LETTERS

Dorothea Stephany, Address for correspondence: Paul H. Consigny, isolated from R. sanguineus in Pierre Buffet, Jean-Marc Rolain, Centre Médical, Institut Pasteur, 28, rue du southern France (3), and fragments Didier Raoult, Docteur Roux, 75724 Paris Cedex 15, France; of ompB, atpA, dnaA, dnaK, and recA and Paul H. Consigny email: [email protected] genes were 100% identical to the R. Author affi liations: Institut Pasteur, Paris, massiliae strain Bar29 (AF123710, France (D. Stephany, P. Buffet, P.H. Con- AY124739, DQ821798, DQ821828, signy); and Université de la Méditerranée, and AY124750, respectively), previ- Marseille, France (J.M. Rolain, D. Raoult). ously isolated from R. sanguineus ticks in Catalonia, Spain (4) (Table). DOI: 10.3201/eid1511.090521 R. massiliae was fi rst isolated in References 1992 from R. sanguineus ticks col- massiliae in the lected near Marseille, France (5). 1. Kelly PJ, Beati L, Matthewman LA, Canary Islands Since then, the pathogen has been Mason PR, Dasch GA, Raoult D. A new identifi ed in different Rhipicephalus pathogenic spotted fever group rick- ettsia from Africa. J Trop Med Hyg. To the Editor: Rickettsia massil- species in France, Greece, Portugal, 1994;97:129–37. iae was recently recognized as a hu- Switzerland, Spain, North and Cen- 2. Raoult D, Fournier PE, Fenollar F, Jense- man -borne spotted fever group tral Africa, Argentina, and the United nius M, Prioe T, de Pina JJ, et al. Rick- States (6,7). R. massiliae has been ettsia africae, a tick-borne pathogen in rickettsia (1). We report the fi nding of travelers to sub-Saharan Africa. N Engl J R. massiliae in Rhipicephalus pusillus identifi ed in southern Spain (8) but Med. 2001;344:1504–10. DOI: 10.1056/ ticks from Gran Canaria, Canary Is- not in the Canary Islands. R. pusillus NEJM200105173442003 lands, Spain. Introduction of this patho- ticks are commonly found in southern 3. Ndip LM, Bouyer DH, Travassos Da Rosa Europe (Portugal, Spain, and France) AP, Titanji VP, Tesh RB, Walker DH. gen into the Canary Islands is thought Acute spotted fever among to have resulted from translocation of and northern Africa (Tunisia and Mo- febrile patients, Cameroon. Emerg Infect the European wild rabbit Oryctola- rocco). All stages of these ticks inhabit Dis. 2004;10:432–7. gus cuniculus (Linnaeus), a preferred burrows of wild rabbits and feed on 4. Freedman DO, Weld LH, Kozarsky PE, them (www.kolonin.org/16_4.html). Fisk T, Robins R, von Sonnenburg F, et al. host of R. pusillus ticks (www.kolonin. Spectrum of disease and relation to place org/16_4.html), from the Iberian Pen- Wild rabbits were introduced into of exposure among ill returned travelers. insula 600 years ago (2). the Canary Islands at the end of 14th N Engl J Med. 2006;354:119–30. DOI: We collected questing adult ticks century during colonization by the 10.1056/NEJMoa051331 kingdom of Castilla. Colonists were 5. Burgdorfer W, Ormsbee RA, Schmidt ML, in 2008 in Gran Canaria and identifi ed Hoogstraal H. A search for the epidemic 2 tick species, Hyalomma lusitanicum asked to bring rabbit couples with agent in Ethiopian ticks. Bull (n = 82 [46 females]) and R. pusil- them to provide food in the islands (2), World Health Organ. 1973;48:563–9. lus (n = 8 [5 females]). Whole ticks a practice continued by new colonists 6. Walker DH, Liu QH, Yu XJ, Li H, Tay- because of their interest in hunting this lor C, Fenq HM. Antigenic diversity of were preserved in 70% ethanol and . Am J Trop Med Hyg. used for DNA extraction by using rabbit species. Introduction of wild rab- 1992;47:78–86. TriReagent (Sigma, St. Louis, MO, bits by colonists led to establishment of 7. Kelly PJ, Matthewman LA, Beati L, Raoult USA) according to the manufacturer’s parasites, such as helminths, coccidia, D, Mason P, Dreary M, et al. African tick and viruses in the Canary Islands (9). bite fever: a new spotted fever group un- instructions. We identifi ed rickett- der an old name. Lancet. 1992;340:982–3. sial sequences by using PCR primers R. pusillus, a common ectoparasite Medline DOI: 10.1016/0140-6736(92) that amplify fragments of 16S rRNA, (tick) that feeds on wild rabbits on the 92878-J ompB, atpA, dnaA, dnaK, and recA Iberian Peninsula, was also introduced 8. Mura A, Socolovschi C, Ginesta J, Lafrance this way. R. massiliae could have been B, Magnan S, Rolain JM, et al. Molecular genes (Table). Amplicons were cloned detection of spotted fever group rickettsiae into pGEM-T (Promega, Madison, introduced in the islands by infected R. in ticks from Ethiopia and Chad. Trans WI, USA), and 3 independent clones pusillus ticks or by infected wild rab- R Soc Trop Med Hyg. 2008;102:945–9. were sequenced from both ends for bits if this species serves as a natural DOI: 10.1016/j.trstmh.2008.03.015 reservoir host for the pathogen. 9. Parola P, Raoult D. Ticks and tickborne each gene marker. Sequence similar- bacterial diseases in humans: an emerg- ity search was performed by using To fi nd evidence for this hypoth- ing infectious threat. Clin Infect Dis. BLAST (www.ncbi.nlm.nih.gov). esis, we tested blood and liver samples 2001;32:897–928. DOI: 10.1086/319347 Rickettsial DNA was detected in 2 R. of 150 wild rabbits from both Canary 10. Parola P, Barre N. , Islands and Andalucía (southern Spain) agent de la fi èvre à tique africaine: un pusillus males only; sequences were pathogène émergent dans les Antilles et identical in both ticks. Fragments of by using Rickettsia-specifi c PCR prim- l'île de la Réunion. Bull Soc Pathol Exot. 16S rRNA were 99% identical to the ers (Table). No R. massiliae DNA was 2004;97:193–8. R. massiliae strain Mtu5 (CP000683) detected in the rabbit samples tested,

Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 15, No. 11, November 2009 1869 LETTERS

Table. Rickettsia massiliae PCR conditions and amplicon size, Canary Islands, 2008* Description Amplicon size, PCR annealing Gene (GenBank accession no.) Primer sequence (5ƍ ĺ 3ƍ) bp conditions 16S rRNA 16S ribosomal RNA F: AGAGTTTGATCCTGGCTCAG 416 50°C/30 s (GQ144453) R: AACGTCATTATCTTCCTTGC ompB Outer membrane protein F: GGGTGCTGCTACACAGCAGAA 618 53°C/30 s (GQ144450) R: CCGTCACCGATATTAATTGCC dnaK Heat-shock protein 70 F: AGCGTCAAGCAACGAAAGAT 323 50°C/30 s (GQ144451) R: CAAACGTTGAAGTGCTAAAGG dnaA Chromosomal replication initiation F: CCTACTAACTTTGTTAGAGATT 241 56°C/30 s protein (GQ144449) R: TGATGATTCTGCAACCGCTC recA RecA recombination protein F: TGCTTTTATTGATGCCGAGC 428 52°C/30 s (GQ144452) R: CTTTAATGGAGCCGATTCTTC atpA ATP synthase F1 alpha subunit F: ACATATCGAGATGAAGGCTCC 731 48°C/30 s (GQ144448) R: CCGAAATACCGACATTAACG *GenBank accession numbers correspond to R. massiliae sequences identified in this study. PCRs were completed by employing the Access RT-PCR system (Promega, Madison, WI, USA) with 1 ng DNA, the oligonucleotide primers, and annealing conditions and with extension for 1 min at 68ºC. F, forward; R, reverse. suggesting that the pathogen probably Author affi liations: Instituto de Investigación 5. Beati L, Raoult L. Rickettsiae massiliae was introduced in the Canary Islands en Recursos Cinegéticos IREC (Consejo sp. nov., a new spotted fever group rickett- sia. Int J Syst Bacteriol. 1993;43:839–40. Superior de Investigaciones Cientifi cas– with infected R. pusillus ticks feeding PMID: 8240964 on rabbits. Alternatively, R. massiliae Universidad de Castilla-La Mancha–Junta 6. Eremeeva ME, Bosserman EA, Demma infection levels in wild rabbits may de Comunidades de Castilla-La Mancha), LJ, Zambrano ML, Blau DM, Dasch GA. be below the PCR detection limit and Ciudad Real, Spain (I.G. Fernández de Isolation and identifi cation of Rickettsia massiliae from Rhipicephalus sanguineus Mera, J. de la Fuente); Utrecht University, were not detected. ticks collected in Arizona. Appl Envi- The Canary Islands are a popular the Netherlands (Z. Zivkovic); Hospital Uni- ron Microbiol. 2006;72:5569–77. DOI: tourist destination. The presence of R. versitario Insular de Gran Canaria, Canary 10.1128/AEM.00122-06 massiliae in the islands constitutes a Islands, Spain (M. Bolaños, C. Carranza, 7. Parola P, Labruna MB, Raoult D. Tick- borne rickettsioses in America: unan- J.L. Pérez-Arellano); Universidad de Las risk for human infection and should swered questions and emerging diseases. be considered in hospital diagnostic Palmas de Gran Canaria, Canary Islands Curr Infect Dis Rep. 2009;11:40–50. DOI: and wildlife management strategies. (J.L. Pérez-Arellano, Carlos Gutiérez); and 10.1007/s11908-009-0007-5 As with other Rhipicephalus spp., R. Oklahoma State University, Stillwater, Okla- 8. Marquez FJ. Spotted fever group Rickett- sia in ticks from southeastern Spain natu- homa, USA (J. de la Fuente). pusillus ticks could feed on humans ral parks. Exp Appl Acarol. 2008;45:185– under certain circumstances (10). Our DOI: 10.3201/eid1511.090681 94. DOI: 10.1007/s10493-008-9181-7 results emphasize the risks associated 9. Foronda PR, Figueruelo EO, Ortego AR, with unsupervised animal transloca- Abreu NA, Casanova JC. Parasites (vi- References ruses, coccidia and helminths) of the wild tions, a factor that probably plays a rabbit (Oryctolagus cuniculus) introduced role in the introduction of ticks and 1. Vitale G, Mansuelo S, Rolain JM, Raoult to Canary Islands from Iberian Peninsula. tick-borne pathogens in different parts D. Rickettsia massiliae human isolation. Acta Parasitologica 2005;50:80–4. of the world. Emerg Infect Dis. 2006;12:174–5. 10. Parola P, Socolovschi C, Jeanjean L, Bi- 2. Nowak RM. Walker’s mammals of the tam I, Fournier PE, Sotto A, et al. Warmer world. Baltimore: The Johns Hopkins weather linked to tick attack and emer- This research was supported by Fun- University Press; 1991. gence of severe rickettsioses. PLoS Negl dación Canaria de Investigación y Salud 3. Beati L, Finidori JP, Gilot B, Raoult D. Trop Dis. 2008;2:e338. DOI: 10.1371/ Comparison of serologic typing, sodium journal.pntd.0000338 (project 34/04) and the Consejeria de Edu- dodecyl sulfate–polyacrylamide gel elec- cación y Ciencia de Castilla-La Mancha trophoresis protein analysis, and genetic Address for correspondence: José de la (project POII09-0141-8176). restriction fragment length polymorphism analysis for identifi cation of rickett- Fuente, Instituto de Investigación en Recursos Isabel G. Fernández de Mera, siae: characterization of two new rickett- Cinegéticos IREC (CSIC-UCLM-JCCM), 13005 sial strains. J Clin Microbiol. 1992;30: Zorica Zivkovic, Ciudad Real, Spain; email: jose_delafuente@ 1922–30. yahoo.com Margarita Bolaños, 4. Cardenosa N, Segura F, Raoult D. Sero- Cristina Carranza, survey among Mediterranean spotted fe- All material published in Emerging José Luis Pérez-Arellano, ver patients of a new spotted fever group rickettsial strain (Bar29). Eur J Epide- Infectious Diseases is in the public Carlos Gutiérrez, miol. 2003;18:351–6. DOI: 10.1023/ domain and may be used and reprinted and José de la Fuente A:1023654400796 without special permission; proper citation, however, is required.

1870 Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 15, No. 11, November 2009