Investigating the Role of Cdk11in Animal Cytokinesis

Investigating the Role of CDK11 in Animal Cytokinesis

Thomas Clifford Panagiotou

A thesis submitted in conformity with the requirements for the degree of Master of Science Department of Molecular Genetics University of Toronto

Investigating the Role of CDK11 in Animal Cytokinesis

Thomas Clifford Panagiotou

Master of Science

Department of Molecular Genetics University of Toronto

2020 Abstract

Finely tuned spatio-temporal regulation of cell division is required for genome stability. Cytokinesis constitutes the final stages of cell division, from chromosome segregation to the physical separation of cells, abscission. Abscission is tightly regulated to ensure it occurs after earlier cytokinetic events, like the maturation of the stem body, the regulatory platform for abscission. Active Aurora B kinase enforces the abscission checkpoint, which blocks abscission until chromosomes have been cleared from the cytokinetic machinery. Currently, it is unclear how this checkpoint is overcome. Here, I demonstrate that the cyclin-dependent kinase CDK11 is required for cytokinesis. Both inhibition and depletion of CDK11 block abscission. Furthermore, the mitosis-specific CDK11p58 kinase localizes to the stem body, where its kinase activity rescues the defects of CDK11 depletion and inhibition. These results suggest a model whereby CDK11p58 antagonizes Aurora B kinase to overcome the abscission checkpoint to allow for successful completion of cytokinesis.

ii Acknowledgments

I am very grateful for the support of my family and friends throughout my studies. I would also like to express my deep gratitude to Wilde Lab members, both past and present, for their advice and collaboration. In particular, I am very grateful to Matthew Renshaw, whose work comprises part of this thesis.

I would also like to thank the Canadian Institute of Health Research for funding. I am also very appreciative for the financial support from the Faculty of Medicine’s Leave of Absence Stipendiary Fund.

Thank you to my committee members, Drs. Laurence Pelletier and Chris McCulloch, for their incisive comments and helpful direction through my studies.

Not least of all, I would like thank my supervisor Dr. Andrew Wilde. Your guidance and mentorship are deeply appreciated.

iii Table of Contents

Abstract ...... ii

Acknowledgements ...... iii

Table of Contents ...... iv List of Figures...... vii List of Tables...... viii Abbreviations ...... ix Preamble ...... x Chapter 1. Introduction ...... 1 1.1. The Eukaryotic Cell Cycle ...... 1 1.1.1. Overview ...... 1 1.1.2. Phases and Checkpoints ...... 1 1.1.3. Mitosis (M phase) ...... 2 1.2. Cyclin-dependent Kinases (CDKs) and Cyclins ...... 5 1.2.1. Overview ...... 5 1.2.2. Discovery ...... 6 1.2.3. Cyclins ...... 6 1.2.4. Structural Features of Cyclin-CDK complexes ...... 7 1.2.5. Expression Patterns ...... 8 1.2.6. General Principles of CDK Regulation ...... 8 1.2.7. Regulation of Cell Cycle Checkpoints ...... 9

1.2.7.1. Regulation of G1/S ...... 9 1.2.7.2. Regulation of S phase ...... 10

1.2.7.3. Regulation of G2/M ...... 10 1.2.7.4. Regulation of M phase ...... 11 1.2.8. Other Functions of CDKs ...... 12 1.3. CDK11 ...... 13 1.3.1. Background ...... 13 1.3.2. Structural Features and Interacting Factors ...... 14 1.3.3. Isoforms and their Associated Functions ...... 15 iv 1.3.3.1. p110 ...... 15 1.3.3.2. p58 ...... 16 1.3.3.3. p46 ...... 17 1.3.4. Implication in Human Disease ...... 18 1.4. Cytokinesis ...... 19 1.4.1. Overview ...... 19 1.4.2. Cytokinesis and Cancer ...... 20 1.4.3. Anaphase ...... 21 1.4.3.1. Central Spindle Assembly ...... 21 1.4.3.2. Contractile Ring Assembly and Furrow Ingression ...... 22 1.4.4. Telophase ...... 22 1.4.4.1. Intercellular Bridge Maturation ...... 22 1.4.4.2. Abscission ...... 23 1.4.4.3. Regulation of Abscission ...... 25 1.5. Research Question ...... 27

Chapter 2. CDK11p58 Kinase Activity is Required for Cytokinesis ...... 28

2.1. Introduction ...... 28 2.1.1. Known Roles of CDK11 in Cell Division ...... 28 2.1.2. Objectives and Strategies ...... 28 2.2. Results ...... 29 2.2.1. CDK11p58, but not CDK11p110, Localizes to Stem Body ...... 29 2.2.2. Knockdown of CDK11 Induces a Multinucleate Phenotype ...... 31 2.2.3. Depletion of CDK11 Stalls Cells Before Abscission ...... 36 2.2.4. Expression of CDK11p110 and/or CDK11p58 Rescue Defects of CDK11 Depletion ... 38 2.2.5. Inhibition of CDK11 Kinase Activity by OTS964 Phenocopies Depletion Defects .. 41 2.2.6. Kinase dead mutant of CDK11p58 Cannot Rescue CDK11 Depletion Defects ...... 43 2.3. Discussion ...... 44 Chapter 3. Summary ...... 48

Chapter 4. Materials and Methods ...... 49

v 4.1 Materials ...... 49 4.1.1 Nucleic acids ...... 49 4.1.1.1 Plasmids ...... 49 4.1.1.2 Primers ...... 49 4.1.2 Bacterial Strains ...... 49 4.1.3 Kits and Reagents ...... 49 4.2 Generation of Stable Cell Lines ...... 49 4.2.1 Plasmid Construction ...... 49 4.2.2 Stable Cell Line Transfection and Selection ...... 50 4.3 Cell Culture and RNAi Transfection ...... 50 4.4 Immunostaining and Microscopy ...... 51 4.4.1 Fixation and Staining ...... 51 4.4.2 Fixed Image Acquisition ...... 52 4.4.3 Live Imaging ...... 52 4.5 Western Blotting ...... 52 4.6 Real Time Quantitative Polymerase Chain Reaction (RT-qPCR) ...... 53 4.7 Statistical Analyses ...... 53 References ...... 54

Supplementary ...... 77

vi List of Figures Figure 1.1. The Cell Cycle and Cell Cycle Checkpoints ...... 2 Figure 1.2. Cellular Organization Through Mitosis ...... 3 Figure 1.3. Overview of Cytokinesis ...... 5 Figure 1.4. Expression Patterns of Major Cell Cycle-regulating Cyclins ...... 8 Figure 1.5. CDK11 Interactors ...... 15 Figure 1.6. CDK11 Domain Organization ...... 17 Figure 1.7. Animal Cytokinesis ...... 20 Figure 1.8. Overview of Cytokinesis ...... 23 Figure 1.9. The Abscission (NoCut) Checkpoint ...... 27 Figure 2.1 CDK11p58, but not CDK11p110, localizes to stem body...... 30 Figure 2.2. Depletion of CDK11 by siRNA ...... 31 Figure 2.3. CDK11 depletion does not alter metaphase spindle morphology ...... 33 Figure 2.4 CDK11 depletion does not induce segregation defects ...... 34 Figure 2.5. Knockdown of CDK11 induces a multinucleate phenotype ...... 35 Figure 2.6. CDK11 depletion stalls cells before abscission ...... 37 Figure 2.7. Expression of various CDK11 constructs ...... 39 Figure 2.8. Expression of CDK11p110 and/or CDK11p58 rescue defects of CDK11 depletion ..... 40 Figure 2.9. OTS964 treatment induces cytokinetic defects ...... 42 Figure 2.10. Kinase dead mutant of CDK11p58 cannot rescue CDK11 depletion defects ...... 43 Figure 2.11. CHMP4C phosphoregulation ...... 47

vii List of Tables Supplementary Table 1. Stable cell lines used ...... 77 Supplementary Table 2. Oligos used in RT-qPCR experiments ...... 77 Supplementary Table 3. Oligos used for cell line construction ...... 78 Supplementary Table 4. Commonly used reagents ...... 79

Abbreviations ADP/ATP Adenosine diphosphate/Adenosine triphosphate

BSA Bovine serum albumen cDNA Complementary DNA DMEM Dulbecco’s modified eagle medium

DNA Deoxyribonucleic acid

RNA Ribonucleic Acid FBS Fetal bovine serum FL Full length (of protein) GFP Green fluorescent protein HeLa Henrietta Lacks (human cervical cancer cell line) LB Lysogeny broth SOC Super optimal broth with glucose min minutes mRNA Messenger RNA nt Nucleotide PBS Phosphate-buffered saline PCR Polymerase chain reaction

PFA Paraformaldehyde TetR Tetracycline receptor protein UTR mRNA 5’ or 3’ untranslated region

ix Preamble

In this thesis, I have undertaken an investigation into the role played by the cyclin-dependent kinase CDK11 in animal cytokinesis. This study addresses two primary questions: What role does CDK11 play in cytokinesis, and; which isoform is responsible for this function? To this end, I have defined the specific contributions of different CDK11 isoforms to the process, highlighted by the requirement of CDK11p58 kinase activity for the completion of abscission. These results contributed to a published manuscript: Renshaw, M.J. et al. CDK11p58-cyclin L1β regulates abscission site assembly. J Biol Chem. 294, 18639-49 (2019).

This thesis includes experiments performed by Matthew Renshaw, in keeping with the Department of Molecular Genetics guideline which allows for inclusion of collaborators’ work when it “is crucial for the understanding of the student’s own data” (2019-2020 Graduate Handbook, Department of Molecular Genetics, University of Toronto). Matthew’s localization data suggested a physiological role for CDK11 in cytokinesis, which I address in this thesis.

Chapter 1. Introduction 1.1 The Eukaryotic Cell Cycle

1.1.1 Overview

The first eukaryotic organisms emerged nearly two billion years ago, giving rise to the approximately 9 million extant species1. The growth and reproduction of all these organisms is dependent on the faithful duplication and segregation of their genetic material, in a process called the cell cycle. This tightly regulated process allows for the division of a single parent cell into two daughter cells. It begins with the parent cell accumulating nutrients in response to internal and external signals. Having satisfied the nutritional requirements, it duplicates its genome and some organelles. Finally, the parent cell divides, partitioning the genetic material, organelles, and cytoplasm between the two daughter cells. Dysregulation of the cell cycle has serious consequences for both unicellular and multicellular organisms: it diminishes the reproductive capacity of unicellular organisms while promoting aneuploidy and mutation in multicellular organisms, which can lead to unrestrained cellular growth and division, a hallmark of cancers2.

1.1.2 Phases and Checkpoints

The cell cycle is divided into four phases. Following cell division, the newly formed daughter cells begin a period of growth referred to as the Gap 1 (G1) phase, where macromolecules like 3 RNA and proteins are synthesized . DNA synthesis (S) follows G1, which in turn is followed by another growth period, Gap 2 (G2). Finally, the cell cycle ends with mitosis (M) or cell division, forming two new daughter cells. In the case of nondividing cells, like differentiated neurons, 4 cells exit the cell cycle at G1 and enter quiescence (G0) .

Cells tightly regulate the progression of the cell cycle to ensure the proper sequence of molecular events. For instance, cell division does not begin until after DNA replication has been completed. Cells utilize a number of mechanisms to ensure that the transmission of genetic material is accurate: repair machinery that corrects errors in DNA synthesis; factors that detect errors and halt cell cycle progression until rectified; and pathways that induce cell death to prevent the production of mutant progeny5. Collectively, these mechanisms constitute ‘cell cycle checkpoints’, which are found at distinct points throughout the eukaryotic cell cycle. There are

three major cell cycle checkpoints: G1/S, G2/M, and the spindle assembly checkpoint (SAC)

(Figure 1.1). The G1/S checkpoint occurs late in G1, and commits cells to proceed with division. Mitogenic cues from the extracellular environment direct cellular growth as well as 3 transcriptional changes to prepare cells for DNA replication . The G2/M checkpoint prevents entry into mitosis upon detection of errors in DNA replication. The SAC occurs within M phase, after chromosomes have aligned in the metaphase plate. It acts to ensure all kinetochore- microtubule attachments are formed prior to segregation6.

Figure 1.1 The Cell Cycle and Cell Cycle Checkpoints. Schematic showing the progression of the cell cycle with major checkpoints indicated (red arrows). As its name implies, the cell cycle is cyclical, beginning in G1, through cellular division, with the resultant daughter cells returning to G1 again. Progression through the cell cycle is halted at various stages to ensure requirements for subsequent stages have been completed. Four such checkpoints are shown on this diagram, including the G1/S checkpoint also known as the restriction point and the Spindle Assembly Checkpoint (SAC). These and other checkpoints will be discussed in more detail later.

Quiescent cells exit the cell cycle at G1 and enter G0, in most cases remaining there indefinitely. Figure adapted from McKinley, M. & O’Loughlin, V.D. in Human Anatomy, 3rd Edition (McGraw- Hill, 2011).

1.1.3 Mitosis (M phase)

The last stage of the cell cycle, mitosis, has two chief objectives: segregation of the genetic material between daughter cells, and the separation of the daughter cells from each other. In metazoa and fungi, these two operations are generally carried out in sequence: segregation followed by division. In preparation for division, cells undergo drastic morphological remodeling. In many contexts, cells detach from their surroundings and adopt a spherical morphology in a process termed “rounding up”. Rounding up facilitates proper spindle assembly and chromosome segregation in the subsequent stages of division10. As division progresses, the dividing cell reattaches to its surroundings, which promotes the physical separation of daughter cells258,264.

Transformation of the morphology of the cell for division is accompanied by the reorganization of the DNA within the cell. Chromatin remodeling is a highly dynamic and complex process, described in Figure 1.2. Beginning in prophase, chromatin is heavily compacted and fully matured centrosomes migrate to opposite poles of the cell, forming an immature spindle7. Prophase is followed by prometaphase, where the nuclear envelope is dissolved and the now matured mitotic spindle forms microtubule-kinetochore attachments8. In metaphase, the spindle pulls on chromosomes to align them on them on the division plane or metaphase plate8. Here the Spindle Assembly Checkpoint (SAC) is activated by the presence of free kinetochores6, preventing segregation until all chromosome attachments have been made. Satisfaction of the SAC promotes sister chromatid dissociation allowing the spindle to pull chromatids apart.

Figure 1.2 Cellular Organization through Mitosis. Cartoon schematic of progression from prophase to anaphase in a metazoan cell. DNA is depicted in blue, the plasma membrane in black, and microtubules in green. (A) In prophase, the cell adopts a spherical shape, with chromatin condensing in the nucleus and the immature spindle beginning to migrate to opposite poles of the cell. (B) In prometaphase, the nuclear envelope dissolves allowing for the now matured spindle to make chromosomal attachments. (C) In metaphase, the attached chromosomes are pulled by the spindle to align them along the division plane or metaphase plate. At this point, the SAC is activated in the presence of free kinetochores. (D) The spindle pulls apart chromatid pairs in anaphase, as the midzone membrane ingresses between the chromosomal masses. A description of the latter stages of cell division will be given later.

The latter half of mitosis, cytokinesis, is concerned with the partitioning of organelles and the physical separation of daughter cells. To achieve division, the parent cell must undergo a vast

reorganization of its structure and contents. The driving force behind these changes, and cytokinesis as a whole, is the cytoskeleton.

Cytokinesis begins with the segregation of chromosomes and concomitant constriction of the membrane-anchored actomyosin contractile ring at the division plane11 (Figure 1.3). The actomyosin contractile ring, in addition to actin and myosin II motor protein, is composed of other actin regulators, including Anillin, Septins, profilin, cofilin, and formins12. Through the combined activity of myosin II and actin remodelers, the membrane-anchored contractile ring constricts between the segregated chromosomes, forming a narrow, microtubule-filled canal between the two daughter cells. This structure is called the intercellular bridge (ICB). Once formed, the ICB undergoes distinct maturation steps: first, at the center of the ICB, a protein-rich bulge called the stem body emerges. The stem body serves as the scaffold for the assembly of the machinery that will ultimately separate the daughter cells in a process termed abscission12. Prior to abscission, Anillin-Septin filaments act to elongate the ICB, before priming the future sites of abscission for the abscission machinery13. Endosomes and microtubule remodeling mediate further development of the abscission site11, until the abscission machinery is recruited and separation is achieved. Abscission marks the end of the cell cycle, forming two daughter cells that enter the cycle again at G1.

Figure 1.3 Overview of Cytokinesis. Schematic showing the progression of metazoan cytokinesis. Concomitant with chromosomal segregation, the actomyosin contractile ring (not shown) drives the ingression of the midzone membrane of the dividing cell to form the ICB between nascent daughter cells. At the centre of the ICB emerges the stem body (denoted SB in diagram), a protein-rich bulge that serves as the scaffold for the final abscission event. Over time, the ICB undergoes distinct maturation events, including dynamic lengthening and thinning, before constriction sites (denoted CS in diagram) are formed on either side of the stem body. Once assembled, the abscission machinery will direct membrane fission at these two sites in an ordered fashion: the first to physically separate the two cells, and the second to release the membrane-bound stem body (also known as the MidBody Remnant or MBR).

1.2 Cyclin-dependent Kinases (CDKs) and Cyclins

1.2.1 Overview

Progression through the eukaryotic cell cycle, from unicellular organisms like yeast to higher organisms like mammals, is driven by the family of Cyclin-Dependent Kinases (CDKs) in complex with cyclins, their cognate regulatory factors. This kinase complex functions in the cell cycle by phosphorylating target proteins to overcome cell cycle checkpoints. CDKs contribute 5

the catalytic core of this serine/threonine kinase, whose activity and specificity are largely regulated by the cyclin in complex with it21. CDKs were first characterized in yeast, in which a single CDK regulates cell cycle progression14. However, multiple CDKs with distinct roles in cell cycle regulation have been discovered in mammals21. Individual CDKs can interact with multiple cyclins, which allows for diversity and dynamism in their target specificity across phases of the cell cycle. In general, CDK-cyclin pairs minimally target Ser/Thr-Pro motifs for phosphorylation, though the optimal motif has been defined as Ser/Thr-Pro-X-Arg/Lys22-24. Given the primary role CDK-cyclin pairs play in promoting cell cycle progression, regulation of these kinases is tightly controlled at multiple levels. CDKs are regulated not only by the binding of cyclins, but also by the binding of inactivating proteins as well as phosphorylation events on active site residues of the kinase domain25,26.

1.2.2 Discovery

The first member of the CDK family, CDK1, was discovered in genetic screens for yeast mutants with defects in the cell division cycle14. CDK1 was found to be essential for cell cycle progression in yeast and soon after human homologs able to complement CDK1 in yeast were identified15,16. Subsequent sequence conservation studies identified multiple family members in higher eukaryotes17, while yeast possess a single CDK.

Independently, a series of proteins cyclically synthesized and destroyed at each cellular division were characterized in sea urchin embryos18. Owing to their cyclical expression patterns, these proteins were named cyclins. Shortly thereafter, they were found to stimulate meiosis in frog oocytes19 and homologs in humans and yeast were described. Biochemically, cyclin function was linked to CDKs by studies in clam and frog oocytes, and starfish20.

1.2.3 Cyclins

Much like CDKs, the numbers of cyclins have expanded in higher eukaryotes. A total of 30 cyclin genes across 13 groups have been identified in the human genome, with molecular weights ranging from 35 to 90 kDa27. Expression of most cyclins is restricted to distinct segments of the cell cycle, after which they are degraded by the ubiquitin proteasome33. Cyclin expression is stimulated by the activation, in a cell cycle-dependent manner, of two transcription factors: E2F and FOXM1 (Forkhead Box Protein M1) 21. Two proteasome systems are responsible for cyclin degradation across different stages of the cell cycle: SCF (Skp1-Cul1-F- 6

box protein) from late G1 to M phase and APC/C (Anaphase-Promoting Complex/Cyclosome) 34 from anaphase through G1 . All cyclins contain a 100-residue domain of five stacked α-helices known as the cyclin box28. The cyclin box facilitates binding of cyclins to CDKs and other substrates, though some cyclins possess an additional cyclin box that aids in protein folding27. Only a handful of the 13 defined cyclin groups have characterized functions in the cell cycle: C- and D-type cyclins regulate quiescence and G1 progression, E-type cyclins control S-phase entry, 28 A-type cyclins promote G2 progression, and B-type cyclins control M-phase entry .

1.2.4 Structural Features of Cyclin-CDK complexes

Generally, CDKs are proline-directed serine/threonine kinases. Peptide array studies have described a preference for serine/threonine residues in front of a proline, followed by a basic residue. The reported consensus sequence of S/T-P-X-K/R holds true for most cell cycle CDKs, whereas transcriptional CDKs display the S/T-P-X consensus22-24, with the exception of CDK7 and CDK9 do not require the +1 proline29.

The size of CDKs differs greatly across the family: cell cycle CDKs encompass little more than the catalytic kinase domain, whereas some transcriptional CDKs have lengthy amino- and/or carboxy-terminal extensions27. The CDK active site is located between amino- and carboxy- terminal lobes, composed of beta-sheets and α-helices respectively. The two lobes are responsive to different regulatory cues, either promoting the activation or inactivation of kinase activity. The highest level of regulation is cyclin-binding: in the absence of bound cyclin, the T-loop structure of the carboxy-terminal lobe occludes the CDK catalytic cleft, blocking kinase activity. Phosphorylation plays a significant role in regulating cyclin-CDK pairs: for instance, phosphorylation of the glycine-rich inhibitory element of the N-lobe diminishes kinase activity30, whereas phosphorylation of the T-loop in the C-lobe is required for kinase activation25. Binding of CDK Inhibitors (CDKi) serves as another mode of kinase regulation. CDKi are divided into two classes based on their mode of inhibition: one class binds to the CDK-cyclin heterodimer, diminishing kinase activity31, while the other binds free CDK to prevent CDK-cyclin complex formation314.

1.2.5 Expression Patterns

Expression of CDKs appear to be constant across the eukaryotic cell cycle37, with few exceptions42,43. On the other hand, the levels of cell cycle-regulating cyclins vary markedly across the cell cycle, whereas transcriptional cyclin levels are more or less constant37. The expression patterns for families of major cell cycle regulating cyclins across the cell cycle are displayed in Figure 1.4.

Figure 1.4. Expression Patterns of Major Cell Cycle-regulating Cyclins. Graph depicting the relative protein levels of important cell cycle-regulating cyclins across the cell cycle (from G1 on the left to M on the right) showing their cyclical nature. The letters above each curve refer to the associated cyclin family. Figure adapted from Yang, V.W. The Cell Cycle. In: Physiology of the Gastrointestinal Tract, 6th Edition (H.M. Said, 2018).

1.2.6 General Principles of CDK Regulation

The most intensively studied aspect of CDK regulation is via cyclin binding. Structural studies have revealed that association of cyclin with CDK promotes an activating rotation to the CDK ATP-binding site29. The effects of this conformational change are two-fold: first, it allows for CDK substrate binding, and second it provides access to target residues of CDK Activating Kinases (CAKs) which when phosphorylated, confer rigidity and stability to the active CDK- cyclin complex. These general structural principles are displayed in the majority of analyzed CDK-cyclin pairs, even though the areas of their interaction surfaces vary. There are, however, some exceptions. For instance, cyclin D binding to CDK4 does not induce an active CDK

conformation203,204, suggesting some CDKs may require additional interacting factors or post- translational modifications to become activated.

From a structural perspective, inactivation of CDKs occurs through two mechanisms: inhibitory phosphorylation events, or CDKi binding. Inhibitory phosphorylation of CDKs is governed by Wee1 and Myt1 kinases, mainly in response to DNA damage48. They target the glycine-rich loop of the CDK N-terminal lobe, which disrupts substrate binding. CDKi are classified into two groups with different inhibitory mechanisms: the INK4 (INhibitor of CDK4) and CIP/KIP (CDK Interacting Protein/Kinase Inhibitory Protein) families. INK4s specifically interact with CDKs 4 and 6, preventing cyclin D association315, whereas CIP/KIP inhibitors appear to interact with a wide range of CDK-cyclin holoenzymes, diminishing their kinase activity32.

1.2.7 Regulation of Cell Cycle Checkpoints

1.2.7.1 Regulation of G1/S

The objective of the cell in G1 is to grow and accumulate nutrients in preparation for DNA replication. Growth in G1 is dictated by the extracellular environment, as cells respond to mitogenic and inhibitory factors via cell-surface receptors. Mitogenic stimulation activates expression of cyclin D which binds to and activates CDK4 and 6, primary regulators of the G1-S transition51. CDK4/6-cyclin D monophosphorylates Retinoblastoma (Rb) protein to release a subset of the E2F transcription factor from its inactivating interaction with Rb46. E2F stimulates expression of cyclin A and E, as well as enzymes required for DNA synthesis47. Further phosphorylation of Rb is catalyzed by either CDK4/6-cyclin D and/or CDK2-cyclin E, increasing levels of S phase-promoting factors in a positive feedback loop3,49,50. Rb is dephosphorylated by Protein Phosphatase type 1 (PP1) and the end of mitosis in preparation for the next cell cycle52.

In the event that the cell has experienced DNA damage, the p53 tumor suppressor mediates cell cycle arrest. p53 is a well-characterized transcription factor that can induce cell cycle arrest or apoptosis in response to DNA damage, hypoxia, and/or oncogene activation54,55. Typically, p53 is suppressed by its own transcriptional target, Mouse Double Minute 2 homolog (MDM2) that prevents p53 from activating expression of a multiple CDK inhibitors3. DNA damage induces a kinase cascade that ultimately leads to p53 phosphorylation53, abolishing the MDM2-p53 interaction to allow p53 to activate expression of the CDK inhibitors and stall the cell cycle. 9

1.2.7.2 Regulation of S phase

Having passed the G1/S checkpoint, cells begin replicating their DNA. In G1, immature replication complexes assemble at replication origins in a process known as licensing56. A recognition module first assembles at the origin before recruiting a helicase to form the Pre-

Replication Complex (pre-RC). Activation of the pre-RC occurs at the G1-S transition and is dependent on the combined action of CDK2-cyclin A/E and the kinase CDC757. These kinases phosphorylate the helicase component of the pre-RC to recruit additional activating factors, to unwind the origin and form the mature, replication-competent replisome complex58.

DNA replication must be tightly regulated to ensure it occurs only once during S phase. Replisome assembly and processivity is permissive at relatively low levels of CDK2-cyclin A activity. As S phase progresses, cyclin E is targeted for degradation, promoting formation of CDK2-cyclin A complexes33. Increased CDK2-cyclin A activity promotes deactivating phosphorylation events on components of the replisome, serving to exclude them from the nucleus, target for proteolysis, or prevent chromatin association3,63,64. This ensures origins of replication cannot be re-licensed, preventing additional rounds of DNA replication.

Cell cycle progression during S phase is also sensitive to lesions of the replicated DNA. The replisome stalls at lesions, often exposing long stretches of single stranded DNA65. Single stranded DNA-associated factors recruit and activate the serine/threonine kinase Ataxia Telangiectasia and Rad3-related (ATR). ATR initiates a kinase cascade that ultimately dampens CDK activity66-69, in effect pausing the cell cycle to allow DNA repair.

DNA replication in S phase is closely tied with centrosome duplication through CDK2-cyclin A/E59. The centrosome plays important roles in the establishment of the cytoplasmic microtubule network and the mitotic spindle. The centrosome must duplicate once per cell cycle to ensure that the daughter cells resulting from division each inherit one. Though a precise role for CDK2- cyclin A/E in promoting centrosome duplication is unknown, it has been shown that substrates common to DNA replication are recruited to the centrosome in a kinase-dependent manner60-62.

1.2.7.3 Regulation of G2/M

The G2-M transition is governed by CDK1 in complex with cyclin B. Like most CDKs, CDK1 is expressed across the cell cycle, but its activity is regulated by cyclin-binding and

phosphorylation events. Expression of cyclin B is drastically increased in G2, allowing for formation of CDK1-cyclin B complexes. However, the complex is kept inactive by inhibitory phosphorylation of CDK1. At the G2-M transition, CDC25 phosphatase removes the inhibitory phosphorylation to activate CDK1-cyclin B. The precise mechanism of CDC25 activation is unclear, but it is believed to be dependent on the mitotic regulatory kinases Polo-Like Kinase-1 (PLK1) and Aurora A71-74. Significant and quick activation of CDK1-cyclin B is achieved by a feedback loop: active CDK1 activates more CDC25 while also inactivating inhibitory CDK kinases72.

1.2.7.4 Regulation of M phase

Activation of CDK1-cyclin B initially occurs in the cytoplasm, especially at the centrosomes76. Here it phosphorylates various spindle components, including tubulin78, microtubule-associated proteins79, and microtubule motors80 in preparation for proper spindle assembly. Simultaneously, a subset of CDK1-cyclin B translocates from the cytoplasm to the nucleus, where it promotes prophase initiation by the breakdown of the nuclear envelope to facilitate chromosome congression78,83. Spindle microtubules then begin to search for and attach to kinetochores. CDK1-cyclin B targets to free kinetochores, favouring and stabilizing microtubule attachments81,84. This facilitates chromosome alignment on the metaphase plate76, in preparation for their segregation (anaphase).

To segregate chromosomes during anaphase, a number of mechanical obstacles must be resolved. Namely, the protein complex cohesin coats the arms and centromeres of chromatids, keeping the pair bound tightly together. The protease separase cleaves a component of cohesin to allow chromosomes to be pulled apart, however it is kept inactive by its chaperone securin100. Complete engagement of kinetochores and tension-sensing across them triggers CDK1-cyclin B- mediated activation of the Anaphase Promoting Complex/Cyclosome (APC/C)90. The APC/C is a multi-subunit ubiquitin ligase complex that targets mitotic cyclins and other mitotic factors for degradation85. CDK1-cyclin B phosphorylation of APC/C components and its associated specificity factor Cdc20 drive the ubiquitination of securin, releasing separase to cleave cohesin and allow sister chromatid separation by the spindle99. Activation of APC/C is stalled by the spindle assembly checkpoint, which monitors kinetochore-microtubule attachments92. A number of factors are recruited to unattached kinetochores to form a complex known as the Mitotic Checkpoint Complex (MCC). The MCC sequesters Cdc20, preventing APC/C activation94,95. 11

Silencing of the checkpoint occurs once all kinetochores are properly attached, requiring the combined action of PP1 and MCC inhibitors101-105.

1.2.8 Other Functions of CDKs

Metazoans possess upwards of 20 CDKs, yet surprisingly only a handful have been directly implicated in cell cycle regulation. In the years following their initial discovery, others members of the family have been shown to play important roles in transcriptional regulation. In fact, some cell cycle-regulating CDKs have also been shown to regulate transcription. Shortly after the initial discovery of CDK1, it was reported that RNA polymerase was one of its targets106, the first suggestion that CDKs may have roles outside of the cell cycle. Over the past few decades, roles for CDKs have been described in a variety of cellular and biological processes, from transcriptional regulation to spermatogenesis21. Given the centrality of the cell cycle in regulating the majority of cellular functions, CDKs have an indirect effect on most cellular processes. Thus, separating the directly cell cycle-related functions of CDKs from their other activities is complicated. For the purposes of this discussion, the focus will be centered on the direct roles CDKs play in the regulation of cellular processes other than the cell cycle.

In recent years, additional CDKs have been implicated in directly phosphorylating RNA polymerase II to regulate is transcriptional activity107-109. Furthermore, CDKs 7, 8, and 11 have established roles in global transcriptional regulation of developing tissues110-112. CDKs 8 and 14, on the other hand, play more specialized roles in transcriptional regulation, specifically modulating Wnt signaling. CDK8 modulates the transcriptional activity of β-catenin114, an effector of the Wnt signaling cascade, whereas CDK14 acts at the plasma membrane to prime the Wnt receptor for activation115. Interestingly, CDK10 appears to play a non-catalytic role in transcriptional regulation by binding to and inhibiting the Ets2 transcription factor116,117.

There is increasing evidence that CDKs play prominent roles in transmission of epigenetic information. CDKs 1 and 2 were first reported to effect gene silencing through phosphorylation of the global histone methyltransferase Polycomb Repressive Complex 2 (PRC2)118,119. CDK4 also promotes gene silencing through activation of specific arginine methyltransferases120. Aside from histone modifications, it has been reported that CDKs 1,2 and/or 5 phosphorylate and activate the major global DNA methylation regulator DNA Methyltransferase 1121.

Metabolic roles for CDK5 and CDK8 have been reported in glycogenesis and lipogenesis respectively. CDK5 functions downstream of serotonin stimulation to promote glycogen synthase activation122, while CDK8 blocks lipogenesis by phosphorylating an insulin-activated transcription factor123.

Intimately connected to their roles in cell cycle regulation, CDKs are able to influence the cell fate decisions of various stem cell populations. Inhibition or germline loss of CDKs 2 and 4 has been shown to promote differentiation of neural stem cells124,125, though it is likely as a result of cell cycle abnormalities. CDK1 on the other hand, has been shown to directly interact with the transcription factor Oct4, leading to repression of differentiation factors128. Though no specific CDKs have been implicated in maintaining myoblast stemness, nonetheless CDK activity targets the MyoD transcription factor for proteolysis129.

In addition to these many secondary CDK functions, significant work has uncovered broad roles for CDK5 in many aspects of neuronal organization and function130,132. CDK5 complexes with neuron-specific proteins, not cyclins, to carryout its roles in neurite outgrowth, synaptic vesicle endocytosis and dopaminergic and glutamatergic transmission131-135. Lastly, recent work has shown that CDK16 is required for the late stages of spermatogenesis: knockout induces a variety of abnormalities in spermatozoa rendering mice infertile136.

1.3 CDK11

1.3.1 Background

Since its discovery decades ago, CDK11 was quickly recognized as an unconventional member of the CDK family. Sharing the defining sequence motif of the p34Cdc2 kinase family137, initial research suggested a cell cycle-related role for CDK11146. However, further dissection of CDK11 function was complicated by the potential for splicing to produce over twenty isoforms137,141. Shortly after its initial characterization, CDK11 was implicated in neuroblastoma development142, and a broader role in cancer and tumorigenesis has been uncovered since143. Further functional studies revealed regulatory roles in transcription and splicing, leading to its primary characterization as a transcriptional CDK138-140. Quite recently, the function of CDK11 in health and disease appears to have extended to both acquired immunodeficiency syndrome

and Alzheimer’s disease144,145. Accordingly, a better understanding of the comprehensive functions of CDK11, whether that be transcriptional or in the cell cycle, is warranted.

1.3.2 Structural Features and Interacting Factors

CDK11 is amongst the largest members of the CDK family, consisting of the canonical PITSLRE kinase domain in addition to N- and C-terminal regulatory regions147. In humans, CDK11 is encoded by the neighbouring (and nearly identical) CDC2L1 and CDC2L2 genes, the product of a relatively recent gene duplication event141,147. The full-length proteins translated from the transcripts encoded by these two genes differ by 16 amino acids and appear to be functionally equivalent147.

There are over twenty reported CDK11 splice variants, with their main variance at the N- terminus. However, only three isoforms have been reported to reach substantial levels137. CDK11 interacts with many factors important for a variety of cellular processes, some of which are depicted in Figure 1.5. The CDK11 N-terminus contains the basic RE domain that facilitates interactions with the serine-rich class of spliceosome factors, notably splicing factor 9G8140. Upstream of the RE domain, there is a binding site for the conserved eukaryotic regulatory factor 14-3-3, which could potentially influence CDK11 subcellular localization or activity158,159. CDK11 contains multiple Nuclear Localization Signals (NLS) that target the full-length CDK11 to the nucleus of interphase cells160. Downstream of the RE domain there is a glutamic acid-rich domain that has been suggested to mediate cytoskeletal interactions143.

CDK11 has been shown to interact with two cyclin types: L and D149,153,154,160. Interactions with D type cyclins are likely restricted to hematopoietic cells149, likely making L type cyclins the predominant partner in other contexts. Cyclin L contains a C-terminal alternating arginine-serine dipeptide repeat that is commonly found in the SR and SR-related families of splicing factors150- 152, 161.

Figure 1.5. CDK11 Interactors. A selection of CDK11 interactors, identified through a variety of means. Proteins in green circles play roles in transcription; salmon circles play roles in splicing; red circles play roles in numerous processes. Figure adapted from Zhou et al. 2016.

1.3.3 Isoforms and their Associated Functions

1.3.3.1 p110

The full-length p110 isoform is the best studied of all CDK11 variants. It is expressed across the entire cell cycle and is present in many human tissues141. It participates in the intimately linked processes of transcription and RNA processing. CDK11p110 was shown to interact with various members of the RNA polymerase pre-initiation complex including TFIIF and TFIIS, as well as the elongation factor ELL2. Depletion of CDK11 was shown to repress RNA polymerase II- dependent transcription. However, it is unclear if CDK11p110 regulates initiation and/or elongation through these factors as none were found to be a substrate139. Shortly thereafter, Casein Kinase 2 (CK2) was reported to phosphorylate and prime CDK11 for its transcriptional function165, as well as targeting the CTD of RNA polymerase II. Only recently has it emerged that CDK11, and not casein kinase 2, is responsible for CTD phosphorylation in vivo144. Through association with transcription elongation complexes, CDK11 phosphorylates the RNA polymerase II CTD to recruit factors required for 3’ end formation, unlike other CTD-targeting CDKs whose phosphorylation governs elongation.

In addition to its roles in transcription, CDK11p110 has been shown to play an essential role in RNA splicing. Early work reported CDK11p110 interacted with RNPS1138, an activator of pre- mRNA splicing162. Immunodepletion of CDK11 led to a global loss of splicing activity tied to loss of SR family splicing factor 9G8 phosphorylation140. In this context, CDK11 is activated by CHeckpoint Kinase 2 (CHK2), which canonically mediates DNA damage and apoptotic signaling163,164. Interestingly, CHK2 activation of CDK11p110 occurs in the absence of genotoxicity and appears to regulate CDK11p110 homodimerization156. Figure 1.6 details the basic domain organization of the p110 and other main CDK11 isoforms.

1.3.3.2 p58

The p58 isoform of CDK11 was first discovered as a kinase regulating mitosis timing146. CDK11p58 is translated from the same transcript as CDKp110 utilizing an in-frame internal start codon166. Typically, translation requires the 5’ cap of the mRNA, which is bound by the initiation factor eIF4F that in cooperation with eIF3 recruits the immature 43S preinitiation complex169. Recruitment of further initiating factors results in the formation of the translation- competent ribosome. Expression of CDK11p58 is temporally restricted to M-phase, a time during the cell cycle where cap-dependent translation is greatly diminished by dephosphorylation of eIF4F170. The lack of cap-dependent translation during M-phase frees up initiation factors for cap-independent modes. Upstream of the CDK11 internal start codon is a purine-rich sequence known as an Internal Ribosome Entry Site (IRES). The IRES sequence forms complex hairpin- like secondary structures that can recruit translation initiation factors169. Thus, p58 expression is restricted to M phase, where it appears to function in various processes.

CDK11p58 has been ascribed numerous mitotic functions, including regulation of the mitotic spindle. Work in Xenopus egg extracts has shown that inactivation of CDK11p58 decreased the rate of mitotic spindle assembly by destabilizing spindle microtubule plus ends171. p58 activity was shown to be downstream of the G-protein Ran, a key promoter of microtubule stability. Further studies found the kinase activity of p58 was required for the recruitment of Polo-like kinases 1 and 4 as well as Cep192 to the immature centrosome172,173. The recruitment of these factors is required for centrosome duplication in the next round of the cell cycle173.

Additionally, p58 was shown to be required for maintaining sister chromatid cohesion. CDK11 depletion induced chromosome segregation defects, including misalignment and lagging of

separated chromosomes. A subset of CDK11-depleted cells failed to complete mitosis, arresting in metaphase and ultimately inducing cell death174.

1.3.3.3 p46

It has long been observed that the chromosomal locus containing CDK11 is deleted in multiple tumor types142,176, suggesting a role for CDK11 as a tumor suppressor. Overexpression of the CDK11p46 isoform in chinese hamster ovary cells induced apoptosis142, and subsequent studies found p46 participates in multiple apoptotic signaling pathways176-178. CDK11p46 can be generated by the cleavage of p110 or p58 by the apoptotic proteases caspase 1 and 3. It solely consists of the CDK11 kinase module, which in the absence of the N-terminal regulatory domains displays different substrate specificity179. This is exemplified by CDK11p46 targeting the p47 subunit of eIF3, which facilitates the binding of the 40S ribosome with mRNA. This is thought to interfere with eIF3 assembly, ultimately inhibiting translation, and effecting the global decrease of protein synthesis observed during apoptosis182,183.

Importantly, it also appears that the N-terminal portion of CDK11 (p60) produced from apoptosis-induced cleavage of p110 contributes to apoptotic signaling. p60 localizes to mitochondria where it disrupts mitochondrial permeability to release cytochrome c into the cytoplasm to activate caspase 3. This is turn produces more cleaved p110, amplifying the apoptotic signal148.

Figure 1.6. CDK11 Domain Organization. Cartoon depicting the domain organization of the three main CDK11 isoforms. “N” denotes the N-terminus of the p110 isoform and “C” denotes the C-termini of all isoforms. Arrows indicate the N-termini of the p58 and p46 isoforms. Figure adapted from Zhou et al. 2016.

1.3.4 Implication in Human Disease

Prior to an understanding of important CDK11 functions in the cell, reports of its duplication and upregulation were associated with a variety of cancers142, 184-186. These early reports suggested that CDK11 might play a role in promoting tumorigenesis and cancer survival. Over the years, further work has expanded the variety of cancers associated with CDK11 dysfunction and defined a bona fide role in promoting cancer survival in multiple cancers143. However, its precise role in pathogenesis remains unclear. Nonetheless, CDK11 has emerged as a prime target for cancer therapeutics, though none are currently on the market143. Interestingly, new research suggests that CDK11 may play roles in the pathogenesis of other illnesses, including Alzheimer’s disease and acquired immunodeficiency syndrome. Thus, a deeper understanding of CDK11 function may inform a wide spectrum of disease research.

Breast cancer is highly prevalent and constitutes the main cause of female cancer-related deaths189. In breast cancers tissues and cell lines, CDK11 was found to be highly expressed and correlated with aggressiveness and poor patient prognosis187. Depletion of CDK11 p110 reduced proliferation and migration rates, as well as viability. In hormone- and antibody-resistant triple negative breast cancer, CDK11 was found to be upregulated and silencing induced cell death188. Further work will be needed to address the specific role of CDK11 in breast cancers.

Melanomas are another common cancer type, where it appears that CDK11 may play a role in the epigenetic transformation of particular subsets. High expression of CDK11 was observed (compared to non-diseased melanocytes) in these melanoma lines, and silencing lead to cell death. Interestingly, CDK11 silencing promoted histone 3 S10 phosphorylation, a mark associated with transcriptional repression190. Other studies have shown the importance of CDK11 in myelomas, where its expression is essential for the survival of multiple subtypes191,192.

There remain few studies focused on CDK11 in other cancers. Work has demonstrated that increased CDK11 expression is a feature of some liposarcomas, osteosarcomas, esophageal squamous cell carcinomas and ovarian cancers193-197. In agreement with more established findings in breast cancers, melanomas and myelomas, CDK11 depletion or knockout led to reduced migratory and proliferative capacities, and increased apoptosis in these other cancers196,197. Intriguing recent work has shown that in osteosarcoma, CDK11 p110

transcriptionally activates the master regulator of osteogenesis325. It remains to be seen if CDK11 plays analogous roles in these other cancers.

It has been reported that the nuclear localization of CDK11 p110 in neurons is shifted to the cytoplasm of cells modeling Alzheimer’s disease145. Furthermore, CDK11 p110 expression was shown to be enhanced in these cells, seemingly stimulated by the presence of amyloid plaque precursors.

Various CDKs have been implicated in effecting the transcription of pathological human immunodeficiency virus (HIV) factors. CDK7 and 9 mediate viral transcript capping and transcript elongation respectively198,199. CDK13 positively regulates splicing of the infamous Gag and Env HIV transcripts200. The role of CDK11 in HIV transcription appears similar to its role in physiological splicing: it primarily promotes 3’ end processing and indirectly influences polymerase readthrough144, 201,202.

1.4 Cytokinesis

1.4.1 Overview

To complete the cell cycle, a dividing mother cell must physically separate into two daughter cells. This process occurs in the latter stages of M phase, known as cytokinesis. The mechanical aspects of cytokinesis are broadly conserved across eukarya (including metazoa and fungi), with the exception of plants210-212. Cytokinesis begins with the segregation of chromosomes by the mitotic spindle, which contains signaling factors that promote the assembly of an actomyosin contractile ring at the division plane12. This membrane-anchored contractile ring then constricts to ingress a membrane furrow between segregated chromosomes, ultimately forming a narrow canal between the daughter cells known as the InterCellular Bridge (ICB) 209. Within the ICB are compacted anti-parallel bundles of microtubules, which overlap at the protein-rich structure known as the stem body at the ICB center209. Over time, the intercellular bridge elongates and thins prior to plasma membrane fission events that physically separate the two daughter cells13. Importantly, successful cytokinesis ensures the fidelity of genomic transmission to the daughter cells, which if disrupted, can lead to aneuploidy, genome instability, and cancer213. A diagram depicting the progression of a cell through animal cytokinesis is shown in Figure 1.7.

Figure 1.7. Animal Cytokinesis. Schema depicting the progression of a cell through cytokinesis. (A) Anaphase begins with the segregation of midzone- aligned chromosomes to the poles of the dividing cell. Spindle microtubules promote signaling to construct the actomyosin contractile ring at the division plane. (B) The membrane-anchored contractile ring assembles and constricts to ingress a membrane furrow between the two nascent daughter cells, compacting spindle microtubules in the process. (C) Furrow ingression ultimately forms a narrow canal connecting the two daughter cells known as the intercellular bridge. (D) Ultimately, the ICB is resolved by membrane fission events to physically separate the daughter cells, each with a complete genome copy.

1.4.2 Cytokinesis and Cancer

As with the delicate control of the cell cycle, careful regulation of cytokinesis is required to ensure each daughter receives a complete copy of the genome. Disruption of cytokinesis at any stage can result in the formation of a tetraploid cell with supernumerary chromosomes and centrosomes. Subsequent divisions of these tetraploid cells will result in an uneven distribution of the genome into daughter cells, generating aneuploidy213. Tetraploid and aneuploid cells derived from failed cytokinesis have been directly linked to both tumorigenesis and cancer evolution214-218. Thus, developing a better understanding of the molecular mechanisms of cytokinesis could have major implications for cancer therapies.

1.4.3 Anaphase

1.4.3.1 Central Spindle Assembly

Following chromosome segregation, assembly of the mitotic spindle is initiated. This structure makes pivotal contributions to both early and late events in cytokinesis, including the specification of the division plane and templating the stem body, the structure within the ICB that serves as the platform for abscission13. Spindle assembly begins with the inactivation of CDK1, the major mitosis-promoting kinase, through APC-mediated degradation of its partner cyclin, cyclin D211,13. Additionally, increased phosphatase activity through anaphase removes inhibitory CDK1-mediated phosphorylations from multiple cytokinetic factors219. The spindle is composed of antiparallel bundles of microtubules, whose plus-ends interdigitate at the midzone220. The reduced CDK1 activity allows for the accumulation of various plus end-directed microtubule-associated factors, including kinases and motor proteins at the midzone219. Cooperatively, these factors bundle overlapping microtubules to promote spindle stability while also forming a spatially restricted hub of signaling at the midzone. The coordination of spindle assembly is chiefly dependent on three factors essential for its construction: Protein Required for Cytokinesis 1 (PRC1), centralspindlin, and the Chromosomal Passenger Complex (CPC)219.

PRC1 is a microtubule bundling factor, specifically binding overlapping microtubule plus ends as a homodimer. Prior to anaphase, PRC1 is unable to dimerize, on account of inhibitory CDK1- mediated phosphorylation221. Thus, inactivation of CDK1 at anaphase onset allows PRC1 to dimerize and bundle spindle microtubules. Additionally, KInesin Family Member 4 (KIF4) cooperates with PRC1 to spatially restrict the midzone and subsequent signaling events222.

Centralspindlin is a tetrameric complex composed of two copies of both Mitotic Kinesin-Like Protein 1 (MKLP1) and Male Germ Cell Rac GTPase Activating Protein (MgcRacGAP). MKLP1 is a plus end-directed motor protein which directs centralspindlin accumulation to the midzone223. Centralspindlin localization is regulated, both positively and negatively, by phosphorylation. Leading up to anaphase MKLP1 is kept inactive by inhibitory 14-3-3 binding and CDK1-mediated phosphorylation224. This inhibitory phosphorylation is relieved in anaphase, while another kinase, Aurora B, phosphorylates MKLP1 to diminish 14-3-3 binding225.

The CPC is a tetramer composed of Aurora B kinase and three activating factors82. The CPC promotes kinetochore-microtubule attachment in metaphase, before translocating to the spindle 21

in anaphase with the loss of CDK1-mediated inhibitory phosphorylation226. Aurora B then phosphorylates both PRC1 and MKLP1 to drive further spindle maturation224,229, in addition to promoting contractile ring assembly230.

1.4.3.2 Contractile Ring Assembly and Furrow Ingression

Assembly of the actomyosin contractile ring at the equatorial cortex is controlled by the small G protein RhoA. Centralspindlin recruits the RhoA Guanine nucleotide Exchange Factor (GEF) Epithelial Cell Transforming 2 (Ect2) there to locally activate RhoA236, where it appears that MgcRacGAP may also directly contribute to maintaining RhoA activity237, 265. This generates a two-pronged signaling cascade culminating on the one hand in the activation of the cytokinetic motor protein myosin II235, and on the other the activation of actin-nucleating Diaphanous formins232-234. Activated myosin II and actin are then thought to coalesce into a network of connected actomyosin nodes to effect ring assembly238. In addition to these primary constituents of the contractile ring, other factors are required for its proper assembly and constriction. Those include the membrane-associated scaffold Anillin240,241, septin filaments242, and actin remodelers and crosslinkers243,244. Much like the mechanics of ring assembly, it remains unclear how constriction of the metazoan ring occurs239. Possibly on account of the membrane-anchoring of Anillin, contractile ring constriction coincides with ingression of the equatorial membrane to form the ICB241.

1.4.4 Telophase

1.4.4.1 Intercellular Bridge Maturation

Ingression of the cytokinetic furrow continues to form the roughly 1-2 uM wide ICB. Over the course of a few hours, the ICB undergoes distinct stages of organization leading up to the final abscission event (Figure 1.8). Broadly, this process consists of the clearance of cytoskeletal components from the ICB and the recruitment of abscission factors.

In the ICB, the overlapping region of the spindle midzone is reorganized into a structure known as the stem body245. The stem body is a protein-rich bulge that scaffolds the assembly of abscission factors in addition to hundreds of other proteins; most of whose functions largely remain unclear246,247. Before abscission occurs, the ICB lengthens and thins in an incompletely understood process. Anillin-Septin filaments promote lengthening of the bridge, as well as the

expulsion of membrane-bound tubules from the ICB13. Furthermore, Golgi- and endosome- derived vesicles accumulate near the stem body and fuse with the ICB membrane248,249.

Figure 1.8. Overview of Cytokinesis. Cartoon detailing key events in the progression of animal cytokinesis (DNA omitted for clarity). (A) The membrane-anchored contractile ring constricts following segregation to ingress a membrane furrow between chromosomal masses. (B) Ring constriction forms the early ICB, which lengthens and extrudes tubules in an Anillin-Septin- dependent manner. The stem body and constriction sites are defined. (C) Polymerization of helical ESCRT filaments from the stem body to an adjacent constriction site drive the physical separation of daughter cells in a process termed abscission (further detail below).

1.4.4.2 Abscission

Abscission of the ICB is carried out by the highly conserved Endosomal Sorting Complex Required for Transport (ESCRT) family, which mediates membrane scission in a variety of biological contexts, from viral budding to multivesicular body formation250,251. The ESCRT-III protein subgroup, also known as CHarged Multivesicular body Proteins (CHMPs), are responsible for catalyzing scission in all these contexts by forming dynamic membrane- 23

associated helical polymers at the membrane neck250. The proper positioning and scission activity of these filaments requires significant flux, which is mediated by the ATPase Vacuolar Protein Sorting-associated protein 4 (Vps4)256. In humans, there are seven core CHMPs and a handful of regulatory proteins that appear to play nonredundant roles in cytokinesis245. Recruitment of CHMPs to perform membrane scission events requires the prior localization of various adaptor complexes. In animal cells, CHMPs are independently recruited to the stem body through direct interactions with Tumor Susceptibility Gene 101 (TSG101) and ALG-2- Interacting protein X (ALIX), which both dock onto the centrosomal protein Cep55 at the stem body core257.

Diligent high-resolution imaging experiments in animal cells have shown that ESCRT-III extends from the stem body to one adjacent constriction site252,255, followed by Vps4252. Accumulation of ESCRT-III at this site coincides with a loss of microtubules and actin around the abscission site, and some time later, membrane scission260. The loss of microtubules has been attributed to the action of the ATPase Spastin, which is recruited to the abscission site by the ESCRT-III CHMP1B326,327. Actin clearance on the other hand, appears to rely on multiple pathways. Factors have been demonstrated to directly promote actin depolymerization in the ICB, including the capping protein328 and MIcrotubule Associated Monooxygenase Calponin And LIM Domain Containing Like 1 (MICALL1)329. Further, Rab11 and Rab35 endosomes mediate actin clearance, through delivery of the actin regulators OCRL (Lowe OculoCerebroRenaL Syndrome Protein) and p50RhoGAP330-332. After the first scission event, a second scission usually occurs on the other side of the stem body, to release the stem body252,255, now known as the MidBody Remnant (MBR). MBRs can phagocytosed by neighbouring cells, where reports claim that they act as a signaling organelle, activating Epidermal Growth Factor Receptor (EGFR) and integrin pathways to promote growth and proliferation333.

In recent years, work in primary cells and at the organismal level has begun to shed light on the abscission process in vivo, which appears to differ in some significant respects from the models based off of transformed and immortalized cell culture lines. Notably, it has been shown that plating of untransformed fibroblasts onto stiff substrates allows for abscission to occur in an ESCRT-independent fashion258. Even more striking, it has been shown that mice lacking Cep55, the pivotal ESCRT adaptor, can complete the majority of mammalian cell divisions and are viable266. Taken together, these results suggest an alternative, tension-driven abscission

mechanism that can account for most animal divisions. It should be noted however, that ESCRTs are indispensable for division in certain developmental contexts, including brain development, early embryonic divisions, and cancers266-269. Further work is needed to assess the frequency of this ESCRT-independent mechanism in unperturbed systems as well as investigating potential regulatory mechanisms that could have implications for long-term organismal health.

1.4.4.3 Regulation of Abscission

Multiple pathways regulating the timing of abscission have been described, but interestingly, CDKs have yet to be implicated in them. Three kinases, Plk1, Aurora B, and Unc-51 Like Kinase 3 (ULK3) have been shown to play important roles in regulating the abscission process. Plk1 regulates stem body maturity, blocking Cep55 targeting to the stem body by a phosphorylation that blocks the Cep55-centralspindlin interaction. At the anaphase-to-telophase transition, degradation of Plk1 by the APC/C promotes Cep55 recruitment to the stem body261, where it in turn recruits ESCRTs.

Aurora B-mediates an abscission checkpoint, also known as the NoCut pathway, through phosphorylation of the ESCRT-III protein CHMP4C253,262. The NoCut pathway is activated in response to a variety of stimuli including lagging DNA in the ICB, DNA damage, nuclear pore defects, and tension across the ICB272, 275-277. Though the precise signal(s) activating the checkpoint across these conditions are unknown, all pathways appear to converge on the sustained activation of Aurora B273.

Some important features of the abscission checkpoint have been uncovered in the last decade, but crucial insights are still needed for to rationalize competing models. The core unit responsible for mediating the checkpoint was found to be Aurora B, CHMP4C, and Vps4. Activation of Aurora B is achieved through phosphorylation of S331, in some contexts mediated by Cdc Like Kinases (CLKs) 1,2, and/or 4274. S331-phosphorylated Aurora B targets CHMP4C for phosphorylation on its C-terminal regulatory region at serines 210, 214, and 215270,280,281. Likely owing to its preference for S210, this creates two differentially phosphorylated pools of CHMP4C: mono-phosphorylated (hereon referred to as mono-4C) and tri-phosphorylated (here on referred to as tri-4C). These pools display distinct cytokinetic localizations and modes of recruitment: mono-4C localizes to the stem body in a centralspindlin-dependent manner while

tri-4C localizes to the adjacent arms of the ICB in a CPC-dependent manner270. Over time, levels of tri-4C diminish in an unknown manner.

Mono-phosphorylated CHMP4C at the stem body has been shown to form a ternary complex with Vps4 and Abscission/NoCut CHeckpoint Regulator (ANCHR) that retains Vps4279. Sequestered Vps4 is unable to freely associate and dissociate with ESCRT-III, a requirement for polymer assembly256. Thus abscission is halted, as ESCRT-III cannot polymerize to the abscission site. It is furthermore reported that knockdown of CHMP4C decreases abscission timing253,279, suggesting CHMP4C is not required for the membrane fission events associated with abscission. However, others have shown that CHMP4C localizes to the abscission site, and is competent to deform membrane in vitro270. Thus, it is clear CHMP4C regulates abscission, but whether it also plays a direct, mechanical role in the process is contested. ULK3 may also regulate CHMP4C, as its depletion rescues the abscission delay caused by CHMP4C overexpression278. Further work is needed to define the ULK3-dependent checkpoint regulation and its interplay with Aurora B.

Only in recent years have insights into overcoming the NoCut checkpoint been made. Regrettably much like the lack of understanding of activating signals for the abscission checkpoint, very little is known about upstream signals to deactivate the checkpoint. It appears that even with satisfaction of the checkpoint, Aurora B activity is maintained at the stem body160,280. However, recent work suggests its substrate specificity may be altered. Protein Kinase C ɛ (PKCɛ) has been shown to phosphorylate Aurora B at S227 late in cytokinesis, serving to reduce the ability of Aurora B to phosphorylate CHMP4C280. Additionally, PP1 has been shown to dephosphorylate mono-4C to partly counteract the checkpoint, although it does not appear to account for all CHMP4C dephosphorylation281. Figure 1.9 depicts a simplified version of positive and negative abscission checkpoint signaling.

Figure 1.9. The Abscission (NoCut) Checkpoint. Model illustrating the positive and negative regulation of the mammalian abscission checkpoint. Circled “P”s signify phosphorylation events; Circled “P”s with a cross through them signify dephosphorylation events. Red arrows indicate events that serve to activate the checkpoint, whereas green arrows indicate events that counteract the checkpoint. 1.5 Research Question

The cell cycle is a tightly controlled cellular process, with a multitude of checkpoints ensuring orderly and timely progression3. Interestingly, little is known about the regulation of cytokinesis, which if interrupted can result in tumorigenesis and cancer213-216. In particular, the timing of the last step of cytokinesis, abscission, is crucial because if chromosomes are entangled in the division machinery, premature abscission can lead to aneuploidy and genome instability. At other points in the cell cycle, CDK-cyclin complexes drive its progression through various checkpoints. Strikingly, no CDK has been implicated in the regulation of abscission. Given the expression of a mitosis-specific isoform of CDK11166,167, and its unclear role in cytokinesis271, I aim to address the molecular role CDK11 plays in cytokinesis. I hypothesize that CDK11 positively regulates cytokinesis. To gain insight into the cytokinetic processes it could be regulating, I will first analyze the localization of CDK11 isoforms through the process. I will then assess the effect of CDK11 depletion on cytokinetic progression, and determine which isoform is responsible for its function.

Chapter 2. CDK11p58 Kinase Activity is Required for Cytokinesis

Remark Experiments performed by Thomas Panagiotou included in this thesis contributed to the following publication: Renshaw, M.J. et al. CDK11p58-cyclin L1β regulates abscission site assembly. J Biol Chem. 294, 18639-49 (2019). Renshaw performed some experiments included in this thesis; those experiments comprise the following figures: 2.1, 2.6D and E, 2.10.

2.1 Introduction 2.1.1 Known Roles of CDK11 in Cell Division

CDK11 has been shown to play a role in multiple processes early in cell division. These include stabilizing sister chromatid cohesion174,282 and assisting in spindle formation171,172. Interestingly, both of these processes are dependent on the p58 isoform, whose expression is restricted to mitosis42,43.

Over the years, studies have hinted that CDK11 is also involved in the late stages of cell division. Overexpression of the human p58 isoform in Chinese Hamster Ovary (CHO) cells led to abnormalities in mitosis146. A later overexpression screen identified CDK11 as a modulator of Rho signaling during cytokinesis in Drosophila271, while reduced expression of CDK11p58 was found to lead to defects in mouse cytokinesis283.

2.1.2 Objectives and Strategies

To thoroughly interrogate the role of CDK11 in cytokinesis, I will first assess its localization through this process. Analysis of CDK localization has been pivotal in understanding their roles in other cellular processes292,293 . To determine if CDK11 is required for cytokinesis, I will assess if cytokinesis is disrupted upon depletion of CDK11 in HeLa cells. If CDK11 were required for cytokinesis, one would expect its depletion to increase the proportion of multinucleated cells, which as previously discussed result from aborted cytokinesis. Furthermore, I will quantify the proportion of cells at distinct stages of cytokinesis upon CDK11 depletion. This approach will determine at what stage of cytokinesis CDK11 is acting, as cells lacking CDK11 will stall there. As previous reports implicate CDK11 in sister chromatid cohesion and spindle assembly, I will

investigate these claims by analyzing spindle morphology and chromosome segregation upon CDK11 depletion.

During mitosis, both CDK11p110 and CDK11p58 are expressed, where the latter is generated by cap-independent translation of the full-length CDK11 transcript. To dissect the specific contributions of CDK11 isoforms to cytokinesis, I will construct stable, doxycycline-inducible HeLa cells lines expressing tagged versions of CDK11p110 and CDK11p58. The ability of these transgenes to rescue the cytokinetic defects induced by CDK11 knockdown will determine which isoform is responsible for CDK11 function in cytokinesis.

To gain insight into the mechanistic role CDK11 plays in cytokinesis, I will determine if its cytokinetic role is mediated by its kinase activity. To test this, I will analyze the effects of treatment with OTS964, a recently discovered CDK11 small molecule inhibitor284. Furthermore, I will generate CDK11 constructs lacking kinase activity and assess their effect on cytokinesis. Together, these experiments will serve to demonstrate the requirement of CDK11 for cytokinesis and importantly, where in the process it acts.

2.2 Results 2.2.1 CDK11p58, but not CDK11p110, Localizes to Stem Body Experiments in this subsection performed by Matt Renshaw

To substantiate a role for CDK11 in cytokinesis, its localization through the cell cycle was examined. Staining of endogenous CDK11, using an antibody that recognizes all isoforms, showed punctate nuclear staining in interphase as previously reported147,174,282. At the beginning of cytokinesis (anaphase), CDK11 appeared dispersed through the cytoplasm (Figure 2.1A). Following furrow ingression, a sub-population of CDK11 became enriched in the space between the midzone microtubules of the InterCellular Bridge (ICB) colocalizing with a known marker of the stem body, Anillin13. CDK11 staining persisted in the stem body beyond Anillin, which clears from the ICB just prior to abscission13. In contrast to previous reports, CDK11 was not detected at either the spindle poles171,172, or on chromosomes174,282.

Next, the contributions of each isoform to the localization of CDK11 were investigated. In mitosis, only CDK11p110 and p58 are expressed290. Hemagglutinin A (HA)-tagged CDK11 stable HeLa cell lines were constructed, and the localization of CDK11p110 and p58 through the cell

cycle was analyzed. Together, the staining of these isoforms recapitulated the localization of endogenous CDK11 staining (Figure 2.1B). HA-CDK11p110 localized to nuclei in interphase, and showed no enrichments in cytokinetic structures. On the other hand, HA-CDK11p58 localized to the stem body, suggesting a role for this variant in cytokinesis.

A Fig

Figur e B2.1 Fig

Figure 2.1. CDK11p58, but not CDK11p110, localizes to stem body. This experiment was performed by Matthew Renshaw. (A) Antibody staining of endogenous CDK11 through cytokinesis. Panels on right correspond to magnified region of left-most images. Arrows indicate stem body localization. (B) Cytokinetic localization of HA-tagged CDK11 variants. Panels on right correspond to magnified region of left-most images. Arrow indicates stem body localization of CDK11.

2.2.2 Knockdown of CDK11 Induces a Multinucleate Phenotype

In order to assess the phenotype of CDK11 depletion, I first confirmed that CDK11 could be knocked down efficiently with small interfering RNA (siRNA). I performed a Western blot on lysates harvested from HeLa cells treated with either control or CDK11 siRNA, blotting for CDK11 and tubulin as a control (Figure 2.2A). The CDK11 antibody recognized all three of the predominant CDK11 isoforms, and each was successfully depleted by siRNA treatment. In addition to analyzing protein levels, I performed Real Time- Quantitative Polymerase Chain Reaction (RT-qPCR) experiments to monitor the levels of CDK11 mRNA (Figure 2.2B). This analysis indicated that levels of the CDK11 transcript (encoded by both CDK11A and CDK11B were reduced by approximately 80%.

A B

Figure 2.2 Depletion of CDK11 by siRNA. (A) Anti-CDK11 immunoblot of control and CDK11 siRNA–treated cells. Cells were transfected with respective siRNAs 48 hours pre-harvest. The respective positions of the predominant isoforms of CDK11 are indicated by the labeled arrows. (B) RT-qPCR analysis of relative CDK11 transcript levels in CDK11 siRNA-treated samples. Relative expression was calculated by normalizing CDK11 transcript levels to β-actin transcript levels. Black dots represent expression levels measured from independent experiments, where red dots represent the mean across all independent experiments, with the whiskers representing the standard deviation. 31

Having established a successful knockdown, CDK11-depleted cells were fixed and analyzed by fluorescence microscopy to determine if they exhibited mitotic defects. In contrast to previous reports, no apparent differences in metaphase spindle morphology, as measured by spindle width and length, were observed (Figure 2.3). In control cells, antibody staining of CDK11 showed an apparent enrichment on the metaphase spindle (Figure 2.3B). This partially agrees with previous reports171, where CDK11 robustly decorates the spindle poles and is only weakly seen on the spindle. Furthermore, there were no significant differences in the proportion of DNA bridges between CDK11-depleted and control cells (Figure 2.4), suggesting normal chromatid cohesion. It has been suggested that CDK11 localizes to kinetochores to promote segregation174. However, I did not observe an enrichment of CDK11 on or near the chromosomal masses (Figure 2.3B). These results argue against an early mitotic role for CDK11 in cell division, positioning it as a potentially late-acting factor.

Figure 2.3. CDK11 depletion does not alter metaphase spindle morphology. Cells were fixed 48 hours post-siRNA transfection. DNA was stained by Hoechst, microtubules by anti-acetylated tubulin antibody and CDK11 by anti-CDK11 antibody. N=3, with at least 15 cells scored per experiment. “n.s.” signifies p-value >0.05 generated by unpaired t-test. (A) Cartoon outlining the measurements displayed in panel C. DNA is shown in cyan, with microtubules in grey. Spindle width and length measurements were made along the dotted lines in the diagram, corresponding to the lines labeled “W” and “L” respectively. (B) Representative micrographs of metaphase cells; scale bar represents 5 uM. (C) Quantification of spindle measurements. Spindle width measurements for each cell were averaged. From bottom to top, box and whisker plots show: minimum, 25th percentile, 50th percentile, 75th percentile, maximum. 33

B n.s. n.s.

Figure 2.4. CDK11 depletion does not induce segregation defects. Cells were fixed 48 hours post-siRNA transfection. DNA was stained by Hoechst, microtubules by anti-acetylated tubulin antibody, and CDK11 by anti-CDK11 antibody. N=3, with at least 45 cells scored per experiment. “n.s.” signifies p-value >0.05 generated by unpaired t-test. (A) Representative micrograph of anaphase cell with DNA bridge. Scale bar represents 5 uM. (B) Quantification of anaphase DNA bridge frequency between control and CDK11 RNAi-treated cells. Black dots represent biological replicates, where red dots are there collective mean with error bars representing the standard deviation.

To assess the role of CDK11 in cytokinesis, I compared the proportion of multinucleated cells between CDK11-depleted and control treatments (Figure 2.5). As intimated earlier, multinucleated cells arise from disruptions of cytokinesis and can promote tumorigenesis in vivo213. Knockdown of CDK11 induced a roughly three-fold increase of multinucleated cells compared to control cells, increasing from 5.00%±0.71% to 13.93%±1.56% (p-value = 0.0317). This result suggests CDK11 is required for cytokinesis.

18 * 16

Cells (%) 6 4

Percentage Multinucleated 0

Control RNAi CDK11 RNAi

Figure 2.5. Knockdown of CDK11 induces a multinucleate phenotype. Multinucleate assay of control and CDK11 siRNA-treated cells. Cells were fixed 48 hours post siRNA transfection, with DNA stained by Hoechst and microtubules by anti-acetylated tubulin antibody. N=3, >250 cells counted per experiment. Statistical significance was determined using an unpaired t-test, where the asterisk signifies a p-value < 0.05.

2.2.3 Depletion of CDK11 Stalls Cells Before Abscission

Having confirmed the requirement of CDK11 for cytokinesis, I sought to precisely define the stage at which it is acting. In addition to the increased proportion of multinucleation observed upon CDK11-depletion, it was also apparent that this treatment served to increase the proportion of cells connected by an ICB (Figure 2.6A). Quantification revealed that CDK-11 knockdown induced a roughly three-fold increase in the number of cells connected by an ICB, increasing from 4.83%±1.17% in control cells to 14.01%±1.33% (p-value=0.0182) (Figure 2.6B). This result supports the claim that CDK11 is required for cytokinesis, while also suggesting its role is played late in the process.

Within the ICB, constriction sites abutting the stem body are formed just prior to the abscission event (Figure 1.8), recognized in fixed cells by a marked thinning of tubulin staining abutting both sides of the stem body252. Thus, ICBs can be classified as either “early” or “late” depending on this characteristic. Accordingly, I classified ICBs into these two classes based on and compared them across siRNA treatments (Figure 2.6C). Importantly, constriction sites were readily observed in both control and CDK11-depleted cells, suggesting that CDK11 is not required for their genesis. As expected, most ICBs in control cells were “early”, since abscission normally occurs quickly after constriction site formation254. In control siRNA-treated cells, late ICBs comprised 19.39%±1.97% of all ICBs. Yet, in CDK-11 depleted cells, they represented 39.52%±2.05% of all ICBs (p-value=0.0121). This drastic increase in the proportion of late ICBs argues that CDK11 is involved in regulating the final stages of cytokinesis.

The above-described phenotypes of CDK11 knockdown, though compelling, could be interpreted as subtle given that increases are only several-fold over control levels. This is likely owing to the fact that asynchronous cell populations were analyzed in these experiments, where only a small proportion of cells undergo mitosis at a given time. To assess the effects of CDK11 depletion on a predominantly mitotic population, RNAi-treated cells were synchronized by treatment with the Eg5 inhibitor monastrol294. Eg5 is kinesin required for bipolar spindle assembly316, whose inhibition results in pro-metaphase arrest294. Subsequent washout of monastrol allowed for synchronized mitotic progression to continue, and ICB proportions were analyzed (Figure 2.6D). Under these conditions CDK11 depletion resulted in a nearly five-fold increase in ICB frequency compared to control siRNA.

36 Downloaded from http://www.jbc.org/

Lastly, to further define the contributions of CDK11 to cytokinetic progression, siRNA-treated cells were followed through cytokinesis by live imaging. The time required to complete cytokinesis was measured from furrow ingression (anaphase) to ICB microtubule disassembly at Univ of Toronto - OCUL on March 2, 2020 (abscission) (Figure 2.6E). Abscission was significantly delayed in in CDK11 knockdown cells, taking roughly 75% longer to complete than control cells (256.1±22.5 min compared to 146.5±14.9 min). Taken together, these results strongly position CDK11 as a regulator of the final step of cytokinesis, abscission.

B 20 C 100 * 80 Downloaded from 15 Control RNAi 60 * 10 CDK11 40 RNAi http://www.jbc.org/ 5 20 ICBs per 100 cells

0 Percentage of ICBs (%) 0

Control RNAi CDK11 RNAi at Univ of Toronto - OCUL on March 2, 2020 Early Late ICBs ICBs

Figure 2.6. CDK11 depletion stalls cells before abscission. Experiments described in Panels (D) and (E) were performed by Matthew Renshaw. (A) Representative images of control and CDK11 siRNA-treated cells. Scale bar represents 5 uM. (B) Quantification of cells connected by an ICB in either control or CDK11 knockdown conditions. Cells were fixed 48 hours post-siRNA transfection. N=3, >250 cells counted per experiment. Asterisk signifies p-value <0.05. (C) Staging of ICBs in either control of CDK11 depletion conditions. Cells were fixed 48 hours post- siRNA transfection. N=3, >250 cells counted per experiment. Asterisk signifies p-value <0.05, determined by unpaired t-test.

37 Downloaded from Downloaded from http://www.jbc.org/ http://www.jbc.org/

at Univ of Toronto - OCUL on March 2, 2020

D E at Univ of Toronto - OCUL on March 2, 2020

(D) Quantification of live-imaging experiments comparing cells treated with control and CDK11 siRNA. Cells were timed from the onset of furrow ingression (anaphase) to the interruption of microtubule staining in the ICB (abscission). n = 8 and 9 cells for control and CDK11 siRNA treatments respectively. Whiskers, box and bar indicate range, 25-75 percentile and mean, respectively; p-value generated by unpaired t-test. (E) Quantification of the proportion of cells connected by an ICB 48 hours post-siRNA transfection and 8 hours after release from a 16-hour monastrol treatment. N=3, >200 cells scored per experiment. P-value determined by an unpaired t-test.

2.2.4 Expression of CDK11p110 and/or p58 Rescue Defects of CDK11 Depletion

To dissect the contributions of the two CDK11 isoforms present during mitosis, stable, doxycycline-inducible HA-tagged CDK11p110 and CDK11p58 HeLa cell lines were constructed using the FlpIn system. Proper cloning of these constructs was verified by sequencing. Given that CDK11p58 is expressed from an IRES in the CDK11 mRNA, it should be noted that the HA- CDK11p110 construct is competent to express CDK11p58. The induction conditions for these cell lines were optimized and analyzed by Western blot to ensure similar expression levels between exogenous and endogenous CDK11 (Figure 2.7).

38 Downloaded from http://www.jbc.org/ at Univ of Toronto - OCUL on March 2, 2020

Downloaded from http://www.jbc.org/ at Univ of Toronto - OCUL on March 2, 2020

Figure 2.7. Expression of various CDK11 constructs. Anti-CDK11 immunoblot of various CDK11 cell lines. Lysates were harvested 48 hours post siRNA treatment and 24 hours post- doxycycline induction where applicable. “p58 DN” signifies the kinase dead mutant. “p110 MA” signifies construct with mutated internal start codon for p58.

Next, I assessed the ability of these transgenes to rescue cytokinesis defects induced by CDK11 knockdown. In multinucleate assays (Figure 2.8A), both HA-CDK11p110 (6.20%±1.04%) and HA-CDK11p58 (7.53%±1.22%) restored multinucleated cells to control levels (5.00%±0.71%; p > 0.1 for both comparisons). In addition, examination of ICBs in these cell lines revealed a rescue of the ICB phenotypes (Figure 2.8B). These results confirm CDK11 as a bona fide requirement of cytokinesis, and furthermore suggest that CDK11p58 is both necessary and sufficient for cytokinesis, whereas CDK11p110 is simply sufficient.

39 A 20 n.s.

15 10

(%) 5

Percentage 0

Mulnucleated Cells Control CDK11 CDK11 CDK11 RNAi RNAi p110 p58 n.s. 20

15 B 10

5 ICBs per 100 cells 0

Control CDK11 CDK11 CDK11 C RNAi RNAi p110 p58 100 80 Control RNAi 60 n.s. CDK11 RNAi 40 CDK11 p110 CDK11 p58 20 Percentage of ICBs (%) 0

Early ICBs Late ICBs

Figure 2.8. Expression of CDK11p110 and/or CDK11p58 rescue defects of CDK11 depletion. All experiments carried out as previously described, with N=3, >250 cells counted per experiment. “n.s” denotes p-values > 0.05 from unpaired t-test. (A) Multinucleate assay with various CDK11 cell lines. (B) Frequency of ICBs in various CDK11 cell lines. (C) Staging of ICBs from various CDK11 cell lines.

2.2.5 Inhibition of CDK11 Kinase Activity by OTS964 Phenocopies Depletion ______Defects

The anti-cancer drug OTS964 has recently been identified as a potent inhibitor of CDK11 kinase activity284. It is proposed that OTS964, much like protein inhibitors of CDKs, binds to and occludes the kinase active site. To determine whether the kinase activity of CDK11 is required for cytokinesis, I assessed the effects of OTS964 treatment on cytokinesis by performing multinucleation and ICB analyses (Figure 2.9). Treatment of cells with 50 µM OTS964 increased, albeit insignificantly, both the proportion of multinucleated and cells attached by an ICB. At 100 µM, multinucleate levels rose to levels comparable to CDK11 knockdown (9.90%±1.81 compared to 11.4%±1.48, p=0.46). The same effect was observed on the proportion of ICBs, with 10.83%±1.17 with 100 µM OTS964 compared to 14.01%±1.33 with CDK11 knockdown (p-value=0.13). However, given that OTS964 is also a potent inhibitor of the mitotically active T-lymphokine-activated killer cell-Originated Protein Kinase (TOPK)284,285, it is difficult to decipher whether OTS964 treatment is inducing a CDK11-dependent cytokinetic phenotype.

B n.s. 18 16 14 12 10 8 6 4 ICBs per 100 cells 2 0 Control CDK11 OTS964 OTS964 RNAi RNAi 50 uM 100uM

Figure 2.9. OTS964 treatment induces cytokinetic defects. Cells were treated with OTS964 8 hours prior to fixation. N=3, >200 cells counted per experiment. “n.s” signifies p-value > 0.05 generated by unpaired t-test. (A) Multinucleate assay across varying OTS964 treatments. (B) ICB counts across varying OTS964 treatments.

2.2.6 Kinase Dead Mutant of CDK11p58 Cannot Rescue CDK11 Depletion Defects

The results from the preceding sections suggest that the CDK11p58 isoform accounts for CDK11 functions in cytokinesis and that these functions may be mediated by its kinase activity. As an alternative strategy of testing this, I sought to further separate the contributions of the full-length and p58 isoforms to cytokinesis by the generation of various mutant CDK11 cell lines. In one such line, referred to as HA-CDK11p110MA, the internal start codon for the p58 isoform was mutated in the CDK11 transcript291, abolishing CDK11p58 expression (Figure 2.7). Thus, only CDK11p110 is competent for expression in the HA-CDK11p110MA cell line. To examine the requirement of CDK11 kinase activity, a cell line expressing a kinase dead mutant of CDK11p58 (HA-CDK11p58DN) was constructed291. I optimized the expression conditions for these cell lines in the previously described manner (Figure 2.7).

The ability of the above-described constructs to rescue CDK11 depletion-induced cytokinetic defects were then assessed. It was observed that expression of wild type HA-CDK11p110 and HA-CDK11p58 result in ICB frequencies of about 5%. Interestingly, CDK11p110MA (mutated internal start codon for CDK11p58) exhibited a two-fold increase in ICB frequency, suggesting that CDK11p58 is required for proper cytokinesis. Further, the HA-CDK11p58DN (kinase dead) cell line exhibited a nearly 2.5-fold increase in ICB frequency. Taken together, these results suggest that CDK11p58, and specifically its kinase activity, accounts for the role of CDK11 in cytokinesis.

Figure 2.10. Kinase dead mutant of CDK11p58 cannot rescue CDK11 depletion defects. This experiment was performed by Matt Renshaw. Cells were fixed 48 hours after siRNA treatment and 16 hours post-doxycycline induction. DNA was stained by Hoechst and microtubules by anti- tubulin antibody. Statistical significance was determined by unpaired t-tests.

2.3 Discussion

Here, I report that CDK11p58, and specifically its kinase activity, positively regulates the final step of cytokinesis, abscission. Depletion of CDK11 induced significant cytokinetic defects, where the exogenous expression of both mitotically expressed isoforms of CDK11 (p110 and p58) was able to rescue. However, only CDK11p58 localized to the ICB and stem body. To definitively rule out contributions from the p110 isoform, a p110 construct unable to express p58 was generated, and this failed to rescue the cytokinetic phenotypes of CDK11 knockdown. Lastly, a kinase dead mutant of CDK11p58 was constructed and found unable to rescue CDK11 depletion defects, arguing that the kinase activity of CDK11p58 mediates its cytokinetic functions.

Taken together, these findings establish CDK11 as an important regulatory factor in animal cytokinesis. Previous work had identified CDK11 as a potential regulator of cell division, but this had yet to be stringently tested. Furthermore, it was unclear which CDK11 isoform was mediating its function. My findings provide strong evidence that CDK11p58 regulates cytokinesis, the first reported CDK to regulate the late stages of cell division75,160. These finding underscore the sweeping importance of CDKs to the regulation of the cell cycle: they contribute not only to progression through interphase and early mitosis, but also coordinate the late stages of division.

Previous reports had implicated CDK11 in the early mitotic processes of sister chromatid cohesion and spindle assembly. However, I detected no defects in these processes upon CDK11 knockdown. Furthermore, neither endogenous nor exogenous CDK11 was detected on chromosomes or the spindle poles. It is not immediately clear what explains these different observations.

In keeping with all other documented functions of CDK11290, I report that its kinase activity is essential to its role in promoting cytokinesis. In an attempt to independently validate the results of the kinase dead CDK11 mutant, I utilized the drug OTS964, a recently discovered inhibitor of CDK11. Though treatment with this drug phenocopied CDK11-depletion defects, there are a number of confounding variables that make the interpretation of this data problematic. First, it should be noted that OTS964 is a novel anti-cancer drug whose targets have not been extensively validated284. In addition to CDK11, it has been shown to inhibit TOPK, an essential mitotic kinase involved in chromosome condensation and spindle assembly288,289. It cannot be ruled out 44

that TOPK may also function in cytokinesis. Furthermore its mechanism of action with respect to CDK11 inhibition is unclear, as it is not known to what extent its binding affects CDK11 kinase activity284.

The experiments performed with OTS964 included prolonged incubation of cells with the drug. Future experiments should attempt to minimize this exposure, perhaps by working with synchronized cell populations. Mitotic arrests can be achieved with drugs like RO3306, allowing cells to accumulate at early M phase before OTS964 treatment306. This approach has the potential to minimize off-target effects, since it restricts drug treatment to a small portion of the cell cycle. This could, however, introduce the complication of drug accessibility to the ICB and stem body. The stem body is an electron-rich, proteinaceous organelle308 that may not allow for diffusion of small molecules across and into it. Research indicates that diffusion across the ICB is possible, albeit somewhat limited272,286,287. This may necessitate increasing the dose of drug to ensure it accesses the ICB.

The finding that CDK11p58 - and not the full-length CDK11p110 - regulates cytokinesis supports the established functional subdivisions of CDK11. Numerous low-throughput studies have reported differences in substrate specificities amongst the three predominant CDK11 isoforms, which appear to account for the necessary differences in specificity required to influence disparate cellular processes143,290. The regulatory N-terminus of full-length CDK11 is not present in CDK11p58, which has been shown to drive CDK11 association with various splicing factors and chromatin-associated proteins147,296. Yet, as is the case with other CDKs, their associated cyclin partner largely determines substrate specificity27,48. In the publication towards which this p58 research substantially contributed, a CDK11 -cyclin L1β complex was shown to mediate the role of CDK11 in cytokinesis160. This result was surprising, given that previous research has suggested that the cell cycle-related roles of CDK11p58 are contingent on association with D type cyclins149,168.

Further studies should assess the contributions of L type cyclins to other incompletely studied aspects of CDK11p58 biology, including androgen- and vitamin D-receptor downregulation299,300. p58 Importantly, the discovery of the CDK11 -cyclin L1β complex can be leveraged in future work to narrow the field of potential CDK11 effectors in cytokinesis.

This work raises the question of what the precise function of CDK11 is in cytokinesis. Towards an answer to this question, I determined that CDK11 functions very late in cytokinesis, at the terminal stage of abscission. It is tempting to speculate that, given the well-documented roles of CDKs in overcoming cell cycle checkpoints2,27,48, CDK11 promotes abscission through opposing the Aurora B-mediated abscission checkpoint. Interestingly, the publication towards which this research contributed shows that CDK11 promotes abscission in opposition to persistent Aurora B activity in the ICB160. Thus, it would appear that CDK11 regulates abscission at some level other than Aurora B deactivation or degradation160.

If not directly silencing the checkpoint, it seems likely CDK11p58 promotes an antagonistic response. Since the abscission checkpoint is dependent on Aurora B-mediated inhibitory phosphorylations of CHMP4C, it is reasonable to posit that CDK11p58 promotes an increase in phosphatase activity to counter CHMP4C phosphorylation. This is in keeping with the well- established shift of the global balance between kinase and phosphatase activity towards phosphatases late in mitosis302. In fact, recent work has shown that PP1 is recruited to the stem body by Rap1-Interacting Factor 1 (RIF1), where it appears to counter the abscission checkpoint by dephosphorylating mono-phosphorylated CHMP4C to promote abscission281. However, this work fails to provide a complete description of the positive regulation of abscission. Firstly, its results imply that other (as yet unidentified) phosphatases contribute to dephosphorylation of mono-phosphorylated CHMP4C in addition to PP1. Second, it does not account for the dephosphorylation of fully(tri)-phosphorylated CHMP4C. Accordingly, future studies aiming to define the downstream effectors of CDK11p58 should not solely focus on PP1. The PP2A phosphatase in complex with B56 family adaptors appear an interesting candidate, as they have been shown to counter Aurora B in early mitotic processes301-305, and have been reported to interact with CHMP4B and C in the ICB307. Figure 2.11 shows CHMP4C phosphorylation sites in relation to nearby putative binding sites for the PP2A adaptor B56. Elucidating the molecular mechanism through which CDK11p58 promotes cytokinesis will constitute an important advance in the field.

Figure 2.11. CHMP4C Phosphoregulation. Cartoon depicting relative positioning of S210, S214, and S215 residues phosphorylated by Aurora B in addition to putative B56ε binding sites on CHMP4C. “N” and “C” denote N- and C-terminus respectively. Aurora B phosphorylates CHMP4C at the three serines shown on the cartoon to generate Triphosphorylated CHMP4C, which is abscission incompetent. Monophosphorylated CHMP4C is phosphorylated at the S210 residue only. The two closest (in primary sequence space) putative B56ε binding sites are shown here.

Chapter 3. Summary

The regulatory networks tightly controlling the cell cycle ensure faithful genome transmission from mother to daughter cell. Crucially, the final stages of cell division, cytokinesis, must be executed in an error-free manner to prevent aneuploidy and genome instability. Yet, little is understood about the regulation of the physical separation of daughter cells, in a process called abscission. In this thesis I have demonstrated that the cyclin-dependent kinase CDK11 is an abscission-promoting factor required for cytokinesis. Furthermore, I show that the kinase activity of the CDK11p58 isoform mediates its cytokinetic function. These findings place CDK11p58 as an important regulatory component of abscission, acting to promote the division process.

Chapter 4. Materials and Methods 4.1 Materials

4.1.1 Nucleic Acids 4.1.1.1 Plasmids

A full list of plasmids and associated cell lines used can be found in Supplementary Table 1.

4.1.1.2 Primers

A full list of primers used can be found in Supplementary Table 3.

All primers were sourced from Integrated DNA Technologies (IDT).

4.1.3 Bacterial Strains

For propagation of plasmids, Top 10 cells were used (genotype: F- mcrA Δ(mrr-hsdRMS- mcrBC) φ80lacZΔM15 ΔlacX74 recA1 araD139 Δ(ara-leu)7697 galU galK λ-rpsL(StrR) endA1 nupG.

E.coli Stellar cells were used for cloning (an HST08 strain, genotype: F-, endA1, supE44, thi-1, recA1, relA1, gyrA96, phoA, Φ80d lacZΔ M15, Δ(lacZYA-argF) U169, Δ(mrr-hsdRMS- mcrBC), ΔmcrA, λ-), supplied as part of the In-Fusion HD Cloning kit (Takarabio).

4.1.3 Kits and Reagents

All commercial kits and commonly used reagents are listed in Supplementary Table 4. 4.2 Generation of Stable Cell Lines

4.2.1 Plasmid Construction

The stable HA-tagged CDK11 cell lines described herein were generated by Dr. Andrew Wilde and Matthew Renshaw utilizing a ligation independent cloning (LIC) system. The various CDK11 constructs were amplified from a FLAG-mCdc2L vector generously gifted by Dr. Stephane Angers (University of Toronto) with primers containing LIC sequences. PCR reactions were performed in a PTC-2000 Thermal Cycler (MJ Research) and purified with the Gel/PCR DNA Fragments Extraction Kit (Geneaid) following the manufacturer’s protocol. Purified cDNA products were treated with T4 DNA polymerase (Invitrogen) to generate single stranded

overhangs on 5’ and 3’ ends. The following components are added into reaction in a final concentration of: 10-50ng/µl of DNA, 5%(v/v) T4 DNA polymerase, 1x T4 polymerase reaction buffer (Invitrogen), 2.5mM dTTP, and 5mM DTT. The reaction was incubated at room temperature for 30min and inhibited at 75°C for 20min in the presence of 10mM EDTA. The pcDNA5/FRT/TO/HA-N vector, modified to contain the LIC sequence, was linearized by restriction digest with FseI,(New England Biolabs) at 37°C for 60min follow by heat inactivation at 65°C for 20min. The linearized vector was then treated with T4 DNA polymerase in the presence of 2.5 mM dATP to generate single stranded overhangs. Respective cDNAs and vector were then mixed and incubated for 10 min at room temperature in the presence of 40 mM EDTA. The ligation reaction was then heated to 75°C and cooled slowly back to room temperature. This reaction was directly transformed into Top10 bacterial cells. Following plasmid addition, the bacteria were incubated on ice for 20-30 min, followed by a 42°C heat-shock for 45 seconds, before resting on ice another 2-5 min. Cells were then diluted with 0.5-1mL pre-warmed SOC media and incubated at 37°C with shaking for 30-60 min prior to plating onto selective LB agar plates and left to grow overnight(s) at 37°C or room temperature. Colonies were picked and propagated before successful insertion was confirmed by restriction digest and sequencing (ACTG Corporation).

4.2.2 Stable Cell Line Transfection and Selection

The FRT vectors described above were transfected into HeLa Flp-In Host cell lines (Thermo Fischer) produced following manufacturer’s instructions by Dr. Andrew Wilde. The transfection solution consisted of: 2.5 ug FRT plasmid, 0.5 ug pOG44 plasmid (encoding the Flp- Recombinase), 7.5 uL Lipofectamine 2000 (Invitrogen), and 200 uL OptiMEM media (Sigma). This solution was mixed vigorously and incubated at room temperature for 20 min. This solution was then added to 60-80% confluent well of HeLa FRT cells in a 6-well plate with 1.25 mL

DMEM (Sigma). Cells were then incubated at 37°C (5% CO2) for 8 hours, at which point the media was replaced. Selection of successful integrations was achieved by treatment with 200 ug/ml hygromycin B (BioShop).

4.3 Cell Culture and RNAi Transfection

HeLa (human cervical cancer) cells were cultured in DMEM with 10% FBS and 1% Penicillin-

Streptomycin and maintained in a 37°C incubator with 5% CO2. For RNAi transfections,selective 50

media was removed and replaced with 1.25mL DMEM with FBS. 60-100 nM of RNAi was mixed with 125 uL OptiMEM, while 5 uL Lipofectamine 2000 was mixed with 125 uL OptiMEM in separate tubes and both were incubated at room temperature for 5 minutes. Following this, the contents of the two tubes were mixed vigorously and incubated at room temperature for 20 min. Lastly, this solution was added to a well of cells and left to incubate at

37°C (5% CO2) for 8-24 hours before replacing media. RNAi for CDK11 (5’- gcaugcuagagugaaagaaagagag-3’) was targeted to a region within the CDK11 coding sequence; the negative control RNAi (NC1, IDT) used was (5’- cguuaaucgcguauaauacgcguat-3’). For synchronization experiments, cells were arrested in pro-metaphase by incubation in 100µM monastrol (Sigma) for 16 hours. For rescue experiments, the RNAi resistant CDK11 isoforms (HA-p110WT, HA-p58WT, HA-p110MA or HA-p58DN) were expressed 24-32 hours after siRNA transfection; live cell imaging or cell fixation was then carried out 48 hours post- transfection. Induction of CDK11 transgene expression was achieved by incubation of cells with 1-5 ug/mL doxycycline for 24 hours.

4.4 Immunostaining and Microscopy

4.4.1 Fixation and Staining

Cells cultured on glass coverslips thickness No.1 1⁄2, size 22 x 22mm (Electron Microscopy Services or Globe Scientific) were stained after fixation with either ice cold 10% TCA buffered in cytoskeleton buffer (CB, 10mM MES pH 6.1, 138mM KCl, 3mM MgCl, 2mM EGTA, 0.32M Sucrose), 4% paraformaldehyde buffered in PBS or 100% methanol. Following fixation, cells were washed with PBS after which they were blocked with 3% BSA in PBS for at least 1 hour at room temperature. Primary antibodies were diluted in PBS and applied on the cell-side of the fixed coverslips inside a humid chamber for at least 1 hour, or overnight at 4°C. Primary antibodies used in this study were: mouse anti-tubulin (DM1A, Sigma used at 1:1000), rabbit anti-CDK11 (ab19393, AbCam used at 1:1000), mouse anti-HA(12CA5 used at 1:1000), rabbit anti-tubulin (ab18251, AbCam used at 1:1000), and mouse anti-acetylated tubulin (sc-23950, Santa Cruz used at 1:1000). After multiple PBS washes, cells were stained with fluorophore- conjugated secondary antibodies (ThermoFisher) in the same humidified chamber. 10 min prior to mounting, 5 ug/mL Hoechst was added drop wise on top of coverslip. Coverslips were mounted onto glass slides with Mowiol (Fluka).

4.4.2 Fixed Image Acquisition

Imaging was performed on a Nikon TE2000 inverted confocal spinning disc microscope with a x60/1.4 NA oil-immersion objective lens and 1.515 immersion oil (Nikon) at room temperature. Images were acquired using Metamorph software (Molecular Devices) driving an electron multiplying CCD camera (ImagEM, Hammamatsu). Z sections (0.2µm apart) were collected to produce a stack that was then imported into Autoquant X2 or X3 (Media Cybernetics) and subjected to 3D Deconvolution (10-15 iterations). Maximum projections were processed in Metamorph or ImageJ324. Individual channels were overlaid, rotated and cropped in either GIMP v2.8.4 or ImageJ.

4.4.3 Live Imaging Cells cultured on circular glass coverslips, thickness No. 1, diameter 25mm (Fisher Scientific) were treated as indicated and mounted in a heated chamber containing air-5% CO2 atmosphere at 37°C (Live Cell Instrument Systems) in dye-free DMEM with 10% fetal bovine serum (Invitrogen) mounted on a Nikon TE2000 inverted microscope equipped with a spinning disk confocal scanning head driven by Metamorph software as described above. Time lapse video microscopy was used to follow cells with a stack of images (z-step 0.6µm) taken every 5 minutes using a x40/1.0 NA PlanApo oil-immersion objective lens and 1.515 immersion oil (Nikon). Acquired images were then processed as previously described.

4.5 Western Blotting

Media was removed from cells growing in 6-well plates, after which they were washed with pre- warmed PBS. Cells were incubated on ice for 15-30 minutes with 50-100 uL RIPA buffer (20 mM Tris-HCl (pH 7.5),150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% NP-40, 1 ug/ml leupeptin, and 1 ug/ml aprotinin) after which they were mechanically lysed with a cell scraper. Lysate was transferred to a pre-chilled tube and spun at 13,000 g for 10 min at 4°C. Supernatant was removed and mixed with 4X SDS loading buffer before boiling at 95°C for 5 min. 5-10 uL of this mixture was applied to a 8% polyacrylamide gel, which was run at 120V for 2-3 hours (BioRad). The gel was then compressed against a nitrocellulose membrane (BioRad) in a cassette and loaded into a transfer box (FisherBrand), which was run at 400 mA for 90 min. The membrane was extracted, washed with TBST, after which it was blocked in 5% skim milk powder (Nestle) in TBST at 4°C for 16 hours. The blocking solution was removed, the 52

membrane washed for 5min with TBST three times, and rabbit anti-CDK11 antibody (Abcam, ab19393) diluted 1:1000 in TBST was incubated with the membrane for 1hour at room temperature with gentle shaking. The membrane was again washed as described, then incubated with HRP-conjugated anti-rabbit secondary (Sigma) at 1:2500 in TBST for 1 hour at room temperature with gentle shaking and protected from light. After removal of the secondary, the membrane was again washed as described before incubation with ECL Western Blotting Detection Reagent (GE Healthcare) and immediate imaging on a ChemiDoc Imaging System (BioRad).

4.6 Real Time Quantitative Polymerase Chain Reaction (RT-qPCR)

HeLa cells in 6-well dishes were transfected with CDK11 RNA or negative-control RNA (Integrated DNA Technologies) as previously described. Cells were harvested forty-eight hours later for RNA extraction. Total RNA was extracted using Nucleozol (Machery-Nagel) according to the manufacturer’s instructions. One microgram of total RNA was treated with 0.5 units of DNase I (New England Biolabs) for 15 mins following manufacturer’s instructions. RT-qPCR was performed with 1 µl of a 1:10 dilution of DNase I-digested RNA, with oligos listed in Supplementary Table 2, using the Luna Universal qPCR Master Mix (New England Biolabs) in a total reaction volume of 20 µl in a Bio-Rad MyIQ2 Real-Time System (Bio-Rad). The relative mRNA expression level was derived from 2-ΔΔCT by use of the comparative threshold cycle (CT) method. The amount of CDK11 mRNA in each sample was normalized to the amount of actin mRNA.

4.7 Statistical Analyses

All experiments were repeated at least three times and statistical analyses were conducted using either R v3.0.1 (R Foundation for Statistical Computing) or JASP v0.13.1(JASP Team). To determine statistical significance, unpaired t tests were performed using the R function t.test and error bar depict the standard deviation, Fisher's Exact tests were done using fisher.test and ANOVAs were done using aov followed by Tukey's post-test with TukeyHSD. A p-value of <0.05 was considered statistically significant. Data was tested for normality with Shapiro-Wilks tests using the R function shapiro.test.

References 1. Harashima, H. et al. Cell Cycle Control across the Eukaryotic Kingdom. Trends Cell Biol. 23, 345-56 (2013). 2. Malumbres, M. & Barbacid, M. Cell cycle kinases in cancer. Curr Opin Genet Dev. 17, 60- 5 (2007). 3. Poon, R.Y. Cell Cycle Control: A system of interlinking oscillators. Methods Mol Biol. 1342, 3-19 (2016). 4. Urbán, N. & Blomfield I.M. & Guillemot, F. Quiescence of Adult Mammalian Neural Stem Cells: a Highly Regulated Rest. Neuron. 104, 834-48 (2019). 5. Murray, A. Cell cycle checkpoints. Curr Opin Cell Biol. 6, 872-6 (1994). 6. Hayward, D. & Alfonso-Perez, T. & Gruneberg, U. Orchestration of the spindle assembly checkpoint by CDK1-Cyclin B1. FEBS Lett. 593, 2889-907 (2019). 7. Raymond, C. et al. Chromatin meets the cell cycle. J Exp Bot. 65, 2677-89 (2014). 8. Kapoor, T.M. Metaphase spindle assembly. Biology (Basel). 6 (2017). 9. Glotzer, M. Cytokinesis in metazoan and fungi. Cold Spring Harb Perspect Biol. 6, (2017). 10. Théry, M. & Bornens, M. Get round and stiff for mitosis. HFSP J. 2, 65-71 (2008). 11. Gerien, K.S. & Wu, J.Q. Molecular mechanisms of contractile ring constriction and membrane trafficking in cytokinesis. Biophys Rev. 10, 1049-66 (2018). 12. Green, R.A. & Paluch, E. & Oegema, K. Cytokinesis in animal cells. Annu Rev Cell Dev Biol. 28, 29-58 (2012). 13. Renshaw, M.J. et al. Anillin-dependent organization of septin filaments promotes intercellular bridge elongation and Chmp4B targeting to the abscission site. Open Biol. (2014). 14. Russell, P. & Nurse, P. Schizosaccharomyces pombe and Saccharomyces cerevisiae: a look at yeasts divided. Cell. 45, 781-2 (1986). 15. Draetta, G. et al. Identification of p34 and p13, human homologs of the cell cycle regulators of fission yeast encoded by cdc2C and suc1C. Cell. 50, 319-25 (1987). 16. Lee, M.G. & Nurse, P. Complementation used to clone human homologue of the fission yeast cell cycle control gene cdc2. Nature. 327, 31-5 (1987). 17. Meyerson, M. et al. A family of cdc2-related protein kinases. EMBO J. 11, 2909-17 (1992).

18. Evans, T. et al. Cyclin: a protein specified by maternal mRNA in sea urchin eggs that is destroyed at each cleavage division. Cell. 33, 389-96 (1983). 19. Hunt, T. Maturation promoting factor, cyclin and the control of M-phase. Curr Opin Cell Biol. 1, 268-74 (1989). 20. Nurse, P. Universal control mechanism regulating onset of M-phase. Nature. 344, 503-8 (1990). 21. Lim, S. & Kaldis, P. Cdks, cyclins and CKIs: roles beyond cell cycle regulation. Development. 140, 3079-93 (2013). 22. Pearson, R.B. & Kemp, B.E. Protein kinase phosphorylation site sequences and consensus specificity motifs: tabulations. Methods Enzymol. 200, 62-81 (1991). 23. Songyang, Z. et al. Use of an oriented peptide library to determine the optimal substrates of protein kinases. Curr Biol. 4, 973-82 (1994). 24. Songyang, Z. et al. A structural basis for substrate specificities of protein Ser/Thr kinases: primary sequence preference of casein kinases I and II, NIMA, phosphorylase kinase, calmodulindepenedent kinase II, CDK5, and Erk1. Mol Cell Biol. 16, 6486-93 (1996). 25. Morgan, D.O. Principles of CDK regulation. Nature. 374, 131-4 (1995). 26. Atherton-Fessler, S. et al. Mechanisms of p34cdc2 regulation. Mol Cell Biol. 13, 1675-85 (1993). 27. Malumbres, M. Cyclin-dependent kinases. Genome Biol. 15, (2014). 28. Quandt, E. Ribeiro, M.P.C. Clotet, J. Atypical cyclins: the extended family portrait. Cell Mol Life Sci. 77, 231-42 (2020). 29. Echalier, A. & Endicott, J.A. & Noble, M.E. Recent developments in cyclin-dependent kinase biochemical and structural studies. Biochim Biophys Acta. 1804, 511-9 (2010). 30. Bartova, I. et al. Activation and inhibition of cyclin-dependent kinase-2 by phosphorylation; a molecular dynamics study reveals the functional importance of the glycine-rich loop. Protein Sci. 13, 1449-57 (2004). 31. Mani, S. et al. Cyclin-dependent kinase inhibitors: novel anticancer agents. Expert Opin Investig Drugs. 9, 1849-70 (2000). 32. Roskoski Jr., R. Cyclin-dependent protein serine/threonine kinase inhibitors as anticancer drugs. Pharmacol Res. 139, 471-88 (2019). 33. Nakayama, K.I. & Nakayama, K. Ubiquitin ligases: cell-cycle control and cancer. Nat Rev Cancer. 6, 369-81 (2006). 55

34. Bassermann, F. & Eichner, R. & Pagano, M. The ubiquitin proteasome system – implications for cell cycle control and the targeted treatment of cancer. Biochim Biophys Acta. 1843, 150-62 (2014). 35. Jeffrey, P.D. & Tong, L. & Pavletich, N.P. Structural basis of inhibition of CDK-cyclin complexes by INK4 inhibitors. Genes Dev. 14, 3115-25 (2000). 36. Pavletich, N.P. Mechanisms of cyclin-dependent kinase regulation: structures of Cdks, their cyclin activators, and Cip and INK4 inhibitors. J Mol Biol. 287, 821-8 (1999). 37. Arooz, T. et al. On the concentrations of cyclins and cyclin-dependent kinases in extracts of cultured human cells. Biochemistry. 39, 9494-501 (2000). 38. Morgan, D. Regulation of the APC and the exit from mitosis. Nat Cell Biol. 1, 47-53 (1999). 39. Clute, P. & Pines, J. Temporal and spatial control of cyclin B1 destruction in metaphase. Nat Cell Biol. 1, 82-7 (1999). 40. Brandeis, M. & Hunt, T. The proteolysis of mitotic cyclins in mammalian cells persists from the end of mitosis until the onset of S phase. EMBO J. 15, 5280-9 (1996).

41. Amon, A. & Irniger, S. & Nasmyth, K. Closing the cell cycle circle in yeast: G2 cyclin

proteolysis initiated at mitosis persists until the activation of G1 cyclins in the next cycle. Cell. 77, 1037-50 (1994). 42. Cornelis, S. et al. Identification and characterization of a novel cell cycle-regulated internal ribosome entry site. Mol Cell. 5, 597-605 (2000). 43. Tinton, S.A. et al. Regulation of the cell-cycle-dependent internal ribosome entry site of the PITSLRE protein kinase: roles of Unr (upstream of N-ras) protein and phosphorylated translation initiation factor eIF-2alpha. Biochem J. 385, 155-63 (2005). 44. Whittaker, S.R. et al. Inhibitors of cyclin-dependent kinases as cancer therapeutics. Pharmacol Ther. 173, 83-105 (2017). 45. Peyressatre, M. et al. Targeting cyclin-dependent kinases in human cancers: from small molecules to peptide inhibitors. Cancers (Basel). 7, 179-237 (2015). 46. Narasimha, A.M. et al. Cyclin D activates the Rb tumor suppressor by mono- phosphorylation. Elife. 3 (2014). 47. Trimarchi, J.M. & Lees, J.A. Sibling rivalry in the E2F family. Nat Rev Mol Cell Biol. 3, 11-20 (2002).

48. Malumbres, M. & Barbacid, M. Mammalian cyclin-dependent kinases. Trends Biochem Sci. 30, 630-41 (2005). 49. Malumbres, M. et al. Mammalian cells cycle without the D-type cyclin-dependent kinases Cdk4 and Cdk6. Cell. 118, 493-504 (2004). 50. Rubin, S.M. Deciphering the retinoblastoma protein phosphorylation code. Trends Biochem Sci. 38, 12-9 (2013).

51. Wang, C. et al. Signal transduction mediated by cyclin D1: from mitogens to cell proliferation: a molecular target with therapeutic potential. Cancer Treat Res. 119, 217-37 (2004). 52. Nelson, D.A. & Krucher, N.A. & Ludlow, J.W. High molecular weight protein phosphatase type 1 dephosphorylates the retinoblastoma protein. J Biol Chem. 272, 4528- 35 (1997). 53. Sherr, C.J. & McCormick, F. The RB and p53 pathways in cancer. Cancer Cell. 2, 103-12 (2002). 54. Levine, A.J. p53, the cellular gatekeeper for growth and division. Cell. 88, 323-31 (1997). 55. Giaccia, A.J. & Kastan, M.B. The complexity of p53 modulation: emerging patterns from divergent signals. Genes Dev. 12, 2973-83 (1998). 56. Masai, H. et al. Eukaryotic chromosome DNA replication: where, when and how? Annu Rev Biochem. 71, 89-130 (2010). 57. Matthews, L.A. & Guarne, A. Dbf4: the whole is greater than the sume of its parts. Cell Cycle. 12, 1180-8 (2013). 58. Kanemaki, M. & Labib, K. Distinct roles for Sld3 and GINS during establishment and progression of eukaryotic DNA replication forks. EMBO J. 25, 1753-63 (2006). 59. Hinchcliffe, E.H. & Sluder, G. “It takes two to tango”: understanding how centrosome duplication is regulated throughout the cell cycle. Genes Dev. 15, 1167-81 (2001). 60. Fu, J. & Hagan, I.M. & Glover, D.M. The centrosome and its duplication cycle. Cold Spring Harb Perspect Biol. 7 (2015). 61. Ferguson, R.L. & Maller, J.L. Cyclin E-dependent localization of MCM5 regulates centrosome duplication. J Cell Sci. 121, 3224-32 (2008). 62. Ferguson, R.L. & Pascreau, G. & Maller, J.L. The cyclin A centrosomal localization sequence recruits MCM5 and Orc1 to regulate centrosome reduplication. J Cell Sci. 123, 2743-9 (2010). 57

63. Coverley, D. & Laman, H. & Laskey, R.A. Distinct roles of cyclins E and A during DNA replication complex assembly and activation. Nat Cell Biol. 4, 523-8 (2002). 64. Copeland, N.A. et al. Cyclin A-CDK2-mediated phosphorylation of CIZ1 blocks replisome formation and initiation of mammalian DNA replication. J Cell Sci. 128, 1518-27 (2015). 65. Friedel, A.M. & Pike, B.L. & Gasser, S.M. ATR/Mec1: coordinating fork stability and repair. Curr Opin Cell Biol. 21, 237-44 (2009). 66. Cimprich, K.A. & Cortez, D. ATR: an essential regulator of genome integrity. Nat Rev Mol Cell Biol. 9, 616-27 (2008). 67. Furnari, B. & Rhind, N. & Russell, P. Cdc25 mitotic inducer targeted by chk1 DNA damage checkpoint kinase. Science. 277, 1495-7 (1997).

68. Peng, C.Y. et al. Mitotic and G2 checkpoint control: regulation of 14-3-3 protein binding by phosphorylation of Cdc25 on serine-216. Science. 277, 1501-5 (1997) 69. Sanchez, Y. et al. Conservation of the Chk1 checkpoint pathway in mammals: linkage of DNA damage to Cdk regulation through Cdc25. Science. 277, 1497-1501 (1997). 70. Fung, T.K. & Poon, R.Y. A roller coaster ride with the mitotic cyclins. Semin Cell Dev Biol. 16, 335-42 (2005). 71. Ma, H.T. & Poon, R.Y. How protein kinases co-ordinate mitosis in animal cells. Biochem J. 435, 17-31 (2011). 72. Lindqvist, A. & Rodriguez-Bravo, V. & Medema, R.H. The decision to enter mitosis: feedback and redundancy in the mitotic entry network. J Cell Bio. 185, 193-202 (2009). 73. van Vugt, M.A. & Medema, R.H. Getting in and out of mitosis with Polo-like kinase-1. Oncogene. 24, 2844-59 (2005). 74. Lens, S.M. & Voest, E.E. & Medema, R.H. Shared and separate functions of polo-like kinases and aurora kinases in cancer. Nat Rev Cancer. 10, 825-41 (2010). 75. Heim, A. & Rymarczyk, B. & Mayer, T.U. Regulation of Cell Division. Adv Exp Med Biol. 953, 83-116 (2017). 76. Santos, S.D. et al. Spatial positive feedback at the onset of mitosis. Cell. 149, 1500-13 (2012). 77. Jin, P. & Hardy, S. & Morgan, D.O. Nuclear localization of cyclin B1 controls mitotic entry after DNA damage. J Cell Biol. 141, 875-85 (1998). 78. Fourest-Lieuvin, A. et al. Microtubule regulation in mitosis: tubulin phosphorylation by the cyclin-depedent kinase Cdk1. Mol Biol Cell. 17, 1041-50 (2006). 58

79. Ookata, K. et al. MAP4 is the in vivo substrate for CDC2 kinase in HeLa cells: identification of an M-phase specific and a cell cycle-independent phosphorylation site in MAP4. Biochem. 36, 15873-83 (1997). 80. Blangy, A. et al. Phosphorylation by p34cdc2 regulates spindle association of human Eg5, a kinesin-related motor essential for bipolar spindle formation in vivo. Cell. 83, 1159-69 (1995). 81. Chen, Q. et al. Cyclin B1 is localized to unattached kinetochores and contributes to efficient microtubule attachment and proper chromosome alignment during mitosis. Cell Res. 18, 268-80 (2008). 82. Ruchaud, S. & Carmena, M.N. & Earnshaw, W.C. Chromosomal passengers: conducting cell division. Nat Rev Mol Cell Biol. 8, 798-812 (2007). 83. Maiato, H. et al. Mechanisms of Chromosome Congression during mitosis. Biology (Basel). 6 (2017). 84. Maia, A.R. et al. Cdk1 and Plk1 mediate a CLASP2 phospho-switch that stabilizes kinetochore-microtubule attachments. J Cell Biol. 199, 285-301 (2012). 85. Morgan, D. Regulation of the APC and the exit from mitosis. Nat Cell Biol. 1, 47-53 (1999). 86. Sivakumar, S. & Gorbsky, G.J. Spatiotemporal regulation of the anaphase-promoting complex in mitosis. Nat Rev Mol Cell Biol. 16, 82-94 (2015). 87. Kraft, C. et al. Mitotic regulation of the human anaphase-promoting complex by phosphorylation. EMBO J. 22, 6598-609 (2003). 88. Sivakumar, S. et al. The spindle and kinetochore-associated (Ska) complex enhances binding of the anaphase-promoting complex/cyclosome (APC/C) to chromosomes and promotes mitotic exit. Mol Biol Cell. 25, 594-605 (2014). 89. Shteinberg, M. et al. Phosphorylation of the cyclosome is required for its stimulation by Fizzy/cdc20. Biochem Biophys Res Commun. 260, 193-8 (1999). 90. London, N. & Biggins, S. Signaling dynamics in the spindle checkpoint response. Nat Rev Mol Cell Biol. 15, 736-47 (2014). 91. Oliveira, R.A. et al. Cohesin cleavage and Cdk inhibition trigger formation of daughter nuclei. Nat Cell Biol. 12, 185-92 (2010).

92. Sudakin, V. & Chan, G.K. & Yen, T.J. Checkpoint inhibition of the APC/C in HeLa cells is mediated by a complex of BUBR1, BUB3, CDC20, and MAD2. J Cell Biol. 154, 925-36 (2001). 93. Burton, J.L. & Solomon, M.J. Mad3p, a pseudosubstrate inhibitor of APCCdc20 in the spindle assembly checkpoint. Genes & Dev. 21, 655-67 (2007). 94. Han Joo, S. et al. Catalytic assembly of the mitotic checkpoint inhibitor BubR1-Cdc20 by a Mad2-induced functional switch in Cdc20. Mol Cell. 51, 92-104 (2013). 95. Izawa, D. & Pines, J. Mad2 and the APC/C compete for the same site on Cdc20 to ensure proper chromosome segregation. J Cell Biol. 199, 27-37 (2012). 96. Lau, D.T.C. & Murray, A.W. Mad2 and Mad3 cooperate to arrest budding yeast in mitosis. Curr Biol. 22, 180-90 (2012). 97. London, N. & Biggins, S. Signaling dynamics in the spindle checkpoint response. Nat Rev Mol Cell Biol. 15, 736-47 (2014). 98. Zhang, S. et al. Molecular mechanism of APC/C activation by mitotic phosphorylation. Nature. 533, 260-4 (2016). 99. Yamano, H. APC/C: current understanding and future perspectives. F1000 Res. 8 (2019). 100. Nasmyth, K. & Peters, J.M. & Uhlmann, F. Splitting the chromosome: cutting the ties that bind sister chromatids. Science. 288, 1379-85 (2000). 101. Fava, L.L. et al. Probing the in vivo function of Mad1:C-Mad2 in the spindle assembly checkpoint. EMBO J. 30, 3322-36 (2011). 102. London, N. et al. Phosphoregulation of Spc105 by Mps1 and PP1 regulates Bub1 localization to kinetochores. Curr Biol. 22, 900-6 (2012). 103. Rosenberg, J.S. & Cross, F.R. & Funabiki, H. KNL1Spc105 recruits PP1 to silence the spindle assembly checkpoint. Curr Biol. 21, 942-7 (2011) 104. Liu, D. et al. Regulated targeting of protein phosphatase 1 to the outer kinetochore by KNL1 opposes Aurora B kinase. J Cell Biol. 188, 809-20 (2010). 105. Meadows, J.C. et al. Spindle checkpoint silencing requires association of PP1 to both Spc7 and kinesin-8 motors. Dev Cell. 20, 739-50 (2011). 106. Cisek, L.J. & Corden, J.L. Phosphorylation of RNA polymerase by the murine homologue of the cell-cycle control protein cdc2. Nature. 339, 679-84 (1989). 107. Bartkowski, B. et al. CDK12 is a transcription elongation-associated CTD kinase, the metazoan ortholog of yeast Ctk1. Genes Dev. 24, 2303-16 (2010). 60

108. Blazek, D. et al. The Cyclin K/Cdk12 complex maintains genomic stability via regulation of expression of DNA damage response genes. Genes Dev. 25, 2158-72 (2011).

109. Cheng, S.W. et al. Interaction of cyclin-dependent kinase 12/CrkRS with cyclin K1 is required for the phosphorylation of the C-terminal domain of RNA polymerase II. Mol Cell Biol. 32, 4691-704 (2012). 110. Ganuza, M. et al. Genetic inactivation of Cdk7 leads to cell cycle arrest and induces premature aging due to adult stem cell exhaustion. EMBO J. 31, 2498-510 (2012). 111. Westerling, T. & Kuuluvainen, E. & Mäkelä, T.P. Cdk8 is essential for preimplantation mouse development. Mol Cell Biol. 27, 6177-82 (2007). 112. Li, T. et al. Failure to proliferate and mitotic arrest of CDK11 (p110/p58)-null mutant mice at the blastocyst stage of embryonic cell development. Mol Cell Biol. 24, 3188-97 (2004). 113. Firestein, R. et al. CDK8 is a colorectal cancer oncogene that regulates beta-catenin activity. Nature. 455, 547-51 (2008). 114. Knuesel, M.T. et al. The human CDK8 subcomplex is a molecular switch that controls Mediator coactivator function. Genes Dev. 23, 439-51 (2009). 115. Jiang, M. et al. Cyclin Y, a novel membrane-associated cyclin, interacts with PFTK1. FEBS Lett. 583, 2171-8 (2009). 116. Kasten, M. & Giordano, A. Cdk10, a Cdc2-related kinase, associates with the Ets2 transcription factor and modulates its transactivational activity. Oncogene. 20, 1832-8 (2001). 117. Iorns, E. et al. Identification of CDK10 as an important determinant of resistance to endocrine therapy for breast cancer. Cancer Cell. 13, 91-104 (2008). 118. Chen, S. et al. Cyclin-dependent kinases regulate epigenetic gene silencing through phosphorylation of EZH2. Nat Cell Biol. 12, 1108-14 (2010). 119. Zeng, X. & Chen, S. & Huang, H. Phosphorylation of EZH2 by CDK1 and CDK2: a possible regulatory mechanism of transmission of the H3K27me3 epigenetic mark through cell division. Cell Cycle. 10, 579-83 (2011).

120. Aggarwal, P. et al. Nuclear cyclin D1/CDK4 kinase regulates CUL4 expression and triggers neoplastic growth via activation of the PRMT5 methyltransferase. Cancer Cell. 18, 329-40 (2010).

121. Lavoie, G. & St-Pierre, Y. Phosphorylation of human DNMT1: implication of cyclin- dependent kinases. Biochem Biophys Res Commun. 409, 187-92 (2011). 122. Tudhope, S.J. A novel mechanism for regulating hepatic glycogen synthesis involving serotonin and cyclin-dependent kinase-5. Diabetes. 61, 49-60 (2012). 123. Zhao, X. et al. Regulation of lipogenesis by cyclin-dependent kinase 8-mediated control of SREBP-1. J Clin Invest. 122, 2417-27 (2012). 124. Calegari, F. & Huttner, W.B. An inhibition of cyclin-dependent kinase that lengthens, but does not arrest, neuroepithelial cell cycle induces premature neurogenesis. J Cell Sci. 116, 4947-55 (2003). 125. Lim, S. & Kaldis, P. Loss of Cdk2 and Cdk4 induces a switch from proliferation to differentiation in neural stem cells. Stem Cells. 30, 1509-20 (2012). 126. Su, S.C. & Tsai, L.H. Cyclin-dependent kinase in brain development and disease. Annu Rev Cell Dev Biol. 27, 465-91. 127. Mikolcevic, P. et al. Cyclin-dependent kinase 16/PCTAIRE kinase 1 is activated by cyclin Y and is essential for spermatogenesis. Mol Cell Biol. 32, 868-79 (2012). 128. Li, L. et al. Cdk1 interplays with Oct4 to repress differentiation of embryonic stem cells into trophectoderm. FEBS Lett. 586, 4100-7 (2012b). 129. Song, A. et al. Phosphorylation of nuclear MyoD is required for its rapid degradation. Mol Cell Biol. 18, 4994-9 (1998). 130. Su, S.C. & Tsai, L.H. Cyclin-dependent kinases in brain development and disease. Annu Rev Cell Dev Biol. 27, 465-91 (2011). 131. Tsai, L.H. et al. p35 is a neural-specific regulatory subunit of cyclin-dependent kinase 5. Nature. 371, 419-23 (1994). 132. Ohshima, T. et al. Targeted disruption of the cyclin-dependent kinase 5 gene results in abnormal corticogenesis, neuronal pathology and perinatal death. Proc Natl Acad Sci USA. 93, 11173-8 (1996). 133. Nikolic, M. et al. The Cdk5/p35 kinase is essential for neurite outgrowth during neuronal differentiation. Genes Dev. 10, 816-25 (1996). 134. Nguyen, C. & Bibb, J.A. Cdk5 and the mystery of synaptic vesicle endocytosis. J Cell Biol. 163, 697-9 (2003).

135. Chergui, K. & Svenningsson, P. & Greeengard, P. Cyclin-dependent kinase 5 regulates dopaminergic and glutamatergic transmission in the striatum. Proc Natl Acad Sci USA. 101, 2191-6 (2004). 136. Mikolcevic, P. et al. Cyclin-dependent kinase 16/PCTAIRE kinase 1 is activated by cyclin Y and is essential for spermatogenesis. Mol Cell Biol. 32, 868-79 (2012). 137. Xiang, J. et al. Molecular cloning and expression of alternatively spliced PITSLRE protein kinase isoforms. J Biol Chem. 269, 15786-94 (1994). 138. Loyer, P. et al. The RNP protein, RNPS1, associates with specific isoforms of the p34cdc2-related PITSLRE protein kinase in vivo. J Cell Sci. 111, 1495-506 (1998). 139. Trembley, J.H. et al. PITSLRE p110 protein kinase associates with transcription complexes and affect their capacity. J Biol Chem. 277, 2589-96 (2002). 140. Hu, D. et al. Cdk11 complexes promote pre-mRNA splicing. J Biol Chem. 278, 8623-9 (2003). 141. Gururajan, R. et al. Duplication of a genomic region containing the Cdc2L1-2 and MMP21-22 genes on human chromosome 1p36.3 and their linkage to D1Z2. Genome Res. 8, 929-39 (1998). 142. Lahti, J. et al. Alterations in the PITSLRE protein kinase gene complex on chromosome 1p36 in childhood neuroblastoma. Nat Genet. 7, 370-5 (1994). 143. Zhou, Y. et al. The emerging roles and therapeutic potential of Cdk11 in human cancers. Oncotarget. 7, 40846-59 (2016). 144. Pak, V. et al. CDK11 in TREX/THOC regulates HIV mRNA 3’ end processing. Cell Host Microbe. 18, 560-70 (2015). 145. Bajic, V.P. et al. Mislocalization of CDK11/PITSLRE, a regulator of the G2/M phase of the cell cycle, in Alzheimer’s disease. Cell Mol Biol Lett. 16, 359-72 (2011). 146. Bunnell, B.A. et al. Increased expression of a 58kDa protein kinase leads to changes in the CHO cell cycle. Proc Natl Acad Sci USA. 87, 7467-71 (1990). 147. Trembley, J.H. et al. Cyclin dependent kinase 11 in RNA transcription and splicing. Prog Nucleic Acid Res Mol Biol. 77, 263-88 (2004). 148. Feng, Y. et al. Death-signal-induced relocalization of cyclin-dependent kinase 11 to mitochondria. Biochem J. 392, 65-73 (2005). 149. Zhang, S. et al. Interaction of p58PITSLRE, a G2/M-specific protein kinase, with cyclin D3. J Biol Chem. 277, 35314-22 (2002). 63

150. Dickinson, L.A. et al. Cyclin L is an RS domain protein involved in pre-mRNA splicing. J Biol Chem. 277, 25465-73 (2002). 151. Sanford, J.R. & Brazik, J.P. Regulation of SR protein localization during development. Proc Natl Acad Sci USA. 98, 10184-9 (2001). 152. Tian, H. & Kole, R. Strong RNA splicing enhancers identified by a modified method of cycled selection interact with SR protein. J Biol Chem. 276, 33833-9 (2001). 153. Loyer, P et al. Characterization of cycin L1 and L2 interactions with CDK11 and splicing factors. J Biol Chem. 283, 7721-32 (2008). 154. de Graaf, K. et al. Characterization of Cyclin L2, a novel cyclin with an Arginine/Serine- rich domain. J Biol Chem. 279, 4612-24 (2004). 155. Sachs, N.A. & Vaillancourt, R.R. Cyclin-dependent kinase 11(p110) activity in the absence of CK2. Biochim Biophys Acta. 1624, 98-108 (2003). 156. Choi, H.H. et al. CHK2 kinase promotes pre-mRNA splicing via phosphorylating CDK11(p110). Oncogene. 33, 108-15 (2014). 157. Feng, Y. et al. The cyclin-dependent kinase 11 interacts with 14-3-3 proteins. Biochem Biophys Res Commun. 331, 1503-9 (2005). 158. Fu, H. & Subramanian, R.R. & Masters, S.C. 14-3-3 proteins: structure, function, and regulation. Annu Rev Pharmacol Toxicol. 40, 617-47 (2000). 159. Muslin, A.J. & Xing, H. 14-3-3 proteins: regulation of subcellular localization by molecular interference. Cell Signal. 12, 703-9 (2000). 160. Renshaw, M.J. et al. CDK11p58-cyclin L1β regulates abscission site assembly. J Biol Chem. 294, 18639-49 (2019). 161. Blencome, B.J. et al. SR-related proteins and the processing of messenger RNA precursors. Biochem Cell Biol. 77, 277-91 (1999). 162. Fukumura, K. & Inoue, K. & Mayeda, A. Splicing activator RNPS1 suppresses errors in pre-mRNA splicing: a key factor for mRNA quality control. Biochem Biophys Res Commun. 496, 921-6 (2018). 163. Solier, S. et al. Death receptor-induced activation of the Chk2- and histone H2AX- associated DNA damage response pathways. Mol Cell Biol. 29, 68-82 (2009). 164. Bartek, J. & Falck, J. & Lukas, J. CHK2 kinase – a busy messenger. Nat Rev Mol Cell Biol. 2, 877-86 (2001).

165. Trembley, J.H. et al. Casein kinase 2 interacts with cyclin-dependent kinase 11 (CDK11) in vivo and phosphorylates both the RNA polymerase II carboxy-terminal domain and CDK11 in vitro. J Biol Chem. 278, 2265-70 (2003). 166. Cornelis, S. et al. Identification and characterization of a novel cell cycle-regulated internal ribosome entry site. Mol Cell. 5, 597-605 (2000). 167. Tinton, S.A. et al. Regulation of the cell-cycle-dependent internal ribosome entry site of the PITSLRE protein kinase: roles of Unr (upstream of N-ras) protein and phosphorylated translation initiation factor eIF-2alpha. Biochem J. 385, 155-63 (2005). 168. Chi, Y. et al. Thr-370 is responsible for CDK11p58 autophosphorylation, dimerization, and kinase activity. J Biol Chem. 286, 1748-57 (2011). 169. Shatsky, I.N. et al. Cap-Independent translation: what’s in a name? Trends Biochem Sci. 43, 882-95 (2018). 170. Huang, J.T. & Schneider, R.J. Adenovirus inhibition of cellular protein synthesis involves inactivation of cap-binding protein. Cell. 65, 271-80 (1991). 171. Yokoyama, H. et al. Cdk11 is a RanGTP-dependent microtubule stabilization factor that regulates spindle assembly rate. J Cell Biol. 180, 867-75 (2008). 172. Petretti, G. et al. The PITSLRE/CDK11p58 protein kinase promotes centrosome maturation and bipolar spindle formation. EMBO Rep. 7, 418-24 (2006). 173. Franck, N. et al. CDK11(p58) is required for centriole duplication and Plk4 recruitment to mitotic centrosomes. PLOS One. 6, (2011). 174. Hu, D. et al. CDK11(p58) is required for the maintenance of sister chromatid cohesion. J Cell Sci. 120, 2424-34 (2007). 175. Dracopoli, N.C. et al. Loss of alleles from the distal short arm of chromosome 1 occurs late in melanoma tumor progression. Proc Natl Acad Sci USA. 86, 4614-8 (1989). 176. Beyaert, R. et al. Cleavage of PITSLRE kinases by ICE/CASP-1 and CPP32/CASP-3 during apoptosis induced by tumor necrosis factor. J Biol Chem. 272, 11694-7 (1997). 177. Ariza, M.E. et al. Fas-induced apoptosis in human malignant melanoma cell lines is associated with the activation of p34cdc2-related PITSLRE protein kinases. J Biol Chem. 274, 28505-13 (1999). 178. Lahti, J.M. et al. PITSLRE protein kinase activity is associated with apoptosis. Mol Cell Biol. 15, 1-11 (1995).

179. Chen, S. et al. The C-terminal kinase domain of the p34cdc2-related PITSLRE protein kinase (p110C) associates with p21-activated kinase 1 and inhibits its activity during anoikis. J Biol Chem. 278, 20029-36 (2003). 180. Tang, D. & Gururajan, R. & Kidd, V.J. Phosphorylation of PITSLRE p110 isoforms accompanies their processing by caspases during Fas-mediated cell death. J Biol Chem. 273, 16601-7 (1998). 181. Masutani, M. et al. Reconstitution reveals the functional core of mammalian eIF3. EMBO J. 26, 3373-83 (2007). 182. Shi, J. et al. The p34cdc2-related cyclin-dependent kinase 11 interacts with the p47 subunit of eukaryotic initiation factor 3 during apoptosis. J Biol Chem. 278, 5062-71 (2003). 183. Shi, J. & Hershey, J.W.B. & Nelson, M.A. Phosphorylation of the eukaryotic initiation factor 3f by cyclin-dependent kinase 11 during apoptosis. FEBS Lett. 583, 971-7 (2009). 184. Nelson, M.A. et al. Abnormalities in the p34cdc2-related PITSLRE protein kinase gene complex (CDC2L) on chromosome band 1p36 in melanoma. Cancer Genet Cytogenet. 108, 91-9 (1999). 185. Dave, B.J. et al. Deletion of cell division cycle 2-like 1 gene locus on 1p36 in non-Hodgkin lymphoma. Cancer Genet Cytogenet. 108, 120-6 (1999). 186. Perlman, E.J. et al. Deletion of 1p36 in childhood endodermal sinus tumors by two-color fluorescence in situ hybridization: a pediatric oncology group study. Genes Chromosomes Cancer. 16, 15-20 (1996). 187. Zhou, Y. et al. Cyclin-dependent kinase 11(p110) (CDK11(p110)) is crucial for human breast cancer cell proliferation and growth. Sci Rep. 5, 104333 (2015). 188. Kren, B.T. et al. Preclinical evaluation of cyclin dependent kinase 11 and casein kinase 2 survival kinases as RNA interference targets for triple negative breast cancer therapy. Breast Cancer Res. 17, 19 (2015). 189. Torre, L.A. et al. Global cancer statistics. Cancer J Clin. 65, 87-108 (2014). 190. Ahmed, R. L. et al. CDK11 loss induces cell cycle dysfunction and death of BRAF and NRAS melanoma cells. Pharmaceuticals (Basel). 12, (2019). 191. Tiedemann, R.E. et al. Identification of molecular vulnerabilities in human multiple myeloma cells by RNA interference lethality screening of the druggable genome. Cancer Res. 72, 757-68 (2012).

192. Tiedemann, R.E. et al. Kinomewide RNAi studies in human multiple myeloma identify vulnerable kinase targets including, including a lymphoid-restricted kinase, GRK6. Blood. 115, 1594-604 (2010). 193. Feng, Y. et al. Targeting CDK11 in osteosarcoma cells using the CRISPR-Cas9 system. J Ortho Res. 33, 199-207 (2015). 194. Du, Y. et al. CDK11p110 plays a critical role in the tumorigenicity of esophageal squamous cell carcinoma cells and is a potential drug target. Cell Cycle. 18, 452-66 (2019). 195. Duan, Z. et al. Systematic kinase shRNA screening identifies CDK11 (PITSLRE) kinase expression is critical for osteosarcoma cell growth and proliferation. Clin Cancer Res. 18, 4580-8 (2012). 196. Jia, B. et al. Cyclin-dependent kinase 11 (CDK11) is crucial in the growth of liposarcoma cells. Cancer Lett. 342, 104-12 (2014). 197. Liu, X. et al. Cyclin-dependent kinase 11 (CDK11) is required for ovarian cancer cell growth in vitro and in vivo, and its inhibition sensitizes cells to Paclitaxel. Mol Cancer Ther. 15, 1691-701 (2016). 198. Peterlin, B.M. & Price, D.H. Controlling the elongation phase of transcription with P- TEFb. Mol Cell. 23, 297-305 (2006). 199. Zhou, M. et al. The Tat/TAR-dependent phosphorylation of RNA polymerase II C-terminal domain stimulates cotranscriptional capping of HIV-1 mRNA. Proc Natl Acad Sci USA. 100, 12666-71 (2003). 200. Berro, R. et al. CDK13, a new potential human immunodeficiency virus type 1 inhibitory factor regulating viral mRNA splicing. J Virol. 82, 7155-66 (2008). 201. Yu, W. et al. Cyclin T1-dependent genes in activated CD4 T and macrophage cell lines appear enriched in HIV-1 co-factors. PLOS ONE. 3, e3146 (2008). 202. Valente, S.T. et al. HIV-1 mRNA 3’ end processing is distinctively regulated by eIF3f, CDK11, and splice factor 9G8. Mol Cell. 36, 279-89 (2009). 203. Takaki, T. et al. The Structure of CDK4/cyclin D3 has implications for models of CDK activation. Proc Natl Acad Sci USA. 106, 4171-6 (2009). 204. Day, P.J. et al. Crystal structure of human CDK4 in complex with a D-type cyclin. Proc Natl Acad Sci USA. 106, 4166-70 (2009). 205. Welburn, J.P.I. et al. How tyrosine 15 phosphorylation inhibits the activity of cyclin- dependent kinase 2-cyclin A. J Biol Chem. 282, 3173-81 (2007). 67

206. Yang, V.W. The Cell Cycle. In: Physiology of the Gastrointestinal Tract, 6th edition (H.M. Said, 2018). 207. Spoerri, L. et al. Cell cycle checkpoint and DNA damage response defects as anticancer targets: from molecular mechanisms to therapeutic opportunities. In: Stress Response Pathways in Cancer (Springer, 2015). 208. Rieder, C.L. & Khodjakov, A. Mitosis through the microscope: advances in seeing inside live dividing cells. Science. 300, 91-6 (2003). 209. Fededa, J.P. & Gerlich, D.W. Molecular control of Animal Cell Cytokinesis. Nat Cell Biol. 14, 440-7 (2012). 210. Bathe, M. & Cheng, F. Cytokinesis and the contractile ring in fission yeast: towards a systems-level understanding. Trends Microbiol. 18, 38-45 (2010). 211. Pollard, T.D. & Wu, J.Q. Understanding cytokinesis: lessons from fission yeast. Nat Rev Mol Cell Biol. 11, 149-55 (2010). 212. Smerlenko, A. et al. Plant cytokinesis: terminology for structures and processes. Trends Cell Biol. 27, 885-94 (2017). 213. Ganem, N.J. & Storchova, Z. & Pellman, D. Tetraploidy, Aneuploidy and Cancer. Curr Opin Genet Dev. 17, 157-62 (2007). 214. Fujiwara, T. et al. Cytokinesis failure generating tetraploids promotes tumorigenesis in p53-null cells. Nature. 437, 1043-7 (2005). 215. Lens, S.M.A. & Medema, R.H. Cytokinesis defects and cancer. Nat Rev Cancer. 19, 32-45 (2019). 216. Weaver, B.A. & Cleveland, D.W. Aneuploidy: instigator and inhibitor of tumorigenesis. Cancer Res. 67, 10103-5 (2007). 217. de Bruin, E.C. et al. Spatial and temporal diversity in genomic instability processes defines lung cancer evolution. Science. 346, 251-6 (2014). 218. Lv, L. et al. Tetraploid cells from cytokinesis failure induce aneuploidy and spontaneous transformation of mouse ovarian surface epithelial cell. Cell Cycle. 11, 2864-75 (2012). 219. Wurzenberger, C. & Gerlich, D.W. Phosphatases: providing safe passage through mitotic exit. Nat Rev Mol Cell Biol. 12, 469-82 (2011). 220. Glotzer, M. The 3Ms of central spindle assembly: microtubules, motors, and MAPs. Nat Rev Mol Cell Biol. 10, 9-20 (2009).

221. Euteneuer, U. & McIntosh, J.R. Polarity of the midbody and phragmoplast microtubules. J Cell Biol. 87, 509-15. 222. Zhu, C. et al. Spatiotemporal control of spindle midzone formation by PRC1 in human cells. Proc Natl Acad Sci USA. 13, 6196-201 (2006). 223. Hu, C.K. et al. KIF4 regulates midzone length during cytokinesis. Curr Biol. 21, 815-24 (2011). 224. Hutterer, A. & Glotzer, M. & Mishima, M. Clustering of centralspindlin is essential for its accumulation to the central spindle and the midbody. Curr Biol. 19, 2043-9 (2009). 225. Mishima, M. et al. Cell cycle regulation of central spindle assembly. Nature. 430, 908-13 (2004). 226. Guse, A. & Mishima, M. & Glotzer, M. Phosphoregulation of ZEN-4/MKLP1 by Aurora B regulates completion of cytokinesis. Curr Biol. 15, 778-86 (2005). 227. Douglas, E. et al. Aurora B and 14-3-3 coordinately regulate clustering of centralspindlin during cytokinesis. Curr Biol. 20, 927-33 (2010). 228. Hummer, S. & Mayer, T.U. Cdk1 negatively regulates midzone localization of the mitotic kinesin Mklp2 and the chromosomal passenger complex. Curr Biol. 19, 607-12 (2009). 229. Ban, R. et al. Human mitotic spindle-associated protein PRC1 inhibits MgcRacGAP activity toward Cdc42 during the metaphase. J Biol Chem. 279, 16394-402 (2004). 230. Lewellyn, L. et al. The chromosomal passenger complex and centralspindlin independently contribute to contractile ring assembly. J Cell Biol. 193, 155-69 (2011). 231. Hu, C.K. et al. KIF4 regulates midzone length during cytokinesis. Curr Biol. 21, 815-24 (2011). 232. Severson, A.F. & Baillie, D.L. & Bowerman, B. A formin homology protein and a profilin are required for cytokinesis and Arp2/3-independent assembly of cortical microfilaments in C. elegans. Curr Biol. 12, 2066-75 (2002). 233. Watanabe, S. et al. mDia2 induces the actin scaffold for the contractile ring and stabilizes its position during cytokinesis in NIH 3T3 cells. Mol Biol Cell. 19, 2328-38 (2008). 234. Chen, A. et al. Cytokinesis requires localized β-actin filament production by an actin isoform specific nucleator. Nat Comm. 8, 1530 (2017). 235. Matsumura, F. Regulation of myosin II during cytokinesis in higher eukaryotes. Trends Cell Biol. 15, 371-7 (2005).

236. Yuce, O. & Piekny, A. & Glotzer, M. An Ect2-centralspindlin complex regulates the localization and function of RhoA. J Cell Biol. 170, 571-82 (2005). 237. Loria, A. & Longhini, K.M. & Glotzer, M. The RhoGAP domain of CYK-4 has an essential role in RhoA activation. Curr Biol. 22, 213-9 (2012). 238. Cheffings, T.H. & Burroughs, N.J. & Balasubramanian, M.K. Actomyosin ring formation and tension generation in eukaryotic cytokinesis. Curr Biol. 26, 719-37 (2016). 239. Pollard, T.D. Nine unanswered questions about cytokinesis. J Cell Biol. 216, 3007-16 (2017). 240. Straight, A.F. & Field, C.M. & Mitchison, T.J. Anillin binds nonmuscle myosin II and regulates the contractile ring. Mol Biol Cell. 16, 193-201 (2005). 241. Liu, J. et al. Cleavage furrow organization requires PIP(2)-mediated recruitment of Anillin. Curr Biol. 22, 64-9 (2012). 242. Estey, M.P. et al. Distinct roles of septins in cytokinesis: SEPT9 mediates midbody abscission. J Cell Biol. 191, 741-9 (2010). 243. Eggert, U.S. & Mitchison, T.J. & Field, C.M. Animal cytokinesis: from parts list to mechanisms. Annu Rev Biochem. 75, 543-66 (2006). 244. Wu, J.Q. & Pollard, T.D. Counting cytokinesis proteins globally and locally in fission yeast. Science. 310, 310-4 (2005). 245. Mullins, J.M. & Biesele, J.J. Terminal phase of cytokinesis in D-98s cells. J Cell Biol. 73, 672-84 (1977). 246. Skop, A.R. et al. Dissection of the mammalian midbody proteome reveals conserved cytokinesis mechanisms. Science. 305, 61-6 (2004). 247. Addi, C. et al. The Flemmingsome reveals an ESCRT-to-membrane coupling via ALIX/syntenin/syndecan-4 required for completion of cytokinesis. Nat Comm. 11, 1941 (2020). 248. Gromley, A. et al. Centriolin anchoring of exocyst and SNARE complexes at the midbody is required for secretory-vesicle-mediated abscission. Cell. 123, 75-87 (2005). 249. Fielding, A.B. et al. Rab11-FIP3 and FIP4 interact with Arf6 and the exocyst to control membrane traffic in cytokinesis. EMBO J. 24, 3389-99 (2005). 250. Hurley, J.H. & Hanson, P.J. Membrane budding and scission by the ESCRT machinery: It’s all in the neck. Nat Rev Mol Cell Biol. 11, 556-66 (2010).

251. Henne, W.M. & Buchkovich, N.J. & Emr, S.D. The ESCRT pathway. Dev Cell. 21, 77-91 (2011). 252. Elia, N. et al. Dynamics of endosomal sorting complex required for transport (ESCRT) machinery during cytokinesis and its role in abscission. Proc Natl Acad Sci USA. 108, 4846-51 (2011). 253. Carlton, J.G. et al. ESCRT-III governs the Aurora B-mediated abscission checkpoint through CHMP4C. Science. 336, 220-5 (2012). 254. Morita, E. Differential requirements of the mammalian ESCRTs in multivesicular body formation, virus budding and cell division. FEBS J. 279, 1399-406 (2012). 255. Guizetti, J. et al. Cortical constriction during abscission involves helices of ESCRT-III- dependent filaments. Science. 331, 1616-20 (2011). 256. Mierzwa, B.E. et al. Dynamic subunit turnover in ESCRT-III assemblies is regulated by Vps4 to mediate membrane remodeling during cytokinesis. Nat Cell Biol. 19, 787-98 (2017). 257. Christ, L. et al. ALIX and ESCRT-I/II function as parallel ESCRT-III recruiters in cytokinetic abscission. J Cell Biol. 212, 499-513 (2016). 258. Gupta, D.K. et al. Tension-induced cytokinetic abscission in human fibroblasts. Oncotarget. 9, 8999-9009 (2018). 259. Lie-Jensen, A. et al. Centralspindlin recruits ALIX to the midbody during cytokinetic abscission in Drosophila via a mechanism analogous to viral budding. Curr Biol. 29, 3538- 48 (2019). 260. Fremont, S. et al. Emerging roles of MICAL family proteins – from actin oxidation to membrane trafficking during cytokinesis. J Cell Sci. 130, 1509-17 (2017). 261. Bastos, R.N. & Barr, F.A. Plk1 negatively regulates Cep55 recruitment to the midbody to ensure orderly abscission. J Cell Biol. 191, 751-60 (2010). 262. Capalbo, L. et al. The chromosomal passenger complex controls the function of endosomal sorting complex required for transport-III Snf7 proteins during cytokinesis. Open Biol. 2, 120070. 263. Norden, C. et al. The NoCut pathway links completion of cytokinesis to spindle midzone function to prevent chromosome breakage. Cell. 125, 85-98 (2006).

264. Kamranvar, S.A. et al. Integrin signaling via FAK-Src controls cytokinetic abscission by decelerating PLK1 degradation and subsequent recruitment of CEP55 at the midbody. Oncotarget. 7, 30820-30 (2016). 265. Breznau, E.B et al. MgcRacGAP restricts active RhoA at the cytokinetic furrow and both RhoA and Rac1 at cell-cell junctions in epithelial cells. Mol Biol Cell. 26, 2439-55 (2015). 266. Tedeschi, A. et al. Cep55 promotes cytokinesis of neural progenitors but is dispensable for most mammalian cell divisions. Nat Comm. 11, 1746 (2020). 267. Eikenes, A, H. et al. ALIX and ESCRT-III coordinately control cytokinetic abscission during germline stem cell division in vivo. PLOS Genet. 11, e1004653 (2015). 268. Matias, N.R. & Matias, N.R. & Huynh, J.R. Abscission is regulated by the ESCRT-III protein shrub in Drosophila germline stem cells. PLOS Genet. 11, e1004653 (2015). 269. Konig, J. et al. Membrane remodeling during embryonic abscission in Caenorhabditis elegans. J Cell Biol. 216, 1277-86 (2017). 270. Capalbo, L. et al. Coordinated regulation of the ESCRT-III component CHMP4C by the chromosomal passenger complex and centralspindlin during cytokinesis. Open Biol. 6, 160248 (2016). 271. Gregory, S. et al. A Drosophila overexpression screen for modifiers of Rho signaling in cytokinesis. Fly. 1, 13-22 (2007). 272. Steigemann, P. et al. Aurora B-mediated abscission checkpoint protects against tetraploidization. Cell. 136, 473-84 (2009). 273. Petsalaki, E. & Zachos, G. Building bridges between chromosomes: Novel insights into the abscission checkpoint. Cell Mol Life Sci. 76, 4291-307 (2019). 274. Petsalaki, E. & Zachos, G. Clks 1, 2 and 4 prevent chromatin breakage by regulating the Aurora B-dependent abscission checkpoint. Nat Comm. 7, 11451 (2016). 275. Mackay, D.R. & Makise, M. & Ullman, K.S. Defects in nuclear pore assembly lead to activation of an Aurora B-mediated abscission checkpoint. J Cell Biol. 191, 923-31 (2010). 276. Mackay, D.R. & Ullman, K.S. ATR and a Chk1-Aurora B pathway coordinate postmitotic genome surveillance with cytokinetic abscission. Mol Biol Cell. 26, 2217-26 (2015). 277. Lafaurie-Janvore, J. et al. ESCRT-III assembly and cytokinetic abscission are induced by tension release in the intercellular bridge. Science. 339, 1625-9 (2013). 278. Caballe, A. et al. ULK3 regulates cytokinetic abscission by phosphorylating ESCRT-III proteins. Elife. 4, e06547 (2015). 72

279. Thoresen, S.B. et al. ANCHR mediates Aurora-B-dependent abscission checkpoint control through retention of Vps4. Nat Cell Biol. 16, 550-60 (2014). 280. Pike, T. et al. PKCε switches Aurora B specificity to exit the abscission checkpoint. Nat Comm. 7, 13853 (2016). 281. Bhowmick, R. et al. The RIF1-PP1 axis controls abscission timing in human cells. Curr Biol. 29, 1232-42 (2019). 282. Rakkaa, T. et al. CDK11 (p58) kinase activity is required to protect sister chromatid cohesion at centromeres in mitosis. Chromosome Res. 22, 267-76. 283. Barna, M. et al. Supression of Myc oncogenic activity by ribosomal haploinsufficiency. Nature. 456, 971-5 (2008). 284. Lin, A. et al. Off-target toxicity is a common mechanism of action of cancer drugs undergoing clinical trials. Sci Transl Med. 11, eaaw8412 (2019). 285. Nandi, A.K. et al. Attenuation of DNA damage checkpoint by PBK, a novel mitotic kinase, involves protein-protein interaction with tumor suppressor p53. Biochem Biophys Res Commun. 358, 181-8 (2007). 286. Schmidt, K. & Nichols, B.J. A barrier to lateral diffusion in the cleavage furrow of dividing mammalian cells. Curr Biol. 14, 1002-6 (2004). 287. Schulze, E.S. & Blose, S.H. Passage of molecules across the intercellular bridge between post-mitotic daughter cells. Exp Cell Res. 151, 367-73 (1984). 288. Riskallah, R. et al. Identification of the oncogenic kinase TOPK/PBK as a mater mitotic regulator of C2H2 zinc finger proteins. Oncotarget. 6, 1446-61 (2015). 289. Abe, Y. et al. A mitotic kinase TOPK enhances Cdk1/cyclin B1-dependent phosphorylation of PRC1 and promotes cytokinesis. J Mol Biol. 370, 231-45 (2007). 290. Dos Santos Paparidis, N.F. & Canduri, F. The emerging picture of CDK11: Genetic, functional, and medicinal aspects. Curr Med Chem. 25, 880-8 (2018). 291. Wilker, E. et al. 14-3-3sigma controls mitotic translation to facilitate cytokinesis. Nature. 446, 329-32 (2007). 292. Huang, J. & Raff, J.W. The disappearance of cyclin B at the end of mitosis is regulated spatially in Drosophila cells. EMBO J. 18, 2184-2195 (1999). 293. Yang, J. & Kornbluth, S. All aboard the cyclin train: subcellular trafficking of cyclins and their CDK partners. Trends Cell Biol. 9, 207-210 (1999). 294. Mayer, T. U. et al. Small molecule inhibitor of mitotic spindle bipolarity identified in a 73

phenotype-based screen. Science. 286, 971-974 (1999). 295. Kong, X. et al. CDK11p58 phosphorylation of PAK1 Ser174 promotes DLC2 binding and roles on cell cycle progression. J Biochem. 146, 417-27 (2009). 296. Gajduskova, P. et al. CDK11 is required for transcription of replication-dependent histone genes. Nat Struc Mol Biol. 27, 500-10 (2020). 297. Mikolajczyk, M. et al. The cyclin-dependent kinase 11p46 isoform interacts with RanBPM. Biochem Biophys Res Commun. 310, 14-8 (2003). 298. Shi, J. & Nelson, M.A. The cyclin-dependent kinase 11 interacts with NOT2. Biochem Biophys Res Commun. 334, 1310-6 (2005). 299. Chi, Y. et al. CDK11p58 represses vitamin D receptor-mediated transcriptional activation through promoting its ubiquitin–proteasome degradation. Biochem Biophys Res Commun. 386, 493-8 (2009). 300. Zong, H. et al. Cyclin D3/CDK11p58 complex is involved in the repression of androgen receptor. Mol Cell Biol. 27, 7125-42 (2007). 301. Meppelink, A. et al. Shugoshin-1 balances Aurora B kinase activity via PP2A to promote chromosome bi-orientation. Cell Rep. 11, 508-15 (2015). 302. Holder, J. & Poser, E. & Barr, F.A. Getting out of mitosis: spatial and temporal control of mitotic exit and cytokinesis by PP1 and PP2A. FEBS Lett. 593, 2908-24 (2019). 303. Bastos, R.N. & Cundell, M.J. & Barr, F.A. KIF4A and PP2A-B56 form a spatially restricted feedback loop opposing Aurora B at the anaphase central spindle. J Cell Biol. 207, 683-93 (2014). 304. Qian, J. et al. Aurora B defines its own chromosomal targeting by opposing the recruitment of the phosphatase scaffold Repo-Man. Curr Biol. 23, 1136-43 (2013). 305. Saurin, A.T. Kinase and phosphatase cross-talk at the kinetochore. Front Cell Dev Biol. 6:62 (2018). 306. Vassilev, L.T. et al. Selective small-molecule inhibitor reveals critical mitotic functions of human CDK1. Proc Natl Acad Sci U S A. 103, 10660-5 (2006). 307. Capalbo, L et al. The midbody interactome reveals unexpected roles for PP1 phosphatases in cytokinesis. Nat Commun. 10, 4513 (2019). 308. Mullins, M.J. & McIntosh, R.J. Isolation and initial characterization of the mammalian midbody. J Cell Biol. 94, 654-61 (1982). 309. Kinoshita, E. & Kinoshita-Kikuta, E. & Koike, T. Separation and detection of large 74

phosphoproteins using Phos-tag SDS-PAGE. Nat Protoc. 4, 1513-21 (2009). 310. Hertz, E. et al. A conserved motif provides binding specificity to the PP2A-B56 phosphatase. Mol Cell. 63, 686-95 (2016). 311. Mi, H. et al. Large-scale gene function analysis with the PANTHER classification system. Nat Protoc. 8, 1551-66 (2013). 312. Oh, H. et al. Negative regulation of cell growth and differentiation by TSG101 through association with p21 (Cip1/WAF1). Proc Natl Acad Sci USA. 99, 5430-5 (2002). 313. Serres, M.P. et al. p27(Kip1) controls cytokinesis via the regulation of citron kinase activation. J Clin Invest. 122, 844-58 (2012).

314. Sherr, C.J. & Roberts, J. M. CDK inhibitors: positive and negative regulators of G1-phase progression. Genes & Dev. 13, 1501-12 (1999). 315. Canepa, E.T. et al. INK4 proteins, a family of mammalian CDK inhibitors with novel biological functions. IUBMB Life. 59, 419-26 (2007). 316. Mann, B.J. & Wadsworth, P. Kinesin-5 regulation and function in mitosis. Trends Cell Biol. 29, 66-79 (2018). 317. Liu, J. & Sun, Y. The role of PP2A-associated proteins and signal pathways in microcystin-LR toxicity. Toxicol Lett. 236, 1-7 (2015). 318. Nasa, I. et al. Aurora B opposes PP1 function in mitosis through phosphorylation of the conserved RVxF binding motif in PP1 regulatory proteins. Sci Signal. 11, eaai8669 (2018). 319. Nielsen, C.F. et al. PICH promotes sister chromatid disjunction and cooperates with topoisomerase II in mitosis. Nat Commun. 6, 8962 (2015). 320. Russo, A.A. et al. Crystal structure of the p27Kip1 cyclin-dependent –kinase inhibitor bound to the cyclin A-Cdk2 complex. Nature. 382, 325-30 (1996). 321. Honkanen, R.E. et al. Characterization of Microcystin-LR, a potent inhibitor of type 1 and type 2A protein phosphatases. J Biol Chem. 265, 19401-4 (1990). 322. Hauf, S. et al. The small molecule Hesperadin reveals a role for Aurora B in correcting kinetochore-microtubule attachment and in maintaining the spindle assembly checkpoint. J Cell Biol. 161, 281-94 (2003). 323. Wu, C. et al. PP2A-B′ holoenzyme substrate recognition, regulation and role in cytokinesis. Cell Discov. 3, 17207 (2017). 324. Schneider, C.A. & Rasband, W.S. & Eliceiri, K.W. NIH Image to ImageK: 25 years of image analysis. Nat Methods. 9, 671-5 (2012). 75

325. Feng, Y. Transcriptional activation of CBFβ by CDK11p110 is necessary to promote osteosarcoma cell proliferation. Cell Commun Signal. 17, 125 (2019). 326. Yang, D. et al. Structural basis for midbody targeting of spastin by the ESCRT-III protein CHMP1B. Nat Struct Mol Biol. 15, 1278-86 (2008). 327. Connell, J.W. et al. Spastin couples microtubule severing to membrane traffic in completion of cytokinesis and secretion. Traffic. 10, 42-56 (2009). 328. Terry, S.J. et al. Capping protein regulates actin dynamics during cytokinetic midbody maturation. Proc Natl Acad Sci USA. 115, 2138-43 (2018). 329. Fremont, S. et al. Oxidation of F-actin controls the terminal steps of cytokinesis. Nat Commun. 8, 1-16 (2017). 330. Dambournet, D. et al. Rab35 GTPase and OCRL phosphatase remodel lipids and F-actin for successful cytokinesis. Nat Cell Biol. 13, 981-8 (2011). 331. Schiel, J.A. et al. FIP3-endosome-dependent formation of the secondary ingression mediates ESCRT-III recruitment during cytokinesis. Nat Cell Biol. 14, 1068-78 (2012). 332. Schiel, J.A. et al. Endocytic membrane fusion and budding-induced microtubule severing mediates cell abscission. J Cell Sci. 124, 1411-24 (2011). 333. Peterman, E. et al. The post-abscission midbody is an intracellular signaling organelle that regulates cell proliferation. Nat Commun. 10, 3181 (2019).

Supplementary

FRT/TO HeLa cells Template

HA-p58WT

HA-p58DN FLAG-mCdc2L (gift from S.

HA-p110WT Angers, University of Toronto)

HA-p110MA

Supplementary Table 1. Stable Cell Lines used.

Oligo Sequence 5’ to 3’

CdK11A RT-qpcr_F AGAGAGCACGAACGTGGGAA

Cdk11A RT-qpcr_R AGCGGTCCCTTTCTCTCCTG

Cdk11B RT-qpcr_F AGGCGTCAACACAGGAAGTG

Cdk11B RT-qpcr_R AGTTAAAACACCCTACGGGGC

GGACTTCGAGCAAGAGA TGG β-actin RT-qpcr_F

β-actin RT-qpcr_R AGCACTGTGTTGGCGTACAG

Supplementary Table 2. Oligos used in RT-qPCR experiments.

Oligo Sequence 5’ to 3’ Construct amplification

CCGTCGGCTCCGCTTCGGCCACCATGTACCCAT LIC- WT ACGACGTCCCAGACTACGCTAGTGGAGATGAAG HA-p58 , HA- DN p58_F AACGAGAA HA-p58

HA-p110WT, CDK11- TCCGTGGCGGCCTCGTCGTCGGGATCAGAACTT HA-p110MA, LIC02_ GAGGCTGAAGCCAGGG WT R HA-p58 , HA-p58DN

CCGTCGGCTCCGCTTCGGCCACCATGTACCCAT LIC03- WT ACGACGTCCCAGACTACGCTGGTGATGAAAAGG HA-p110 , HA- MA p110- F ACTCTTGGAAA GTGAA HA-p110

CDK11 ATCCTGCACCGTAACCTCAAGACGTCCAACCTG HA-p58DN D-N_F CTG

CDK11 GGACGTCTTGAGGTTACGGTGCAGGATCCAGTT HA-p58DN D-N_R GTCGTG

CDK11 AGTGAGGAAGAAGCGAGTGAAGATGAAGAACG HA-p110MA M-A_F

CDK11 TTCATCTTCACTCGCTTCTTCCTCACTTACTTC HA-p110MA M-A_R

Supplementary Table 3. Oligos used for cell line construction.

Type Name Manufacturer Catalogue # 2x CloneAmp HiFi Takarabio 639298 PCR Premix

5x In-Fusion HD Takarabio 638910 Cloning Kit

Gel/PCR DNA Geneaid DF100/300 Fragments Extraction Kit Cloning and PCR High-speed Plasmid Geneaid PD100/300 Mini Kit

E.coli Top10 Invitrogen C404010

Ampicillin Bioshop AMP201

(DMEM) Dulbecco's Sigma-Aldrich D5796 Modified Eagles Medium (FBS) Fetal Bovine Life Technologies 12483020 Serum (P/S) Penicillin Bioshop PST999 Tissue Culture Streptomycin

(PBS) Phosphate Sigma-Aldrich D8537 Buffered Saline Lipofectamine 2000 Invitrogen 11668027

Opti-MEM (Reduced- Life Technologies 31985062 Serum Medium) (PFA) ThermoFisher Discontinued Paraformaldehyde Methanol Caledon Laboratories 6705-7-40

Immunofluorescence (BSA) Bovine Serum Bioshop ALB001 Albumen Hoechst Sigma-Aldrich B2261 Mowiol (Polyvinyl Fluka 81381 alcohol 4-88)

Supplementary Table 4. Commonly Used Reagent