Cyclin F-Chk1 Synthetic Lethality Mediated by E2F1 Degradation
Total Page:16
File Type:pdf, Size:1020Kb
Load more
										Recommended publications
									
								- 
												  Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IBTable S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
- 
												  Analysis of the Human Serum ProteomeCedarville University DigitalCommons@Cedarville Pharmaceutical Sciences Faculty Publications Department of Pharmaceutical Sciences 6-2004 Analysis of the Human Serum Proteome King C. Chan David A. Lucas Denise Hise Carl F. Schaefer Zhen Xiao See next page for additional authors Follow this and additional works at: https://digitalcommons.cedarville.edu/ pharmaceutical_sciences_publications Part of the Pharmacy and Pharmaceutical Sciences Commons This Article is brought to you for free and open access by DigitalCommons@Cedarville, a service of the Centennial Library. It has been accepted for inclusion in Pharmaceutical Sciences Faculty Publications by an authorized administrator of DigitalCommons@Cedarville. For more information, please contact [email protected]. Authors King C. Chan, David A. Lucas, Denise Hise, Carl F. Schaefer, Zhen Xiao, George M. Janini, Kenneth H. Buetow, Haleem J. Issaq, Timothy D. Veenstra, and Thomas P. Conrads Clinical Proteomics Journal Copyright ©Humana Press Inc. All rights of any nature whatsoever are reserved. ISSN 1542-6416/04/01:101–225/$25.00 Serum/Plasma Proteome Analysis of the Human Serum Proteome King C. Chan,1,† David A. Lucas,1,† Denise Hise,2 Carl F. Schaefer,2 Zhen Xiao,1 George M. Janini,1 Kenneth H. Buetow,2 Haleem J. Issaq,1 Timothy D.Veenstra,1 and Thomas P. Conrads1,* 1Laboratory of Proteomics and Analytical Technologies, National Cancer Institute at Frederick, SAIC-Frederick, Inc, PO Box B, Frederick, MD 21702 2Center for Bioinformatics, National Cancer Institute, Bethesda, MD 20892 †These authors contributed equally to this work. each of which was analyzed by microcapillary Abstract reversed-phase liquid chromatography coupled Changes in serum proteins that signal online with MS/MS analysis.
- 
												  A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes MellitusPage 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
- 
												  1 Isolation and Characterization of Cul1-7, a Recessive Allele OfGenetics: Published Articles Ahead of Print, published on February 25, 2009 as 10.1534/genetics.108.097675 Isolation and Characterization of cul1-7, a Recessive Allele of CULLIN1 that Disrupts SCF Function at the C-terminus of CUL1 in Arabidopsis thaliana Jonathan Gilkerson*,†, Jianhong Hu‡, Jessica Brown*, Alexander Jones* 1, Tai-ping Sun‡ and Judy Callis*,†,2 *Department of Molecular and Cellular Biology and †Plant Biology Graduate Group, University of California-Davis, Davis, CA 95616, ‡Department of Biology, Duke University, Durham, North Carolina 27708-1000 1 Current Address: Department of Plant and Microbial Biology, UC-Berkeley, Berkeley, CA 94720-3102 1 Running head: Characterization of cul1-7 Key words: Protein Degradation, Aux/IAA, RGA, SCF Ubiquitin Ligase, RBX1 2Corresponding Author: Judy Callis Department of Molecular and Cellular Biology University of California-Davis One Shields Avenue Davis, CA 95616 Phone: 530-752-1015 Fax: 530-752-3085 E-mail: [email protected] 2 ABSTRACT Many aspects of plant biology depend on the ubiquitin proteasome system for degradation of regulatory proteins. Ubiquitin E3 ligases confer substrate specificity in this pathway, and SCF-type ligases comprise a major class of E3s. SCF ligases have four subunits: SKP1, CUL1, RBX1, and an F-box protein for substrate recognition. The Aux/IAAs are a well- characterized family of SCF substrates in plants. Here, we report characterization of a mutant isolated from a genetic screen in Arabidopsis thaliana designed to identify plants defective in degradation of an Aux/IAA fusion protein, Aux/IAA1-luciferase (IAA1-LUC). This mutant exhibited four-fold slower IAA1-LUC degradation compared to the progenitor line, and seedlings displayed altered auxin responses.
- 
												  Profiling DataCompound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8
- 
												  Ccnf (NM 007634) Mouse Tagged ORF Clone – MR210593 | OrigeneOriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR210593 Ccnf (NM_007634) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Ccnf (NM_007634) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Ccnf Synonyms: CycF; Fbxo1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 Ccnf (NM_007634) Mouse Tagged ORF Clone – MR210593 ORF Nucleotide >MR210593 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGAGCGGCGGTGTGATCCATTGTAGGTGTGCCAAGTGTTTCTGTTATCCTACTAAACGAAGAATCA AAAGAAGACCCAGAAACTTAACCATCTTGAGTCTCCCAGAAGATGTACTCTTTCATATCCTGAAATGGCT TTCTGTTGGGGACATCCTTGCTGTCCGAGCTGTCCACTCCCACCTCAAGTACCTGGTGGACAACCATGCC AGTGTGTGGGCATCCGCCAGCTTCCAGGAGCTGTGGCCTTCTCCACAGAACCTGAAGCTCTTTGAAAGGG CTGCTGAAAAGGGAAATTTTGAAGCTGCTGTGAAGTTGGGGATTGCCTACCTCTACAATGAAGGCCTGTC TGTGTCAGATGAGGCCTGCGCAGAAGTGAACGGCTTGAAGGCCTCTCGCTTCTTCAGCATGGCTGAGAGA CTGAATACGGGTTCTGAGCCCTTCATTTGGCTCTTCATCCGCCCACCGTGGTCAGTGTCCGGAAGCTGCT GCAAGGCTGTGGTTCATGACAGCCTCCGAGCGGAGTGTCAGTTACAGAGAAGTCATAAAGCTTCCATACT ACACTGCTTGGGAAGGGTGCTAAATCTTTTTGAGGACGAAGAGAAAAGGAAGCAGGCGCGTAGCCTTTTG
- 
												  Mithramycin Represses Basal and Cigarette Smoke–Induced Expression of ABCG2 and Inhibits Stem Cell Signaling in Lung and Esophageal Cancer CellsCancer Therapeutics, Targets, and Chemical Biology Research Mithramycin Represses Basal and Cigarette Smoke–Induced Expression of ABCG2 and Inhibits Stem Cell Signaling in Lung and Esophageal Cancer Cells Mary Zhang1, Aarti Mathur1, Yuwei Zhang1, Sichuan Xi1, Scott Atay1, Julie A. Hong1, Nicole Datrice1, Trevor Upham1, Clinton D. Kemp1, R. Taylor Ripley1, Gordon Wiegand2, Itzak Avital2, Patricia Fetsch3, Haresh Mani6, Daniel Zlott4, Robert Robey5, Susan E. Bates5, Xinmin Li7, Mahadev Rao1, and David S. Schrump1 Abstract Cigarette smoking at diagnosis or during therapy correlates with poor outcome in patients with lung and esophageal cancers, yet the underlying mechanisms remain unknown. In this study, we observed that exposure of esophageal cancer cells to cigarette smoke condensate (CSC) led to upregulation of the xenobiotic pump ABCG2, which is expressed in cancer stem cells and confers treatment resistance in lung and esophageal carcinomas. Furthermore, CSC increased the side population of lung cancer cells containing cancer stem cells. Upregulation of ABCG2 coincided with increased occupancy of aryl hydrocarbon receptor, Sp1, and Nrf2 within the ABCG2 promoter, and deletion of xenobiotic response elements and/or Sp1 sites markedly attenuated ABCG2 induction. Under conditions potentially achievable in clinical settings, mithramycin diminished basal as well as CSC- mediated increases in AhR, Sp1, and Nrf2 levels within the ABCG2 promoter, markedly downregulated ABCG2, and inhibited proliferation and tumorigenicity of lung and esophageal cancer cells. Microarray analyses revealed that mithramycin targeted multiple stem cell–related pathways in vitro and in vivo. Collectively, our findings provide a potential mechanistic link between smoking status and outcome of patients with lung and esophageal cancers, and support clinical use of mithramycin for repressing ABCG2 and inhibiting stem cell signaling in thoracic malignancies.
- 
												  Vascular Inflammatory Response Deneddylase-1/SENP8 in FineCentral Role for Endothelial Human Deneddylase-1/SENP8 in Fine-Tuning the Vascular Inflammatory Response This information is current as Stefan F. Ehrentraut, Douglas J. Kominsky, Louise E. of September 30, 2021. Glover, Eric L. Campbell, Caleb J. Kelly, Brittelle E. Bowers, Amanda J. Bayless and Sean P. Colgan J Immunol 2013; 190:392-400; Prepublished online 3 December 2012; doi: 10.4049/jimmunol.1202041 Downloaded from http://www.jimmunol.org/content/190/1/392 Supplementary http://www.jimmunol.org/content/suppl/2012/12/03/jimmunol.120204 Material 1.DC1 http://www.jimmunol.org/ References This article cites 53 articles, 15 of which you can access for free at: http://www.jimmunol.org/content/190/1/392.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision by guest on September 30, 2021 • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2012 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Central Role for Endothelial Human Deneddylase-1/SENP8 in Fine-Tuning the Vascular Inflammatory Response Stefan F.
- 
												  Neddylation: a Novel Modulator of the Tumor Microenvironment Lisha Zhou1,2*†, Yanyu Jiang3†, Qin Luo1, Lihui Li1 and Lijun Jia1*Zhou et al. Molecular Cancer (2019) 18:77 https://doi.org/10.1186/s12943-019-0979-1 REVIEW Open Access Neddylation: a novel modulator of the tumor microenvironment Lisha Zhou1,2*†, Yanyu Jiang3†, Qin Luo1, Lihui Li1 and Lijun Jia1* Abstract Neddylation, a post-translational modification that adds an ubiquitin-like protein NEDD8 to substrate proteins, modulates many important biological processes, including tumorigenesis. The process of protein neddylation is overactivated in multiple human cancers, providing a sound rationale for its targeting as an attractive anticancer therapeutic strategy, as evidence by the development of NEDD8-activating enzyme (NAE) inhibitor MLN4924 (also known as pevonedistat). Neddylation inhibition by MLN4924 exerts significantly anticancer effects mainly by triggering cell apoptosis, senescence and autophagy. Recently, intensive evidences reveal that inhibition of neddylation pathway, in addition to acting on tumor cells, also influences the functions of multiple important components of the tumor microenvironment (TME), including immune cells, cancer-associated fibroblasts (CAFs), cancer-associated endothelial cells (CAEs) and some factors, all of which are crucial for tumorigenesis. Here, we briefly summarize the latest progresses in this field to clarify the roles of neddylation in the TME, thus highlighting the overall anticancer efficacy of neddylaton inhibition. Keywords: Neddylation, Tumor microenvironment, Tumor-derived factors, Cancer-associated fibroblasts, Cancer- associated endothelial cells, Immune cells Introduction Overall, binding of NEDD8 molecules to target proteins Neddylation is a reversible covalent conjugation of an can affect their stability, subcellular localization, conform- ubiquitin-like molecule NEDD8 (neuronal precursor ation and function [4]. The best-characterized substrates cell-expressed developmentally down-regulated protein of neddylation are the cullin subunits of Cullin-RING li- 8) to a lysine residue of the substrate protein [1, 2].
- 
												  PHKG2, Active (SRP5062)PHKG2, active, GST tagged, human PRECISIOÒ Kinase recombinant, expressed in Sf9 cells Catalog Number SRP5062 Storage Temperature –70°C Synonyms: GSD9C Figure 1. SDS-PAGE Gel of Typical Lot Product Description 70–95% (densitometry) PHKG2 is the hepatic and testis isoform of the gamma subunit of phosphorylase kinase. PHKG2 gene contains 10 exons and spans 9.5 kb and maps to chromosome 16p12.1-p11.2.1 Deficiency of PHK, a regulatory enzyme of glycogen metabolism, is responsible for 25% of all cases of glycogen storage disease and is genetically and clinically heterogeneous. Mutations in the PHKG2 gene lead to autosomal liver-specific PHK deficiency (glycogen storage disease IXc) and an increased risk of cirrhosis, and at least 11 PHKG2 mutations have been identified to date.2 Figure 2. Specific Activity of Typical Lot Recombinant, full-length, human PHKG2 was 59–81 nmole/min/mg expressed by baculovirus in Sf9 insect cells using an N-terminal GST tag. The gene accession number is NM_000294. Recombinant protein stored in 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.25 mM DTT, 0.1 mM EDTA, 0.1 mM PMSF, and 25% glycerol. Molecular mass: ~70 kDa Purity: 70–95% (SDS-PAGE, see Figure 1) Specific Activity: 59–81 nmole/min/mg (see Figure 2) Precautions and Disclaimer Procedure This product is for R&D use only, not for drug, Preparation Instructions household, or other uses. Please consult the Material Kinase Assay Buffer – 25 mM MOPS, pH 7.2, 12.5 mM Safety Data Sheet for information regarding hazards glycerol 2-phosphate, 25 mM MgCl2, 5 mM EGTA, and and safe handling practices.
- 
												  The Tumor Suppressor Notch Inhibits Head and Neck Squamous CellThe Texas Medical Center Library DigitalCommons@TMC The University of Texas MD Anderson Cancer Center UTHealth Graduate School of The University of Texas MD Anderson Cancer Biomedical Sciences Dissertations and Theses Center UTHealth Graduate School of (Open Access) Biomedical Sciences 12-2015 THE TUMOR SUPPRESSOR NOTCH INHIBITS HEAD AND NECK SQUAMOUS CELL CARCINOMA (HNSCC) TUMOR GROWTH AND PROGRESSION BY MODULATING PROTO-ONCOGENES AXL AND CTNNAL1 (α-CATULIN) Shhyam Moorthy Shhyam Moorthy Follow this and additional works at: https://digitalcommons.library.tmc.edu/utgsbs_dissertations Part of the Biochemistry, Biophysics, and Structural Biology Commons, Cancer Biology Commons, Cell Biology Commons, and the Medicine and Health Sciences Commons Recommended Citation Moorthy, Shhyam and Moorthy, Shhyam, "THE TUMOR SUPPRESSOR NOTCH INHIBITS HEAD AND NECK SQUAMOUS CELL CARCINOMA (HNSCC) TUMOR GROWTH AND PROGRESSION BY MODULATING PROTO-ONCOGENES AXL AND CTNNAL1 (α-CATULIN)" (2015). The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access). 638. https://digitalcommons.library.tmc.edu/utgsbs_dissertations/638 This Dissertation (PhD) is brought to you for free and open access by the The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences at DigitalCommons@TMC. It has been accepted for inclusion in The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access) by an authorized administrator of DigitalCommons@TMC. For more information, please contact [email protected]. THE TUMOR SUPPRESSOR NOTCH INHIBITS HEAD AND NECK SQUAMOUS CELL CARCINOMA (HNSCC) TUMOR GROWTH AND PROGRESSION BY MODULATING PROTO-ONCOGENES AXL AND CTNNAL1 (α-CATULIN) by Shhyam Moorthy, B.S.
- 
												  Supplementary Table 1. in Vitro Side Effect Profiling Study for LDN/OSU-0212320. Neurotransmitter Related SteroidsSupplementary Table 1. In vitro side effect profiling study for LDN/OSU-0212320. Percent Inhibition Receptor 10 µM Neurotransmitter Related Adenosine, Non-selective 7.29% Adrenergic, Alpha 1, Non-selective 24.98% Adrenergic, Alpha 2, Non-selective 27.18% Adrenergic, Beta, Non-selective -20.94% Dopamine Transporter 8.69% Dopamine, D1 (h) 8.48% Dopamine, D2s (h) 4.06% GABA A, Agonist Site -16.15% GABA A, BDZ, alpha 1 site 12.73% GABA-B 13.60% Glutamate, AMPA Site (Ionotropic) 12.06% Glutamate, Kainate Site (Ionotropic) -1.03% Glutamate, NMDA Agonist Site (Ionotropic) 0.12% Glutamate, NMDA, Glycine (Stry-insens Site) 9.84% (Ionotropic) Glycine, Strychnine-sensitive 0.99% Histamine, H1 -5.54% Histamine, H2 16.54% Histamine, H3 4.80% Melatonin, Non-selective -5.54% Muscarinic, M1 (hr) -1.88% Muscarinic, M2 (h) 0.82% Muscarinic, Non-selective, Central 29.04% Muscarinic, Non-selective, Peripheral 0.29% Nicotinic, Neuronal (-BnTx insensitive) 7.85% Norepinephrine Transporter 2.87% Opioid, Non-selective -0.09% Opioid, Orphanin, ORL1 (h) 11.55% Serotonin Transporter -3.02% Serotonin, Non-selective 26.33% Sigma, Non-Selective 10.19% Steroids Estrogen 11.16% 1 Percent Inhibition Receptor 10 µM Testosterone (cytosolic) (h) 12.50% Ion Channels Calcium Channel, Type L (Dihydropyridine Site) 43.18% Calcium Channel, Type N 4.15% Potassium Channel, ATP-Sensitive -4.05% Potassium Channel, Ca2+ Act., VI 17.80% Potassium Channel, I(Kr) (hERG) (h) -6.44% Sodium, Site 2 -0.39% Second Messengers Nitric Oxide, NOS (Neuronal-Binding) -17.09% Prostaglandins Leukotriene,