DOCSLIB.ORG

Rickettsia Massiliae in the Canary Islands

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Rickettsia Massiliae in the Canary Islands LETTERS Dorothea Stephany, Address for correspondence: Paul H. Consigny, isolated from R. sanguineus ticks in Pierre Buffet, Jean-Marc Rolain, Centre Médical, Institut Pasteur, 28, rue du southern France (3), and fragments Didier Raoult, Docteur Roux, 75724 Paris Cedex 15, France; of ompB, atpA, dnaA, dnaK, and recA and Paul H. Consigny email: [email protected] genes were 100% identical to the R. Author affi liations: Institut Pasteur, Paris, massiliae strain Bar29 (AF123710, France (D. Stephany, P. Buffet, P.H. Con- AY124739, DQ821798, DQ821828, signy); and Université de la Méditerranée, and AY124750, respectively), previ- Marseille, France (J.M. Rolain, D. Raoult). ously isolated from R. sanguineus ticks in Catalonia, Spain (4) (Table). DOI: 10.3201/eid1511.090521 R. massiliae was fi rst isolated in References Rickettsia 1992 from R. sanguineus ticks col- massiliae in the lected near Marseille, France (5). 1. Kelly PJ, Beati L, Matthewman LA, Canary Islands Since then, the pathogen has been Mason PR, Dasch GA, Raoult D. A new identifi ed in different Rhipicephalus pathogenic spotted fever group rick- ettsia from Africa. J Trop Med Hyg. To the Editor: Rickettsia massil- species in France, Greece, Portugal, 1994;97:129–37. iae was recently recognized as a hu- Switzerland, Spain, North and Cen- 2. Raoult D, Fournier PE, Fenollar F, Jense- man tick-borne spotted fever group tral Africa, Argentina, and the United nius M, Prioe T, de Pina JJ, et al. Rick- States (6,7). R. massiliae has been ettsia africae, a tick-borne pathogen in rickettsia (1). We report the fi nding of travelers to sub-Saharan Africa. N Engl J R. massiliae in Rhipicephalus pusillus identifi ed in southern Spain (8) but Med. 2001;344:1504–10. DOI: 10.1056/ ticks from Gran Canaria, Canary Is- not in the Canary Islands. R. pusillus NEJM200105173442003 lands, Spain. Introduction of this patho- ticks are commonly found in southern 3. Ndip LM, Bouyer DH, Travassos Da Rosa Europe (Portugal, Spain, and France) AP, Titanji VP, Tesh RB, Walker DH. gen into the Canary Islands is thought Acute spotted fever rickettsiosis among to have resulted from translocation of and northern Africa (Tunisia and Mo- febrile patients, Cameroon. Emerg Infect the European wild rabbit Oryctola- rocco). All stages of these ticks inhabit Dis. 2004;10:432–7. gus cuniculus (Linnaeus), a preferred burrows of wild rabbits and feed on 4. Freedman DO, Weld LH, Kozarsky PE, them (www.kolonin.org/16_4.html). Fisk T, Robins R, von Sonnenburg F, et al. host of R. pusillus ticks (www.kolonin. Spectrum of disease and relation to place org/16_4.html), from the Iberian Pen- Wild rabbits were introduced into of exposure among ill returned travelers. insula 600 years ago (2). the Canary Islands at the end of 14th N Engl J Med. 2006;354:119–30. DOI: We collected questing adult ticks century during colonization by the 10.1056/NEJMoa051331 kingdom of Castilla. Colonists were 5. Burgdorfer W, Ormsbee RA, Schmidt ML, in 2008 in Gran Canaria and identifi ed Hoogstraal H. A search for the epidemic 2 tick species, Hyalomma lusitanicum asked to bring rabbit couples with typhus agent in Ethiopian ticks. Bull (n = 82 [46 females]) and R. pusil- them to provide food in the islands (2), World Health Organ. 1973;48:563–9. lus (n = 8 [5 females]). Whole ticks a practice continued by new colonists 6. Walker DH, Liu QH, Yu XJ, Li H, Tay- because of their interest in hunting this lor C, Fenq HM. Antigenic diversity of were preserved in 70% ethanol and Rickettsia conorii. Am J Trop Med Hyg. used for DNA extraction by using rabbit species. Introduction of wild rab- 1992;47:78–86. TriReagent (Sigma, St. Louis, MO, bits by colonists led to establishment of 7. Kelly PJ, Matthewman LA, Beati L, Raoult USA) according to the manufacturer’s parasites, such as helminths, coccidia, D, Mason P, Dreary M, et al. African tick and viruses in the Canary Islands (9). bite fever: a new spotted fever group un- instructions. We identifi ed rickett- der an old name. Lancet. 1992;340:982–3. sial sequences by using PCR primers R. pusillus, a common ectoparasite Medline DOI: 10.1016/0140-6736(92) that amplify fragments of 16S rRNA, (tick) that feeds on wild rabbits on the 92878-J ompB, atpA, dnaA, dnaK, and recA Iberian Peninsula, was also introduced 8. Mura A, Socolovschi C, Ginesta J, Lafrance this way. R. massiliae could have been B, Magnan S, Rolain JM, et al. Molecular genes (Table). Amplicons were cloned detection of spotted fever group rickettsiae into pGEM-T (Promega, Madison, introduced in the islands by infected R. in ticks from Ethiopia and Chad. Trans WI, USA), and 3 independent clones pusillus ticks or by infected wild rab- R Soc Trop Med Hyg. 2008;102:945–9. were sequenced from both ends for bits if this species serves as a natural DOI: 10.1016/j.trstmh.2008.03.015 reservoir host for the pathogen. 9. Parola P, Raoult D. Ticks and tickborne each gene marker. Sequence similar- bacterial diseases in humans: an emerg- ity search was performed by using To fi nd evidence for this hypoth- ing infectious threat. Clin Infect Dis. BLAST (www.ncbi.nlm.nih.gov). esis, we tested blood and liver samples 2001;32:897–928. DOI: 10.1086/319347 Rickettsial DNA was detected in 2 R. of 150 wild rabbits from both Canary 10. Parola P, Barre N. Rickettsia africae, Islands and Andalucía (southern Spain) agent de la fi èvre à tique africaine: un pusillus males only; sequences were pathogène émergent dans les Antilles et identical in both ticks. Fragments of by using Rickettsia-specifi c PCR prim- l'île de la Réunion. Bull Soc Pathol Exot. 16S rRNA were 99% identical to the ers (Table). No R. massiliae DNA was 2004;97:193–8. R. massiliae strain Mtu5 (CP000683) detected in the rabbit samples tested, Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 15, No. 11, November 2009 1869 LETTERS Table. Rickettsia massiliae PCR conditions and amplicon size, Canary Islands, 2008* Description Amplicon size, PCR annealing Gene (GenBank accession no.) Primer sequence (5ƍ ĺ 3ƍ) bp conditions 16S rRNA 16S ribosomal RNA F: AGAGTTTGATCCTGGCTCAG 416 50°C/30 s (GQ144453) R: AACGTCATTATCTTCCTTGC ompB Outer membrane protein F: GGGTGCTGCTACACAGCAGAA 618 53°C/30 s (GQ144450) R: CCGTCACCGATATTAATTGCC dnaK Heat-shock protein 70 F: AGCGTCAAGCAACGAAAGAT 323 50°C/30 s (GQ144451) R: CAAACGTTGAAGTGCTAAAGG dnaA Chromosomal replication initiation F: CCTACTAACTTTGTTAGAGATT 241 56°C/30 s protein (GQ144449) R: TGATGATTCTGCAACCGCTC recA RecA recombination protein F: TGCTTTTATTGATGCCGAGC 428 52°C/30 s (GQ144452) R: CTTTAATGGAGCCGATTCTTC atpA ATP synthase F1 alpha subunit F: ACATATCGAGATGAAGGCTCC 731 48°C/30 s (GQ144448) R: CCGAAATACCGACATTAACG *GenBank accession numbers correspond to R. massiliae sequences identified in this study. PCRs were completed by employing the Access RT-PCR system (Promega, Madison, WI, USA) with 1 ng DNA, the oligonucleotide primers, and annealing conditions and with extension for 1 min at 68ºC. F, forward; R, reverse. suggesting that the pathogen probably Author affi liations: Instituto de Investigación 5. Beati L, Raoult L. Rickettsiae massiliae was introduced in the Canary Islands en Recursos Cinegéticos IREC (Consejo sp. nov., a new spotted fever group rickett- sia. Int J Syst Bacteriol. 1993;43:839–40. Superior de Investigaciones Cientifi cas– with infected R. pusillus ticks feeding PMID: 8240964 on rabbits. Alternatively, R. massiliae Universidad de Castilla-La Mancha–Junta 6. Eremeeva ME, Bosserman EA, Demma infection levels in wild rabbits may de Comunidades de Castilla-La Mancha), LJ, Zambrano ML, Blau DM, Dasch GA. be below the PCR detection limit and Ciudad Real, Spain (I.G. Fernández de Isolation and identifi cation of Rickettsia massiliae from Rhipicephalus sanguineus Mera, J. de la Fuente); Utrecht University, were not detected. ticks collected in Arizona. Appl Envi- The Canary Islands are a popular the Netherlands (Z. Zivkovic); Hospital Uni- ron Microbiol. 2006;72:5569–77. DOI: tourist destination. The presence of R. versitario Insular de Gran Canaria, Canary 10.1128/AEM.00122-06 massiliae in the islands constitutes a Islands, Spain (M. Bolaños, C. Carranza, 7. Parola P, Labruna MB, Raoult D. Tick- borne rickettsioses in America: unan- J.L. Pérez-Arellano); Universidad de Las risk for human infection and should swered questions and emerging diseases. be considered in hospital diagnostic Palmas de Gran Canaria, Canary Islands Curr Infect Dis Rep. 2009;11:40–50. DOI: and wildlife management strategies. (J.L. Pérez-Arellano, Carlos Gutiérez); and 10.1007/s11908-009-0007-5 As with other Rhipicephalus spp., R. Oklahoma State University, Stillwater, Okla- 8. Marquez FJ. Spotted fever group Rickett- sia in ticks from southeastern Spain natu- homa, USA (J. de la Fuente). pusillus ticks could feed on humans ral parks. Exp Appl Acarol. 2008;45:185– under certain circumstances (10). Our DOI: 10.3201/eid1511.090681 94. DOI: 10.1007/s10493-008-9181-7 results emphasize the risks associated 9. Foronda PR, Figueruelo EO, Ortego AR, with unsupervised animal transloca- Abreu NA, Casanova JC. Parasites (vi- References ruses, coccidia and helminths) of the wild tions, a factor that probably plays a rabbit (Oryctolagus cuniculus) introduced role in the introduction of ticks and 1. Vitale G, Mansuelo S, Rolain JM, Raoult to Canary Islands from Iberian Peninsula. tick-borne pathogens in different parts D. Rickettsia massiliae human isolation. Acta Parasitologica 2005;50:80–4. of the world. Emerg Infect Dis. 2006;12:174–5. 10. Parola P, Socolovschi C, Jeanjean L, Bi- 2. Nowak RM. Walker’s mammals of the tam I, Fournier PE, Sotto A, et al. Warmer world. Baltimore: The Johns Hopkins weather linked to tick attack and emer- This research was supported by Fun- University Press; 1991.
Load more

Recommended publications
  • Genome Project Reveals a Putative Rickettsial Endosymbiont
    GBE Bacterial DNA Sifted from the Trichoplax adhaerens (Animalia: Placozoa) Genome Project Reveals a Putative Rickettsial Endosymbiont Timothy Driscoll1,y, Joseph J. Gillespie1,2,*,y, Eric K. Nordberg1,AbduF.Azad2, and Bruno W. Sobral1,3 1Virginia Bioinformatics Institute at Virginia Polytechnic Institute and State University 2Department of Microbiology and Immunology, University of Maryland School of Medicine 3Present address: Nestle´ Institute of Health Sciences SA, Campus EPFL, Quartier de L’innovation, Lausanne, Switzerland *Corresponding author: E-mail: [email protected]. yThese authors contributed equally to this work. Accepted: March 1, 2013 Abstract Eukaryotic genome sequencing projects often yield bacterial DNA sequences, data typically considered as microbial contamination. However, these sequences may also indicate either symbiont genes or lateral gene transfer (LGT) to host genomes. These bacterial sequences can provide clues about eukaryote–microbe interactions. Here, we used the genome of the primitive animal Trichoplax adhaerens (Metazoa: Placozoa), which is known to harbor an uncharacterized Gram-negative endosymbiont, to search for the presence of bacterial DNA sequences. Bioinformatic and phylogenomic analyses of extracted data from the genome assembly (181 bacterial coding sequences [CDS]) and trace read archive (16S rDNA) revealed a dominant proteobacterial profile strongly skewed to Rickettsiales (Alphaproteobacteria) genomes. By way of phylogenetic analysis of 16S rDNA and 113 proteins conserved across proteobacterial genomes, as well as identification of 27 rickettsial signature genes, we propose a Rickettsiales endosymbiont of T. adhaerens (RETA). The majority (93%) of the identified bacterial CDS belongs to small scaffolds containing prokaryotic-like genes; however, 12 CDS were identified on large scaffolds comprised of eukaryotic-like genes, suggesting that T.
    [Show full text]
  • Ohio Department of Health, Bureau of Infectious Diseases Disease Name Class A, Requires Immediate Phone Call to Local Health
    Ohio Department of Health, Bureau of Infectious Diseases Reporting specifics for select diseases reportable by ELR Class A, requires immediate phone Susceptibilities specimen type Reportable test name (can change if Disease Name other specifics+ call to local health required* specifics~ state/federal case definition or department reporting requirements change) Culture independent diagnostic tests' (CIDT), like BioFire panel or BD MAX, E. histolytica Stain specimen = stool, bile results should be sent as E. histolytica DNA fluid, duodenal fluid, 260373001^DETECTED^SCT with E. histolytica Antigen Amebiasis (Entamoeba histolytica) No No tissue large intestine, disease/organism-specific DNA LOINC E. histolytica Antibody tissue small intestine codes OR a generic CIDT-LOINC code E. histolytica IgM with organism-specific DNA SNOMED E. histolytica IgG codes E. histolytica Total Antibody Ova and Parasite Anthrax Antibody Anthrax Antigen Anthrax EITB Acute Anthrax EITB Convalescent Anthrax Yes No Culture ELISA PCR Stain/microscopy Stain/spore ID Eastern Equine Encephalitis virus Antibody Eastern Equine Encephalitis virus IgG Antibody Eastern Equine Encephalitis virus IgM Arboviral neuroinvasive and non- Eastern Equine Encephalitis virus RNA neuroinvasive disease: Eastern equine California serogroup virus Antibody encephalitis virus disease; LaCrosse Equivocal results are accepted for all California serogroup virus IgG Antibody virus disease (other California arborviral diseases; California serogroup virus IgM Antibody specimen = blood, serum, serogroup
    [Show full text]
  • Gene Gain and Loss Events in Rickettsia and Orientia Species Kalliopi Georgiades1,2, Vicky Merhej1, Khalid El Karkouri1, Didier Raoult1, Pierre Pontarotti2*
    Georgiades et al. Biology Direct 2011, 6:6 http://www.biology-direct.com/content/6/1/6 RESEARCH Open Access Gene gain and loss events in Rickettsia and Orientia species Kalliopi Georgiades1,2, Vicky Merhej1, Khalid El Karkouri1, Didier Raoult1, Pierre Pontarotti2* Abstract Background: Genome degradation is an ongoing process in all members of the Rickettsiales order, which makes these bacterial species an excellent model for studying reductive evolution through interspecies variation in genome size and gene content. In this study, we evaluated the degree to which gene loss shaped the content of some Rickettsiales genomes. We shed light on the role played by horizontal gene transfers in the genome evolution of Rickettsiales. Results: Our phylogenomic tree, based on whole-genome content, presented a topology distinct from that of the whole core gene concatenated phylogenetic tree, suggesting that the gene repertoires involved have different evolutionary histories. Indeed, we present evidence for 3 possible horizontal gene transfer events from various organisms to Orientia and 6 to Rickettsia spp., while we also identified 3 possible horizontal gene transfer events from Rickettsia and Orientia to other bacteria. We found 17 putative genes in Rickettsia spp. that are probably the result of de novo gene creation; 2 of these genes appear to be functional. On the basis of these results, we were able to reconstruct the gene repertoires of “proto-Rickettsiales” and “proto-Rickettsiaceae”, which correspond to the ancestors of Rickettsiales and Rickettsiaceae, respectively. Finally, we found that 2,135 genes were lost during the evolution of the Rickettsiaceae to an intracellular lifestyle. Conclusions: Our phylogenetic analysis allowed us to track the gene gain and loss events occurring in bacterial genomes during their evolution from a free-living to an intracellular lifestyle.
    [Show full text]
  • Intraspecies Comparative Genomics of Rickettsia
    AIX ͲMARSEILLE UNIVERSITÉ FACULTÉ DE MÉDECINE DE MARSEILLE ÉCOLE DOCTORALE DES SCIENCES DE LA VIE ET DE LA SANTÉ T H È S E Présentée et publiquement soutenue devant LA FACULTÉ DE MÉDECINE DE MARSEILLE Le 13 décembre 2013 Par M. Erwin SENTAUSA Né le 16 décembre 1979 àMalang, Indonésie INTRASPECIES COMPARATIVE GENOMICS OF RICKETTSIA Pour obtenir le grade de DOCTORAT d’AIX ͲMARSEILLE UNIVERSITÉ SPÉCIALITÉ :PATHOLOGIE HUMAINE Ͳ MALADIES INFECTIEUSES Membres du Jury de la Thèse : Dr. Patricia RENESTO Rapporteur Pr. Max MAURIN Rapporteur Dr. Florence FENOLLAR Membre du Jury Pr. Pierre ͲEdouard FOURNIER Directeur de thèse Unité de Recherche sur les Maladies Infectieuses et Tropicales Émergentes UM63, CNRS 7278, IRD 198, Inserm 1095 Avant Propos Le format de présentation de cette thèse correspond à une recommandation de la spécialité Maladies Infectieuses et Microbiologie, à l’intérieur du Master de Sciences de la Vie et de la Santé qui dépend de l’Ecole Doctorale des Sciences de la Vie de Marseille. Le candidat est amené àrespecter des règles qui lui sont imposées et qui comportent un format de thèse utilisé dans le Nord de l’Europe permettant un meilleur rangement que les thèses traditionnelles. Par ailleurs, la partie introduction et bibliographie est remplacée par une revue envoyée dans un journal afin de permettre une évaluation extérieure de la qualité de la revue et de permettre àl’étudiant de le commencer le plus tôt possible une bibliographie exhaustive sur le domaine de cette thèse. Par ailleurs, la thèse est présentée sur article publié, accepté ou soumis associé d’un bref commentaire donnant le sens général du travail.
    [Show full text]
  • Diapositive 1
    29.04.2013 ESCMID-BERLIN «Culturomics» © by author ESCMID Online Lecture Library Didier Raoult Marseille - France [email protected] www.mediterranee-infection.com As samples in 2012 We received -220,000 samples for culture (bactéria, fungi, viruses) - 200,000 PCR were performed - 115,000 serological testing were tested © by author Real-time laboratory surveillance of sexually-transmissible infections in Marseille University hospitals reveals rise of gonorrhea, syphilis and HIV seroconversions in 2012. PhilippeESCMID Colson1,2 , Frédérique Online Gouriet1,2 Lecture , Sékéné Badiaga 2,3Library, Catherine Tamalet 1,2, Andreas Stein2,4, Didier Raoult1,2 *. Eurosurveillance 2013 2 Culture has been negleted in clinical microbiology, very few new media have been recently very few introduced but it is still central for: Causality Suceptibility testing Genome sequencing© by author ESCMID Online Lecture Library Pathophysiology 3 NEW IDENTIFICATIONS Helicobacter pylori • Peptic ulcer disease • Cancer of the stomach, grown in 1983 © by author ESCMIDSeen sinceOnline the Lecture 19th century Library 4 © by author ESCMID Online Lecture Library 5 PROGRESSES MADE IN MICROBIOLOGY FROM 1979 TO 2012 THANKS TO THE DEVELOPMENT OF NEW TECHNOLOGIES © by author a) the ESCMIDleft ordinate axis refers toOnline the cumulative numbers Lecture of bacterial species Library with validly published names (green curve); the right ordinate axis refers to the cumulative numbers of sequenced bacterial genomes (purple) and sequenced viral genomes (blue); 6 © by author b) the left ordinate axis refers to the numbers of articles containing “metagenome” as keyword (red) and of articles containing “microbiota” as keyword (grey); the right ordinate axisESCMID refers to the numbers Online of articles containing Lecture “MALDI-TOF” andLibrary “clinical microbiology” as keywords (orange).
    [Show full text]
  • Paradoxical Evolution of Rickettsial Genomes
    Ticks and Tick-borne Diseases 10 (2019) 462–469 Contents lists available at ScienceDirect Ticks and Tick-borne Diseases journal homepage: www.elsevier.com/locate/ttbdis Paradoxical evolution of rickettsial genomes T ⁎ Awa Diopa, Didier Raoultb, Pierre-Edouard Fourniera, a UMR VITROME, Aix-Marseille University, IRD, Service de Santé des Armées, Assistance Publique-Hôpitaux de Marseille, Institut Hospitalo-Uuniversitaire Méditerranée Infection, 19-21 Boulevard Jean Moulin, 13005, Marseille, France b UMR MEPHI, Aix-Marseille University, IRD, Assistance Publique-Hôpitaux de Marseille, Institut Hospitalo-Uuniversitaire Méditerranée Infection, Marseille, France ARTICLE INFO ABSTRACT Keywords: Rickettsia species are strictly intracellular bacteria that evolved approximately 150 million years ago from a Rickettsia presumably free-living common ancestor from the order Rickettsiales that followed a transition to an obligate Genomics intracellular lifestyle. Rickettsiae are best known as human pathogens vectored by various arthropods causing a Evolution range of mild to severe human diseases. As part of their obligate intracellular lifestyle, rickettsial genomes have Virulence undergone a convergent evolution that includes a strong genomic reduction resulting from progressive gene Genome rearrangement degradation, genomic rearrangements as well as a paradoxical expansion of various genetic elements, notably Non-coding DNA Gene loss small RNAs and short palindromic elements whose role remains unknown. This reductive evolutionary process is DNA repeats not unique to members of the Rickettsia genus but is common to several human pathogenic bacteria. Gene loss, gene duplication, DNA repeat duplication and horizontal gene transfer all have shaped rickettsial genome evolution. Gene loss mostly involved amino-acid, ATP, LPS and cell wall component biosynthesis and tran- scriptional regulators, but with a high preservation of toxin-antitoxin (TA) modules, recombination and DNA repair proteins.
    [Show full text]
  • Detecting Phylogenetic Signals from Deep Roots of the Tree of Life
    UNIVERSITY OF CALIFORNIA,MERCED Detecting Phylogenetic Signals From Deep Roots of the Tree of Life A dissertation submitted in partial fulfillment of the requirements for the degree Doctor of Philosophy in Quantitative and Systems Biology by Katherine Colleen Harris Amrine Committee in charge: Professor Carolin Frank, Chair Professor David Ardell Professor Meng-Lin Tsao Professor Suzanne Sindi August 2013 Copyright Katherine C. Amrine All Rights Reserved UNIVERSITY OF CALIFORNIA,MERCED Graduate Division The Dissertation of Katherine Colleen Harris Amrine is approved, and it is acceptable in quality and form for publication on microfilm and electronically: Faculty Advisor: David H. Ardell Committee Members: Chair: Carolin Frank Meng-Lin Tsao Suzanne Sindi Date iii Contents List of Figures ................................................................. vi List of Tables .................................................................. ix Acknowledgements ............................................................. x Vita ........................................................................... xi Abstract ...................................................................... xii 1 Shifting focus in evolutionary biology – identifying a new signal for phylogenetic tree reconstruction and taxonomic classification 1 1.1 The evolution of bacterial classification and phylogeny . .1 1.2 The historical marker – 16S . .2 1.3 Complications in bacterial classification and phylogeny . .2 1.3.1 Horizontal gene transfer . .2 1.3.2 Does a true tree exist? . .3 1.4 Methods for phylogenetic tree reconstruction . .3 1.4.1 DNA . .3 1.4.2 RNA . .4 1.4.3 Proteins . .4 1.4.4 Data compilation . .5 1.5 Bias in tree-building . .5 1.6 Biological bias in biological data . .6 1.7 The tRNA interaction network . .6 1.8 Information theory . .8 1.9 Machine Learning for bacterial classification . .9 2 tRNA signatures reveal polyphyletic origins of streamlined SAR11 genomes among the Alphaproteobacteria 12 2.1 Abstract .
    [Show full text]
  • Emerging Spotted Fever Group Rickettsiae in Ticks, Northwestern China
    Ticks and Tick-borne Diseases 7 (2016) 1146–1150 Contents lists available at ScienceDirect Ticks and Tick-borne Diseases j ournal homepage: www.elsevier.com/locate/ttbdis Emerging spotted fever group rickettsiae in ticks, northwestern China a,1 a,b,1 c d c Li-Ping Guo , Su-Hua Jiang , Dan Liu , Shi-Wei Wang , Chuang-Fu Chen , a,∗ Yuan-Zhi Wang a School of Medicine, Shihezi University, Shihezi 832000, Xinjiang Uygur Autonomous Region, China b Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430030 Hubei, China c School of Animal Science and Technology, Shihezi University, Shihezi 832000, Xinjiang, China d School of Animal Science and Technology, Tarim University, Aral 843300, Xinjiang, China a r t i c l e i n f o a b s t r a c t Article history: We report Rickettsia conorii subsp. indica, Candidatus R. barbariae and R. massiliae in Rhipicephalus turan- Received 9 March 2016 icus from sheep around the Taklamakan desert, northwestern China. The topology of the phylogenetic Received in revised form 5 August 2016 trees produced from the maximum likelihood (ML) analyses of the ompA-gltA-rrs-geneD-ompB concate- Accepted 15 August 2016 nated sequence data was very similar to that of the neighbor joining (NJ) tree, and with total support Available online 16 August 2016 of 69%–100% bootstrap values for the inclusion of the rickettsiae in Rh. turanicus within the clade that contained R. conorii subsp. indica; Candidatus R. barbariae and Rickettsia sp. Tselentii; R. massiliae str. Keywords: AZT80; and R. massiliae MTU5, respectively. Studies suggest that the co-existence of these spotted fever Rickettsia conorii group rickettsiae is a threat to public health in China.
    [Show full text]
  • Using Core Genome Alignments to Assign Bacterial Species 2
    bioRxiv preprint doi: https://doi.org/10.1101/328021; this version posted May 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. 1 Using Core Genome Alignments to Assign Bacterial Species 2 3 Matthew Chunga,b, James B. Munroa, Julie C. Dunning Hotoppa,b,c,# 4 a Institute for Genome Sciences, University of Maryland Baltimore, Baltimore, MD 21201, USA 5 b Department of Microbiology and Immunology, University of Maryland Baltimore, Baltimore, MD 6 21201, USA 7 c Greenebaum Comprehensive Cancer Center, University of Maryland Baltimore, Baltimore, MD 21201, 8 USA 9 10 Running Title: Core Genome Alignments to Assign Bacterial Species 11 12 #Address correspondence to Julie C. Dunning Hotopp, [email protected]. 13 14 Word count Abstract: 371 words 15 Word count Text: 4,833 words 16 1 bioRxiv preprint doi: https://doi.org/10.1101/328021; this version posted May 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. 17 ABSTRACT 18 With the exponential increase in the number of bacterial taxa with genome sequence data, a new 19 standardized method is needed to assign bacterial species designations using genomic data that is 20 consistent with the classically-obtained taxonomy.
    [Show full text]
  • Bacterial Diversity in Amblyomma Americanum (Acari: Ixodidae) with Afocusonmembersofthegenusrickettsia
    VECTOR-BORNE DISEASES,SURVEILLANCE,PREVENTION Bacterial Diversity in Amblyomma americanum (Acari: Ixodidae) With aFocusonMembersoftheGenusRickettsia 1 2 1 STEPHANIE R. HEISE, M. S. ELSHAHED, AND S. E. LITTLE Department of Veterinary Pathobiology, Center for Veterinary Health Sciences, Oklahoma State University, Stillwater, OK 74078 J. Med. Entomol. 47(2): 258Ð268 (2010); DOI: 10.1603/ME09197 ABSTRACT The lone star tick, Amblyomma americanum (Acari: Ixodidae), is commonly reported from people and animals throughout the eastern U.S. and is associated with transmission of a number of emerging diseases. To better deÞne the microbial communities within lone star ticks, 16S rRNA gene based analysis using bacteria-wide primers, followed by sequencing of individual clones (n ϭ 449) was used to identify the most common bacterial operational taxonomic units (OTUs) present within colony-reared and wild A. americanum.Thecolony-rearedtickscontainedprimarilysequenceafÞl- iated with members of the genus Coxiella (89%; 81/91), common endosymbionts of ticks, and Brevibacterium (11%; 10/91). Similarly, analysis of clones from unfed wild lone star ticks revealed that 96.7% (89/92) of all the OTUs identiÞed were afÞliated with Coxiella-like endosymbionts, as compared with only 5.1Ð11.7% (5/98Ð9/77) of those identiÞed from wild lone star ticks after feeding. In contrast, the proportion of OTUs identiÞed as Rickettsia sp. in wild-caught ticks increased from 2.2% (2/92) before feeding to as high as 46.8% (36/77) after feeding, and all Rickettsia spp. sequences recovered were most similar to those described from the spotted fever group Rickettsia,speciÞcallyR. amblyo- mmii and R. massiliae.AdditionalcharacterizationoftheRickettsialestickcommunitybypolymerase chain reaction, cloning, and sequencing of 17 kDa and gltA genes conÞrmed these initial Þndings and suggested that novel Rickettsia spp.
    [Show full text]
  • Asymptomatic-Anaplasmosis Confirmation Using Genetic And
    Yoo et al. BMC Infectious Diseases (2020) 20:458 https://doi.org/10.1186/s12879-020-05170-9 CASE REPORT Open Access Asymptomatic-anaplasmosis confirmation using genetic and serological tests and possible coinfection with spotted fever group Rickettsia: a case report Jiyeon Yoo1†, Jong-Hoon Chung2†, Choon-Mee Kim3, Na Ra Yun2 and Dong-Min Kim2* Abstract Background: Anaplasmosis is an emerging acute febrile disease that is caused by a bite of an Anaplasma phagocytophilum–infected hard tick. As for healthy patients, reports on asymptomatic anaplasmosis resulting from such tick bites are rare. Case presentation: A 55-year-old female patient visited the hospital with a tick bite in the right infraclavicular region. The tick was suspected to have been on the patient for more than 10 days. PCR and an indirect immunofluorescence assay (IFA) were performed to identify tick-borne infectious diseases. The blood sample collected at admission yielded a positive result in nested PCR targeting Ehrlichia-orAnaplasma-specific genes groEL and ankA. Subsequent sequencing confirmed the presence of A. phagocytophilum, and seroconversion was confirmed by the IFA involving an A. phagocytophilum antigen slide. PCR detected no Rickettsia-specific genes [outer membrane protein A (ompA) or surface cell antigen 1 (sca1)], but seroconversion of spotted fever group (SFG) rickettsiosis was confirmed by an IFA. Conclusions: This study genetically and serologically confirmed an asymptomatic A. phagocytophilum infection. Although SFG rickettsiosis was not detected genetically, it was detected serologically. These findings indicate the possibility of an asymptomatic coinfection: anaplasmosis plus SFG rickettsiosis. It is, therefore, crucial for clinicians to be aware of potential asymptomatic anaplasmosis following a tick bite.
    [Show full text]
  • Infection Potential of Rickettsia Felis Via Ingestion Matthew M
    Louisiana State University LSU Digital Commons LSU Master's Theses Graduate School July 2019 Infection Potential of Rickettsia felis via Ingestion Matthew M. Schexnayder Louisiana State University and Agricultural and Mechanical College, [email protected] Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_theses Part of the Bacteria Commons, Bacteriology Commons, Medical Microbiology Commons, Pathogenic Microbiology Commons, Veterinary Infectious Diseases Commons, and the Veterinary Pathology and Pathobiology Commons Recommended Citation Schexnayder, Matthew M., "Infection Potential of Rickettsia felis via Ingestion" (2019). LSU Master's Theses. 4978. https://digitalcommons.lsu.edu/gradschool_theses/4978 This Thesis is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Master's Theses by an authorized graduate school editor of LSU Digital Commons. For more information, please contact [email protected]. INFECTION POTENTIAL OF RICKETTSIA FELIS VIA INGESTION A Thesis Submitted to the Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College in partial fulfillment of the requirements for the degree of Master of Science in The Department of Pathobiological Science by Matthew M. Schexnayder B.A., Louisiana State University 2012 D.V.M., Louisiana State University 2016 August 2019 May greater glory, love unending be forever thine. ii ACKNOWLEDGEMENTS First and foremost, I would like to thank Dr. Kevin R. Macaluso for readily accepting me into his lab and for offering me the chance to take on an exciting and meaningful project. His easy-going nature and sense of humor have been a breath of fresh air in the too-often stuffy atmosphere of higher academia.
    [Show full text]