTCATTTGGCTCTTCATCCGCCCACCGTGGTCAGTGTCCGGAAGCTGCT GCAAGGCTGTGGTTCATGACAGCCTCCGAGCGGAGTGTCAGTTACAGAGAAGTCATAAAGCTTCCATACT ACACTGCTTGGGAAGGGTGCTAAATCTTTTTGAGGACGAAGAGAAAAGGAAGCAGGCGCGTAGCCTTTTG -
Mithramycin Represses Basal and Cigarette Smoke–Induced Expression of ABCG2 and Inhibits Stem Cell Signaling in Lung and Esophageal Cancer Cells
Cancer Therapeutics, Targets, and Chemical Biology Research Mithramycin Represses Basal and Cigarette Smoke–Induced Expression of ABCG2 and Inhibits Stem Cell Signaling in Lung and Esophageal Cancer Cells Mary Zhang1, Aarti Mathur1, Yuwei Zhang1, Sichuan Xi1, Scott Atay1, Julie A. Hong1, Nicole Datrice1, Trevor Upham1, Clinton D. Kemp1, R. Taylor Ripley1, Gordon Wiegand2, Itzak Avital2, Patricia Fetsch3, Haresh Mani6, Daniel Zlott4, Robert Robey5, Susan E. Bates5, Xinmin Li7, Mahadev Rao1, and David S. Schrump1 Abstract Cigarette smoking at diagnosis or during therapy correlates with poor outcome in patients with lung and esophageal cancers, yet the underlying mechanisms remain unknown. In this study, we observed that exposure of esophageal cancer cells to cigarette smoke condensate (CSC) led to upregulation of the xenobiotic pump ABCG2, which is expressed in cancer stem cells and confers treatment resistance in lung and esophageal carcinomas. Furthermore, CSC increased the side population of lung cancer cells containing cancer stem cells. Upregulation of ABCG2 coincided with increased occupancy of aryl hydrocarbon receptor, Sp1, and Nrf2 within the ABCG2 promoter, and deletion of xenobiotic response elements and/or Sp1 sites markedly attenuated ABCG2 induction. Under conditions potentially achievable in clinical settings, mithramycin diminished basal as well as CSC- mediated increases in AhR, Sp1, and Nrf2 levels within the ABCG2 promoter, markedly downregulated ABCG2, and inhibited proliferation and tumorigenicity of lung and esophageal cancer cells. Microarray analyses revealed that mithramycin targeted multiple stem cell–related pathways in vitro and in vivo. Collectively, our findings provide a potential mechanistic link between smoking status and outcome of patients with lung and esophageal cancers, and support clinical use of mithramycin for repressing ABCG2 and inhibiting stem cell signaling in thoracic malignancies.