Phosphatidylinositol-3-Kinase Related Kinases (Pikks) in Radiation-Induced Dna Damage
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
AGC Kinases in Mtor Signaling, in Mike Hall and Fuyuhiko Tamanoi: the Enzymes, Vol
Provided for non-commercial research and educational use only. Not for reproduction, distribution or commercial use. This chapter was originally published in the book, The Enzymes, Vol .27, published by Elsevier, and the attached copy is provided by Elsevier for the author's benefit and for the benefit of the author's institution, for non-commercial research and educational use including without limitation use in instruction at your institution, sending it to specific colleagues who know you, and providing a copy to your institution’s administrator. All other uses, reproduction and distribution, including without limitation commercial reprints, selling or licensing copies or access, or posting on open internet sites, your personal or institution’s website or repository, are prohibited. For exceptions, permission may be sought for such use through Elsevier's permissions site at: http://www.elsevier.com/locate/permissionusematerial From: ESTELA JACINTO, AGC Kinases in mTOR Signaling, In Mike Hall and Fuyuhiko Tamanoi: The Enzymes, Vol. 27, Burlington: Academic Press, 2010, pp.101-128. ISBN: 978-0-12-381539-2, © Copyright 2010 Elsevier Inc, Academic Press. Author's personal copy 7 AGC Kinases in mTOR Signaling ESTELA JACINTO Department of Physiology and Biophysics UMDNJ-Robert Wood Johnson Medical School, Piscataway New Jersey, USA I. Abstract The mammalian target of rapamycin (mTOR), a protein kinase with homology to lipid kinases, orchestrates cellular responses to growth and stress signals. Various extracellular and intracellular inputs to mTOR are known. mTOR processes these inputs as part of two mTOR protein com- plexes, mTORC1 or mTORC2. Surprisingly, despite the many cellular functions that are linked to mTOR, there are very few direct mTOR substrates identified to date. -
Generation of a Mouse Model Lacking the Non-Homologous End-Joining Factor Mri/Cyren
biomolecules Article Generation of a Mouse Model Lacking the Non-Homologous End-Joining Factor Mri/Cyren 1,2, 1,2, 1,2, 1,2 Sergio Castañeda-Zegarra y , Camilla Huse y, Øystein Røsand y, Antonio Sarno , Mengtan Xing 1,2, Raquel Gago-Fuentes 1,2, Qindong Zhang 1,2, Amin Alirezaylavasani 1,2, Julia Werner 1,2,3, Ping Ji 1, Nina-Beate Liabakk 1, Wei Wang 1, Magnar Bjørås 1,2 and Valentyn Oksenych 1,2,4,* 1 Department of Clinical and Molecular Medicine (IKOM), Norwegian University of Science and Technology, 7491 Trondheim, Norway; [email protected] (S.C.-Z.); [email protected] (C.H.); [email protected] (Ø.R.); [email protected] (A.S.); [email protected] (M.X.); [email protected] (R.G.-F.); [email protected] (Q.Z.); [email protected] (A.A.); [email protected] (J.W.); [email protected] (P.J.); [email protected] (N.-B.L.); [email protected] (W.W.); [email protected] (M.B.) 2 St. Olavs Hospital, Trondheim University Hospital, Clinic of Medicine, Postboks 3250, Sluppen, 7006 Trondheim, Norway 3 Molecular Biotechnology MS programme, Heidelberg University, 69120 Heidelberg, Germany 4 Department of Biosciences and Nutrition (BioNut), Karolinska Institutet, 14183 Huddinge, Sweden * Correspondence: [email protected]; Tel.: +47-913-43-084 These authors contributed equally to this work. y Received: 7 November 2019; Accepted: 26 November 2019; Published: 28 November 2019 Abstract: Classical non-homologous end joining (NHEJ) is a molecular pathway that detects, processes, and ligates DNA double-strand breaks (DSBs) throughout the cell cycle. -
Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG -
A Process of Resection-Dependent Nonhomologous End Joining Involving the Goddess Artemis
A process of resection-dependent nonhomologous end joining involving the goddess Artemis Article (Published Version) Jeggo, Penny and Löbrich, Markus (2017) A process of resection-dependent nonhomologous end joining involving the goddess Artemis. Trends in Biochemical Sciences, 42 (9). pp. 690-701. ISSN 0968-0004 This version is available from Sussex Research Online: http://sro.sussex.ac.uk/id/eprint/77876/ This document is made available in accordance with publisher policies and may differ from the published version or from the version of record. If you wish to cite this item you are advised to consult the publisher’s version. Please see the URL above for details on accessing the published version. Copyright and reuse: Sussex Research Online is a digital repository of the research output of the University. Copyright and all moral rights to the version of the paper presented here belong to the individual author(s) and/or other copyright owners. To the extent reasonable and practicable, the material made available in SRO has been checked for eligibility before being made available. Copies of full text items generally can be reproduced, displayed or performed and given to third parties in any format or medium for personal research or study, educational, or not-for-profit purposes without prior permission or charge, provided that the authors, title and full bibliographic details are credited, a hyperlink and/or URL is given for the original metadata page and the content is not changed in any way. http://sro.sussex.ac.uk [160_TD$IF]Opinion A Process of Resection- Dependent Nonhomologous End Joining Involving the Goddess Artemis Markus Löbrich1,* and Penny Jeggo2,* DNA double-strand breaks (DSBs) are a hazardous form of damage that can Trends potentially cause cell death or genomic rearrangements. -
Cyclin E1 and RTK/RAS Signaling Drive CDK Inhibitor Resistance Via Activation of E2F and ETS
www.impactjournals.com/oncotarget/ Oncotarget, Vol. 6, No.2 Cyclin E1 and RTK/RAS signaling drive CDK inhibitor resistance via activation of E2F and ETS Barbie Taylor-Harding1, Paul-Joseph Aspuria1, Hasmik Agadjanian1, Dong-Joo Cheon1, Takako Mizuno1,2, Danielle Greenberg1, Jenieke R. Allen1,2, Lindsay Spurka3, Vincent Funari3, Elizabeth Spiteri4, Qiang Wang1,5, Sandra Orsulic1, Christine Walsh1,6, Beth Y. Karlan1,6, W. Ruprecht Wiedemeyer1 1 Women’s Cancer Program at the Samuel Oschin Comprehensive Cancer Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 2Graduate Program in Biomedical Sciences and Translational Medicine, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 3Genomics Core, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 4Department of Pathology, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 5Department of Medicine, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 6 Department of Obstetrics and Gynecology, David Geffen School of Medicine, University of California, Los Angeles, CA 90048, USA Correspondence to: W. Ruprecht Wiedemeyer, e-mail: [email protected] Keywords: Cyclin-dependent kinase inhibitors, palbociclib, dinaciclib, cyclin E1, ovarian cancer Received: July 15, 2014 Accepted: November 02, 2014 Published: December 22, 2014 ABSTRACT High-grade serous ovarian cancers (HGSOC) are genomically complex, heterogeneous cancers with a high mortality rate, due to acquired chemoresistance and lack of targeted therapy options. Cyclin-dependent kinase inhibitors (CDKi) target the retinoblastoma (RB) signaling network, and have been successfully incorporated into treatment regimens for breast and other cancers. Here, we have compared mechanisms of response and resistance to three CDKi that target either CDK4/6 or CDK2 and abrogate E2F target gene expression. -
Diverse Mechanisms Activate the PI 3-Kinase/Mtor Pathway In
Tran et al. BMC Cancer (2021) 21:136 https://doi.org/10.1186/s12885-021-07826-4 RESEARCH ARTICLE Open Access Diverse mechanisms activate the PI 3- kinase/mTOR pathway in melanomas: implications for the use of PI 3-kinase inhibitors to overcome resistance to inhibitors of BRAF and MEK Khanh B. Tran1,2,3, Sharada Kolekar1, Anower Jabed2, Patrick Jaynes2, Jen-Hsing Shih2, Qian Wang2, Jack U. Flanagan1,3, Gordon W. Rewcastle1,3, Bruce C. Baguley1,3 and Peter R. Shepherd1,2,3* Abstract Background: The PI 3-kinase (PI3K) pathway has been implicated as a target for melanoma therapy. Methods: Given the high degree of genetic heterogeneity in melanoma, we sought to understand the breadth of variation in PI3K signalling in the large NZM panel of early passage cell lines developed from metastatic melanomas. Results: We find the vast majority of lines show upregulation of this pathway, and this upregulation is achieved by a wide range of mechanisms. Expression of all class-IA PI3K isoforms was readily detected in these cell lines. A range of genetic changes in different components of the PI3K pathway was seen in different lines. Coding variants or amplification were identified in the PIK3CA gene, and amplification of the PK3CG gene was common. Deletions in the PIK3R1 and PIK3R2 regulatory subunits were also relatively common. Notably, no genetic variants were seen in the PIK3CD gene despite p110δ being expressed in many of the lines. Genetic variants were detected in a number of genes that encode phosphatases regulating the PI3K signalling, with reductions in copy number common in PTEN, INPP4B, INPP5J, PHLLP1 and PHLLP2 genes. -
Role of Cyclin-Dependent Kinase 1 in Translational Regulation in the M-Phase
cells Review Role of Cyclin-Dependent Kinase 1 in Translational Regulation in the M-Phase Jaroslav Kalous *, Denisa Jansová and Andrej Šušor Institute of Animal Physiology and Genetics, Academy of Sciences of the Czech Republic, Rumburska 89, 27721 Libechov, Czech Republic; [email protected] (D.J.); [email protected] (A.Š.) * Correspondence: [email protected] Received: 28 April 2020; Accepted: 24 June 2020; Published: 27 June 2020 Abstract: Cyclin dependent kinase 1 (CDK1) has been primarily identified as a key cell cycle regulator in both mitosis and meiosis. Recently, an extramitotic function of CDK1 emerged when evidence was found that CDK1 is involved in many cellular events that are essential for cell proliferation and survival. In this review we summarize the involvement of CDK1 in the initiation and elongation steps of protein synthesis in the cell. During its activation, CDK1 influences the initiation of protein synthesis, promotes the activity of specific translational initiation factors and affects the functioning of a subset of elongation factors. Our review provides insights into gene expression regulation during the transcriptionally silent M-phase and describes quantitative and qualitative translational changes based on the extramitotic role of the cell cycle master regulator CDK1 to optimize temporal synthesis of proteins to sustain the division-related processes: mitosis and cytokinesis. Keywords: CDK1; 4E-BP1; mTOR; mRNA; translation; M-phase 1. Introduction 1.1. Cyclin Dependent Kinase 1 (CDK1) Is a Subunit of the M Phase-Promoting Factor (MPF) CDK1, a serine/threonine kinase, is a catalytic subunit of the M phase-promoting factor (MPF) complex which is essential for cell cycle control during the G1-S and G2-M phase transitions of eukaryotic cells. -
Collision with Duplex DNA Renders Escherichia Coli DNA Polymerase III
www.nature.com/scientificreports OPEN Collision with duplex DNA renders Escherichia coli DNA polymerase III holoenzyme susceptible to Received: 8 May 2017 Accepted: 18 September 2017 DNA polymerase IV-mediated Published: xx xx xxxx polymerase switching on the sliding clamp Thanh Thi Le, Asako Furukohri, Masahiro Tatsumi-Akiyama & Hisaji Maki Organisms possess multiple DNA polymerases (Pols) and use each for a different purpose. One of the five Pols inEscherichia coli, DNA polymerase IV (Pol IV), encoded by the dinB gene, is known to participate in lesion bypass at certain DNA adducts. To understand how cells choose Pols when the replication fork encounters an obstacle on template DNA, the process of polymerase exchange from the primary replicative enzyme DNA polymerase III (Pol III) to Pol IV was studied in vitro. Replicating Pol III forming a tight holoenzyme (Pol III HE) with the sliding clamp was challenged by Pol IV on a primed ssDNA template carrying a short inverted repeat. A rapid and lesion-independent switch from Pol III to Pol IV occurred when Pol III HE encountered a hairpin stem duplex, implying that the loss of Pol III-ssDNA contact induces switching to Pol IV. Supporting this idea, mutant Pol III with an increased affinity for ssDNA was more resistant to Pol IV than wild-type Pol III was. We observed that an exchange between Pol III and Pol IV also occurred when Pol III HE collided with primer/template duplex. Our data suggest that Pol III-ssDNA interaction may modulate the susceptibility of Pol III HE to Pol IV-mediated polymerase exchange. -
Role of Ataxia-Telangiectasia Mutated Kinase in Cardiac Autophagy and Glucose Metabolism Under Ischemic Conditions Patsy Thrasher East Tennessee State University
East Tennessee State University Digital Commons @ East Tennessee State University Electronic Theses and Dissertations Student Works 8-2018 Role of Ataxia-Telangiectasia Mutated Kinase in Cardiac Autophagy and Glucose Metabolism Under Ischemic Conditions Patsy Thrasher East Tennessee State University Follow this and additional works at: https://dc.etsu.edu/etd Part of the Biology Commons, and the Physiology Commons Recommended Citation Thrasher, Patsy, "Role of Ataxia-Telangiectasia Mutated Kinase in Cardiac Autophagy and Glucose Metabolism Under Ischemic Conditions" (2018). Electronic Theses and Dissertations. Paper 3442. https://dc.etsu.edu/etd/3442 This Dissertation - Open Access is brought to you for free and open access by the Student Works at Digital Commons @ East Tennessee State University. It has been accepted for inclusion in Electronic Theses and Dissertations by an authorized administrator of Digital Commons @ East Tennessee State University. For more information, please contact [email protected]. Role of Ataxia-Telangiectasia Mutated Kinase in Cardiac Autophagy and Glucose Metabolism Under Ischemic Conditions ____________________________________ A dissertation presented to the faculty of the Department of Biomedical Sciences East Tennessee State University In partial fulfillment of the requirements for the degree Doctor of Philosophy in Biomedical Sciences __________________________________ by Patsy R. Thrasher August 2018 _________________________________ Krishna Singh, Ph.D., Chair Mahipal Singh, Ph.D. Chuanfu Li, M.D. Tom Ecay, Ph.D. Yue Zou, Ph.D. Douglas Thewke, Ph.D. Keywords: ATM, myocardial infarction, autophagy, ischemia, glucose, metabolism ABSTRACT Role of Ataxia-Telangiectasia Mutated Kinase in Cardiac Autophagy and Glucose Metabolism Under Ischemic Conditions by Patsy R. Thrasher Ataxia-telangiectasia mutated kinase (ATM), a serine/threonine kinase primarily located in the nucleus, is typically activated in response to DNA damage. -
Phosphatidylinositol 3-Kinase Mediates Proliferative Signals in Intestinal Epithelial Cells H Sheng, J Shao, C M Townsend Jr, B M Evers
1472 COLON Gut: first published as 10.1136/gut.52.10.1472 on 11 September 2003. Downloaded from Phosphatidylinositol 3-kinase mediates proliferative signals in intestinal epithelial cells H Sheng, J Shao, C M Townsend jr, B M Evers ............................................................................................................................... Gut 2003;52:1472–1478 Background and aims: Determination of intracellular signalling pathways that mediate intestinal epithelial proliferation is fundamental to the understanding of the integrity and function of the intestinal tract under normal and diseased conditions. The phosphoinositide 3-kinase (PI3K)/Akt pathway transduces signals See end of article for initiated by growth factors and is involved in cell proliferation and differentiation. In this study, we assessed authors’ affiliations the role of PI3K/Akt in transduction of proliferative signals in intestinal epithelial cells. ....................... Methods: A rat intestinal epithelial (RIE) cell line and human colorectal cancer HCA-7 and LS-174 cell lines Correspondence to: served as in vitro models. The Balb/cJ mouse was the in vivo model. Dr H Sheng, Department of Results: PI3K activation was critical for G1 cell cycle progression of intestinal epithelial cells. Ectopic Surgery, University of expression of either active p110a or Akt-1 increased RIE cell proliferation. In vivo experiments Texas Medical Branch, 301 University Boulevard, demonstrated that PI3K activation was closely associated with the proliferative activity of intestinal mucosa. Galveston, Texas 77555, Treatment of mice with PI3K inhibitors blocked induction of PI3K activity and attenuated intestinal mucosal USA; [email protected] proliferation associated with oral intake. Epidermal growth factor and transforming growth factor a Accepted for publication stimulated PI3K activation which was required for growth factor induced expression of cyclin D1. -
Radiation-Sensitive Severe Combined Immunodeficiency (RS-SCID)
Radiation-sensitive severe combined immunodeficiency (RS-SCID) Contact details Introduction Molecular Genetics Service Severe combined immunodeficiency (SCID) is a group of genetically and Level 6, York House phenotypically heterogeneous disorders that can be immunologically classified by the 37 Queen Square absence or presence of T, B, and natural killer (NK) cells. The most severe form of - - + London, WC1N 3BH SCID has the T B NK phenotype, accounting for ~20% of all cases in which patients T +44 (0) 20 7762 6888 present with a virtual absence of both circulating T and B cells, while maintaining a F +44 (0) 20 7813 8578 normal level and function of NK cells. This form of SCID is caused by autosomal recessive mutations in at least three primary genes necessary for V(D)J recombination, RAG1, RAG2, and DCLRE1C (ARTEMIS). DCLRE1C mutations Samples required cause a T and B cell deficient form of SCID that is clinically indistinguishable from a • 5ml venous blood in plastic EDTA RAG1/RAG2 disorder. Infants present with severe recurrent viral, bacterial or fungal bottles (>1ml from neonates) infections and failure-to-thrive. Defects in DCLRE1C can be distinguished from RAG • Prenatal testing must be arranged defects because the former has the additional feature of increased sensitivity to in advance, through a Clinical ionising radiation in bone marrow and fibroblast cells. Genetics department if possible. The DNA crosslink repair 1C gene (DCLRE1C; MIM 605988) encodes ARTEMIS • Amniotic fluid or CV samples which is an essential factor of V(D)J recombination during lymphocyte development should be sent to Cytogenetics for and in the repair of DNA double-strand breaks (DSB) by the non-homologous end dissecting and culturing, with joining (NHEJ) pathway. -
The Microbiota-Produced N-Formyl Peptide Fmlf Promotes Obesity-Induced Glucose
Page 1 of 230 Diabetes Title: The microbiota-produced N-formyl peptide fMLF promotes obesity-induced glucose intolerance Joshua Wollam1, Matthew Riopel1, Yong-Jiang Xu1,2, Andrew M. F. Johnson1, Jachelle M. Ofrecio1, Wei Ying1, Dalila El Ouarrat1, Luisa S. Chan3, Andrew W. Han3, Nadir A. Mahmood3, Caitlin N. Ryan3, Yun Sok Lee1, Jeramie D. Watrous1,2, Mahendra D. Chordia4, Dongfeng Pan4, Mohit Jain1,2, Jerrold M. Olefsky1 * Affiliations: 1 Division of Endocrinology & Metabolism, Department of Medicine, University of California, San Diego, La Jolla, California, USA. 2 Department of Pharmacology, University of California, San Diego, La Jolla, California, USA. 3 Second Genome, Inc., South San Francisco, California, USA. 4 Department of Radiology and Medical Imaging, University of Virginia, Charlottesville, VA, USA. * Correspondence to: 858-534-2230, [email protected] Word Count: 4749 Figures: 6 Supplemental Figures: 11 Supplemental Tables: 5 1 Diabetes Publish Ahead of Print, published online April 22, 2019 Diabetes Page 2 of 230 ABSTRACT The composition of the gastrointestinal (GI) microbiota and associated metabolites changes dramatically with diet and the development of obesity. Although many correlations have been described, specific mechanistic links between these changes and glucose homeostasis remain to be defined. Here we show that blood and intestinal levels of the microbiota-produced N-formyl peptide, formyl-methionyl-leucyl-phenylalanine (fMLF), are elevated in high fat diet (HFD)- induced obese mice. Genetic or pharmacological inhibition of the N-formyl peptide receptor Fpr1 leads to increased insulin levels and improved glucose tolerance, dependent upon glucagon- like peptide-1 (GLP-1). Obese Fpr1-knockout (Fpr1-KO) mice also display an altered microbiome, exemplifying the dynamic relationship between host metabolism and microbiota.