WNT SIGNALING DURING INFLAMMATION, MECHANICAL STIMULATION AND DIFFERENTIATION
DISSERTATION
Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy
in the Graduate School of the Ohio State University
By
Danen S. Sjostrom, B.S
Oral Biology Graduate Program
* * * *
The Ohio State University
2010
Dissertation Committee:
Professor Sudha Agarwal, Advisor
Professor Sarandeep Huja
Professor Zongyang Sun
Professor Lai-Chu Wu
ABSTRACT
Wnt signaling is important in many developmental and homeostatic processes.
Among these are chondrogenesis and cartilage maintenance. As has been amply described, cartilage is also a mechanosensitive tissue that is able to respond to its environment. A relatively prominent pathologic environment is created by arthritic diseases. As an autoimmune disease, arthritis creates inflammatory conditions resulting in damage to arthritic surfaces including cartilage. Inflammation can be abrogated by mechanical signals found to block NFB signaling. However, potential repair or regeneration has yet to be studied. This dissertation describes the effects of Wnt signaling in articular disc fibrochondrocytes and C3H10T1/2 mesenchymal cells in the presence of an inflammatory environment. In addition, both cyclic tensile and compressive forces are studied on mature and developing chondrocytes. Importantly, all members necessary for a functioning Wnt/-catenin signaling pathway are present in fibrochondrocytes. In conditions of inflammation and cyclic tensile stress, Wnt components show remarkable stability. However, Wnt4 is regulated by IL-1. Wnt4 expression is downregulated by 1ng/mL exogenous IL-1. In addition to Wnt4,
Frizzled4, Frizzled6 and LRP6 were also regulated by IL-1 when compared to controls.
-catenin expression and protein regulation was found to be consistent but the cellular distribution was also modulated by IL-1. Developing chondrocytes also exhibit Wnt signaling mediation in response to inflammatory and mechanical stimuli. Chondrocyte differentiation in electrospun scaffolds occurs without further stimulation and mediates
ii differentiation compared to more conventional culturing techniques. These results suggest that Wnt signaling can be modulated in both mature and developing cells. In addition, results provide promise for future clinical application of cell-scaffold constructs as therapy for damaged cartilage.
iii
Dedicated to Robin, my wife
and my parents, Scott and Nancy Sjostrom.
iv ACKNOWLEDGMENTS
I would first like to thank my advisor, Dr. Sudha Agarwal for her direction and support.
Without her guidance and enthusiasm I would not have been able to complete my studies.
I am also extremely grateful for the senior researchers and post doctoral fellows I have
had the privilege to learn from; Dr. Thomas Knobloch, Dr. James Deschner and Dr.
Mirela Anghelina. I would also give a special thanks to Dr. Jin Nam with whom I had much collaboration. He is also responsible for the development and synthesis the scaffolds used in my research, for which I am indebted. I would also like to thank the members of my dissertation committee; Dr. Ning Quan, Dr. Sarandeep Huja, Dr. Zongyang Sun and Dr. Lai-
Chu Wu for their support and input. It was my pleasure to work with all those in my lab during my training. I owe my friendship and gratitude to Agata, Bessie, Bjoern, Priyangi,
Shashi and Ravi for the encouragement and friendship they offered.
A special thanks is necessary to my family for their love, encouragement and understanding for the many hours I was away.
v
VITA
September 10, 1979 Born Price, Utah
2003 B.S., Medical Biology University of Utah
2003 – 2010 D.D.S. The Ohio State University College of Dentistry
2003 – 2010 Ph.D. The Ohio State University College of Dentistry – Section of Oral Biology
2005 –2010 National Institute Of Dental & Craniofacial Research (NIDCR) Fellow Individual Predoctoral Dental Scientist Fellowship NIH Grant F30DE017269
PUBLICATIONS
Deschner J, Rath-Deschner B, Wypasek E, Anghelina M, Sjostrom D, Agarwal S. Biomechanical strain regulates TNFR2 but not TNFR1 in TMJ cells. J Biomech. 2007;40(7):1541-9.
Madhavan S, Anghelina M, Sjostrom D, Dossumbekova A, Guttridge DC, Agarwal S. Biomechanical signals suppress TAK1 activation to inhibit NF-kappaB transcriptional activation in fibrochondrocytes. J Immunol. 2007 Nov 1;179(9):6246-54.
Anghelina M, Sjostrom D, Perera P, Nam J, Knobloch T, Agarwal S. Regulation of biomechanical signals by NF-kappaB transcription factors in chondrocytes. Biorheology. 2008;45(3-4):245-56.
FIELDS OF STUDY
Major Field: Oral Biology
vi TABLE OF CONTENTS Page Abstract...……………………………………………………………………...……..……ii Dedication……………………………………………………………………...…………iv Acknowledgements…………….………………………………………….…..……...... v Vita………………………………………………………………….…….……….……...vi List of Tables………………………………………………………………..……….…...ix List of Figures…………………………………………………………………..………....x List of Commonly Used Abbreviations………………………………………….……....xii
Chapters:
1. Introduction and Background……………………………………………………..1
Introduction………………………………………………………………………..1 Cartilage...…………………………………………………………………………4 Cellular Biomechanics………………………………………………………...... 10 Wnt Signaling….………………………………………………………………...15 Conclusion……………………………………………………………………….20
2. The effects of various magnitudes and frequencies of cyclic tensile forces (CTS) on fibrochondrocytes of the TMJ…..………………….………….26
Introduction………………………………………………………………………26 Materials and Methods………………………………………………...…………29 Results……...…………………………………………………………………….34 Discussion………………………………………………………………………..37
3. The effects of CTS on Wnt signaling in inflamed and noninflamed fibrochondrocytes ...…...…...………………………….…………….…………..50
Introduction………………………………………………………………………50 Materials and Methods………………………………………………...…………54 Results……...…………………………………………………………………….57 Discussion………………………………………………………………………..61
4. CTS and N-cadherin in fibrochondrocytes during normal and inflammatory conditions………………………………………………………………………...78
Introduction………………………………………………………………………78 Materials and Methods………………………………………………...…………80 Results……...…………………………………………………………………….83 Discussion………………………………………………………………………..84
5. Micromass Cultures……………………………………………………………...93 vii
Introduction………………………………………………………………………93 Materials and Methods………………………………………………...…………95 Results……...…………………………………………………………………….97 Discussion…………………………………………………………………...….100
6. Discussion and Final Conclusions…………………………………………..….120
Reference List…………………………………………………………….…….123
viii
LIST OF TABLES
Table Page
2.1 Chapter 2 primers .…………...... ………………………………………….32
3.1 Chapter 3 primers.…………….………………...... ……...... ……………….....55
4.1 Chapter 4 primers .…………………………...…………………………………...81
5.1 Chapter 5 primers ………………………………………….………...…………...97
ix LIST OF FIGURES
Figure Page
Chapter 1
1.1 Wnt and cadherin signaling..……………………………………………25
Chapter 2
2.1 Primer sequence example…..…..…………………..……………….…..31 2.2 Temperature gradient example...……….……………………….………32 2.3 Magnitude effect for iNOS expression....……...……………….………43 2.4 Frequency effect for iNOS expression....……………………….………45 2.5 Magnitude effect for aggrecan and collagen expression.……….………47 2.6 Frequency effect for aggrecan and collagen expression ………………..49
Chapter 3
3.1 Firbrochondrocyte -catenin expression..……………………….………67 3.2 -catenin desturction complex expression...…………………….………69 3.3 Wnt receptor expression..……………….……………………….………71 3.4 Wnt4 expression..……………………….……………………….………73 3.5 Wnt3a and Wnt7a protein……………….……………………….………75 3.6 Aggrecan expression and cell proliferation..…………………….………77
Chapter 4
4.1 N-cadherin expression and synthesis..….……………………….………88 4.2 SRC and BCL9-2 expression..………….……………………….………90 4.3 -catenin cellular location...…………….……………………….………92
Chapter 5
5.1 C3H10T1/2 cell growth in scaffolds...….……....……………….………105 5.2 C3H10T1/2 cell characterization....…….……………………….………107 5.3 C3H10T1/2 iNOS expression during differentiation...………….………109 5.4 C3H10T1/2 iNOS expression during scaffold differentiation ….………111 5.5 C3H10T1/2 N-cadherin and sox9 expression..………………….………113 5.6 Wnt5a expression...... ………………….…….………………….………115 5.7 Wnt7a expression ..……………………..……………………….………117 5.8 Wnt11 expression ………………………....…………………….………119
x TABLE OF COMMONLY USED ABBREVIATIONS
APC Adenomatous Polyposis Coli BMP bone morphogenic protein COX-2 cyclooxygenase-2 CTS cyclic tensile strain DSH Dishevelled EFM electrospun fiber matrix FBS Fetal Bovine Serum FGF fibroblast growth factor GSK glycogen synthase kinase IKK I-kB kinase IKK-α IkB kinase subunit alpha IKK-β IkB kinase subunit beta IKK-γ IkB kinase subunit gamma IFN interferon IL-1R interleukin 1 receptor IL-1β interleukin 1β IL-6 interleukin 6 iNOS inducible nitric oxide synthase I-κB inhibitor of NF-κB LEF lymphoid enhancer-binding factor 1 MMP matrix metalloprotease mRNA Messenger Ribonucleic Acid NF-κB nuclear factor kappa B NIK NF-kB inhibitor kinase NO nitric oxide OA/RA Osteo-, Rheumatoid arthritis PBS Phosphate Buffered Saline PCR Polymerase chain reaction PGE2 Prostaglandin E2 rhIL-1β recombinant human IL-1β RT/PCR reverse transcriptase/PCR TCF T cell-specific transcription factor TMJ temporomandibular joint TMJD TMJ disorder TGF-β transforming growth factor β TIMP tissue inhibitor metalloprotease TNF-α tumor necrosis factor
xi CHAPTER 1
INTRODUCTION AND BACKGROUND
Osteoarthritis (OA) and rheumatoid arthritis (RA) comprise the two major types of joint
diseases characterized by joint destruction. In 1995, 40 million or about 15% of
Americans had arthritis. Arthritis prevalence is estimated to increase to 59.4 million or
about 18.2% of Americans by the year 2020 (1). Arthritis also demands large economic resources in America. In 1992, an estimated 64.8 billion dollars were attributed due to
medical expenses and lost wages(2). Osteoarthritis is characterized by gradual
development, increased water and decreased proteoglycan content, and failure of
cartilage collagen matrix. Osteoarthritis is not caused by inflammatory mediators but
progression of the disease is aggravated by them. Instead, osteoarthritis is initiated by
age, mechanical stress to joints and genetics. TNF, IL-1, and nitric oxide are included in
the inflammatory mediators that alter cartilage organization and causes chondrocyte
apoptosis. In osteoarthritis, chondrocytes are first enlarged and become disorganized.
This is followed by fibrillation at the surface of articular cartilage, eventual degradation
and small detached cartilage members in joint synovial fluid may result (3). Rheumatoid
arthritis (RA) is a debilitating disease occurring more than any other inflammatory
arthritis. It affects up to 1.0% of the world adult population and is frequently found in the
temporomandibular joint (TMJ) (4,5,6). Cytokines, including IL-1β and TNF-α, are
1 produced by macrophage and fibroblast cell types in rheumatoid synovium. Rheumatoid
arthritis is characterized by chronic inflammation. Induction of degradative enzymes,
such as matrix metalloproteinases, serine proteases and aggrecanases, results in the
destruction of extracellular matrix and articular anatomy (7). Unlike osteoarthritis,
rheumatoid or arthrosynovitis progressively destroys cartilage and eventually
subcartilaginous bone. Chronic arthrosynovitis is characterized by hyperplasia and
proliferation of synovial cells, inflammatory cell influx, angiogenesis of local vessels,
and increased osteoclast invasion and activation in subcartilaginous bone. Joint articular
cartilage is eventually destroyed leading to fibrosis, calcification and perhaps permanent
ankylosis (8). Both osteoarthritis and rheumatoid arthritis have important implications
for the health of joints and particularly cartilage found in joints.
Articular cartilage (AC) and fibrocartilage (FC) are important joint structures in the TMJ.
Both function to provide smooth articular movement in masticatory and speech
physiology. In antigen induced arthritis (AIA) models, researchers have been able to
show that, when compared to immobilized joints, knees of AIA rabbits treated with
continues passive motion (CPM) therapy exhibited decreased inflammation. Included in this assessment was histological and PCR data indicating decreased levels of IL-1, Cox-
2, and MMP-1. Importantly, CPM also induced the synthesis of the anti inflammatory cytokine IL-10 in inflamed joints (9). In studies involving IL-1β and cartilage destruction, cyclic tensile strain has been found to be beneficial as an antagonist to inflammatory actions. These studies found the production of Cox-II and iNOS are decreased by cyclic tensile strain as well as IL-1β-dependant inhibition of tissue inhibitor
2 of metalloprotease (TIMP). Beneficial results have been observed in both AC and FC types (10,11). Clearly, cyclic tensile stress is able to abrogate catabolic pathways but the effect of cyclic tensile stress on anabolic pathways is poorly understood. The Wnt/beta- catenin pathway is important in cartilage formation and homeostasis. During embryogenesis, Wnts direct differentiation and histogensis of cartilage (12). β-catenin is a transcriptional cofactor and a major component of the signaling pathway regulated by
Wnt proteins. Wnts activate a signaling cascade by binding to membrane proteins. In the absence of activation, β-catenin is marked for ubiquitination by phosphorylation and degraded. In addition to regulation of development, β-catenin is also involved in the adhesion molecule N-cadherin. β-catenin binds to N-cadherin in the cytoplasm ultimately attaching it to cytoskeletal actin proteins. This is important because cadherin complexes may act as a decoy receptors limiting available β-catenin for transport to the nucleus and transcription of target genes (13).
Furthermore, early observations demonstrated that, in vitro, in fibrochondrocytes of the
TMJ, IL-1β inhibits wnt 3a and wnt 7a expression. More importantly, mechanical signals were shown to antagonize IL-1β actions by abrogating IL-1β-induced inhibition of wnt
7a and wnt 3a expression. Wnt 3a induces proliferation in chondrocyte progenitor cells, whereas, wnt 7a induces β-catenin synthesis that is important for the activation of genes associated with chondrogenesis. Simultaneously, mechanical signals inhibited IL-1β- induced upregulation of N-cadherin. N-cadherin sequesters β-catenin, inhibits its nuclear translocation, and ultimately, its actions. Mechanical signals, therefore, regulate three critical chondrogenic functions during inflammation. Mechanical signals were shown to: 3 upregulate wnt 3a thereby regulating chondrocyte progenitor cell proliferation;
upregulate wnt 7a thereby increasing β-catenin synthesis, prechondrocyte proliferation in
the short term, alter matrix production; and downregulate N-cadherin thereby allowing β- catenin-mediated signaling. Thus, there was reason to believe that mechanical signals may act as critical regulators of chondrocyte proliferation and matrix production via β- catenin pathways to repair cartilage during inflammation.
Using embryogenesis as a model for wound healing is not new. Studies have focused on using mesenchymal progenitor cells for skin regeneration, bone regeneration and even myocardium regeneration (14, 15, 16). The TMJ is affected by mechanical loading and stress during normal physiological functions. It is an encapsulated joint containing a synovial lining that produces synovial fluid. Synovial fluid is a known reservoir of mesenchymal progenitor cells and has recently been studied in arthritic joints. Arthritic synovial fluid mesenchymal progenitor cells have been characterized as equivalent to bone marrow mesenchymal progenitor cells and able to differentiate into cartilage (17).
Cartilage
Inhibition of cartilage degradation or initiation and amplification of cartilage repair is
essential for relief of arthritis patients. Cartilage is a type of connective tissue
specifically designed to withstand mechanical stress and support soft tissues. Cartilage
also lowers friction for diarthrodial joints and is important in endochondral ossification of
long bones. Cartilage is composed of chondrocytes situated in lacunae surrounded by an
extracellular matrix of hyaluronic acid, proteoglycans, type II or type I collagen, and 4 small amounts of certain glycoproteins (18). Elastic cartilage also consists of
considerable amounts of elastin. Variation in matrix composition can be seen in each of
the three different forms of cartilage. These forms include hyaline cartilage (the most
common type and precursor of articular cartilage), elastic cartilage and fibrocartilage.
Hyaline and elastic cartilages incorporate collagen type II into their matrix while
fibrocartilage has a matrix characterized by collagen type I. All three types of cartilage
lack nerves, lymphatics, and vascular supply (19). Nourishment is established by
diffusion of molecules from capillaries in the perichondrium or from synovial fluid.
Nerves, lymphatics and blood vessels can be found in the perichondrium, but articular
cartilage lacks a perichondrium. As mentioned earlier, articular cartilage is the target of
degenerative joint diseases like arthritis. Perichondrium is important for potential repair
because it contains cells that, although resemble fibroblasts, are chondroblasts and can be
differentiated into chondrocytes. Because articular cartilage lacks a perichondrium,
treatment of damaged cartilage tissue must rely upon cartilogenisis type therapies.
Articular cartilage is formed during the endochondral ossification of long bones. The
initiating cells of this process are mesenchymal in origin. Mesenchymal cells are first recruited and begin to condense. Cells deep in the condensation become dividing chondroblasts while those cells more superficial become the perichondrium (20). Cells in
the center of the condensation later differentiate into prehypertrophic chondrocytes which
later hypertrophy. Hypertrophic chondrocytes are characterized by expression of type X
collagen while type II and IX production is decreased (21). During hypertrophy of
central cells, cells in the perichondrium are differentiated into osteoblasts that encapsulate
5 the prehypertrophic and hypertrophic sections by subperiosteal bone. Hypertrophic cells probably become apoptotic at this point and vascularization and bone deposition occur on the mineralized cartilage (22). Hyaline cartilage remains as articular cartilage on epiphyseal ends of bones with diarthrodial joints.
Signaling is an important aspect in the development of cartilage and the pattern in which
it is formed. Wnt, Indian hedgehog, TGF-b, and Sox-9 are all important in cartilage
development and associated signaling. Wnt will be discussed in more detail in the
section covering this pathway. Indian hedgehog was first associated with the induction of
intramembranous bone collar formation around the collar of long bones. However, it has
now been recognized as an important chondrocyte proliferator and maturation factor in
conjunction with periarticular cell-derived parathyroid hormone-related protein (PTHrP)
(23). Indian hedgehog (Ihh) is fundamental in regulating developmental processes in
embryos as secreted proteins (24, 25). Upon arriving at the target cells, hedgehog
proteins interact with the cell surface receptor Patched and signals propagated by the
receptor Smoothened in cooperation with primary cilia (25). Intercellularly, signaling
continues through zinc-finger transcription factors Gli1, Gli2, and Gli3, with Gli2 and
Gli1 acting mainly as transcriptional activators of hedgehog target genes and Gli3
functioning primarily as a repressor (27, 28). In Ihh-/- mice, PTHrP expression and cell
division are low in prechondrocyte layers. Decreased polymorphic progenitor cells
subsequently create a deficient number of chondrocytes (29). Evidence is directed to the
PTHrP/Ihh regulatory loop which has been found to operate not only between
prehypertrophic and peri-articular chondrocytes in developing long bones but also
6 between Ihh-expressing condylar chondrocytes and the Sox9-expressing polymorphic
progenitor layer. It is likely that PTHrP, through Ihh signaling, enhances or sustains
proliferation of chondroprogenitor cells and also sustains their viability or lineage association (30).
In addition to others, TGF- related proteins include TGF-s, activins and BMPs. These
secreted proteins act on either type I or type II serine/threonine kinase receptors to
propogate a cellular response. In conjunction with other molecules, TGF-and activin
are important in limb development and specifically impact cartilage formation. BMP2,
BMP4, BMP5 and BMP7 are all expressed during limb bud outgrowth and have been
implicated with chondorgenesis. Like other signaling pathways, however, their function
is dependant on other factors. As is the case with Wnt signaling, BMP signaling
outcomes can be drastically different depending on the receptors present. For example,
BMPs can actually induce apoptosis in mesenchymal cells (31). Specifically, members
of the TGF- superfamily act sequentially to regulate chondrocyte differentiation. TGF-
l, TGF-2 and BMP-4 act synergistically to promote chondrogenesis in chick limb bud
mesenchymal cells. In pre-condensation mesenchyme, TGF- effectively promotes
differentiation. However, in cells that have already begun to differentiate, BMP-2 is most
effective in promoting further differentiation. The response of cells to TGF- depends on
their differentiation status. When grown to high density, TGF- induces early
chondrogenesis in cultures of the mouse multipotent mesenchymal cell line C3Hl0T1/2
(32). Type II collagen is expressed in response to TGF- but cells do not attain the
7 typical chondrocyte morphology, maintaining the appearance of condensed precartilage mesenchyme, suggesting a requirement for additional factors. TGF- promotes chondroblast differentiation of rat calvaria cells plated on matrigel. TGF-, however,
inhibits the formation of hypertrophic cartilage and bone mineralization in cultured mouse long bone rudiments (33); other researchers have also found that TGF- blocks
the conversion of mature chondrocytes to hypertrophic cells (34).
As part of the SRY (sex-determining region on the Y chromosome) family, Sox-9 also
has a HMG (high mobility group) box DNA binding domain. As a master regulator of
chonrogensis, Sox-9 is expressed in conjunction with chondrogenic aggregates.
Inactivation studies of mice induce early death demonstrating severe hypoplasia and
compromised cartilage formation and integrity. Gain-of-function studies in chick
embryos suggest a delicate balance exists between the levels of Sox9 and Runx2. This
balance is important for osteochondroprogenitor differentiation where higher Sox9 levels
lead to chondrogenesis and higher Runx2 levels lead to osteogenesis (35). This balance
has been found to be regulated in part by Wnt/-catenin signaling. In some conditions,
Wnt signaling induces osteoblastic differentiation and suppresses chondrogenic
differentiation (36). There are more than 20 genes with varying roles which act during
embryonic development and mature tissue homeostasis. Again, Wnt signaling will be
discussed in detail in its respective section. However, to be short, the best characterized
Wnt signaling pathway is the canonical pathway. In this pathway, binding of Wnt to cell
surface receptors induces stabilization and accumulation of cytosolic -catenin.
Stabilzied -catenin is then transported into the nucleus where it induces transcription of
target genes. Conditional inactivation of specific Wnt ligand induced -catenin signaling 8 results in osteochondroprogenitors differentiating into chondroblasts rather than osteoblasts, leading to an arrest of osteoblast differentiation. At least some of the inhibitory effect of Wnt/-catenin signaling on chondrogenesis can be explained by a mutual antagonism between -catenin and Sox9.
The point at which canonical Wnt signaling regulates Sox9 is at the post-translational level. By interacting with Sox9, -catenin can antagonizie Sox9 (37). Although there may be other mechanisms of inhibition, this is, nevertheless, an important mechanism by which Wnt/-catenin signaling negatively regulates Sox9 function and chondrogenesis
(38). Conversely, Wnt/-catenin signaling is antagonized by Sox9. Sox9, therefore, inhibits Wnt/-catenin gene transcription targets including proliferation genes. This decreases the cell number at the hypertrophic cartilage stage.
As a tissue, cartilage is unique. It lacks blood vessels and lymphatics and has been known to be difficult to repair or treat. Understanding the structure and function in both formation and maintenance provides insight to treatment and intervention. Many studies have been done to investigate possible regeneration. However, an equal number have focused on synthetic bioengineered implants. Recently, studies have emerged focusing on combinations of both of these approaches. Once a treatment is in place, however, it is imperative to know how that treatment will respond to normal function. For cartilage, this equates to cellular biomechanics.
9
Cellular Biomechanics
Biomechanical signaling regulates diverse and essential functions throughout development and continues to regulate homeostatic maintenance of mature tissue.
Signaling events initiated by mechanical forces during embryogenesis control axial rotation and asculoangiogenesis through hedgehog signaling (39). The cardiovascular system has recently been investigated for the effects of biomechanical signal transduction. Vascular endothelial cells have been found to respond to such signals and evidence has been gathered suggesting mechanical stretch contributes to the regulation of matrix metalloproteinases (40) and, due to hypertention mechanical stress, cardio-cerebrovascular disease (41). In addition to embryogenesis and the cardiovascular system, bone is highly regulated by biomechanical signaling. Bone is a dynamic tissue and is able to remodel and repair in response to stimuli.
Mechanical force is one of the main ways osteocytes perceive and react to stimuli in the surrounding environment. Especially important as age increases, appropriate forces increase bone strength and minimize bone loss (42). Muscle differentiation is enhanced through cyclic tensile train as evidence by the up regulation of myogenic regulatory factors including, MYOD1, MYOG (myogenin), MEF2A, CDKN1A
(p21) in undifferentiated C2C12 cells. Also, increased synthesis of myosin heavy chain (MYHC) and TPM1 (alpha-tropomyosin), resulted in an eventual formation of myotubes (43). These findings and many other reports have been published on the resultant outcome of biomechanical signaling. However, few studies have
10 investigated the actual mechanisms of how these signals operate to produce the end
result.
There are many cell types and conditions in which biomechanical signaling is
important. Of the many pathways that could be studied, few are as studied relative to
cartilage inflammation as the NF-B signaling pathway. This is an important aspect
to understand in light of the two way approach discussed earlier in the introduction.
Cartilage degradation can be induced by inflammation, autoimmune diseases or abnormal joint loading. Cartilage destruction caused by inflammation is contributed to by induced catabolic and inhibited anabolic components. First, induced catabolic products of IL-1β include iNOS, COX-II, and matrix metalloprotease-I (MMP-I). Further, NO and PGE2 produced by iNOS and COX-II cumulatively aggrevate cartilage catabolism. Inhibited anabolic factors include tissue inhibitor of metalloprotease-II (TIMP-II), type II collagen
synthesis, and aggrecan mRNA transcription. Motion based therapies have been shown
to be beneficial for cartilage by shielding the harmful effects of IL-1β induced
inflammation (44, 45). The positive effects of motion on inflammed joints is widely
accepted and recognized as a valuable treatment for debiliatating diseases such as
rheumatoid and osteoarthritis (46, 47, 48). Mechanical signals downregulate
inflammation in articular chondrocytes (AC) by inhibiting NF-kappaB nuclear
translocation and, thereby, suppress proinflammatory gene induction (49). However, the
molecular mechanisms that regulate the long term adaptive response of cartilage to
mechanical loading remains unknown.
11
Signals propagated by the inflammatory mediators IL-1 and TNF- utilize the NF-B
pathway. In this signaling pathway, inflammatory ligands bind to their respective
receptors to begin a series of phosphorylation events. First, IB kinase kinase (IKKK) is
recuited and activated at the cytoplasmic end of the receptors. IKK activates the
heterotrimer IB kinase (IKK) by phosphorylation which then phosphorylates the
inhibitory protein IB. Phosphorylation and eventual ubiquitylation and degradation of
IB allows the NF-B dimmer to translocate to the nucleas where, in collaboration with
coactivator proteins, activates target gene transcription.
As a transcription factor that must translocate to the nucleus, NF-B is essential for TNF-
and IL-1 signaling during inflammation. Biomechanical physical therapy has long
been known to suppress inflammation and restore function to injured joints. The
mechanism of this process was recently investigated using an in vitro system utilizing
primary articular cell cultures. Under conditions of cyclic tensile strain (CTS), the point
of inhibition of inflammatory NF-B signaling was investigated. Multiple points along
this pathway have been found to be regulated by biomechanical stress. First, CTS acts at
IKK to inhibit its activation and results in a marked reduction of IB degradation.
Increased IB protein in the cytoplasm inhibits NF-B nuclear translocation and
inflammatory gene transcription. Second, IB and IB are transcriptionally
upregualted in response to CTS. An upregulation in IkB results in increased cytoplasmic
sequestered NF-B and inhibition of inflammatory cytokine signaling. Finally, IB is
imported into the nucleus in a biomechanical dependant manner. CTS increases nuclear 12 transportation of IB and, thereby, NF-B exportation and downregulation of inflammatory signaling. These points of regulation present the known points of regulation in the NF-B pathway by biomechanical signaling. These three points of regulation provide the information necessary for understanding the potency of CTS in decreasing inflammation.
It is important to offer some discussion on the magnitude dependency of NF-B signaling
regulation. Biomechanical stretch inhibits NF-B nuclear translocation by mechanisms
discussed previously but only under low physiological magnitudes. Treatment with these
conditions not only inhibits NF-B nuclear translocation but also inhibits NF-B mRNA
transcription. On the other hand, CTS of high magnitudes not only failed to inhibit NF-
B nuclear translocation and mRNA transcription but is found to increase translocation to
the nucleus and upregulate mRNA expression of NF-B (50).
Since the establishment of the ECM as an important cellular force transducer, integrins
have come to be recognized as critical mechanoreceptors, and focal adhesions as
nanoscale mechanosensory organelles. There is clear evidence that stress applied to
integrins can produce a local response as in focal adhesion remodeling and signaling (51,
52). However, the entire cell should be thought of as the mechanotransducer because
procession of these stimuli with other extra and intra cellular signals occurs by the whole
of the cell before producing a response. For example, proliferation is induced in adherent
cells when subjected to soluble mitogens when the cell is physically spread on the ECM.
On the other hand, intermediate-sized cells differentiate, and apoptosis results in round or 13 retracted cells (53, 54). Another example which illustrates the importance of the cell on
the eventual out come of mechanical signaling is the extension of lemellipodia. The organization, as well as, the orientation of the force on the cell determines the extention of lemellipodia and cellular movement (55, 56). Of course, in this case, the action is lemellipodia extention.
The overall response of the cell due to mechanical stimuli also depends on the concentration of prestress in its supporting structural network. Since tensed cytoskeletal
members link various mechanochemical transduction elements in the cell, differences in
cellular prestress can impact how different autonomously members work in concert to reach a concerted response (57). Stress-induced activation of cAMP signaling through integrins and large G-proteins is a good example of this differential and autonomous prestress influence. Activation locally at stress sites within focal adhesions at the plasma membrane occur independent of the amount of prestress in cytoskeletan (58). However, higher level responses, such as focal adhesion assembly, growth, contractility and directional motility occur due to changes in prestress and how these changes are integrated with other mediators acting on the cell from microenvironmental stimuli (59,
60).
Therefore, a whole cell physical and chemical integration occurs before a cell responds.
This occurs even though the cells perceive and act to forces locally. This pattern of
cellular behavior to mechanical signals is also true during embryogenesis and tissue
pattern formation. Cell fate is mediated by cytoskeletal microtubule and microfilament
14 interactions. These communications can change cell shape, regulate cell fate and mediate
position-specific control of epithelial architecture during wing development in drosophila
embryos (61). Embryonic wound healing in Xenopus laevis is also mediated by
cytoskeletal contractile forces that extend and bring together many different cells needed
to restore the wound (62). During the formation of mammal epithelial buds and capillary
branches, local bursts in cell proliferation can be seen in the later stages of tissue
morphogenesis. This may be due to area increases in the mechanical compliance of the
tensed basement membranes. These increases change tissue structure and induce greater
cytoskeletal tension within close adjacent cells (63). Cell surface forces can also
potentially affect the pattern formed by tissues during development through changing the
cell division plane. Finally, distorting cell shape and subjecting cells to mechanical
stresses can dictate stem cell commitment.
Wnt Signaling
Wnt signaling is important for embryogenesis and mature tissue homeostasis. Wnt
proteins are secreted in a palmitolyated form which helps direct them to membranes for
signaling. Biochemically, Wnts contain a signaling sequence followed by a conserved
component of cysteine residues to which palmitate is attached. There are three described
wnt signaling pathways. By far, the best characterized and written about is the canonical
wnt or -catenin/went pathway. The hallmark feature in this pathway is the stabilization
and nuculear translocation of -catenin. Another Wnt pathway is the calcium/wnt
pathway. As its name suggests, cellular Ca2+ regulation is the defining aspect of this pathway. Finally, the planar cell polarity (PCP) pathway was initially discovered as the 15 process whereby cells orient themselves relative to the body axes. As a classic example,
the distal orientation of actin-based wing hairs of Drosophila.
The canonical pathway begins with a Wnt protein binding to Frizzled (Fz) and low density lipoprotein (LDL) receptor-related protein (LRP). This complex resides as a transmembrane related unit in the plasma membrane of a target cell. Wnt binding results in the phosphorylation of Dishevelled (Dsh), a cytoplasmic protein. Dsh is thought to interact with Fz directly and its subsequent action is dependant on LRP phosphorylation.
Cytoplasmic phosphorylation of LRP, which also occurs by Wnt binding, allows Axin, a cytoplasmic scaffold protein, to attach to the cytoplasmic tail of LRP. The Wnt pathway is subsequently controlled by β-catenin. Elevation of cytoplasmic β-catenin is an important and defining trait of the Wnt signaling pathway. In the absence of Wnt binding to the Fz/LRP membrane complex, β-catenin is phosphorylated by glycogen synthase kinase-3β (GSK-3) and casein kinase Iα (CKIα). Both kinases are serine/threonine kinases which form a degradation complex with scaffolding proteins Axin and
Adenomatous Polyposis Coli (APC). Phosphorylated β-catenin is then recognized by β-
TrCP, marked for ubiquitination, and degraded in the 26S proteosome. Wnt binding and activation of Dsh inhibits β-catenin phosphorylation and degradation. Cytoplasmic concentrations of β-catenin rise and β-catenin is translocated into the nucleus. Nuclear β- catenin cooperates with transcription factors lymphoid enhancer-binding factor 1/T cell- specific transcription factor (LEF/TCF) to regulate transcription (Figure 1.1). Wnt target genes are more dependant on cell phenotype and cell evnironment than specific Wnt signals. However, in some cases, the same target genes are transcribed in various tissue
16 phenotypes. Three main functions of the Wnt pathway have been described. First, during development, Wnt target genes direct cell proliferation and tissue type selection and differentiation. Next, Wnts are important in mature tissue homeostasis. As its name implies, APC mis-regulation is associated with polyposis coli and colon cancer. A mutation of LRP may increase or decrease bone density in regions of the jaw and palate.
Finally, canonical Wnt signaling can induce regulation of other Wnt signaling members.
Other experimental research suggests that some noncanonical Wnt signaling may involve intracellular calcium transrelease. In zebrafish blastulae, Wnt5a or rat Fz2 overexpression increases the frequency of calcium fluxes in the enveloping layer (EVL) cells (64). Wnt
5a, in addition to Wnt 11, can also activate calcium-sensitive kinases. In Xenopus embryos, Wnt 5a or Wnt11 overexpression activates protein kinase C and calcium/calmodulin-dependent kinase II (65). NFAT is another potential target in certain contexts as it is a calcium-responsive transcription factor (66). Since the common theme in this pathway is calcium, this pathway has been called the Wnt/calcium pathway, to distinguish it from the canonical Wnt/-catenin pathway. Even though disheveled is the first activated cytoplasmic protein in the canonical pathway, a function for Dsh in
Wnt/calcium signaling has only recently been investigated (63). Compared to a modest effect by full length Dsh, Dsh without the DIX domain, and therefore more likely to be active in PCP signaling rather than canonical Wnt/-catenin signaling, produced a stronger effect in calcium flux, PKC, and CamKII assays. Interestingly, by activating
Wnt/calcium members, this previously thought PCP specific member suggests a potential connection between the PCP and Wnt/calcium pathways. In response to Xenopus Frizzled 17 7, PKCand disheveled have recently been shown to form a complex required for
Dishevelled translocation to the cell membrane (67). Therefore, instead of acting linearly,
Dishevelled and PKC may be acting together as part of a protein complex.
The first studies indicating -catenin-independent signaling was introduced from studies
in zebrafish and Xenopus. Initially,observations of 5HT1c serotonin receptor phenotypes
seemed to match from experiments of Wnt 5a overexpression in Xenopus embryos (68).
Importantly, since Wnt receptors had not yet been identified and the 5HT1c receptor
stimulates intracellular Ca2+ release in a G-protein-dependent manner, it was
hypothesized that Wnt5a might activate a similar pathway. It was later found intracellular
Ca2+ release was induced by Wnt5a but not by axis-inducing Wnts. An early study
indicated that there is a preferential Ca2+ release with the Wnt receptor Rfz-2 as
compared to Rfz-2, thereby, separating receptors with either -catenin or Wnt/calcium
signaling tendencies (69). When studied further, Ca2+ release was found to be dependent
on heterotrimeric G proteins as part of the signaling cascade. Confirming this
dependence, results were obtained by a study where biphosphonate compound L-
690,330, which competitively inhibits inositol monophosphatase, blocked Rfz-2 induced intracellular Ca2+ release. Later, intracellular Ca2+ could again be released with the
addition of myoinositol suggesting the Wnt5a signaling through the receptor Rfz-2
involves phosphatidylinositol and G proteins as down stream members of the cascade. As
additional members of this -catenin independent signaling pathway, the enzymes
Ca2+/calmodulin dependent protein kinase II (CamKII) and protein kinase C (PKC) were
found to be independently inmportnant (70,71). Through in vitro kinase activity and 18 autophosphorylation, CamKII activity was confirmed. Since activation and function of
PKC requires translocation to the plasma membrane, this criterion along with in vitro kinase activity was used to establish PKC’s role in Wnt/calcium signaling. On the other hand, the Wnt/-catenin pathway members Wnt-8 and Rfz-1, were not able to activate
CamKII or PKC in these assays. In addition to the regulation of intracellular Ca2+ release,
G protein inhibition also blocks Rfz-2 mediated CamKII and PKC activity. G-protein- mediated activation of CamKII occurs only minutes after the initially signaling event is begun. Understanding of this temporal regulation employed a novel chimeric Frizzled homolog with Rfz-2 for all intracellular sequences, and 2-adrenergic receptors for all extracellular and transmembrane sequences (72). This chimeric receptor was also used to test the minute timeline of Rfz-2 stimulation of Ca21 release only minutes after signaling activation. Similarly, cells expressing the Rfz-2/2-adrenergic receptor chimera and challenged with the 2-adrenergic receptor agonist isoproterenol also demonstrated the rapid requirement for G proteins (68). With response times after signal initiation around ten minutes, these data suggest Rfz-2 stimulation of intracellular Ca21 release and activation of CamKII, occurs through a pathway that directly involves pertussis toxin- sensitive G proteins. Interstingly, frizzled homologs and G-protein-coupled receptors are related. In fact, some responses of cultured cells to signaling do require G proteins (73), but there is no evidence that they act during the activation of the Wnt/-catenin pathway as in the rapid response seen in the Ca2+/Wnt pathway.
19
Conclusion
Development and freedom for movement rely on functional cartilage, just the right amount of cellular biomechanics which can affect everything from initiation of proliferation and differentiation to extracellular matrix breakdown and injury, and proper cellular signaling. Wnt signaling, among other signaling pathways, is critical in many processes including limb bud outgrowth and cell differentiation during embryogenesis, cell proliferation and proliferative malfunction as in colon carcinoma, and inflammatory function. Wnt signaling and its proper function is important during our entire life for many reasons. For the initial development and health of joints, Wnt signaling is essential.
Although cartilage has been studied for many years, it has been described as a troublesome thing and, as early as 1743, Hunter concluded that cartilage once injured is incapable of healing. To be fair, there have been advancements since this 18th century description but treatment of injured cartilage is still very difficult to treat and repair. As is seen with arthritis, disease progression continues despite the best efforts of doctors and researchers alike. Cartilage is avascular, thereby, robbing it from the mechanisms of healing of most other tissues. Undifferentiated cells are not able to be transported through the vascular system for chondrogenesis-like repairs of damaged tissues. Although there have been studies indicating a mesenchymal population within synovial fluid surrounding the cartilage, effective natural repair does not occur through this population of cells. The perichondrium has also been noted as a potential cell bank of chondroblasts necessary for
20 possible cartilage repair. However, articular cartilage does not have a neighboring
perichondrium and thus can not benefit from this mechanism either.
There are many important pathways necessary for cartilage formation and function. Wnt,
Indian hedgehog, TGF-, and Sox-9 are some that were discussed in this chapter.
Interestingly, there is overlap or possible signaling cross talk among all these pathways.
Making a study of cartilage function in relation to this complicated and sometimes
redundant array of function through signaling is, of course, challenging. However, much
advancement has been made in both technique and knowledge for studying a pathway
under these circumstances.
Advancements have also been made in studying the effects and mechanisms of
biomechanical signaling. Again, biomechanical signaling has importance in both
development and homeostasis of mature tissue. During embryogenesis, axial rotation and
asculoangiogenesis occur due to biomechanics which propagates signals through the
hedgehog pathway. As for mature tissue, bone is an excellent example of the impact of
biomechanical signals on the structure and function of tissue. Bone can be either
resorbed or deposited depending on whether the forces are compressive or tensile in
nature. Distinct differences due to biomechanical signaling can be seen in the thickness
and mass of the bone due to use, overuse or a lack of use.
The NF-B pathway has been an important pathway for understanding the effect of
biomechanical signaling within a cell. This pathway has been well characterized for both 21 ligand mediated and mechanical mediated signaling. From the study of this pathway, we have learned that biomechanical signals are dependant on the magnitude and frequency of the force being applied. Another important lesson is that the effects of biomechanical forces, although transitory, can have effects longer than the time that the force is being applied to the cells. This is an important implication for future clinical integration of laboratory findings. As far as how these signals propagate from the cell surface, integrins have appeared at the forefront of proteins that are thought to accomplish this task. In addition to integrins, the cytoskeletal form and the direction of the force relative to the orientation of the cell are additional determinates to the action of the cell. This principle could be demonstrated by the extension of lemellipodia. Finally, the prestress of the cell has also been demonstrated to be an important factor in controlling and predicting the effect of biomechanical forces on cells. The better we understand these processes, the better we can manipulate cell signaling through biomechanics for health.
Importantly, Wnt signaling is one of the pathways that would be invaluable to be able to direct to provide maintenance of health and repair in times of injury. There are three main Wnt pathways described to date. The best characterized is the canonical Wnt pathway. This signaling cascade utilizes -catenin as its regulatory point. If GSK is phosphorylated and deactivated, -catenin is stabilized and is able to translocate to the nucleus for gene transcription. It is important to understand that the genes that will be transcribed depend on the receptor ligand combination as well as the environment of the cell. Therefore, different Wnt ligands can produce different end products and outcomes for the cell/tissue depending on the cell type, environment and receptors present on the 22 cell surface. Which ever the combination is, canonical Wnt signaling has been reported
to be important during development and mature tissue homeostasis. Additionally,
canonical Wnt signaling can induce regulation of other Wnt signaling members.
Wnt signaling can also occur in Wnt independent mechanisms. Important for
understanding data in this dissertation is the Wnt/calcium pathway. Wnts known to
activate this pathway include Wnt4, Wnt5a and Wnt 11. Again, depending on the
organism and the receptors present, some of these Wnts can also activate canonical or
PCP/Wnt signaling. Wnt/calcium signaling involves an increase in intercellular calcium concentration. In addition it utilizes Ca2+/calmodulin dependent protein kinase II
(CamKII) and protein kinase C (PKC) to continue the cascade that ends in gene transcription. There have been reports of cross talk between all three Wnt signaling
pathways. Perhaps the most important crosstalk for the purposes presented in future
chapters is the downregulation of canonical or -catenin Wnt signaling by Ca2+/Wnt signaling.
The combination of study for the effect of biomechanical signaling in cartilage and its effect of Wnt signaling there has promise for better understanding of cartilage under its normal function and the potential benefits of biomechanical and Wnt signaling. Once understood, regimens would ideally be organized to unlock the most effective and beneficial treatments for joint disorders. It was my hypothesis that mechanical signals are potent reparative signals that utilize Wnt mediated signaling pathways to repair inflamed cartilage. This hypothesis is based on the facts that the wnt pathway is
23 potentially regenerative and is important in cartilage homeostasis and chondrogenesis
(22).
24
Fer Src Wnt Src P LRP 1 p120 Y-654 2 P Fer Frizzled Activated 3 P Y-142
P p-β-Catenin APC 3 P Y-142 Proteasome β-Catenin BCL9-2 Actin
TCF/LEF
DNA
Wnt and cadherin signaling: phosphorylation drives both -catenin and cadherin complex stability. Wnt binding initiates signaling that inactivates GSK3 phosphorylation of -catenin. -catenin then translocates to the nucleus and promotes gene transcription. In general, tyrosine phosphorylation destabilizes the cadherin complex and serine/threonine strengthen the complex.
Figure 1.1
25
CHAPTER 2
THE EFFECTS OF VARIOUS MAGNITUDES AND FREQUENCIES OF CYCLIC TENSILE FORCES (CTS) ON FIBROCHONDROCYTES OF THE TMJ
INTRODUCTION
Connective tissues gain important information about their surrounding environment
through mechanical signals. Mechanical signals are important for homeostasis and
alterations in connective tissue structure and function during pathology or growth.
Mechanosignaling has been studied in many types of connective tissue cells including
smooth muscle cells, endothelial cells, osteoblasts, fibroblasts, and chondrocytes.
Interestingly, these cells utilize many of the same signaling pathways; however, the
cellular response to mechanical loading depends on the magnitude, frequency, and type of these forces and the resultant signaling molecules that are expressed.
The initial steps of signaling are thought to be mediated by mechanotransducer molecules
that change their structure in response to mechanical stimuli. There are, however, many
candidates that could fill this roll in biomechanical signaling. For example, cell adhesions molecules including cadherins and gap junctions are prime targets. Also included on the list of potential mediators are primary or stereocilia, ion channels, integrins, collagen, fibronectin, microtubules, and many others. Individual peptide domains have been
26 shown to sequentially unfold in response to mechanical stress as seen in single molecule
force spectroscopy studies in cytoskeletal (73), cell-cell adhesion (74), and extracellularal
matrix (ECM) (75) proteins. Specificity to unfolding in response mechanical forces has
been observed as is the case with temperature. Temperature is also able to initiate protein
unfolding, however, it is done by a mechanism exclusive of mechanical stimulated
unfolding (76). The kinetics of protein-protein or protein-ligand binding can be changed
by altering the stimulus of mechanical signals which are known to shift the molecular
conformation of proteins. For example, the force generated by myosin motors that is
exerted on actin filaments serves to prolong the lifetime of bound crossbridges, whereas
crossbridge release is accelerated if the force on actin filaments decreases (77). Much of
mechanical cell signaling is operated by biochemistry in which the enzymes and substrates are in contact with these celluar scaffolds. An example of these two processes can be observed in the formation of focal adhesions. First, ligands can bind the receptors
in the extracellualr matrix inducing a conformational change and thereby integrins initiate
signaling pathways to initiate focal adhesion assembly (79). Second, mechanical stress promotes focal adhesion assembly through bound integrins by triggering the small
GTPase Rho and activating its downstream targets mDia1 and Rhoassociated kinase
(ROCK), which induce actin filament polymerization and cytoskeletal contraction (80).
The initiatory sequence of biomechanical signals is and important first step in
understanding how forces are transcribed by the cell into actual action by the cell.
However, the action taken is different for each cell and each microenvironment.
Specifically, fibrochondrocytes from the TMJ are mechanosensitive and respond to
27 tensile forces in a magnitude-dependent manner to activate or inhibit catabolic or anabolic events. While high magnitudes of mechanical tensile forces (CTS-H) induce marked upregulation of proinflammatory proteins (iNOS, COX-II, MMP-1, and MMP-3), these same signals inhibit synthesis of TIMP-II and matrix proteins (Collagen type I and type II, proteoglycans). Collectively, these results suggest that tensile forces of high magnitudes are damaging to the fibrocartilage, and may be an important factor in the etiology of TMJDs. Remarkably, mechanical tensile forces of lower magnitudes (3 to
12% tensile forces; CTS-L) are potent anti-inflammatory and reparative signals on fibrochondrocytes (80). CTS-L, abrogates the catabolic actions of TNF- and IL-1 in vitro, by inhibiting expression of multiple genes, such as iNOS, COX-2, IL-1β, TNF-α, and collagenase. Thus, the beneficial effects of CTS/exercise can be attributed, at least partially, to the direct anti-inflammatory and reparative actions of tensile forces on fibrochondrocytes (81), (82). While it is becoming clear that anti-inflammatory actions of mechanical signals are at least partly mediated by the NF-B pathway, how CTS-L initiates repair is as-yet little understood. The objectives of the experiments in this chapter were to first characterize genes known to be sensitive to mechanical signaling in other cells and to calibrate the magnitude and frequency that is most healthy to the cell cultures as assessed by the production of iNOS as an inflammatory marker. The second objective was to assess whether a specific magnitude and frequency could be used to initiate extracellular matrix production as this is one component of what has been defined as repair of cartilage tissue.
28
MATERIALS AND METHODS
Isolation and characterization of Fibrochondrocytes. Fibrocartilage from the disc was
aseptically excised from the TMJ of mature Sprague Dawley female rats, 16-20 weeks
old according to the Institutional Laboratory Animal Care and Use Committee approved
protocols. The excised tissue was diced in Hank’s balanced salt solution (HBSS)
(GIBCO, Grand Island, NY), and transferred to a two compartment digestion chamber where it was digested at 37°C with constant stirring by 10 ml of 0.2 % trypsin (grade
TRL, Worthington) for 10 minutes. Material, thus removed, will be discarded and the cartilage fragments digested with 0.2% Clostridial collagenase (grade CLS, Worthington) for 3 hours. This results in a suspension of viable rat fibrochondrocytes. The suspension is washed in HBSS and seeded in a collagen coated 75 mm3 flask. Cells were then
centrifuged for 5 min at 1000 RPM. Pelleted cells were resuspended in 10 ml of TCM
(Ham’s F-12 (GIBCO) nutrient medium; 10% fetal calf serum; penicillin, 100 U/ml;
streptomycin,10 µg/ml). An aliquot was then removed for cell counting. A total of 2 x
105 cells in 2 ml TCM will be plated in each well of pronectin coated 6 well Bioflex® plates and incubated at 37°C in an atmosphere of 5% CO2 and 95 % humidity. The cells
were used during the first 3 passages, where fibrochondrocytes from the articular disc
exhibit their phenotypic markers as evidenced by the expression of aggrecan and collagen
type I.
Treatment regimens: Fibrochondrocytes were divided in four groups, untreated and
unstressed control cells (group a), cells treated with CTS (group b), cells treated with IL-
29 1 (1 ng/ml as detailed below) (group c), and cells treated with CTS and IL-1 (1 ng/ml; group d).
Application of Cyclic Tensile Strain (CTS): Cells were grown for 4 to 5 days (70-80 % confluence were washed twice with TCM, and incubated with serum-free F-12 medium overnight. Cells were then subjected to equibiaxial stress using Flexercell Stress Unit
(Flexcell International Corp, Hillsborough, NC) regimens in the presence or absence of rhIL-1ß. Preliminary studies with various concentrations of rhIL-1ß (0.1, 0.5, 1.0, 5.0,
10.0 ng/ml) indicate that 1 ng/ml of IL-1 optimally induces iNOS mRNA expression
within 2 hours of incubation (71, 68, 73). All control cells in each assay were also
cultured on Bioflex® plates but not exposed to CTS.
Real Time PCR: RNA was extracted by the use of an RNA extraction kit (Qiagen Inc.,
Santa Clara, CA), according to the manufacturer’s recommended protocols and quantified
spectrophtometrically. A total of 1 microgram RNA was used for RT. The Quantitative
Real-time PCR was performed with Platinum® Taq DNA polymerase (Life
Technologies) using the iCycler IQ real time Detection System from Bio Rad®. SYBR
Green primers were designed with Primer Express®. The volume of each reagent was
calculated as follows: In a total of 25 microliter TaqMan® 2x PCR Mastermix (12.5
microliter), forward primer 300 nM, reverse primer 300 nM, Probe 250 nM, 1 microgram
cDNA, distilled RNAse/ DNase free water to bring the mixture to 25 microliters.
Samples were mixed and added to tube in a 8-tube strip. The samples were then
centrifuged for one minute at 1000 rpm. The Real time cycle was programmed as: Cycle1 30 (1x) Step1: 95.0 ºC for 03.00 min; Cycle 2 (50x) Step1: 95.0 ºC for 00.30 min Step 2: X
ºC for 00.30 min. In an effort to decrease DNA products during PCR, primers were designed to span the longest segment of intron sequence possible to increase the chance that the transcriptase would not complete the intron sequence in the event of DNA contamination. A typical design used can be seen in the aggrecan primers used in these experiments (Figure 2.1). In this example, where the introns are bracketed and primers are highlighted, the primers straddle a 21,049 base pair intron. Primers spanning exon junctions were used when a suitable intron sequence could not be included between the primers. However, of the average primer length of 20 nucleotides only 6-9 nucleotides are need to initiate primer-template binding depending on the GC content of the primer.
As most primers include a GC clamp or at least a more stable 3’ end, relatively few (6-9) nucleotides may initiate binding even in DNA sequences containing mismatched bases for the nuclotides 5’ to the binding 6-9 bases.
ATACCCCATCCACACTCCCCGGGAAGGTTGCTATGGTGACAAGGACGAGTTCCCTGGAG TGAGGACCTATGGAATCCGAGACACCAACGAGACCTATGATGTGTACTGCTTCGCTGAA GAGATGGAGG|intron 5:1341bp|GTGAGGTCTTTTATGCCACATCCCCGGAGAAA TTCACCTTCCAGGAGGCAGCCAACGAGTGCCGGAGGCTGGGGGCACGGTTGGCCACCAC AGGCCAGCTCTACCTTGCCTGGCAGGGCGGTATGGACATGTGCAGCGCTGGCTGGCTGG CGGACCGCAGCGTTCGCTACCCCATCTCCAAGGCTCGGCCCAACTGCGGAGGCAACCTC CTGGGTGTAAGGACTGTCTATCTGCACGCCAACCAGACAGGCTACCCTGATCCCTCATC CCGCTACGACGCCATCTGCTACACAG|intron 6:21049bp|GTGAAGACTTTGTAG ACATCCCAGAAAACTTCTTCGGAGTGGGTGGTGAAGAGGACATCACCATCCAGACAGTG ACCTGGCCAGATCTGGAGCTGCCCCTGCCCCGTAATATTACGGAGGGAGAAGCCCGGGG CAATGTGATCCTCACTGCAAAGCCCATCTTCGACATGTCCCCCACTGTCTCAGAGCCTG GGGAGGCCCTCACACTTGCCCCTGAAGTGGGGACCACAGTCTTCCCTGAGGCTGGGGAG AGAACTGAAAAGACCACCAGGCCCTGGGGCTTTCCCGAGGAAGCCACACGTGGGCCTGA TTCTGCCACTGCCTTCGCCAGTGAGGACCTGGTGGTGCGAGTGACCATCTCTCCAGGTG CAGTTGAGGTCCCTGGTCAGCCCCGCTTGCCAGGGG|intron 7:961bp| Figure 2.1 Aggrecan Primers in Sequence
The temperature for cycle 2 step 2 was optimized for each primer set by examining the expression of each primer set in a temperature gradient. Specificity is directly 31 proportional to the temperature of the reaction. However yield is inversely proportional to the temperature. Therefore, as was the case in for the primers created for aggrecan shown in figure 2.3, when two temperatures appear to produce the same yield the higher temperature was chosen for that primer set reaction.
Lane 1 2 3 4 5 6 7 8 9 Ladder 51.5ºC 53.2ºC 55.5ºC 58.1ºC 60.8ºC 63.5ºC 66.0ºC 68.1ºC
1 2 3 4 5 6 7 8 9 Figure 2.2 Aggrecan Temperature Gradient
Primer sequences used to generate the data presented in this chapter are included in Table
2.1.
Primer Sequence Product Size iNOS Sense CACCTCACTGTGGCTGTGGTCAC 285 bp
Anti-sense GCACCCAAACACCAAGGTCATG
Aggrecan Sense CTACGACGCCATCTGCTACACA 179 bp
Anti-sense GCTTTGCAGTGAGGATCACA
Col1A2 Sense CGAGACCCTTCTCACTCCTG 298 BP
Anti-sense CACCCCTTCTGCGTTGTATT
Table 2.1 Chapter 2 Primers
32 Data collection and real-time analysis enabled Step 3: 72.0 ºC for 00.30 min Cycle 3 (1x)
Step1: 4.0 ºC hold. The relative amount of transcript was determined using the
comparative Ct method as described by the following equation where Etarget and Eref are the real time efficiencies for the target and reference genes respectively.
ΔCPtarget(control –sample) Relative Expression Ratio = (Etarget) ΔCPref(control –sample) (Eref)
CP is defined as the point where fluorescence for a primer reaction set rises appreciably
above background fluorescence and, therefore, ΔCPtarget represents the change in appreciable fluorescence for the target and ΔCPref represents the change in appreciable fluorescence for the reference gene, GAPDH in this case. In all experiments GAPDH or
RPS18 was used as an internal control.
Western blot analysis: To examine each protein, whole cell lysates, 20 to 40 µg protein, were subjected to SDS-10% polyacrylamide gel electrophoresis. The proteins were electrophoretically transferred to a nitrocellulose membrane (NEN), and the membrane blocked with PBS-T (PBS with 0.02% Tween-20, 2% bovine serum albumin and 2% nonfat milk) for 30 min on ice. The blot was then reacted with monoclonal/polyclonal primary antibody (purified IgG) against each specific protein or phosphospecific protein in PBS-T at 1:100 to 1:500 dilution. Primary antibodies against all the proposed proteins and phosphospecific antibodies are commercially available and were obtained from Santa
Cruz Biotechnology Inc, R&D Systems Inc. and Novus Biologicals, Inc. The binding of primary antibodies was detected by HRP-conjugated or Licor flourscence secondary
33 antibodies, at a pretitrated dilution (or as recommended by the supplier) to obtain
maximal binding without significant background. For HRP-conjugated secondary
antibodies, membranes will then be washed and treated with chemiluminescent HRP
substrate Luminol (NEN) for 30 to 60 sec. The blots will be washed 4 times and exposed
to a Reflection® NEF-496 film (NEN) for 30 - 60 sec to visualize the protein. For semi-
quantitative analysis, images captured on Reflection® autoradiographic film will be
analyzed by densitometric analysis of each band using Biorad Fluor-S MultiImager.
Licor probed primary antibodies will be scanned and analyzed using Licor software.
RESULTS
Effects of magnitude on the expression of iNOS in fibrochondrocytes of the TMJ
To study the effects of biomechanical forces on cell signaling, a known marker
for cell activation through biomechanical force had to first be established. A well studied
and predictable gene is iNOS. Not only would iNOS enable experimental and technical
validity but would also provide invaluable information for assessing the inflammatory
nature and environment of the magnitude of biomechanical force applied to the cells. As outlined in the materials and methods, the biomechnical force applied in these experiments was stretch. As previous experiments had been performed on articular
chondrocytes and articular disc cells for the TMJ of rabbits, an evidence based selection
of magnitudes could be selected to test. Cyclic equibiaxial tensile strain (CTS)
magnitudes were applied at 6%, 9%, 12%, and 18%. As was expected and shown in
figure 2.1, rat fibrochondrocyte iNOS gene expression was activated by the addition of
34 1ng/mL rH IL-1However, the application of CTS did not induce any appreciable
iNOS expression at 6%, 9%, 12% or 18%. Each degree of magnitude did, in the presence of 1 ng/mL rH IL-1, decrease the amount of iNOS production as compared the the iNOS
induction control. The greatest effect for magnitude was seen by 12% CTS.
Effects of frequency on the expression of iNOS in fibrochondrocytes of the TMJ
In addition to the amount of force applied to the cells, how often forces change also affects the outcome for the cell. Static versus dynamic forces have been thoroughly investigated and important differences are observed. As an example in the case of inflammation, static forces have no or increased effects on the expression of inflammatory mediators. Dynamic low magnitude forces have an anti-inflammatory effect. The data for frequency determination of cell response in articular disc cells from the TMJ also follow this pattern. Frequencies of 0.25 Hz, 0.05 Hz, 0.01 Hz, and 0.002
Hz were tested in articular disc cell cultures for the effect of dynamic tensile strain on the expression iNOS. Although 0.25 Hz, 0.05 Hz, and 0.01 Hz were all effective in decreasing iNOS expression when compared to cells subjected to only IL-1, 0.05 Hz decreased the amount of iNOS mRNA expression by over 50% compared to 0.25Hz and
0.01 Hz.
Effects of magnitude on the expression of aggrecan and collagen II in fibrochondrocytes of the TMJ
A stable standard for cell activation through mechanical signals was important to establish through the expression of iNOS. However, the definition of repair in these studies included the expression and synthesis of extra cellular matrix. As a connective tissue, articular disc fibrocartilage contains more matrix than cells thereby making a 35 study of the effect of magnitude on cellular matrix production important. To this end,
experiments examining 6%, 9%, 12%, and 18% equibiaxial stretch were designed similar
to the experiments testing for iNOS expression discussed previously. In these
experiments, the expression pattern considered to be reparative did not mirror the expression pattern for decreased inflammation. Adding IL-1 to cell cultures decreased
both aggrecan and collagen type II expression. However, the percribed magnitude did
not affect both extracellular matrix components equally. For aggrecan, 9% equibiaxial
stretch was most effective in abrogating the actions of IL-1. Collagen II, conversely,
was best expressed in the presence of IL-1 when treated with 6% equibiaxial stretch.
Effects of frequency on the expression of aggrecan and collagen II in
fibrochondrocytes of the TMJ
As in the case of iNOS expression, frequency is important for the expression of
the extracellualr matrix components aggrecan and collagen II. Again, the results for the
most effective frequency for matrix gene expression were different than the most
effective frequency for abrogating IL-1 induced iNOS expression. Frequencies of 0.25
Hz, 0.05 Hz, 0.01 Hz, and 0.002 Hz were tested in articular disc cell cultures for the
effect of dynamic tensile strain on the expression iNOS. As in the magnitude
experiments, aggrecan expression was decreased by the addition IL-1. 0.25 Hz was the
only frequency that was able to abrogate the effect of IL-1 on aggrecan expression. For
Collagen II, only 0.25 Hz did not decrease Collagen expression below IL-1 treated cells.
36 DISCUSSION
Early studies in biomechanical signaling in articular cartilage assessed the importance of CTS on inflammation. Inflammatory disorders have been major destructive elements in ailing joints of millions of people. These important studies solidified results important for establishing an in vitro model for studying the effects of biomechanical stretch in chondrocytes. It was shown in 1999 that CTS was able to abrogate the IL-1 induction of iNOS in chondrocytes. From there, investigators discovered CTS also affects the expression patterns of other inflammatory mediators including cox-2, prostaglandin E2, matrix metaloprotease-1, and the induction of iNOS by TNF-It became very clear that biomechanical signals were important for decreasing joint degradation during inflammatory processes. Additional studies centered on the magnitudes that influenced this anti-inflammatory pattern. It was found that, in general, forces of low magnitudes were anti-inflammatory in nature and forces of high magnitudes were pro-inflammatory in nature. As mentioned previously, studies also concluded that dynamic forces were needed to observe abrogation in IL-1 induced expression of pro- inflammatory mediators. Additionally, duration of the IL-1 abrogating effect was determined through experiments investigating the lasting effect of CTS after the actual stimulus had been discontinued. Remarkably, the cellular anti-inflammatory effects of
CTS are able to last for many hours after CTS has stopped. However, how low magnitude dynamic tensile strain was able to accomplish potent anti-inflammatory effects were unknown. Therefore, proceeding studies have focused on possible inflammatory signaling mechanisms that affect inflammatory gene expression.
37 Perhaps the best known pro-inflammatory pathway was found to be affected CTS.
The NF-B pathway utilizes a p65/p50 heterodimer as the hallmark activating feature of
the pathway. Briefly, the make-up and release of p65/p50 determines whether the
pathway will be activated further and pro-inflammatory genes transcribed. P65/p50 is
bound by I-B which is, in turn, phosphorylated by IKK. Upon phosphorylation, the p65/50 heterodimer is released from I-B and is able to translocate to the nucleus. It is
this step that is inhibited by CTS to abrogate the transcription of NF-B response genes.
As a crucial regulatory mechanism, CTS inhibits the phosphorylation of I-B by IKK.
Clearly, the induction and resolution of IL-1 stimulated inflammation in primary
cultures has been thoroughly studied. Not only has a plethora of inflammatory cytokines
been researched in this system but the mechanism has also been discovered and
described. Importantly, the NF-B pathway has been identified as the major contributor
of this inflammatory process. In light of the objectives considered in the whole of this
dissertation, it is important that the up-regulation of these pro-inflammatory genes be
identified to a known canonical inflammatory pathway since there have been some
reports describing wnt signaling as an inflammatory agonist (83, 84, 85). The aim of the
studies beyond this chapter is to investigate the role of wnt signaling in conjunction with
the largest abrogation of IL-1 induced inflammation to better understand how an anti-
inflammatory stimulus can be coupled with a growth and repair stimulus.
To this end, we will consider the effect of inflammation on Wnt signaling. In
rabbit articular chondrocytes, IL-1 has a deleterious effect on Wnt 11 expression and a
positive effect on the expression of Wnt 5a. One of the effects of these wnt ligands can
38 be seen in the modulation of the ECM of mature articular chondrocytes. Wnt 11 acts as a stimulus for collagen II production, whereas, Wnt 5a has a negative effect on collagen II synthesis. Interestingly, these affects differ from studies previously reported during limb development. Chondrogenesis, limb development, and longitudinal skeletal outgrowth have been attributed to Wnt 5a regulation (88, 89. Only prehypertrophic chondrocytes express Wnt-11 and it does not affect chondrogenic differentiation or hypertrophy of chondrocytes in chick micromass culture (90). However, in RCJ3.1 cells, Wnt-11 stimulates chondrogenic differentiation and synthesis of cartilage matrix (91). The seeming differences cited here are explained by the cell and its function at the time of signaling. Wnt ligands bind to receoptors which control the function of the ligand by
directed the signaling cascade through a specific pathway. For example, Wnt 5a is
known to signal through the Wnt/Ca2+ pathway to initiate Chondrogenesis, limb
development, and longitudinal skeletal outgrowth. However, in mature rabbit articular
chondrocytes, Wnt 5a signals through the JNK pathway to down-regulate collagen II
expression. Clearly, the ligand, receptors, and the environment of the cell are important.
A final example of the importance of IL-1 in Wnt signaling is Wnt 7a. Wnt 7a has been described as important and necessary in limb bud development by stimulating
N-cadherin expression and increasing cell-cell adhesion nessary for the condensation of
mesenchymal cells. However, in mature articular chondrocytes, IL-1 induces Wnt-7a
which suppresses type II collagen expression, induces type I collagen expression, and
has no effects on type X collagen expression, thereby, indicating Wnt 7a as a
dedifferentiation stimulus. It is important to note that Wnt 7a induced dedifferentiation
of primary culture mature chondrocytes operates through the Wnt/-catenin pathway. 39 Wnt 7a also inhibits NO-induced apoptosis through a Wnt/-catenin independent mechanism in mature chondrocytes. Understanding how IL-1 can influence Wnt signaling is important for interpreting data and crafting future experiments.
The data presented in this chapter indicate different magnitudes and frequencies best suited for either iNOS abrogation or stimulation of aggrecan and collagen II. For iNOS suppression in the presense of IL-1, a magnitude of 12% biaxial elongation and frequency of 0.05 Hz is efficient. For stimulation of aggrecan and collagen II a magnitude of 6% biaxial elongation and a frequency of 0.25 Hz is most effective.
Because of time constraints a differential study of both magnitude and frequency combinations is not possible.
The magnitude and frequency corresponding to the best abrogation of iNOS was selected to use as a qualifying test for experiments and the configuration for future research. 12% and 0.05 Hz abrogate iNOS more effectively than 6% and 0.25 Hz. There are at least three reasons the magnitude and frequency data for iNOS was chosen over that for aggrecan and collagen II. First, iNOS induction was 43000 to 55000 percent more than control upon IL-1 stimulation and aggrecan. Collagen II suppression was decreased by only 30 and 70 percent respectively upon the addition IL-1Although the decrease in aggrecan and collagen II expression is significant, the normalizing effect of CTS was not as potent as that for iNOS which change was much greater in response to IL-1.
Second, in respect to using a gene as a qualifying test for future experiments, that is to provide an exclusion factor for failed experiments, the inflammatory pathway is much better characterized and the mechanism for the actions of CTS in the pathway is already known. Except for the effect, nothing is known about the mechanism of action for 40 aggrecan and collagen II decrease in response to IL-1 in articular disc cellsFinally, the hope of these studies is to discover the effects of biomechanical signaling in relation to possible repair or regeneration of articular tissue that is beneficial in addition to the known anti-inflammatory effects. IL-1 is known to change the way Wnt ligands propagate upon receptor stimulation. The receptors and, therefore, the pathway and action of Wnts may drastically change in the presence of large amounts of inflammatory products. It is understood that these changes may be beneficial. However, it would be unfortunate in light of the objectives stated for these studies to observe, for example, a compensatory increase in ECM in response to Wnt induced inflammation. Again, it is the hypothesis of these studies that mechanical signals provide reparative benefits in addition to anti-inflammatory benefits observed previously.
41
Figure 2.3 rH IL-1induced iNOS expression is abrogated by CTS in a magnitude dependent manner in fibrochondrocytes of the temporomandibular joint. Bars represent iNOS quantification relative to control samples. rH IL-1induced iNOS production compared to control. CTS alone did not induce iNOS expression over control samples. The addition of CTS to rH IL-1treated groups decreased iNOS expression as compared to rH IL-1 treated cells. The reduction amount is dependent on the magnitude with 12% equibiaxial stretch being the most efficient iNOS reducing magnitude.
42
Figure 2.3
43
Figure 2.4 rH IL-1induced iNOS expression is abrogated by CTS in a frequency dependent manner in fibrochondrocytes of the temporomandibular joint. Bars represent iNOS quantification relative to control samples. rH IL-1induced iNOS production compared to control. CTS alone did not induce iNOS expression over control samples. The addition of CTS to rH IL-1treated groups decreased iNOS expression as compared to rH IL-1 treated cells. The reduction amount is dependent on the frequency of 0.05 Hz equibiaxial stretch being the most efficient iNOS reducing frequency.
44
Figure 2.4
45
Figure 2.5 rH IL-1reduced aggrecan and collagen II expression is abrogated by CTS in a magnitude dependent manner in fibrochondrocytes of the temporomandibular joint. Bars represent aggrecan and collagen quantification relative to control samples. rH IL-1reduced aggrecan and collagen II production compared to control. CTS alone did not induce aggrecan or collagen II expression over control samples. However, the addition of CTS to rH IL-1treated groups increased collagen II expression as compared to rH IL-1 treated cells. The increased amount is dependent on the magnitude of 6% equibiaxial stretch and is shown to be the most efficient collagen II inducing frequency.
46
Figure 2.5
47
Figure 2.6 rH IL-1reduced aggrecan and collagen II expression is abrogated by CTS in a frequency dependent manner in fibrochondrocytes of the temporomandibular joint. Bars represent aggrecan and collagen quantification relative to control samples. rH IL-1reduced aggrecan and collagen II production compared to control. CTS alone did induce aggrecan or collagen II expression over control samples. Further, the addition of CTS to rH IL-1treated groups increased aggrecan and collagen II expression as compared to rH IL-1 treated cells. The increased amount is dependent on the frequency of 0.01 Hz equibiaxial stretch being the most efficient aggrecan and collagen II inducing frequency.
48
Figure 2.6
49
CHAPTER 3
THE EFFECTS OF CTS ON WNT SIGNALING IN INFLAMED AND NONINFLAMED FIBROCHONDROCYTES
INTRODUCTION
Using cartilage differentiation as a model, an initial hypothesis was formulated for cells isolated from the articular disc of the TMJ. Well studied Wnt ligands important in
prechondrocyte proliferation and differentiation include Wnt 3a and Wnt7a. Wnt 3a has
been used extensively for studying the canonical wnt pathway due to its availability and
consistent activation of TCF/LEF reporter assays. In human mesenchymal stem cell
(hMSC) cultures, media supplemented with 10% Wnt3a-conditioned medium induced a
significantly increased proliferation rate when compared to cultures supplemented with
10% mock-conditioned media (92). In addition, cells grown in the presence of Wnt3a
supplemented medium, ALP activity remained at the previous base line. Cells in mock
medium, however, displayed an increase in ALP activity suggesting that Wnt3a does not
initially function in bone differentiation. In validating the importance of Wnt3a in
developing cartilage, in vivo results identify Wnt3a in the developing chick limb. Wnt3a
expression persists in the apical ectodermal ridge (AER) throughout limb development.
Here, Wnt3a induces fgf8 through the -catenin signaling pathway to continue AER
formation (93).
50 Wnt7a is another well known and important signaling ligand in canonical -
catenin signaling. Wnt7a is induced in cartilage cells in the presence of inflammation.
Specifically, in primary culture chondrocytes, IL-1 at 5ng/ml induced Wnt7a in a time
dependent manner. In a segmented time span of zero to thrity-six hours, peak Wnt7a
expression was observed between twelve and twenty-four hours. Although not exact, this
pattern was matched by an increase in -catenin protein synthesis (94). This is an
important observation since Wnt7a signals through -catenin. Wnt7a has been known for
its inhibition of chondrogensis in models where it is overexpressed. The point of this
inhibition has recently been discovered. During chondrogenesis there are four steps to
maturation: proliferation and migration, pre-chondrogenic blastema, chondroblasts, and finally mature chondrocytes. In the first phase, mesenchymal cells aggregate in the limb bud core. These aggregates are structured by cell adhesion molecules including N-CAM
and N-cadherin. Next, the prechondrogenic blastema can be identified by peanut
agglutinin staining. Protodifferentiation of chondroblasts culminates in the following
step. This step is characterized by the initiation of collagen II expression. Cell adhesion
molecules are down-regulated once the cells are fully differentiated chondrocytes and are
Alcain blue-reactive. The Wnt7a block of final maturation in micromass cultures appears
at the early chondroblast maturation stage. The mechanism of this block is thought to be
an upregualtion or stabilization of N-cadherin. N-cadherin stabilization would secure cell
condensation, thereby inhibiting final maturation (95).
Important data has also become available describing Wnt7a as a dedifferentiation mediator in addition to inhibition of differentiation discussed previously. When exogenous Wnt7a is added to primary articular chondrocyte cultures, Wnt7a suppresses 51 type II collagen expression and synthesis of sulfated proteoglycan. Wnt7a also initiated collagen type I expression. Importantly, expression of type X collagen was stable in the presence of Wnt 7a and was only slightly detectable in both control and Wnt7a chondrocyte cultures. This is important to distinguish chondrocyte dedifferentiation and hypertrophic changes. In addition to its ability to dedifferentiate, Wnt 7a is also able to inhibit NO-induced apoptosis in primary culture chondrocytes. Interestingly, this ability is independent of any -catenin signaling.
Wnt 5a in primary cultures is also responsive when cells are exposed to IL-1. At
5ng/ml, IL-1 is able to increase Wnt 5a expression in a time dependent manner. Wnt 5a begins to peak after 6 hours and continues to be strongly expressed up to 36 hours (96).
The change in Wnt 5a expression is significant because Wnt 5a decreases collagen II expression and synthesis. A decrease in collagen II synthesis can be seen after 6 hours of treatment with Wnt 5a. However, protein synthesis changes are not detected appreciably until 24 hours. As is expected, there is also a concentration dependency to the effectiveness of Wnt 5a in decreasing collagen II production. Although Wnt 5a is able to decrease collagen II alone, its action is much more potent when combined with IL-1.
This is probably due to the fact that IL-1 induces more Wnt 5a from the cell suggesting that the collagen response to Wnt 5a is concentration dependent. Interestingly, the mechanism of these actions is not produced through the canonical -catenin signaling pathway. Wnt 5a, in this case, signals through phophorylating JNK, thereby initiating the
JNK pathway (95). Specifically, the regulation is carried out through histone deacetylase
(HDAC). In primary culture chondrocytes, trichostatin or PXD101inhibition of HDAC blocks type II collagen expression. Redifferentiation of dedifferentiated chondrocytes 52 was also blocked through HDAC inhibition by suppressing the synthesis and accumulation of type II collagen. Wnt-5a expression, and decreased type II collagen, is increased through HDAC inhibition. Further, knockdown of Wnt-5a blocked the ability of HDAC inhibitors to suppress type II collagen expression. It was later found the inhibition of HDAC and induction of Wnt-5a expression is associated with acetylation of the Wnt-5a promoter. It is thought that these findings suggest HDAC induces type II collagen expression by suppressing the transcription of Wnt-5a (97).
Wnt 4 has more than one function depending on the location of expression in developing cartilage. Most sources agree that Wnt 4 is a canonical signaling ligand in both pre-natal and post-natal cartilage. In post-natal growth plates, Wnt4 was found to be expressed stronger in the proliferative and prehypertrophic states and weaker in the resting zone (98). In joint phenotypes in mice lacking β-catenin in the entire limb mesenchyme, extensive marker analysis suggest Wnt9a and Wnt4 act redundantly in joint maintenance actively repressing the chondrogenic potential of synovial and fibrous joint cells. However, Wnt4 and Wnt9a are probably not required for the formation of the early joint interzone. This is supported by additional data of limbs lacking mesenchymal β- catenin activity at early stages, when the interzone is being formed, which reveal that early joint markers, in particularly Gdf5 are still expressed, suggesting that Gdf5 expression is not dependent on canonical Wnt-signalling. Wnt 4 and Wnt9a are redundant and important for joint formation. However, it is thought that Wnt genes are not required for the initiation of joint formation since initial joint formation is normal in double mutants for Wnt9a and Wnt4. Later in development, at about E15.5, joint cells in various joints seem unable to maintain their joint cell identity in the absence of Wnt4 and
53 Wnt9a. It has been suggested that Wnt-signalling, probably through the canonical Wnt
pathway, is actively involved in maintaining joint identity by repressing the chondrogenic
potential of cells within the joint region. Some of these cells might still remain as
precursor cells, which are still bipotential, being able to differentiate to chondrocytes as
well as synoviocytes or joint capsule cells (99). This hypothesis is supported by previous
findings showing that synovial tissue contains chondro-progenitors (100).
MATERIALS AND METHODS
Isolation and characterization of Fibrochondrocytes: Isolation and growth of
fibrochondrocytes followed the same protocols outlined in the materials and methods
section of Chapter 2.
Treatment regimens: Fibrochondrocytes were divided in four groups, untreated and
unstressed control cells (group a), cells treated with CTS (group b), cells treated with IL-
1 (1 ng/ml as detailed below) (group c), and cells treated with CTS and IL-1 (1 ng/ml; group d).
Application of Cyclic Tensile Strain (CTS): Cells were grown for 4 to 5 days (70-80 % confluence were washed twice with TCM, and incubated with serum-free F-12 medium overnight. Cells were then subjected to equibiaxial stress using Flexercell Stress Unit
(Flexcell International Corp, Hillsborough, NC) regimens in the presence or absence of rhIL-1ß. As the data in Chapter 1 indicted most effective, a magnitude of 12% stress and
54 a frequency of 0.05 Hz was used for experiments in this chapter. All control cells in each
assay were also cultured on Bioflex® plates but not exposed to CTS.
Real Time PCR: PCR, data collection and analysis were conducted by the same methods described in Chapter 2. Of course, the primer sequences used for the data in this chapter have changed. Primer sequences used to generate the data presented in this chapter are included in Table 3.1.
Primer Sequence (5’ – 3’) Product Size
-catenin Sense TCAGCTGCTTGTACGAGCACATCAG 248 bp
Anti-sense CACAGAGGACCCCTGCAGCTACTC
FZD 4 Sense CCAGGACCCTGGCTTCAGCTATGG 225 bp
Anti-sense TCAGCCAGCTTAGCCGTGGCAG
FZD 6 Sense CTGCTTCCCACCTGCTTACCAGGA 243 bp
Anti-sense CTGCCACGGCTAAGCTGGCTGA
GSK 3b Sense CAAGCAGACACTCCCTGTGA 232 bp
Anti-sense CAGTGGTGTGGATCAGTTGG
LRP6 Sense CAGGCTCGGATTGCTCAGCTCAGTG 260 bp
Anti-sense CAGGCCACAGGGATGCAGTCAATG
Wnt 3a Sense GCTCTGCCATGAACCGTCACAAC 224 bp
Anti-sense CTCCACCCAGCCACGAGACTCTC
Table 3.1 Chapter 3 Primers (Continued)
55 Wnt 4 Sense CCGGACAGTACACGGGGTCAG 222 bp
Anti-sense CCTGACACCCCATGGCACTTG
Wnt 5a Sense GGAATTCGTGGACGCACGAGAAAGG 246 bp
Anti-sense ATGGCCGCTGCGCTGTCATACTTC
Wnt 7a Sense ACCCAAGGCAACCTGAGTGACTG 243 bp
Anti-sense GCCATGGCACTTACACTCCAGTTTC
Western blot analysis: To examine each protein, whole cell lysates, 20 to 40 µg protein, were subjected to SDS-10% polyacrylamide gel electrophoresis. The proteins were electrophoretically transferred to a nitrocellulose membrane (NEN), and the membrane blocked with PBS-T (PBS with 0.02% Tween-20, 2% bovine serum albumin and 2% nonfat milk) for 30 min on ice. The blot was then reacted with monoclonal/polyclonal primary antibody (purified IgG) against each specific protein or phosphospecific protein in PBS-T at 1:100 to 1:500 dilution. Primary antibodies against all the proposed proteins and phosphospecific antibodies are commercially available and were obtained from Santa
Cruz Biotechnology Inc, R&D Systems Inc. and Novus Biologicals, Inc. The binding of primary antibodies was detected by HRP-conjugated or Licor flourscence secondary antibodies, at a pretitrated dilution (or as recommended by the supplier) to obtain maximal binding without significant background. For HRP-conjugated secondary antibodies, membranes will then be washed and treated with chemiluminescent HRP substrate Luminol (NEN) for 30 to 60 sec. The blots will be washed 4 times and exposed to a Reflection® NEF-496 film (NEN) for 30 - 60 sec to visualize the protein. For semi-
56 quantitative analysis, images captured on Reflection® autoradiographic film will be
analyzed by densitometric analysis of each band using Biorad Fluor-S MultiImager.
Licor probed primary antibodies will be scanned and analyzed using Licor software.
RESULTS
Effects of cyclic tensile strain and IL-1 on -catenin in fibrochondrocytes of the TMJ
The basic unit of canonical Wnt signaling is -catenin. After binding of a Wnt
ligand to a frizzled receptor and LRP coreceptor, a sequence of phosphorylations
inactivate GSK3. GSK3 is then unable to phosphorylate -catenin which preserves it
and allows nuclear translocation where -catenin binds to TCF/LEF and initiates gene
transcription. The quantity of -catenin is, therefore, important for Wnt induced gene transcription. A measurement of both the amount of -catenin being transcribed and total
protein will reveal the effect of experimental conditions on the relative change in total -
catenin. RNA harvested from cells treated with 1 ng/mL rH IL-1 and CTS at 12% and
0.05Hz did not result in a significant difference between any of the experimental groups
at p<0.05. As can be seen in figure 3.1A, -catenin gene transcription is constant
throughout the groups. Regardless of the method, an increase in free total -catenin
results in nuclear translocation. Total -catenin protein was measured after thirty and
sixty minutes of CTS at 12% and 0.05Hz. The results were analyzed by western blot.
Figure 3.1B clearly demonstrates a remarkably constant level between each group.
57 Effects of cyclic tensile strain and IL-1 on -catenin intracellular signaling members in fibrochondrocytes of the TMJ
There are multiple steps from Wnt binding at the cell surface to -catenin binding to the TCF/LEF transcription factor complex. Some proteins involved in this process include Axin, Axin2, APC and GSK3These proteins make up the degradation complex which -catenin interacts for serine/threonine phosphorylation and its ultimate ubiqutination and degradation in a proteaosome. Axin is important as a scaffold for the degradation complex and is thought to dock with the cytoplasmic tail of the Wnt coreceptor LRP. APC is another important scaffolding protein. Deregulation of this protein through mutation impairs the complex, allows -catenin to build to high quantities in the cell and is known to be a major contributor to the etiology of certain types of cancer. GSK3 is the kinase that phosphorylates -catenin. Unlike other kinases which must be activated, GSK3 is naturally active and must be deactivated through Wnt signaling. It is important to note that GSK3 is important in other cell signaling processes including the AKT pathway.
The application of rH IL-1 did not affect the expression of either axin or axin2.
Similarlly, APC and GSK3 were not altered from their normal expression levels by addition of rH IL-1In the presence of CTS at 12% and 0.05Hz, the expression of axin, axin2, APC or GSK3 was also not changed at a p<0.05 level. Finally, the combination of 1 ng/mL rH IL-1plus CTS at 12% and 0.05Hz did not significantly increase or decrease the expression of these proteins (Figure 3.2).
58 Effects of cyclic tensile strain and IL-1 on -catenin receptors in fibrochondrocytes of
the TMJ
In general, Wnt signaling through -catenin involves two receptros. Frizzled
receptors consist of seven-transmembrane domains, one of which is thought to directly
bind to the intracellular protein dishevelled. LRP are also coreceptors for necessary for
Wnt signaling. Without these receptors, Wnt is not able to bind to the cell surface, no
signal is propagated and no genes are transcribed. Receptors are specific for the Wnts
they receive. The most common coreceptor form, LRP6, and two types of frizzled
receptors were investigated. Frizzled 4 has been reported as a receptor for Wnt5a and
Frizzled 6 has been reported as a receptor for Wnt4. Interestingly, Frizzled 6 has also
been shown to be a negative regulator of Wnt signaling in some cases.
Effects of cyclic tensile strain and IL-1 on -catenin ligands in fibrochondrocytes of
the TMJ
There are over twenty Wnt ligands. The lack of specific data on many one-to-one
correspondence between Wnts and receptors suggest that a single Frizzled may be
activated by more than one Wnt ligand or that a certain Wnt might bind multiple
Frizzleds. Wnts important in cartilage development, defined here as proliferation and
differentiation, include Wnt4, Wnt5a, Wnt3a and Wnt7. The eventual gene transcription
that occurs after the binding of these Wnts depends largely on the local environment of
the particular tissue in which they are found. The type of receptor and coreceptor is an
example of one factor that makes up each unique environment. The experimental design
for assessing these Wnts was modeled from the previous experiments described for RNA 59 and protein analysis. Wnt4 expression was found to be significantly decreased by IL-1
and IL-1 plus CTS when compared to CTS alone. Although Wnt5a was strongly
expressed in these experiments, no significant difference was observed between any of
the four experimental groups. Investigation of Wnt3a and Wnt7a protein revealed no
recognizable difference between control and IL-1, stress or combination groups. -
catenin location was investigated by immunoflouresence. The important translocation of
-catenin from the cytoplasm to the nucleus did not increase or decrease in the presence
of IL-1, exogenous Wnt or in the combination group of IL-1 and Wnt.
Effects of cyclic tensile strain and IL-1 on aggrecan and cell proliferation in
fibrochondrocytes of the TMJ
The hypothesis of this dissertation is that induction of Wnt signaling through
biomechanical signals would increase proliferation and matrix production and result in
the repair or regeneration of inflamed fibrochondrocytes. The main components of
cartilage are cells and matrix. Increase in these two components were analyzed in the
form of aggrecan expression and cell proliferation. Cells were grown for 4 to 5 days (70-
80 % confluence), the RNA extracted and analyzed by PCR. Aggrecan was not
significantly different in any of the experimental groups compared to control. For assaying cell number, cells were plated and allowed to attach. Then, cells were subjected to experimental conditions and assayed 24 hours later. IL-1 significantly decreased cell number compared to control. Adding CTS at 12% and 0.05 Hz rescued this drop to numbers similar to control.
60 DISCUSSION
The data presented in this chapter describes the behavior of Wnt signaling in noninflamed and inflamed fibrochondrocytes harvested from the articular disc. These conditions were also examined under CTS. As -catenin is the hallmark component of this signaling process, regulation of the production and total amount of available - catenin would influence cell signaling. This is especially important with -catenin since its nuclear translocation and binding to TCF/LEF is dependant on -catenin reaching a quantity sufficient for nuclear translocation. The experimental data provided in this section demonstrates that, on the RNA level, -catenin is not significantly regulated between any of the groups studied. Additionally, -catenin total protein did not change between any of the groups after a period of treatment of thirty minutes. Prolonged stimulation of sixty minutes also resulted in constant total protein.
Importantly, these results show that mature fibrochondrocytes from the articular disc produce -catenin. However, the constant nature of -catenin on both the RNA and protein level suggest that signaling is constant for cells treated with inflammation and biomechanical stretch. Although consistent signaling under these conditions may be true, another option is possible which would increase or decrease -catenin signaling under the experimental conditions outlined in this chapter. Other proteins bind -catenin and sequester it from the signaling process. If this process occurred, RNA would not show changes for -catenin and total protein would not necessarily change. One protein that is involved with -catenin and would possibly sequester free -catenin from signaling is N- cadherin. N-cadherin will be discussed in it's own chapter. But to be short, N-cadherin
61 binds -catenin as part of its structural complex. Specific phosphorylation events are able to release -catenin to the cytoplasm. This process may be a key regulator of available signaling -catenin.
Another possibility exists where Wnt signaling may be active in these cells.
Depending on the environment and the Wnt ligand involved, Wnts may signal through calcium signaling. In this process, calcium replaces -catenin as the regulatory mechanism for eventual gene transcription. Some known Wnts involved in Wnt/calcium signaling include Wnt5a and Wnt11. Further investigation of these Wnts may reveal active Wnt signaling under the experimental conditions studied here.
Disregulation of the -catenin destruction complex is most notably known as the pathology of certain types of cancer. As the phosphorylation sequence is disrupted at this point, -catenin is free to accumulate and promote gene expression. In this case, an increase in the quantity of destruction complex units in the cytoplasm would decrease signaling if stimulation from receptor components is held constant. However, this is not the only consequence of increased number of Axin, APC and GSK3. Investigation has led to a more recent finding localizing this complex to the plasma membrane. Here, the complex can hold -catenin at the plasma membrane much like N-cadherin (101). There is also evidence that membrane complexes can work with N-cadherin through phosphorylation to increase -catenin turnover (102). An increase in complex members here would not only withdraw more -catenin from signaling by binding to additional destruction complexes but also increase the degradation of -catenin itself. However, the expression of these members did not increase indicating that the quantity of potential
62 signaling -catenin is not changed as its quantity relates to phosphorylation and ubiqutination.
Although no significant differences were observed in -catenin or its destruction complex, important Wnt receptors were modulated by IL-1. Of the three receptors
examined, two propagate the Wnt signal and one is thought to inhibit Wnt signaling.
LRP6 is a common coreceptor used by many Wnts. In the presence of IL-1 it was
significantly decreased. This is important as the decrease would limit Wnt signaling to
the nucleus and reduce the ratio of functioning versus decoy receptors in a concentration
competitive environment. Frizzled 4 is known to bind Wnt4 in some cases and acts as
another important receptor in -catenin propagated signaling (103). The consequences of
IL-1 mediated downregulation of frizzled 4 would be similar to those discussed for
LRP6 depending on the environment the receptor is found. In some cases, frizzled 6 acts as a -catenin signaling Wnt receptor. In one study, a four fold increase of frizzled 6 expression in B-cells resulted in increased B-cell leukemogenesis by increasing - catenin signaling (104). However, frizzled 6 has another reported role in Wnt signaling through -catenin. Frizzled 6 can act as a negative regulator of Wnt signaling. This inhibition occurred in the presence of a stabilized β-catenin(S33Y) mutant, and glycogen synthase kinase-3β repression by LiCl. This inhibition could be reversed by removal of
N′- or C′-terminal sequences of frizzled 6. Since β-catenin stabilization remained constant throughout the experiments, the authors suggested that frizzled 6 does not affect Wnt signaling at the -catenin level. Instead, frizzled 6 transmits a repressive signal that inhibits the canonical Wnt pathway downstream of the β-catenin destruction complex.
63 Within the nucleus, frizzled 6 does not affect T-cell factor 4 or its association with β- catenin. However, frizzled 6 does inhibit the binding of the TCF/LEF transcription factors to DNA (105). Therefore, a decrease in frizzled 6, as presented in figure 3.3C, may increase signaling without changing -catenin quantity in the cytoplasm or nucleus.
Wnt expression is important for -catenin stabalization and accumulation.
Important Wnts included in limb development including cartilage differentiation and proliferation are Wnt3a, Wnt4, Wnt5a and Wnt7a. Particularly, Wnt4 is important in joint homeostasis. Possibly, Wnt4 decreases cell proliferation in crucial areas such as synovial cavities. Wnt4 is complementary to frizzled 6. As discussed in previously, frizzled 6 may decrease Wnt signaling by inhibiting TCF/LEF association with DNA. This possibility is counterintuitive considering earlier Wnt functions but maybe an important process in joint homeostasis. In the IL-1 environment, Wnt4 expression is significantly less than cells under CTS. This decrease may be important in releasing -catenin signaling by allowing TCF/LEF binding to DNA. Importantly, Wnt expression of other Wnts studied were not changed. Wnt3a is known to induce proliferation in chondrocytes and Wnt7a is important in early proliferation and later differentiation, important processes for repairing damaged cartilage. Adding Wnt3a to cell cultures of articular cell fibrochondrocytes did not change -catenin quantity or location within the cells. These results suggest a couple possibilities for mature fibrochondrocytes. First, the correct receptor for Wnt3a in articular fibrocartilage may not be present. Second, the pathway is inhibited. There are many ways that Wnt may be inhibited. Wnt inhibitory factor (WIF) binds to Wnt and inhibits Wnt signaling. Dickkopf (DKK) binds to LRP6 and inhibits Wnt signaling.
64 Although frizzled 6 does not affect -catenin quantity or location, it would inhibit Wnt feedback loops which, in some cases, amplify Wnt signaling.
As functional experiments designed to asses final outcomes of my hypthosis for
Wnt signaling in inflamed fibrocartilage, cell proliferation and matrix production were assessed. There was no difference in aggrecan expression between any of the experimental groups. This consistency maybe be partially due to Wnt4 downregulation and subsequent release of frizzled 6 inhibition of TCF/LEF binding to DNA to continue homeostatic -catenin signaling. Interestingly, there is a significant difference between cell number in the control group and the IL-1 group. IL-1 significantly decreased cell proliferation. This decrease was rescued by treating IL-1 cell concomitantly with CTS.
65
Figure 3.1 No difference in -catenin is observed in rat articular disc fibrochondrocytes when treated with 1 ng/mL rH IL-1, cyclic tensile strain (CTS) of 12% equibiaxial stretch and 0.05 Hz or the combination of IL1-b and CTS. Cells were grown for 4 to 5 days (70-80 % confluence), the RNA extracted and analyzed by PCR and western blot analysis. -catenin expression (3.1A) or protein synthesis (3.1B) is not changed by IL-1, equibiaxial stress or the combination of the two conditions. Mean values ±SE of at least 3 samples from a representative experiment are shown.
66
-CATENIN
-ACTIN
IL-1 - + - + - + - + CTS - + - + - + - +
30 min 60 min
FIGURE 3.1B
67
Figure 3.2 Important components of the -catenin degradation complex demonstrate consistency in rat articular disc fibrochondrocytes when treated with 1 ng/mL rH IL-1, cyclic tensile strain (CTS) of 12% equibiaxial stretch and 0.05 Hz or the combination of IL1- and CTS. Cells were grown for 4 to 5 days (70-80 % confluence), the RNA extracted and analyzed by end point and real-time PCR. Axin, Axin2, APC and GSK3 expression is not changed by IL-1, equibiaxial stress or the combination of the two conditions. Mean values ±SE of at least 3 samples from a representative experiment are shown.
68 AXIN
GAPDH
AXIN2
GAPDH
APC
GAPDH IL-1 - + - +
CTS - - + +
Figure 3.2
69
Figure 3.3 Wnt receptor expression in rat articular disc fibrochondrocytes is decreased when treated with the combination of IL1- and CTS. However CTS alone did not regulated these receptors. Cells were grown for 4 to 5 days (70-80 % confluence), the RNA extracted and analyzed by PCR. LRP6 expression was significantly decreased by IL-1 and the combination group of IL-1 and CTS. However, CTS alone did not regulate LRP6 expression compared to control(3.3A). Frizzled 4 experimental results were very similar to LRP6 with significant difference between the control group and the IL-1 and combination groups. Additionally, the combination group is significantly different from the stress group (3.3B). Frizzled 6 produced significant differences between the IL-1 group and the control group and stress group. Like Fizzled 4, frizzled 6 expression was significantly different between the stress group and the combination group. Mean values ±SE of at least 3 samples from a representative experiment are shown.
70 FIGURE 3.3A
FIGURE 3.3B
FIGURE 3.3C
71
Figure 3.4 Wnt4 ligand expression in rat articular disc fibrochondrocytes is decreased when treated with IL1- and the combination of IL1- and CTS. However CTS alone did not regulate this ligand. Wnt5a remains unchanged when subjected to these conditions. Cells were grown for 4 to 5 days (70-80 % confluence), the RNA extracted and analyzed by PCR. Wnt4 expression was significantly decreased by IL-1 and the combination group of IL-1 and CTS. However, CTS alone did not regulate Wnt4 expression compared to control(3.4A). Wnt5a experimental results were unchanged in any experimental group. (3.4B). Mean values ±SE of at least 3 samples from a representative experiment are shown.
72
Figure 3.4A
Figure 3.4B
73
Figure 3.5 Wnt3a and Wnt7a protein are not regulated in rat articular disc fibrochondrocytes when treated with IL1-CTS alone or the combination of IL-1 and CTS. -catenin location within the cell was not changed by IL-1 or the addition of exogenous wnt. Cells were grown for 4 to 5 days (70-80 % confluence), the protein was extracted and analyzed by western blot. Wnt3a and Wnt7a protein was not significantly changed by IL-1CTS or the combination group of IL-1 and CTS (3.5A). -catenin cellular location, including nuclear translocation, is unchanged in experimental conditions of added IL-13.5B) exogenous Wnt (3.4C) or the combination of IL-1 and Wnt (3.5D). Mean values ±SE of at least 3 samples from a representative experiment are shown.
74 Wnt 3a -actin Figure 3.5A Wnt 7a -actin
IL-1 - + - + CTS - - + +
B C
CONTROL IL-1
D E
WNT WNT + IL-1
Figure 3.5
75
Figure 3.6 Aggrecan expression in rat articular disc fibrochondrocytes is not changed compared to control when treated with IL1-CTS or the combination of IL1- and CTS (3.6A). Cell proliferation was significantly decreased in the IL-1 group relative to control and the combination group of IL1- and CTS (3.6B). For assaying RNA, cells were grown for 4 to 5 days (70-80 % confluence). The RNA was extracted and analyzed by PCR. For determining proliferation, cells were subjected to experimental conditions and assayed 24 hours later. For aggrecan expression, no significant difference was observed in any condition. However, IL-1 significantly decreased cell number compared to control. In addition, CTS was able to rescue this decrease as the combination group was significantly increased compared to the IL-1 group (3.6B). Mean values ±SE of at least 3 samples from a representative experiment are shown.
76
Figure 3.6A
Figure 3.6B
77 CHAPTER 4
CTS AND N-CADHERIN IN FIBROCHONDROCYTES DURING NORMAL AND INFLAMMATORY CONDITIONS
INTRODUCTION
Chondrogenesis can be described as having four phases. First, proliferation and migration of mesenchymal cells occur preparing the cells and environment for continued cell growth. Next, these cells form aggregates in which N-cadherin and N-CAM are upregulated. This phase is known as the prechondrogenic blastema. Collagen expression is initiated next as the cells become protodifferentiated chondroblasts. Cell adhesion molecules including N-cadherin, are downregulated when the cells become fully differentiated. At this point, there is enough proteogycan production to produce a positive
Alcian blue stain. If N-cadherin is not downregualted at the protodifferentiated chondroblast stage, differentiation cannot continue. This step is thought to be sometimes inhibited by upregulation of Wnt7a because Wnt7a is known to upregulate N-cadherin production. Therefore, cartilage differentiation is related to the Wnt pathway and N- cadherin through Wnt7a. This is, however, not the only junction of N-cadherin and Wnt.
Like Wnt7a, -catenin also links N-cadherin to Wnt signaling. As has been discussed, -catenin is an essential component of canonical Wnt signaling. Likewise, -
78 catenin is also an important protein in the cytoplasmic domain of the cadherin complex.
Here, -catenin plays an important role in the structural and functional organization of cadherin. Another catenin, p120, adheres to the cytoplasmic tail of cadherin. p120 catenin is important for structural and functional regulation of the cadherin complex. -catenin binds to p120 catenin and, in turn, -catenin binds to -catenin. Finally, -catenin links extracellular to intracellular by binding to the actin cytoskeleton.
Regulation of this complex occurs through phoshporylation. In general, serine/threonine phosphorylation of -catenin results in great catenin/cadherin
stabilization. Alternatively, tyrosine phosphorylation of -catenin results in disruption of
this complex. Since -catenin binds to the cytoplasmic tail of cadherin to -catenin, total
release of -catenin requires two phosphorylation steps. Fer, a tyrosine cytoplasmic
kinase, releases -catenin from -catenin. -catenin is released from cadherin by Src,
another tyrosine kinase. Cadherin release from the cell surface requires phophorylation of
p120 by Src or Fer. This may be due to either the loss of -catenin from the complex or
because p120 is associated with protein tyrosine phosphatases that inhibit tyrosine kinase
phosphorylation effects on the complex. In general, protein tyrosine phosphatases
increase cadherin cell adhesion and strengthen catenin binding to cadherin. It is important
to consider the consequences of the relationship between cadherin and the available
signaling -catenin.
The importance of -catenin location was exemplified in C3H10T1/2 cells. A
biochemical distribution study revealed a greater distribution of -catenin at cell
junctions in normal and especially MNCD2-T1/2 cells which overexpress N-cadherin.
79 However, in cells expressing a dominant negative form of N-cadherin, non continuous -
catenin was observed at cell junctions. Later experiements revealed that higher amounts
of total -catenin are found in C3H10T1/2 cells campared to MNCD2-T1/2 which
overexpress N-cadherin and 390-T1/2 cells which express a dominant negative form of
N-cadherin. As would be expected, nuclear -catenin was found to be highest in 390-
T1/2 cells then C3H10T1/2 cells and finally MNCD2-T1/2 cells. These results suggest
that N-cadherin can sequester -catenin from nuclear signaling.
As a counter to downregulation of Wnt signaling in response to -catenin
sequestration, Wnt signaling can increase -catenin saturation at the cell membrane and
increase cell-cell adhesion. Two suggestions were made to explain the increased -
catenin/N-cadherin association. First, Wnt expression may result in a posttranslational
modification of -catenin increasing it's affinity for N-cadherin. Second, -catenin may
transfer between a N-cadherin bound and unbound pool (105).
MATERIALS AND METHODS
Isolation and characterization of Fibrochondrocytes: Isolation and growth of
fibrochondrocytes followed the same protocols outlined in the materials and methods
section of Chapter 2.
Treatment regimens: Fibrochondrocytes were divided in four groups, untreated and
unstressed control cells (group a), cells treated with CTS (group b), cells treated with IL-
80 1 (1 ng/ml as detailed below) (group c), and cells treated with CTS and IL-1 (1 ng/ml; group d).
Application of Cyclic Tensile Strain (CTS): Cells were grown for 4 to 5 days (70-80 % confluence were washed twice with TCM, and incubated with serum-free F-12 medium overnight. Cells were then subjected to equibiaxial stress using Flexercell Stress Unit
(Flexcell International Corp, Hillsborough, NC) regimens in the presence or absence of rhIL-1ß. As the data in Chapter 1 indicted most effective, a magnitude of 12% stress and a frequency of 0.05 Hz was used for experiments in this chapter. All control cells in each assay were also cultured on Bioflex® plates but not exposed to CTS.
Real Time PCR: PCR, data collection and analysis were conducted by the same methods described in Chapter 2. Of course, the primer sequences used for the data in this chapter have changed. Primer sequences used to generate the data presented in this chapter are included in Table 4.1.
Primer Sequence (5’ – 3’) Product Size
N-cadherin Sense GACTGCACCGACGTAGACAGGATCG 282 bp
Anti-sense GATGGCATCAGGCTCCACGGTATC
BCL9-2 Sense GTGCACTCCCCGCTGGTCAC 235 bp
Anti-sense CAAGACAGCCATGCCTAGTC
SRC Sense CCTATGTGGAGCGGATGAAC 258 bp
Anti-sense GCTCACCACTAAGGGCAGAG
Table 4.1 Chapter 4 Primers 81
Western blot analysis: To examine each protein, whole cell lysates, 20 to 40 µg protein, were subjected to SDS-10% polyacrylamide gel electrophoresis. The proteins were electrophoretically transferred to a nitrocellulose membrane (NEN), and the membrane blocked with PBS-T (PBS with 0.02% Tween-20, 2% bovine serum albumin and 2% nonfat milk) for 30 min on ice. The blot was then reacted with monoclonal/polyclonal primary antibody (purified IgG) against each specific protein or phosphospecific protein in PBS-T at 1:100 to 1:500 dilution. Primary antibodies against all the proposed proteins and phosphospecific antibodies are commercially available and were obtained from Santa
Cruz Biotechnology Inc, R&D Systems Inc. and Novus Biologicals, Inc. The binding of primary antibodies was detected by HRP-conjugated or Licor flourscence secondary antibodies, at a pretitrated dilution (or as recommended by the supplier) to obtain maximal binding without significant background. For HRP-conjugated secondary antibodies, membranes will then be washed and treated with chemiluminescent HRP substrate Luminol (NEN) for 30 to 60 sec. The blots will be washed 4 times and exposed to a Reflection® NEF-496 film (NEN) for 30 - 60 sec to visualize the protein. For semi- quantitative analysis, images captured on Reflection® autoradiographic film will be analyzed by densitometric analysis of each band using Biorad Fluor-S MultiImager.
Licor probed primary antibodies will be scanned and analyzed using Licor software.
82
RESULTS
Effects of cyclic tensile strain and IL-1 on N-cadherin in fibrochondrocytes of the
TMJ
N-cadherin is important for cell-cell adhesion and may sequester signaling - catenin. Articular disc fibrochondrocyte RNA extracted and analyzed by real-time PCR revealed that N-cadherin is detectable in these cells. Further, N-cadherin expression is not significantly changed when treated with IL-1, equibiaxial stress or the combination of the two conditions (figure 4.1A). Additionally, total N-cadherin protein did not demonstrate any change under these experimental conditions compared to untreated control cells (figure 4.1B).
Effects of cyclic tensile strain and IL-1 on SRC and BCL9-2 in fibrochondrocytes of
the TMJ
In a system controlled by phosphorylation, SRC is important in the release of - catenin from the cadherin complex. Expression of SRC was examined to assess whether cells being treated with IL-1 or CTS may regulate cadherin and -catenin through an increase in this tyrosine kinase. Again, SRC was expressed in articular fibrochondrocytes.
However, expression did not change due to IL-1 or CTS. Phosphorylation at the Y-142 site on -catenin contributes to it's release from cadherin. This phosphorylation even occurs by the same kinases that contribute to -catenin release from N-cadherin. Y-142 phosphorylation is also important for -catenin docking and transport by BCL9-2 to the
83 nucleus. To examine whether BCL9-2 expression fluctuates in the presence of IL-1 and
CTS, RNA was extracted and PCR performed. Although BCL9-2 is expressed in these cells, no change was observed under these experimental conditions.
Effects of cyclic tensile strain and IL-1 on -catenin location in fibrochondrocytes of
the TMJ
Location of -catenin can help determine how IL-1 and CTS mediates Wnt signaling. N-cadherin mediated-catenin sequestration would manifest itself as greater
-catenin being localized to the cell periphery. Cells treated with IL-1 had an increase in
-catenin translocation to the cell periphery compared to control cells. Cells subjected to
20% and 0.05 Hz CTS displayed less -catenin at the cell periphery compared to the IL-
1 group. This pattern continued when IL-1 treated cells are compared to cells treated with both IL-1 and CTS.
DISCUSSION
N-cadherin is important in the differentiation and development of cartilage by increasing and releasing cell adhesion and the appropriate times. This process is mediated, at least in part, by Wnt signaling and specifically Wnt7a. N-cadherin is also important in Wnt signaling itself. The N-cadherin complex includes -catenin which binds to its cytoplasmic domain. Therefore, N-cadherin in fibrochondrocytes of the articular disc is important in regulating homeostasis and any potential modification in
Wnt signaling to promote cartilage repair or regeneration. 84 Regulation to N-cadherin expression and protein can dramatically change available signaling -catenin and the differentiated state of the cell. For example, Wnt7a is known to dedifferentiate articular chondrocytes (107). Although the dedifferentiation process is unknown, it is possible that it occurs by an increase in cell adhesion which then changes the phenotype matrix production as observed in maturing chondrocytes. It is clear that chondrocytes must be tightly regulated to have an increase and later decrease in cell adhesion to achieve full maturation (108). In light of these observations, N-cadherin quantity regulation by either IL-1 or CTS may affect fibrochondrocytes resulting in dedifferentiation of mature cells or loss of the ability of immature cells to complete maturation. Additionally, N-cadherin may sequester more or less -catenin depending on the up or downregulation of its quantity. However, N-cadherin expression and protein remain constant in the presence of IL-1, CTS or the combination of IL-1 and CTS
(Figure 4.1). Although unexpected, this finding is important for the cells as far as homeostasis is achieved even under conditions of inflammation or biomechanical stretch.
Quantity of N-cadherin, however, is not the only potential regulator of this system.
Another possibility is that N-cadherin regulates Wnt signaling by modulating separate pools of -catenin. -catenin can be found in the cytoplasm, nucleus or bound at the cell membrane. Src is an important tyrosine kinase that releases -catenin from the cadherin complex. Another tyrosine kinase, Fer, phosphorylates -catenin at Y-142 which continues to release -catenin from the cadherin complex. Additionally, phosphorylation at Y-142 is a requirement for BCL9-2 binding. BCL9-2 assists -catenin to the nucleus and allows docking to TCF/LEF. Importantly, both Src and BCL9-2 are
85 expressed in mature fibrochartilage. However, expression of both Src and BCL9-2 expression are resistant to inflammatory and mechanical stress conditions (figure 4.2).
To gain a better understanding of -catenin dynamics during inflammation and
CTS, immunoflouresence was used to trace -catenin location under these conditions. In contrast to the clear consistency of N-cadherin, Src and BCL9-2 expression and protein,
-catenin translocates to the cell periphery when treated with IL-1 compared to control,
CTS and the combination group of IL-1 and CTS. This result may indicate that - catenin is, in fact, sequestered to the cadherin complex. This would decrease available - catenin and downregulate Wnt signaling. However, there is another possiblity. The destruction complex has also been shown to bind to frizzled receptors at the membrane.
This process would also appear as a greater -catenin signal on the cell periphery. This situation would increase -catenin destruction and, as was presented in chapter 3, also decrease Wnt signaling. Either by N-cadherin or increased degradation through a membrane bound destruction complex, more -catenin at the cell periphery suggests less available signaling -catenin.
86
Figure 4.1 N-cadherin expression and protein synthesis demonstrate consistency in rat articular disc fibrochondrocytes when treated with 1 ng/mL rH IL-1, cyclic tensile strain (CTS) of 12% equibiaxial stretch and 0.05 Hz or the combination of IL1- and CTS. Cells were grown for 4 to 5 days (70-80 % confluence), the RNA extracted and analyzed by real-time PCR. N-cadherin expression is not significantly changed by IL-1, equibiaxial stress or the combination of the two conditions (figure 4.1A). Additionally, total N-cadherin did not demonstrate any change under these experimental conditions (figure 4.1B). Mean values ±SE of at least 3 samples from a representative experiment are shown.
87
N-CADHERIN -ACTIN IL-1 - + - + CTS - + - +
Figure 4.1
88
Figure 4.2 Src and BCL9-2 are expressed in disc fibrochondrocytes. Expression is unchanged when treated with 1 ng/mL rH IL-1, cyclic tensile strain (CTS) of 12% equibiaxial stretch and 0.05 Hz or the combination of IL1- and CTS. Cells were grown for 4 to 5 days (70-80 % confluence), the RNA extracted and analyzed by end point and real-time PCR. SRC (figure 4.2A) and BCL9-2 (figure 4.2B)expression is not changed by IL-1, equibiaxial stress or the combination of the two conditions. Mean values ±SE of at least 3 samples from a representative experiment are shown.
89
BCL9-2
BCL9-2
GAPDH
IL-1 - + - + CTS - - + +
Figure 4.2
90
Figure 4.3 -catenin translocates to the cell periphery in rat articular disc fibrochondrocytes when treated with 1 ng/mL rH IL-1 when compared to control, cells treated with 12% and 0.05 Hz CTS and in cells treated with both IL1- and CTS. Cells were grown for 4 to 5 days (70-80 % confluence), fixed and examined through immunoflouresence. Actin is shown in green, -catenin in red and the nucleus is stained blue. Increased junctional -catenin is observed in the presence of IL-1 compared to control, CTS or the combination of IL-1 and CTS. A representative example of three experiments is shown.
91
C IL
S SIL
Figure 4.3
92
CHAPTER 5
WNT, MICROMASS CULTURES AND SCAFFOLDING
INTRODUCTION
The dynamics of mechanical stress on the articular disc during function include
tensile and compressive forces. Having examined and discussed the effects of tensile
strain on articular fibrochondrocytes in chapters 2 through 4, this chapter will explore the effect of compressive forces and Wnt signaling. However, a mesenchymal cell line,
C3H10T1/2, will be used in place of mature fibrochondrocytes to better understand Wnt signaling in developing chondrocytes.
Developmental studies have often used micromass cultures of undifferentiated cells to study the process of differentiation. As discussed previously, an important step of mesenchymal chondrogenesisis is cellular condensation prior to differentiation (109).
Previous studies have shown that N-cadherin and other cell adhesion protein expression changes accompany cellular condensation (110). This observation has been found for both in vivo and in vitro studies which suggest functional roles for these adhesion
molecules in chondrogenesis. N-cadherin and N-CAM have been found to be involved
during the condensation phase of cartilage differentiation in in vitro high-density
micromass mesenchymal cell cultures (111). As a homogeneous population of
93 undifferentiated cells that remain undifferentiated during normal culture conditions,
C3H10T1/2 cells are an ideal model for studying the differentiation process of cartilage.
While previous studies have achieved chondrogenesis in C3H10T1/2 cells by means of high-density micromass culture and TGF-1 treatment, the question remains whether these cells can be grown and differentiated in prepared scaffolding for study and potential clinical placement (112).
Many scaffolding types have been used to culture cells including agarose gel, alginate gel, hydrogels and polymeric scaffolds (113, 114). Specifically, some success has been achieved with hydrogels. However, hydrogels are limited by their high viscoelasticity and are unable to support various magnitudes and frequencies desired for studying developing chondrocytes under compressive forces. In addition, in vivo simulations of migratory intercellular proteins such as Wnt can not be accurately studied as they are unable to reach embedded cells within the gels in a realistic timeline. As an improvement upon these materials and models, an electrospun fiber matrix (EFM) has been recently fabricated that overcomes the biological limitations of previous fabricated scaffolds. These scaffolds can function as a platform biologically and mechanically sufficient to support the application of compressive forces within a three-dimensional
(3D) cell culture system. Because they are permeable, EFM scaffolds allow experiments to incorporate exogenous additions of soluble treatments to the cell system. These scaffolds also maintain phenotypic stability of the chondrocytes in vitro. Additionally,
EFM scaffolds allow post treatment RNA and protein to be readily harvested for analysis after experimental compression. Further, the mechanical properties of EFM scaffolds are stable and are shape reseliant through sustained dynamic compression periods up to 40%
94 strain for 4h. Established reports have presented present data showing that EFM scaffolds reproducing articular cartilage thickness (~3mm) and environment can be used to study chondrocytes response tocompressive forces (115).
As has been discussed previously, important Wnt ligands for chondrocyte proliferation and differentiation include Wnt5a and Wnt7a. N-cadherin has been implicated as a potential Wnt signaling mediator. Additionally, Wnt 11 has shown to be important in articular cartilage collagen type II expression. Addition of exogenous Wnt11 has been shown to significantly increase collagen type II expression in articular cartilage.
This Wnt111 induced increase in type II collagen expression was found to be dose dependent (116). These results suggest an important homeostatic role for Wnt 11 in mature articular cartilage.
MATERIALS AND METHODS
Scaffold synthesis: With a steel plate wrapped in aluminum foil as a base, Fifteen percent poly(-caprolactone) (PCL, Mw 65,000; Sigma-Aldrich, St. Louis, MO) dissolved
in dichloromethane (Mallinckroff Baker, Phillipsburg, NJ) was electrospun into an
approximately 3mm thick mesh. A flow rate of 15mL/h at −20kV and a 30cm tip-to- substrate distance was used during fabrication. A gradually applied voltage of 0 to +5kV was submitted over a time period of 1.5h. To remove residual solvents, the fiber mesh was treated in a vacuum oven (<30mmHg) at 45°C for 24h. The fabricated scaffolds were processed into 6mm diameter cylinders using a biopsy punch (Miltex, York, PA).
95 EFM scaffold cell culture: C3H10T1/2 cells were expanded subconfluently to preserve
mesenchymal phenotype. Scaffolds were sterilized overnight in a 70% ethanol solution
and washed with sterile water. To improve hydrophilicity, the scaffolds were incubated
overnight in CCM. Prior to cell seeding, the medium present in the scaffolds was
aspirated. Cells were seeded in 6mm diameter and approximately 3mm thick EFM scaffolds at 6 x 105 cells / 30uL in a 24-well plate. Cells were allowed to attach for three
hours at 37°C and 90% relative humidity before the wells were flooded with media
(Figure 5.1 courtesy of Dr. Jin Nam) The cell–scaffold constructs were cultured for 24
hours prior to the application of compressive forces. Twelve hours prior to compression,
the cell–scaffold constructs were serum-restricted by replacing CCM with CCM
containing 1% FBS.
Application of compression: Compression was applied to cells grown in scaffolds at
1Hz with a saw-tooth profile for 4h, controlled by a custom-designed, computer device
consisting of a vertical translation stage and a servo controller (AVL125 and Soloist,
respectively; Aerotech, Pittsburgh, PA). The samples were preloaded with a ram
weighing approximately 2.5g and fastened with a ram fixture. The loading with the ram
resulted in only 0.8% strain on the scaffold; preliminary experiments showed no
demonstrable differences in gene expression between samples with or without the rams.
The entire setup was then placed in a cell culture incubator at 37°C during the application
of compression. The cell–scaffold constructs were exposed to compression in the absence
or presence of recombinant human interleukin-1β (rhIL-1β, 1ng/mL; Calbiochem, San
Diego, CA). The experimental protocols consisted of (i) control uncompressed cell–
96 scaffold constructs; Cells treated with IL-1 (ii); cells subjected to compression only (iii);
and cells treated with both IL-1 (1ng/mL) and 10% compression at 0.05Hz (iv).
Real Time PCR: PCR, data collection and analysis were conducted by the same methods described in Chapter 2. Of course, the primer sequences used for the data in this chapter have changed. Primer sequences used to generate the data presented in this chapter employ previously described primers for Wnt7a Wnt5a, N-cadherin and iNOS and those included in Table 5.1.
Primer Sequence (5’ – 3’) Product Size
Sox9 Sense GACTGCACCGACGTAGACAGGATCG 282 bp
Anti-sense GATGGCATCAGGCTCCACGGTATC
Wnt11 Sense GTGCACTCCCCGCTGGTCAC 235 bp
Anti-sense CAAGACAGCCATGCCTAGTC
Table 5.1 Chapter 5 Primers
RESULTS
Cells grown in free micromass and EFM scaffold micromass express chondrocytic
markers as assessed by Alcian Blue staining.
To phenotype cell cultures in both free micromass and EFM scaffold micromass cultures
Alcian Blue staining was employed at the end of a five day growing period. Although
original studies employed the addition of BMP-2 for chondrocyte differentiation, no
BMP-2 was necessary for differentiation in these enviornments. Cells in free micromass, 97 meaning not grown in a scaffold, clearly differentiate into chondorcytes by the fifth day
(Figure 5.2A). Characteristic blue staining is also observed for cells grown in EFM scaffolds by the fifth day (Figure 5.2C). Importantly, cells grown in monolayer did not exhibit any staining after five days (Figure 5.2B). Cell differentiation was further characterized by Alkaline phosphatase staining. Cells grown in monolayer did not produce any significant characteristic red Alkaline phosphatase staining (Figure 5.2D).
Some staining can be observed on the periphery of chondrocyte nodules by the fifth day
(Figure 5.2E). Osteocytes grown for five days produced clear positive staining as a control (Figure 5.2F).
iNOS expression in free and EFM scaffold micromass.Cyclic compression does not
change iNOS expression.
To allow consistancy, iNOS is used to determine the presence and strength of inflammatory response. These conditions were studied with and without cyclic compression. In addition, cells grown in both free micromass and micromass in EFM scaffolds were examined. Interestingly, C3H10T1/2 cells grown in free micromass exhibited significantly less iNOS expression than cells grown in monolayer (Figure
5.3A). Cells grown in EFM scaffolds expressed increasing quantities of iNOS RNA as growth time increased (Figure 5.3B). Cells compressed for four hours at the end of a five day growth period expressed significantly higher levels of iNOS (Figure 5.4A). However, compared to iNOS induction by the addition of IL-1, the increase due to compression was comparably small. No significant difference was found between compression and control cells when cells were compressed after only 24 hours growth time. As mentioned
98 previously, cells induced with IL-1 expressed significantly more iNOS than NC, control and compression treated cells.
N-cadherin is significantly increased by IL-1b. Sox9 is decreased by all treatements
compared to control.
As N-cadherin is important in the differentiation of chondrocytes, and examination of the effects of an EFM scaffold environment, IL-1 and compression are important to understand the progression of an undifferentiated cell to a chondrocyte in this environment. N-cadherin is significantly increased by IL-1 treatment. This increase, however, was not affected by compression (Figure 5.5A). Sox9 is also important in the differentiation process. Sox9 is significantly increased in cells grown in EFM scaffolds compared to monolayer cells. However, treatment with IL-1 abrogates this increase
(Figure 5.5B).
Wnt5a expression peaks at 120h during growth in EFM scaffolds. In addition, Wnt5a
expression is highest in control cells grown in EFM scaffolds.
Expression of Wnt5a peaks at five days growth in EFM scaffolds (Figure 5.6A).
Importantly, this expression is higher in scaffolds than in monolayer cultures. However,
Wnt5a expression was decreased compared to control in the presence of IL-1 and compression (Figure 5.6B).
Wnt7a expression peaks at 48h during growth in EFM scaffolds. In addition, Wnt5a
expression is highest in cells subjected to cyclic compression. 99 Wnt7a is important during cell condensation during chondrocyte differentiation. Wnt7a expression peaks at 48h and remains high until at least 120h (Figure 5.7A). Wnt7a expression also increases when cells grown in EFM scaffolds are subjected to compression. Significantly higher expression is observed in cells compressed at 10% and
0.05Hz. This effect is also true in cell treated with compression and IL-1 (Figure 5.7B).
Wnt11 expression peaks at 72h during growth in free micromass cultures. Cells grown in EFM scaffolds express significantly higher Wnt11 at 120h. In addition, Wnt11
expression significantly increases when cells are treated with IL-1.
Wnt11 is important in regulating differentiation. Its expression peaks two days earlier in free micromass compared to micromass in scaffolds. Peak Wnt11 expression occurs at
72h in free micromass and 120h in EFM scaffolds (Figures 5.8A and B). Wnt11 is also regulated by IL-1 but not by cyclic compression. Wnt11 expression increases when cells are treated with IL-1compared to NC, control and cell subjected to compression (Figure
5.8C).
DISCUSSION
Undifferentiated cells that can be supported by a biologically compatible
scaffolding system may provide another option for treatment of damaged cartilage.
Characterization and study of this system provides better understanding of the
environment and feasibility of future treatments. To this end, the study of this system
under conditions of inflammation and compressive forces were completed. As an
undifferentiated cell line, C3H10T1/2 cells provide a progressive picture as they divide 100 and differentiate into chondrocytes. Interestingly, these cells are driven by the environment to differentiate into specific cell types. For chondrocyte differentiation, a three-dimensional environment is sufficient. This environment can be provided by either a free micromass culture or scaffolding. Results presented in this chapter suggest that, merely by environment, cells differentiate into chondrocytes. Some other cell types, however, may be found at the periphery of the micromass or scaffolding. This may be due to change in the three dimensional environment.
iNOS expression is remarkably lower in free micromass cultures compared to control. This finding is significant since increased inflammation has been indicated in chondrocyte inhibition and even dedifferentiation in previous studies (8, 117). Unlike free micromass, cells grown in EFM scaffolds increased iNOS expression as time progressed. This increase may be due to increased cell contact within the scaffolding.
Whereas free micromass cultures expand laterally, cells grown in scaffolding are unable to expand laterally. This may increase inflammatory signals as cell-cell contact increase.
In RA studies, cell contact has been found to be contributory to destructive inflammatory processes including a reduction of collagen production (118). iNOS is also increased during late compression. Compression after five days growth produces a significant increase in iNOS expression. This increase may also reflect the importance of cell contact and the effect of 10% compression on mature cells. Although this inflammatory induction is important, cells grown in scaffolds experienced a much greater reaction as a result of exogenous 1ng/mL IL-1. iNOS expression is significantly increased with the addition of
IL-1 compared to control cells grown for five days. These findings are important to
relate the subsequent findings to the inflammatory environment in which they occur. 101 N-cadherin is important for chondrocyte differentiation. It, along with N-CAM, form cell-cell adhesion that are required for differentiation. However, these adhesions must be later downregulated or differentiation can not continue. It is precisely this step that was found to be modified by Wnt7a expression (119). Interestingly, Wnt7a is known to increase the stability of the cadherin complex by an increase in serine/threonine phosphorylation of -catenin (120). The increase in Sox9 expression in scaffolds compared to monolayer cultures suggests a greater level of differentiation in scaffolds at
120h. However, IL-1 and compression decrease this important chondrocyte transcription factor.
Wnt5a is a known Wnt/calcium signaling ligand important in cartilage development. Wnt5a expression peaks at 120h and is significantly different from negative control monolayer cultures at that point. However, IL-1 and compression decrease this expression. Wnt5a is known to inhibit collagen type II expression in articular chondrocytes. However, the expression patter for Wnt5a in articular chondrocytes in an inflammatory environment is different. In articular chondrocytes, Wnt5a is increased when treated with exogenous IL-1. The reason for the difference between articular chondrocytes and fibrochondrocytes is not known. A better understanding of the effect, however, would be beneficial in understanding the different ion process of fibrochondrocytes of the articular disc during inflammation.
As discussed with N-cadherin, Wnt7a is an important canonical Wnt signaling ligand that is important in strengthening the cadherin complex. In this study, Wnt7a peaks at 48h and remains high to at least 120h. It is important that this high expression be relieved at some point so that differentiation may continue. Interestingly, cells in this 102 environment are still able to differentiate as evidenced by positive Alcian blue staining.
Differentiation may be facilitated by a downregulation beyond five days or some other
mechanism.
In addition to Wnt5a, Wnt11 is a Wnt/calcium signaling ligand. Wnt 11 has been described as prochondrogenic as it increases collagen type II in articular chondrocytes.
However, in these reports, IL-1 decreases Wnt11 expression. In the experiments described here, IL-1 increases Wnt11 expression compared to control. Again, experimental evidence confirming or reversing the role of Wnt11 in fibrochondrocytes would be beneficial. Importantly, Wnt11 expression is mediated by both free micromass and micromass in EFM scaffolds. Both environments express Wnt11 in greater quantities than monolayer cultures. However, free micromass cultures have a peak Wnt11 expression at least two days earlier than cells grown in scaffolds. Assuming the function of Wnt11 in fibrochondrocytes mirrors that of articular chondrocytes, this difference
would delay differentiation by at least two days (8).
Clearly, micromass cultures in scaffolding have potential worthy of further study.
These scaffolds support cell viability, are able to provide an environment amiable to
chondrocyte differentiation form a mesenchymal cell line and regulate important
differentiation mediators. These mediators include iNOS, N-cahderin, Sox9, Wnt5a,
Wnt7a and Wnt11. Further studies will provide valuable insight that will contribute to
clinical translation.
103
Figure 5.1 SEMs showing C3H10T1/2 cells in EFM scaffolds. Cells were grown in micromass in EFM scaffolds. SEMs were taken to examine cell morphology and attachment to the scaffold.
104
Figure 5.1
105
Figure 5.2 Alcian blue staining in C3H10T1/2 cell micromass (Figure 5.1A), cells grown to 80% confluence (Figure 5.1B) and cells grown in EFM scaffolds (Figure 4.1C). Alkaline phosphatase is negative for 80% confluence and micromass cultures (Figure 5.1D and E) compared a to osteocyte positive control (Figure 5.1F). Cells were grown in micromass, monolayer or EFM scaffolds. Alcian blue staining confirmed the presence of chondrocytic markers in micromass and scaffold cultures. However, cells grown in monolayer did not exhibit Alcian blue staining. Alkaline phosphatase staining is negative in monolayer and micromass cultures. An osteocyte culture was used as a positive control.
106
A B
C
NC C IL COMP CIL
D E F
Figure 5.2
107
Figure 5.3 iNOS expression during differentiation of C3h10T1/2 cells in micromass cultures (Figure 5.2A) and EFM scaffolds (Figure 5.2B). Cells express less iNOS in micromass than monolayer cultures (A). However, in scaffolds, iNOS expression increases in a time dependant manner. Cells were grown for 24h as a negative control monolayer (NC) in micromass (A) or EFM scaffolds (B). iNOS RNA expression revealed a sharp decrease in iNOS expression for micromass cultures compared to the monolayer negative control (NC). This decrease remained constant for the full 120h (Figure 5.2A). Although iNOS expression in EFM scaffolds was not significantly different compared to monolayer negative controls (NC), by 120h iNOS expression had significantly increased (Figure 5.2B). The RNA was extracted from these cultures and analyzed by real-time PCR. Mean values ±SE of at least 3 samples from a representative experiment are shown.
108
A
B
Figure 5.3
109
Figure 5.4 iNOS expression during differentiation of C3h10T1/2 cells in micromass cultures in EFM scaffolds increased when compressed at 120h (Figure 5.3A) iNOS expression significantly increased in the presence of IL-1b compared to cells plated in monolayer, EFM scaffold micromass, and EFM scaffold micromass under compression(Figure 5.2B). Cells were grown for 24h as a negative control monolayer (NC) and EFM scaffold micromass. RNA expression was analyzed with 4 hours compression at 120h. iNOS significantly increased with compression at 120h (Figure5.3A). NC and cells grown in EFM scaffolds were examined under conditions of IL-1b, compression at 10% and 0.05Hz and a combination of IL-1 and 10%/0.05Hz (Figure 5.3B). NC, control and compression iNOS expression were all significantly lower than IL-1 and IL-1 with compression groups. The RNA was extracted from these cultures and analyzed by real-time PCR. Mean values ±SE of at least 3 samples from a representative experiment are shown.
110
A
B
Figure 5.4
111
Figure 5.5 N-cadherin and Sox9 expression during differentiation of C3H10T1/2 cells in micromass cultures in EFM scaffolds. IL-1b significantly increases N- cadherin expression. Sox9 expression is significantly higher in control cells. Cells were grown for 24h as a negative control monolayer (NC) and EFM scaffold micromass. Experimental conditions were applied for four hours and RNA analyzed by real-time PCR. N-cadherin significantly increased in both the IL-1 and the combination group IL-1 and 10%/0.05Hz compression. Sox9 expression is decreased in NC, IL-1 treated, compression treated and IL-1/compression groups when compared to control. Mean values ±SE of at least 3 samples from a representative experiment are shown.
112
A
B
Figure 5.5
113
Figure 5.6 Wnt5a expression during differentiation of C3H10T1/2 cells in micromass cultures in EFM scaffolds. Wnt5a expression peaks at 120h and is significantly different compared to monolayer cultured cells (Figure 5.5A). Monolayer, IL-1b, compression and IL-1b/compression groups were all significantly decreased compared to control (Figure 5.5B). Cells were grown for 24h as a negative control monolayer (NC) and EFM scaffold micromass. Experimental conditions were applied for four hours and RNA analyzed by real-time PCR. Wnt5a increases and peaks at 120h in cells grown in EFM scaffolds. Additionally, Wnt5a significantly decreased in all experimental conditions compared to control cells Mean values ±SE of at least 3 samples from a representative experiment are shown.
114
A
B
Figure 5.6
115
Figure 5.7 Wnt7a expression during differentiation of C3H10T1/2 cells in micromass cultures in EFM scaffolds. Wnt7a expression peaks after 48h and is significantly different compared to monolayer cultured cells, and the 12h and 24 hour growth cells (Figure 5.6A). Cells subjected to dynamic with IL-1 express significantly more Wnt7a than the NC and IL-1 groups. Additionally, the combination group, CIL, expressed significantly more Wnt7a than the control group (Figure 5.6B). Cells were grown for 24h as a negative control monolayer (NC) and EFM scaffold micromass. Cells were grown and RNA harvested at 12h, 24h, 48h, 72h and 120h. In addition, Experimental conditions were applied for four hours and RNA analyzed by real-time PCR. Wnt7a peaks at 48h in cells grown in EFM scaffolds. Wnt7a expression was significantly increased in cells subjected to dynamic compression and IL- 1 compared to the NC and IL-1 groups. Additionally, the combination group, CIL, expressed significantly more Wnt7a than the control group. Mean values ±SE of at least 3 samples from a representative experiment are shown.
116
A
B
Figure 5.7
117
Figure 5.8 Wnt11 expression during differentiation of C3H10T1/2 cells in free micomass and micromass cultures in EFM scaffolds. Wnt11 expression peaks at 72h in free micromass cultures and at 120h in EFM scaffolds (Figures 5.7A and 5.7B). Cells in both environments express more Wnt11 than in monolayer. Wnt11 expression is significantly increased in the presence of IL-1b (Figure 5.7C). Cells were grown for 24h as a negative control monolayer (NC) and EFM scaffold micromass. Cells were grown and RNA harvested at 12h, 24h, 48h, 72h, 96h and 120h for free micromass cultures and 48h, 72h and 120h for cell in EFM scaffolds. Experimental conditions were applied for four hours and RNA analyzed by real-time PCR. Wnt11 peaks at 72h for cells grown in free micromass and at 120h for cells grown in EFM scaffolds. Cells treated withIL-1 express significantly more Wnt11 than cells not treated with IL-1. Mean values ±SE of at least 3 samples from a representative experiment are shown.
118 A
B
C
Figure 5.8
119
CHAPTER 6
DISCUSSION AND FINAL CONCLUSIONS
Cartilage is an important tissue for the proper function of joints. It has also been found difficult to manage once it has been damaged. Since it lacks blood vessels and a ready source of undifferentiated cells, repair or regeneration has been largely ineffective.
Because of this, most studies for future therapy have focused on prevention of injury and inhibition of destructive autoimmune processes like those found in arthritis. While these treatments have been beneficial, they have not been able to stop the destructive forces associated with cartilage breakdown. The hypothesis for this work was that, in addition to previously studied anti-inflammatory effects, mechanical signals are reparative and utilize Wnt mediated pathways as the means for regeneration or repair of inflamed cartilage. Studies focused on fibrochondrocytes from the articular disc and the mesenchymal cell line C3H10T1/2. Importantly, the components for a functioning
Wnt/-catenin signaling pathway are present in fibrochondrocytes. These mature cells display a remarkable resiliency and consistency for Wnt signaling members.
Undoubtedly, this steadiness is important to insure health and homeostasis. As discussed previously, disregulated Wnt signaling is a known cause of many types of cancer because of the pathway's potential to affect proliferation and differentiation. However, this rigid
120 stability also does not allow this pathway to readily function in a reparative role in mature cells. Interestingly, a few members were regulated by IL-1. The regulated members included one Wnt ligand and three receptors. The concomitant decrease in Wnt4 and
Frizzled6 by IL-1 may be important in further stabilizing Wnt signaling as Wnt4 has been found to be associated with Frizzled6. In previous experiments, Firzzled6 has been shown to act as a decoy receptor for canonical Wnt signaling. This mechanism may act as a further check point to protect against disfunctioning Wnt pathologies like cancer.
In contrast to mature cells which display Wnt signaling in a homeostatic environment, developing chondrocytes are greatly mediated by conditions of inflammation and mechanical stimuli. First, it is important to recognize the mediation of a three dimensional environment on developing chondrocytes. Cells grown in EFM scaffolds are not only viable but also able to differentiate into cartilage without any further stimulation. When subjected to exogenous IL-1, the scaffolding allowed reception of this cytokine to the cells. This is important as it displays the ability of the scaffolds to allow other mediators to permeate to the cells. In light of this dissertation, this would suggest that Wnt would also be able to travel from one cell to another as it does in vivo. Wnts known to regulate cartilage differentiation and homeostatic phenotype stability were regulated. These Wnts include Wnt5a, Wnt7a and Wnt11 in addition to other important chondrogenic determinants. While the effects of these Wnts are unknown in these conditions, similar studies have been completed that suggest some possible outcomes. Wnt7a has been shown to be necessary for chondrocyte differentiation by increasing cell aggregates. Importantly, it signals through the Wnt/-catenin pathway.
Wnt11 and Wnt5a have been described as Wnt/calcium signaling ligands. However, in 121 one study, Wnt5a was shown to signal through JNK. In this way, Wnt5a was found to
decrease collagen production in articular chondrocytes. Wnt11 had the opposite effect on collagen production in this same system. Further studies in developing chondrocytes are needed to determine if these Wnts produce the same results in C3H10T1/2 cell cultured in EFM scaffolds. N-cadherin, Sox9 and iNOS were also modulated by environments of
3D EFM scaffolds, IL-1 and cyclic compression. In general, differentiation seemed to be delayed by 48 hours in cells grown in scaffolds compared to free micromass cultures.
These results show that these pathways can be manipulated in undifferentiated cells. The ability to mediate a potential reparative pathway is important because it opens many possibilities. With further understanding of this powerful pathway, Wnts may, indeed, be an important point of control for future reparative therapies.
122
REFERENCE LIST
1. Lawrence RC, Helmick CG, Arnett FC, Deyo RA, Felson DR, Wolfe F, et al. Estimates of the prevalence of arthritis and selected musculoskeletal disorders in the United States. Arthritis Rheum 1998;41:778-99.
2. Yelin E, Callahan LF. The economic cost and social and psychological impact of musculoskeletal conditions. Arthritis Rheum 1995 Oct;38(10):1351-62.
3. Felson DT, Lawrence RC, Dieppe PA, Hirsch R, Helmick CG, Jordan JM, Kington RS, Lane NE, Nevitt MC, Zhang Y, Sowers M, McAlindon T, Spector TD, Poole AR, Yanovski SZ, Ateshian G, Sharma L, Buckwalter JA, Brandt KD, Fries JF. Osteoarthritis: new insights. Part 1: the disease and its risk factors.
4. Firestein, G. S. Evolving concepts of rheumatoid arthritis. Nature. 423, 356-61 (2003).
5. Ettala-Ylitalo UM, Syrjanen S, Halonen P. Functional disturbances of the masticatory system related to temporomandibular joint involvement by rheumatoid arthritis. J Oral Rehabil. 5, 415-27 (1987).
6. Celiker R, Gokce-Kutsal Y, Eryilmaz M. Temporomandibular joint involvement in rheumatoid arthritis. Relationship with disease activity. Scand J Rheumatol. 1, 22-5 (1995).
7. Deschner J, Hofman CR, Piesco NP, Agarwal S. Signal transduction by mechanical strain in chondrocytes. Curr Opin Clin Nutr Metab Care. 3, 289-93 (2003).
8. Kumar V, Cotran RS, Robbins SL. Basic Pathology, ed 7. Philadelphia, Sauders, 2003 pp. 136-39.
9. Ferretti M, Gassner R, Wang Z, Perera P, Deschner J, Sowa G, Salter RB, Agarwal S. Biomechanical signals suppress proinflammatory responses in cartilage: early events in experimental antigen-induced arthritis. J Immunol. 2006 Dec 15;177(12):8757-66.
10. Xu Z, Buckley MJ, Evans CH, Agarwal S. Cyclic tensile strain acts as an antagonist of IL-1 beta actions in chondrocytes. J Immunol. 1, 453-60 (2000).
11. Agarwal S, Long P, Gassner R, Piesco NP, Buckley MJ. Cyclic tensile strain suppresses catabolic effects of interleukin-1beta in fibrochondrocytes from the temporomandibular joint. Arthritis Rheum. 3, 608-17 (2001).
123 12. Church V, Nohno T, Linker C, Marcelle C, Francis-West P. Wnt regulation of chondrocyte differentiation. J Cell Sci. Pt 24, 4809-18 (2002).
13. Nelson WJ, Nusse R. Convergence of Wnt, beta-catenin, and cadherin pathways. Science. 5663, 1483-7 (2004).
14. Satoh H, Kishi K, Tanaka T, Kubota Y, Nakajima T, Akasaka Y, Ishii T. Transplanted mesenchymal stem cells are effective for skin regeneration in acute cutaneous wounds. Cell Transplant. 4, 405-12 (2004).
15. Tuan RS, Eyre D, Schurman DJ. Biology of developmental and regenerative skeletogenesis. Clin Orthop. 427 Suppl, S105-17 (2004).
16. Liu J, Hu Q, Wang Z, Xu C, Wang X, Gong G, Mansoor A, Lee J, Hou M, Zeng L, Zhang JR, Jerosch-Herold M, Guo T, Bache RJ, Zhang J. Autologous stem cell transplantation for myocardial repair. Am J Physiol Heart Circ Physiol. 2, H501-11 (2004).
17. Jones EA, English A, Henshaw K, Kinsey SE, Markham AF, Emery P, McGonagle D. Enumeration and phenotypic characterization of synovial fluid multipotential mesenchymal progenitor cells in inflammatory and degenerative arthritis. Arthritis Rheum. 3, 817-27 (2004).
18. Jasin HE. Structure and function of the articular cartilage surface. Scand J Rheumatol Suppl. 1995;101:51-5.
19. Eyre DR, Muir H. The distribution of different molecular species of collagen in fibrous, elastic and hyaline cartilages of the pig. Biochem J. 1975 Dec;151(3):595- 602.
20. Junqueira LC, Carneiro J. Baxic Histology, ed 10. New York, Lange Medical Books McGraw-hill, 2003 pp. 135-140.
21. Volk SW, Leboy PS. Regulating the regulators of chondrocyte hypertrophy. J Bone Miner Res. 1999 Apr;14(4):483-6.
22. Gerber HP, Ferrara N. Angiogenesis and bone growth. Trends Cardiovasc Med. 2000 Jul;10(5):223-8.
23. Long F, Zhang XM, Karp S, Yang Y, Mc-Mahon AP. 2001. Genetic manipulation of hedgehog signaling in the endochondral skeleton reveals a direct role in the regulation of chondrocyte proliferation. Development 128:5099–5108.
24. Cohen MM. 2003. The hedgehog signalingnetwork. Am J Med Genet 123A:5–28.
124 25. Nybakken K, Perrimon N. 2002. Hedgehog signal transduction: recent findings. Curr Opin Genet Dev 12:503–511.
26. Corbit KC, Aanstad P, Singla V, Norman AR, Stainier DY, Reiter JF. 2005. Vertebrate Smoothened functions at the primary cilium. Nature 437:1018–1021.
27. Huangfu D, Anderson KV. 2006. Signaling from Smo to Ci/Gli: conservation and divergence of Hedgehog pathways from Drosophila to vertebrates. Development 133:3–14.
28. Hooper JE, Scott MP. 2005. Communicating with Hedgehogs. Nat Rev Mol Cell Biol 6:306–317.
29. Rabie AB, Hagg U. 2002. Factors regulating mandibular condylar growth. Am J Orthod Dentofacial Orthop 122:401–409.
30. Yoshihiro Shibukawa, Blanche Young, Changshan Wu, Satoru Yamada, Fanxin Long, Maurizio Pacifici, and Eiki Koyama. Temporomandibular Joint Formation and Condyle Growth Require Indian Hedgehog Signaling. Developmental Dynamics 236:426–434, 2007.
31. Guha U, Gomes WA, Kobayashi T, Pestell RG, Kessler JA: In vivo evidence that BMP signaling is necessary for apoptosis in the mouse limb. Dev Biol 2002, 249:108- 120.
32. Denker AE, Nicoll SE, Tuan RS: Formation of cartilage-like spheroids by micromass cultures of murine C3Hl0T1/2, cells upon treatment with TGF-01. Differentiation 1994, 59:25-34.
33. Dieudonne SC, Semeins CM, Goei SW, Vukicevic S, Nulend JK, Smapath TK, Helder M, Burger EH: Opposite effects of osteogenic protein and TGF-P on chondrogenesis in cultured long bone rudiments. I Bone Miner Res 1994, 9:771-780.
34. Ballock RT, Heydemann A, Wakefield LM, Flanders KC, Roberts AB, Sporn MB: TGF-PI prevents hypertrophy of epiphyseal chondrocytes: regulation of gene expression for cartilage matrix proteins and metalloproteases. Dev Biol 1993, 158:414-429.
35. Eames BF, Sharpe PT, Helms JA: Hierarchy revealed in the specification of three skeletal fates by Sox9 and Runx2. Dev Biol 2004, 274:188-200.
36. Day TF, Guo X, Garrett-Beal L, Yang Y: Wnt/b-catenin signaling in mesenchymal progenitors controls osteoblast and chondrocyte differentiation during vertebrate skeletogenesis. Dev Cell 2005, 8:739-750.
125 37. Akiyama H, Lyons JP, Mori-Akiyama Y, Yang X, Zhang R, Zhang Z, Deng JM, Taketo MM, Nakamura T, Behringer RR et al.:Interactions between Sox9 and b- catenin control chondrocyte differentiation. Genes Dev 2004, 18:1072-1087.
38. Hartmann C, Tabin CJ: Dual roles of Wnt signaling during chondrogenesis in the chicken limb. Development 2000, 127:3141-3159.
39. Nagase T, Nagase M, Machida M, Yamagishi M. Hedgehog signaling: a biophysical or biomechanical modulator in embryonic development? Ann N Y Acad Sci. 2007 Apr;1101:412-38. Epub 2007 Mar 1.
40. Cummins PM, von Offenberg Sweeney N, Killeen MT, Birney YA, Redmond EM, Cahill PA. Cyclic strain-mediated matrix metalloproteinase regulation within the vascular endothelium: a force to be reckoned with. Am J Physiol Heart Circ Physiol. 2007 Jan;292(1):H28-42. Epub 2006 Sep 1.
41. Li C, Xu Q. Mechanical stress-initiated signal transduction in vascular smooth muscle cells in vitro and in vivo. Cell Signal. 2007 May;19(5):881-91. Epub 2007 Jan 18.
42. Robling AG, Castillo AB, Turner CH. Biomechanical and molecular regulation of bone remodeling. Annu Rev Biomed Eng. 2006;8:455-98.
43. Chandran R, Knobloch TJ, Anghelina M, Agarwal S. Biomechanical signals upregulate myogenic gene induction in the presence or absence of inflammation. Am J Physiol Cell Physiol. 2007 Mar 28.
44. Gassner RJ, Buckley MJ, Studer RK, Evans CH, Agarwal S. Interaction of strain and interleukin-1 in articular cartilage: effects on proteoglycan synthesis in chondrocytes. Int J Oral Maxillofac Surg. 2000 Oct;29(5):389-94.
45. Xu Z, Buckley MJ, Evans CH, Agarwal S. Cyclic tensile strain acts as an antagonist of IL-1 beta actions in chondrocytes. J Immunol. 2000 Jul 1;165(1):453-60.
46. Salter RB. History of rest and motion and the scientific basis for early continuous passive motion. Hand Clin. 1996 Feb;12(1):1-11.
47. Kim HK, Kerr RG, Cruz TF, Salter RB. Effects of continuous passive motion and immobilization on synovitis and cartilage degradation in antigen induced arthritis. J Rheumatol. 1995 Sep;22(9):1714-21.
48. Williams JM, Moran M, Thonar EJ, Salter RB. Continuous passive motion stimulates repair of rabbit knee articular cartilage after matrix proteoglycan loss. Clin Orthop Relat Res. 1994 Jul;(304):252-62.
126 49. Agarwal S, Deschner J, Long P, Verma A, Hofman C, Evans CH, Piesco N. Role of NF-kappaB transcription factors in antiinflammatory and proinflammatory actions of mechanical signals. Arthritis Rheum. 2004 Nov;50(11):3541-8.
50. Agarwal S, Deschner J, Long P, Verma A, Hofman C, Evans CH, Piesco N. Role of NF-kappaB transcription factors in antiinflammatory and proinflammatory actions of mechanical signals. Arthritis Rheum. 2004 Nov;50(11):3541-8.
51. Matthews, B. D., Overby, D. R., Mannix, R., and Ingber, D. E. (2006) Cellular adaptation to mechanical stress: role of integrins, Rho, cytoskeletal tension, and mechanosensitive ion channels. J. Cell Sci. 119, 508– 518.
52. Galbraith, C. G., Yamada, K. M., and Sheetz, M. P. (2002) The relationship between force and focal complex development. J. Cell Biol. 159, 695–705.
53. Singhvi, R., Kumar, A., Lopez, G. P., Stephanopoulos, G. N., Wang, D. I., Whitesides, G. M., and Ingber, D. E. (1994) Engineering cell shape and function. Science 264, 696–698.
54. Dike, L. E., Chen, C. S., Mrksich, M., Tien, J., Whitesides, G. M., and Ingber, D. E. (1999) Geometric control of switching between growth, apoptosis, and differentiation during angiogenesis using micropatterned substrates. In Vitro Cell Dev. Biol. Anim. 35, 441–448.
55. Parker, K. K., Brock, A. L., Brangwynne, C., Mannix, R. J., Wang, N., Ostuni, E., Geisse, N. A., Adams, J. C., Whitesides, G. M., and Ingber, D. E. (2002) Directional control of lamellipodia extension by constraining cell shape and orienting cell tractional forces. FASEB J. 16, 1195–1204.
56. Katsumi, A., Milanini, J., Kiosses, W. B., del Pozo, M. A., Kaunas, R., Chien, S., Hahn, K. M., and Schwartz, M. A. (2002) Effects of cell tension on the small GTPase Rac. J. Cell Biol. 158, 153–164
57. Donald E. Ingber. Cellular mechanotransduction: putting all the pieces together again. FASEB J. 20, 811–827 (2006).
58. Meyer, C. J., Alenghat, F. J., Rim, P., Fong, J. H., Fabry, B., and Ingber, D. E. (2000) Mechanical control of cyclic AMP signaling and gene transcription through integrins. Nat. Cell Biol. 2, 666–668.
59. Parker, K. K., Brock, A. L., Brangwynne, C., Mannix, R. J., Wang, N., Ostuni, E., Geisse, N. A., Adams, J. C., Whitesides, G. M., and Ingber, D. E. (2002) Directional control of lamellipodia extension by constraining cell shape and orienting cell tractional forces. FASEB J. 16, 1195–1204.
127 60. Tan, J. L., Tien, J., Pirone, D. M., Gray, D. S., Bhadriraju, K., and Chen, C. S. (2003) Cells lying on a bed of microneedles: an approach to isolate mechanical force. Proc. Natl. Acad. Sci.USA 100, 1484–1489.
61. Gibson, M. C., and Perrimon, N. (2005) Extrusion and death of DPP/BMP- compromised epithelial cells in the developing Drosophila wing. Science 307, 1785– 1789.
62. Davidson, L. A., Ezin, A. M., and Keller, R. (2002) Embryonic wound healing by apical contraction and ingression in Xenopus laevis. Cell Motil. Cytoskeleton 53, 163–176.
63. Moore, K. A., Polte, T., Huang, S., Shi, B., Alsberg, E., Sunday, M. E., and Ingber, D. E. (2005) Control of basement membrane remodeling and epithelial branching morphogenesis in embryonic lung by Rho and cytoskeletal tension. Dev. Dynamics 232, 268–28.
64. Slusarski, D.C., Yang-Snyder, J., Busa, W.B., and Moon, R.T. (1997b). Modulation of embryonic intracellular Ca2_ signaling by Wnt-5A. Dev. Biol. 182, 114–120.
65. Sheldahl, L.C., Slusarski, D.C., Pandur, P., Miller, J.R., Ku¨ hl, M., and Moon, R.T. (2003). Dishevelled activates Ca2_ flux, PKC, and CamKII in vertebrate embryos. J. Cell Biol. 161, 769–777.
66. Murphy, L.L., and Hughes, C.C. (2002). Endothelial cells stimulate T cell NFAT nuclear translocation in the presence of cyclosporin A: involvement of the wnt/glycogen synthase kinase-3 _ pathway. J. Immunol. 169, 3717–3725.
67. Kinoshita, N., Iioka, H., Miyakoshi, A., and Ueno, N. (2003). PKC_ is essential for Dishevelled function in a noncanonical Wnt pathway that regulates Xenopus convergent extension movements. Genes Dev. 17, 1663–1676.
68. Ault, K. et al. (1996) Modulation of Xenopus embryo mesoderm-specific gene expression and dorsoanterior patterning by receptors that activate the phosphatidylinositol cycle signal transduction pathway. Development 122, 2033– 2041.
69. Slusarski, D.C. et al. (1997) Interaction of Wnt and a Frizzled homologue triggers G- protein-linked phosphatidylinositol signaling. Nature 390, 410–413.
70. Kühl, M. et al. (2000) Calcium/calmodulin dependent protein kinase II is stimulated by Wnt and Frizzled homologs and participates in axis formation in Xenopus. J. Biol. Chem. 275, 12701–12711.
128 71. Sheldahl, L. et al. (1999) Protein kinase C is differentially stimulated by Wnt and Frizzled homologs in a G-protein dependent manner. Curr. Biol. 9, 695–698.
72. Liu, X. et al. (1999). Activation of a Frizzled-2/b-adrenergic receptor chimera promotes Wnt signaling and differentiation of mouse F9 teratocarcinoma cells via G- ao and Gat. Proc. Natl. Acad. Sci. U. S. A. 96, 14383–14388.
73. Liu, T. et al. (1999) Activation of rat frizzled-1 promotes Wnt signaling and differentiation of mouse F9 teratocarcinoma cells via pathways that require Galpha(q) and Galpha(o) function. J. Biol. Chem. 274, 33539–33544.
74. Li, H., Linke, W. A., Oberhauser, A. F., Carrion-Vazquez, M., Kerkvliet, J. G., Lu, H., Marszalek, P. E., and Fernandez, J. M. (2002) Reverse engineering of the giant muscle protein titin. Nature 418, 998–1002.
75. Carl, P., Kwok, C. H., Manderson, G., Speicher, D. W., and Discher, D. E. (2001) Forced unfolding modulated by disulfide bonds in the Ig domains of a cell adhesion molecule. Proc. Natl. Acad. Sci. USA 98, 1565–1570.
76. Oberhauser, A. F., Badilla-Fernandez, C., Carrion-Vazquez, M., and Fernandez, J. M. (2002) The mechanical hierarchies of fibronectin observed with single-molecule AFM. J. Mol. Biol. 319, 433–447.
77. Paci, E., and Karplus, M. (2000) Unfolding proteins by external forces and temperature: the importance of topology and energetics. Proc. Natl. Acad. Sci. USA 97, 6521–6526.
78. Veigel, C., Molloy, J. E., Schmitz, S., and Kendrick-Jones, J. (2003) Load-dependent kinetics of force production by smooth muscle myosin measured with optical tweezers. Nat. Cell Biol. 5, 980–986.
79. Ingber, D. E. (1993) The riddle of morphogenesis: a question of solution chemistry or molecular cell engineering? Cell 75, 1249–1252
80. Ingber, D. E. (1997) Tensegrity: the architectural basis of cellular echanotransduction. Annu. Rev. Physiol. 59, 575–599.
81. Riveline, D., Zamir, E., Balaban, N. Q., Schwarz, U. S., Ishizaki, T., Narumiya, S., Kam, Z., Geiger, B., and Bershadsky, A. D. (2001) Focal contacts as mechanosensors: externally applied local mechanical force induces growth of focal contacts by an mDia1-dependent and ROCK-independent mechanism. J. Cell Biol. 153, 1175–1186.
129 82. Agarwal, S., Long, P., Gassner, R., Piesco, N.P., and Buckley, M.J., Cyclic tensile strain suppresses catabolic effects of interleukin-1β in fibrochondrocytes from the temporomandibular joint. Arth & Rheumat. 44: p. 608-17, 2001.
83. Gassner R, Buckley MJ, Georgescu H, Zhongfa X, Studer R, Stefanvich-Racic M, Piesco, NP, Evans CH, and Agarwal S. Cyclic Tensile Stress exerts anti- inflammatory actions on chondrocytes by inhibiting inducible nitric oxide synthase. J. Immunology. 163:2187-92, 1999.
84. Gassner R, Agarwal S. Biological basis for the effectiveness of Continuous Passive Motion-mediated repair in TMJ diseases; J Cranio Mandibular Prac 20: 152-153, 2002.
85. Liang and Pardee, Science. 1992, 257:967.
86. Du Q, Park KS, Guo Z, He P, Nagashima M, Shao L, Sahai R, Geller DA, Hussain SP. Regulation of human nitric oxide synthase 2 expression by Wnt beta-catenin signaling. Cancer Res. 2006 Jul 15;66(14):7024-31.
87. Blumenthal A, Ehlers S, Lauber J, Buer J, Lange C, Goldmann T, Heine H, Brandt E, Reiling N. The Wingless homolog WNT5A and its receptor Frizzled-5 regulate inflammatory responses of human mononuclear cells induced by microbial stimulation. Blood. 2006 Aug 1;108(3):965-73. Epub 2006 Apr 6.
88. Sen M, Lauterbach K, El-Gabalawy H, Firestein GS, Corr M, Carson DA. Expression and function of wingless and frizzled homologs in rheumatoid arthritis. Proc Natl Acad Sci U S A. 2000 Mar 14;97(6):2791-6.
89. Yang, Y., Topol, L., Lee, H., and Wu, J. (2003) Development 130, 1003–1015.
90. Kawakami, Y., Wada, N., Nishimatsu, S. I., Ishikawa, T., Noji, S., and Nohno, T. (1999) Dev. Growth Differ. 41, 29–40.
91. Loganathan, P. G., Nimmagadda, S., Huang, R., Scaal, M., and Christ, B. (2005) Histochem. Cell Biol. 123, 195–201.
92. Bergwitz, C., Wendlandt, T., Kispert, A., and Brabant, G. (2001) Biochim. Biophys. Acta 1538, 129–140.
93. De Boer J, Wang HJ, Van Blitterswijk C. Effects of Wnt signaling on proliferation and differentiation of human mesenchymal stem cells. Tissue Eng. 2004 Mar- Apr;10(3-4):393-401.
94. Church VL, Francis-West P. Wnt signalling during limb development. Int J Dev Biol. 2002;46(7):927-36.
130
95. Hwang SG, Ryu JH, Kim IC, Jho EH, Jung HC, Kim K, Kim SJ, Chun JS. Wnt-7a causes loss of differentiated phenotype and inhibits apoptosis of articular chondrocytes via different mechanisms. J Biol Chem. 2004 Jun 18;279(25):26597- 604. Epub 2004 Apr 13.
96. Rudnicki JA, Brown AM. Inhibition of chondrogenesis by Wnt gene expression in vivo and in vitro. Dev Biol. 1997 May 1;185(1):104-18.
97. Je-Hwang Ryu and Jang-Soo Chun. Opposing Roles of WNT-5A and WNT-11 in Interleukin-1b Regulation of Type II Collagen Expression in Articular Chondrocytes. The Journal Of Biological Chemistry VOL. 281, NO. 31, pp. 22039–22047, August 4, 2006.
98. Yun Hyun Huh, Je-Hwang Ryu, and Jang-Soo Chun. Regulation of Type II Collagen Expression by Histone Deacetylase in Articular Chondrocytes. The Journal Of Biological Chemistry VOL. 282, NO. 23, pp. 17123–17131, June 8, 2007.
99. Andrade AC, Nilsson O, Barnes K, and Baron J. Wnt gene expression in the post- natal growth plate: regulation with chondrocyte differentiation. Bone. 2007 May ; 40(5): 1361–1369.
100. Später D, Hill TP, Gruber M, Hartmann C. Role of canonical Wnt-signalling in joint formation. Eur Cell Mater. 2006 Nov 17;12:71-80.
101. Nalin AM, Greenlee TK Jr, Sandell LJ. Collagen gene expression during development of avian synovial joints: transient expression of types II and XI collagen genes in the joint capsule. Dev Dyn. 1995 Jul;203(3):352-62.
102. Meghan T. Maher, Annette S. Flozak, Adam M. Stocker, Anjen Chenn, and Cara J. Gottardi. Activity of the β-catenin phosphodestruction complex at cell–cell contacts is enhanced by cadherin-based adhesion. J Cell Biol. 2009 July 27; 186(2): 219–228.
103. Hendriksen J, Jansen M, Brown CM, van der Velde H, van Ham M, Galjart N, Offerhaus GJ, Fagotto F, Fornerod M. Plasma membrane recruitment of dephosphorylated beta-catenin upon activation of the Wnt pathway. J Cell Sci. 2008 Jun 1;121(Pt 11):1793-802
104. Hunter DD, Zhang M, Ferguson JW, Koch M, Brunken WJ. The extracellular matrix component WIF-1 is expressed during, and can modulate, retinal development. Mol Cell Neurosci. 2004 Dec;27(4):477-88.
105. Qing-Li Wu, Claudia Zierold, and Erik A. Ranheim. Dysregulation of Frizzled 6 is a critical component of B-cell leukemogenesis in a mouse model of chronic lymphocytic leukemia. Blood, 26 March 2009, Vol. 113, No. 13, pp. 3031-3039.
131
106. Golan T, Yaniv A, Bafico A, Liu G, Gazit A. The Human Frizzled 6 (HFz6) Acts as a Negative Regulator of the Canonical Wnt·β-Catenin Signaling Cascade. J Biol Chem. 2004 Apr 9;279(15):14879-88. Epub 2004 Jan 27.
107. Hinck L, Nelson WJ, Papkoff J. Wnt-1 modulates cell-cell adhesion in mammalian cells by stabilizing beta-catenin binding to the cell adhesion protein cadherin. J Cell Biol. 1994 Mar;124(5):729-41.
108. Hwang SG, Ryu JH, Kim IC, Jho EH, Jung HC, Kim K, Kim SJ, Chun JS. Wnt-7a causes loss of differentiated phenotype and inhibits apoptosis of articular chondrocytes via different mechanisms. J Biol Chem. 2004 Jun 18;279(25):26597- 604. Epub 2004 Apr 13.
109. Rudnicki JA, Brown AM. Inhibition of chondrogenesis by Wnt gene expression in vivo and in vitro. Dev Biol. 1997 May 1;185(1):104-18.
110. Ede DA (1983) Cellular condensations and chondrogenesis. In: Hall BK (ed) Cartilage: Development, Differentiation, and Growth. Academic Press, New York, Vol. 2, pp 143–185
111. Oberlender SA, Tuan RS (1994b) Spatiotemporal profile of Ncadherin expression in the developing limb mesenchyme. Cell Adhesion Comm 2:521–537.
112. Ahrens PB, Solursh M, Reiters R (1977) Stage-related capacity for limb chondrogenesis in cell culture. Dev Biol 60:69–82
113. Denker AE, Nicoll SB, Tuan RS (1995) Formation of cartilage-like spheroids by micromass cultures of murine C3H10T1/2 cells upon treatment with transforming growthfactor-ß1. Differentiation 59:25–34.
114. Chowdhury T.T. Bader D.L. Lee D.A. Dynamic compression inhibits the synthesis of nitric oxide and PGE(2) by IL-1 beta-stimulated chondrocytes cultured in agarose constructs. Biochem Biophys Res Commun. 2001;285:1168.
115. Hunter C.J. Imler S.M. Malaviya P. Nerem R.M. Levenston M.E. Mechanical compression alters gene expression and extracellular matrix synthesis by chondrocytes cultured in collagen I gels. Biomaterials. 2002;23:1249.
116. Nam J, Rath B, Knobloch TJ, Lannutti JJ, Agarwal S. Novel Electrospun Scaffolds for the Molecular Analysis of Chondrocytes Under Dynamic Compression. Tissue Eng Part A. 2009 March; 15(3): 513–523.
132 117. Je-Hwang Ryu and Jang-Soo Chun Opposing Roles of WNT-5A and WNT-11 in Interleukin-1 Regulation of Type II Collagen Expression in Articular Chondrocytes. J Biol Chem. 281(31), pp. 22039–22047.
118. Hwang SG, Ryu JH, Kim IC, Jho EH, Jung HC, Kim K, Kim SJ, Chun JS. Wnt-7a causes loss of differentiated phenotype and inhibits apoptosis of articular chondrocytes via different mechanisms. J Biol Chem. 2004 Jun 18;279(25):26597- 604. Epub 2004 Apr
119. Rezzonico R, Burger D, Dayer JM. Direct contact between T lymphocytes and human dermal fibroblasts or synoviocytes down-regulates types I and III collagen production via cell-associated cytokines. J Biol Chem. 1998 Jul 24;273(30):18720-8.
120. Rudnicki JA, Brown AM. Inhibition of chondrogenesis by Wnt gene expression in vivo and in vitro. Dev Biol. 1997 May 1;185(1):104-18.
121. Tufan AC, Tuan RS. Wnt regulation of limb mesenchymal chondrogenesis is accompanied by altered N-cadherin-related functions. FASEB J. 2001 Jun;15(8):1436-8.
133