bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
PKA drives paracrine crisis and WNT4-dependent testis tumor in Carney complex
Authors: C. Djari1, I. Sahut-Barnola1, A. Septier1, I. Plotton2, N. Montanier1,3, D. Dufour1, A.
Levasseur1, J. Wilmouth1, JC. Pointud1, FR. Faucz4, C. Kamilaris4, AG. Lopez5, F. Guillou6,
A. Swain7, S. Vainio8, I. Tauveron1,3, P. Val1, H. Lefebvre9, CA. Stratakis4, A. Martinez1,
AM. Lefrançois-Martinez1*
Affiliations :
1 Université Clermont Auvergne, CNRS, Inserm, GReD, F-63000 Clermont–Ferrand, France.
2 Laboratoire de Biochimie et Biologie Moléculaire Grand Est, UM Pathologies Endocriniennes
Rénales Musculaires et Mucoviscidose, Groupement Hospitalier Est, Hospices Civils de Lyon,
Bron, France.
3 Université Clermont Auvergne, CHU Clermont-Ferrand, F-63000 Clermont–Ferrand, France.
4 Section on Endocrinology and Genetics, Eunice Kennedy Shriver National Institute of Child
Health and Human Development (NICHD), National Institutes of Health (NIH), Bethesda, MD
20892, USA.
5 Normandie Univ, UNIROUEN, INSERM U1239, Rouen University Hospital, Department of
Endocrinology, Diabetology and Metabolic Diseases, F 76000, Rouen, France.
6 PRC, INRA, CNRS, IFCE, Tours University, 37380 Nouzilly, France.
7 Division of Cancer Biology, Institute of Cancer Research, London SW3 6JB, United
Kingdom.
8 Laboratory of Developmental Biology, Faculty of Biochemistry and Molecular Medicine,
Biocenter Oulu, University of Oulu, Aapistie 5A, 90220, Oulu, Finland.
9 Normandie Univ, UNIROUEN, INSERM U1239, Rouen University Hospital, Department of
Endocrinology, Diabetology and Metabolic Diseases and CIC-CRB 1404, F 76000, Rouen,
France.
* Corresponding author. Email: [email protected]
1 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
ABSTRACT
Large Cell Calcifying Sertoli Cell Tumors (LCCSCTs) are among the most frequent lesions
occurring in Carney complex (CNC) male patients. Although they constitute a key diagnostic
criterion for this rare multiple neoplasia syndrome resulting from inactivating mutations of the
tumor suppressor PRKAR1A leading to unrepressed PKA activity, the LCCSCT pathogenesis
and origin remain elusive. Mouse models targeting Prkar1a inactivation in all somatic
populations or separately in each cell type were generated to decipher the molecular and
paracrine networks involved in the CNC testis lesion induction. We demonstrate that Prkar1a
mutation is required in both stromal and Sertoli cells for the occurrence of LCCSCT. Integrative
analyses comparing transcriptomic, immunohistological data and phenotype of mutant mouse
combinations led to understand the human LCCSCT pathogenesis and demonstrated
unprecedented PKA-induced paracrine molecular circuits in which the aberrant WNT4 signal
production is a limiting step in shaping intratubular lesions and tumor expansion both in mouse
model and human CNC testes.
2 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
INTRODUCTION
Carney complex (CNC) is a rare multiple neoplasia syndrome mainly associated with
inactivating mutation of PRKAR1A gene encoding the R1α subunit of the PKA which results in
overactive PKA signaling pathway (1). It is characterized by pigmented lesions of the skin and
mucosae, cardiac, cutaneous and other myxomatous tumors, and multiple other endocrine and
non-endocrine neoplasms (2, 3). Approximatively 70% of patients are estimated to develop
Large Cell Calcifying Sertoli Cell Tumors (LCCSCTs) (2, 4). LCCSCT is a testicular Sex Cord
Stromal Tumor (SCST) subtype characterized by bilateral and multifocal masses caused by
inactivating mutations of PRKAR1A (17q22-24) associated with Carney complex (CNC) but is
also described in Peutz-Jeghers syndrome (PJS) caused by inactivating mutations of STK11
(19p13.3) (5, 6). LCCSCTs developing in the case of CNC (CNC-LCCSCTs) are mostly benign
tumors with low malignant potential and may be diagnosed from the childhood by sonographic
examination, and associated with precocious puberty in some cases (7, 8). In engineered
Prkar1a+/- mice, loss of heterozygosity occurrence for Prkar1a locus has been implicated in
the tumorigenesis process for CNC related neoplasia (9) indicating that the resulting
constitutive PKA activity plays an oncogenic role in specific tissues (10). The LCCSCT current
management consists in the resection of the primary tumor owing to the limited effect of
chemotherapy or radiation treatments. However the tumor discriminant markers are insufficient
to allow early detection of a potential recurrence and to distinguish LCCSCT from other SCST.
Histological analyses highlight various tissue alterations (11). Moderate tubular damages
characterized by spermatogenesis defects, calcifications, peritubular fibrosis and composite
tumour mass combined with Sertoli cell proliferating nodules are described (12, 13). LCCSCT
are systematically associated with increased production of Inhibin-α, S100, Calretinin and β-
catenin but its molecular status is still incomplete due to the low LCCSCT incidence (11, 14,
15). Therefore the molecular mechanisms and the cellular events involved in LCCSCT
3 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
pathogenesis remain to be understood to improve their management. Moreover, the
reproductive alterations have been poorly investigated in male CNC patients, concerning their
fertility as well as their testis endocrine activity.
In embryo, Sertoli cells (SC) and Leydig cells (LC) arise from a common pool of SF1+ (also
called NR5A1) progenitor cells under the control of coordinate genetic and paracrine
mechanisms triggered by the male determining SRY and SOX9 induced programs to counteract
the female RSPO1/WNT4/-catenin and FOXL2 pathways (16). At adulthood, testicular
physiology carries out exocrine and endocrine functions: SC support the germ cell (GC) nursing
including growth and differentiation in seminiferous tubules (ST), and LC produce androgens
in interstitial compartment. Pituitary Follicle Stimulating Hormone (FSH) and Luteinizing
Hormone (LH) are the main regulators of the adult SC and LC functions through their respective
specific G protein-coupled receptor, FSH-R and LH-R, both interacting with number of
intracellular effectors, among which the cAMP/PKA pathway plays a central role. Activating
mutations of human FSH-R and LH-R resulting in permanent PKA activity have been described
for several years and their physiological outcomes were extensively studied through
biochemical and functional approaches including mutant mice models (17–20). Whether
activating mutations of the gonadotropin receptors are involved in tumor development is not
yet clear and their pathological outcomes do not overlap with the testis CNC lesions etiology.
The objective of our work was to identify the molecular networks (deregulated by PKA
activation) which cause the resulting cellular alterations found in the CNC testis. We generated
several mouse genetic models lacking Prkar1a either in all somatic testicular cells arising from
fetal somatic progenitor (prKO model: Sf1:Cre,Prkar1afl/fl), or exclusively in SC (srKO model:
Amh:Cre,Prkar1afl/fl) or LC (lrKO model: Cyp11a1:Cre,Prkar1afl/fl). The ontogenic follow-up
of these models together with genetic manipulation of catalytic PKA subunit and WNT signal
4 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
should provide a readout of the sequence of histological, molecular and endocrine modifications
arising in human LCCSCT from CNC patient.
5 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
RESULTS
Prkar1a loss in mouse testicular somatic cells induces LCCSCT-like lesions
Sf1:Cre, Prkar1afl/fl mice (prKO mice) were generated to clarify the CNC-LCCSCT lesions
arising mechanisms by targeting early Prkar1a inactivation (E10.5) in somatic testis cells
(Figure S1A and B). The use of Rosa26R-mtmg reporter locus confirmed that the recombination
affected all somatic testis cell type excluding the GC population as previously described (21)
(Figure S1 A-C) and RTqPCR analyses confirmed a robust reduction in Prkar1a mRNA levels
in prKO testes (Figure S1D). The mutant mice colony setup revealed that prKO male mice were
sterile since the onset of puberty due to a lack of spermatozoa production and displayed
disrupted gonadotropic axis with collapsed FSH and LH levels associated with
hypertestosteronemia (Figure S1 E-G). By contrast, 2-month-old Sf1:cre,Prkar1afl/fl,Prkaca-/+
male mice, harboring Prkaca haploinsufficiency with decreased PKA catalytic activity,
retained healthy testis histological integrity indicating that testis failures in prKO mice were
mostly due to PKA overactivation (Figure S2 A-E). Masson trichrome and HE staining revealed
that 2 and 4-month-old prKO mice exhibited a severe gonadic dysplasia with seminiferous
compartment disorganization. These defects were combined to calcification areas revealed by
Alizarin Red coloration, peritubular basal lamina thickening attested by Laminin B1
immunostaining, and germ cell loss in close similarity with human CNC-LCCSCT histology
(Figure 1, A and B) (Figure S1 H-J) (Figure S3). Transcripts levels for the SCST current
molecular markers i.e. Calb2, Ctnnb1, Inha, S100a1 were also strongly increased in the 4-
month-old prKO testes compared with WT (Figure 1C). Moreover, hypertrophic blood vessels
and early bilateral proliferative stromal tumor mass expansion attested by increased stromal
PCNA index were observed in 4-month-old mutant testes whereas only limited stromal
hyperplastic areas arose without tubular defect in 2-week-old mutant testis (Figure 1A, D-E)
(Figure S1K-L). By contrast, heterozygous Sf1:Cre,Prkar1afl/+ littermates display healthy
6 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
testicular phenotype similarly to the Prkar1afl/fl mice. All these observations demonstrated that
loss of Prkar1a in mice phenocopied all tissue defects found in testes from CNC patients. To
gain insight into the gene expression profiles associated with the prKO testis lesion set up, we
conducted comparative microarray analyses on gene expression in 2-week and 2-month-old
prKO and WT testes. Transcriptomic analyses revealed 1328 significantly deregulated genes in
adult prKO mice (676 up- and 652 down-regulated genes) whereas only 93 genes were
deregulated at 2 weeks in mutant testes (90 up- and 3 down-regulated genes compared with WT
(abs(Log2FC)>1, adj. p-val.<0.05) (Figure 1F and G). These data emphasized the delayed
functional response to Prkar1a inactivation that was triggered from the early fetal gonadal stage
(Figure S1B). Gene ontology analyses performed on transcriptomic data from 2-week-old testes
highlighted an increased expression in genes involved in steroid metabolism whereas gene
signatures associated with intratubular cells homeostasis were virtually unaffected (Datafiles
S3). Consistent with these observations, hormonal assays revealed a significative 134-fold
increased testosterone levels in 17 day-old prKO testes (5.39ng/organ) compared with WT
(0.04ng/organ) (plasma testosterone levels = 16.01ng/mL ± 5.12 in prKO vs 0.16 ng/mL ± 0.04
in WT) whereas testosterone levels were unchanged in the plasma of 5-day-old prKO mice
(0.27ng/mL ± 0.12) compared with WT (0.14ng/mL ± 0.04). In 2-month-old prKO mice,
unbiased Gene Ontology (GO) and KEGG analyses revealed a negative enrichment in
molecular signatures associated with spermatogenesis, sperm motility and a positive
enrichment in gene expression involved in tissue reorganization and metabolic processes
(Figure 1H) indicating that Prkar1a gene inactivation resulted in complex and deep disruption
of adult testis functions and somatic cell tumor formation.
Seminiferous tubules defects are associated with Prkar1a loss in Sertoli cells
Sf1:Cre mediated recombination in testis targeted both supporting and stromal cells and resulted
in a complex phenotype in adult prKO mice with intratubular and stromal compartment
7 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
alterations that could be amplified by reciprocal dysregulated paracrine signals. To unravel the
cell specific Prkar1a loss impacts in the global LCCSCT pathogenesis, we generated lrKO
(Scc-Cre,Prkar1afl/fl) and srKO (Amh-Cre,Prkar1afl/fl) mouse models with either Leydig or
Sertoli cell-specific Prkar1a invalidation triggered from E13.5 and E15 respectively using
Cyp11a1:Cre or Amh:Cre drivers (22, 23). The cell specificity of recombination was confirmed
by analysing Rosa26R-mtmg reporter activity (Figure S4 A-D). Similarly to WT, 2-month-old
lrKO mice were fertile and showed healthy testicular histology (Figure 2 A-E) devoid of stromal
hyperplasia or tumor expansion. However like prKO mice, adult lrKO male mice developed
hypertestosteronemia (Figure S4G). Transcriptomic data from comparative lrKO vs WT testes
microarrays analyses confirmed fewer molecular deregulations in 2-month-old lrKO testes with
only 22 significantly deregulated genes (17 up- and 5 down-regulated genes) (Figure 2G). By
contrast loss of Prkar1a in SC (srKO model) was sufficient to reproduce intratubular and
peritubular LCCSCT lesions and led to infertility (Figure 2 A-D) (Figure S4 E and F).The
unbiased transcriptomic analyses revealed a huge deregulation of the molecular networks in 2-
month-old srKO testes (560 deregulated, 150 up- and 410 down-regulated genes) (Figure 2F
and G). Comparative heatmap analyses between WT, prKO, srKO, and lrKO model data
highlighted a main cluster of 473 genes (84.4 % of srKO deregulated genes) exhibiting
deregulations both in 2-month-old prKO and srKO mutant testes (114 up- and 359 down-
regulated genes) compared with WT. Consistent with the germ cell population decrease, 75.5%
of this cluster genes were significantly down-regulated and strongly associated with
spermatogenesis alteration in gene set enrichment analyses (Figure 2G and H) (Figure 3A).
Unlike prKO model, adult srKO mice had normal testosterone plasmatic levels and never
developed tumour mass (up to 12 months of age) (Figure S4 G and H). In agreement with the
delayed Prkar1a loss impact previously observed in prKO model, transcriptomic analyses of
both 2-week-old lrKO and srKO testes revealed very few divergence from WT molecular
8 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
signatures (Figure 2F). Altogether molecular and histological data from srKO mice
demonstrated that loss of Prkar1a restricted to SC failed to initiate tumorigenesis although ST
functions were altered.
PKA overactivation in Sertoli cell triggers increased germ cell apoptosis from prepubertal
age
Adult prKO and srKO mice shared common deregulated molecular signatures associated with
non-autonomous GC loss that could be attributed to disturbed Sertoli cells nursing capacities.
Hallmark gene set enrichment analyses (GSEA) of a “spermatogenesis” gene set showed a
robust negative enrichment in srKO and prKO testes, that was associated with an “apoptosis”
gene set positive enrichment compared with WT (Figure 3, A and B). In order to specify the
nature of the cellular events leading to the GC loss at adulthood in response of Sertoli Prkar1a
inactivation, the developing GC types in srKO testes were evaluated. Significant increased
TUNEL staining over the entire width of the germinal epithelium from 5-week and 2-month-
old srKO testes confirmed that apoptosis induced by Prkar1a loss occurred at different
spermatogenesis stages and contributed to decrease the germinal epithelium thickness (Figure
3, C-F). Although a complete lack of spermatozoa was evidenced in 2-month-old srKO ST
(Figure 3G), immunostaining analyses inventoried only a significant 1.8-fold decrease in
ZBTB16+ spermatogonia and a 1.6-fold decrease in G9A+ cells number (Figure 3, H-K)
corresponding to the undifferentiated spermatogonia up to early leptotene spermatocyte
populations. Moreover, SYCP3+ spermatocyte number was unchanged in srKO compared with
WT (Figure 3, L and M), suggesting the occurrence of compensatory events counteracting
increased apoptotic germ cell counts. Indeed, further time course analysis revealed a transient
growing number of ZBTB16+ cells, G9A+ cells and SYCP3+ meiotic cells from 2 up to 5
weeks of age which paralleled a significant increased srKO testis weight from PND9 to 5 weeks
compared with WT (Figure S5, A and B). This enhanced germ line expansion including
9 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
elongated spermatid formation resulted in an abnormal full filling of the srKO ST as attested
by testis weight that culminated at 5 weeks of age before being drastically drained thereafter
(Figure S5, C-E). SOX9 immunostaining analyses revealed that SC number was significantly
1.17-fold increased in 2-week-old srKO testis compared with WT and 0.85-fold decreased at 7
weeks (Figure S5, F and G). However, these slight variations were unlikely to fully account for
the magnitude of the alterations affecting the germ line. Altogether these data demonstrated that
the lack of germ line in adult srKO testis was rather due to chronic apoptosis events overlapping
deregulated increase of GC population than to a meiosis commitment blockade in response to
SC Prkar1a gene inactivation. These observations are consistent with DDX4 immunostaining
in human CNC-LCCSCT biopsies evidencing a strong decrease in GC number (Figure 3, N-P).
PKA overactivation alters Sertoli cell polarity
The formation of flaking vacuoles inside the germinal epithelium associated with round clusters
of GC released in the lumen was another phenomena specifically occurring in the testes of CNC
patients and prKO and srKO mice that should result, together with apoptosis, in the loss of
spermatogenic cells (Figure4A-D). Comparative time course analyses of srKO and prKO
histological intratubular alterations indicated a more precocious prKO increase in vacuolated
tubules into the germinal epithelium compared with srKO model that could contribute to worsen
germ cell depletion (Figure 4D) (Figure S6A). Consistent with these observations, GSEA of the
transcriptome of 2-month-old srKO testis revealed extended modification of the molecular
networks supporting tubule architecture including, cytoskeleton, adhesion, or junctional
proteins (Figure 4E). To gain insight into the modulators of the germinal epithelium integrity,
we extracted expression levels of a list of 32 genes involved in Sertoli-Sertoli junctions or
Sertoli-GC interactions. Fifteen of these 32 genes were significantly up-regulated and 3 genes
were down-regulated both in srKO and prKO testes compared with WT (Figure 4F) and RT–
qPCR conducted on independent WT, srKO and prKO samples confirmed their significative
10 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
deregulated expression (Figure S6B). Immunohistological analyses of Claudin11 (Cldn11) and
β-catenin (Ctnnb1) specified that these junction proteins involved in BTB establishment were
delocalized to the entire membrane perimeter in both srKO and prKO mutant testes (5 wk) and
that β-catenin staining was also diffused into the cytoplasm (Figure 4G-I). These delocalizations
were associated with a SC cytoskeleton alteration attested by Tubulinβ3 densification and
Vimentin disorganization (Figure S6C). The junctional defects were also present in the human
CNC ST located out of the tumor mass as attested by Claudin11 and -catenin IHC analyses
(Figure 4J-L). These data suggested a compromised setting of the adluminal compartment by
the blood-testis barrier (BTB) junctions which is critical to spermatogenesis achievement (24).
Therefore BTB functional integrity has been tested in the srKO and prKO mutant mice by
intratesticular injection of a fluorescent tracker (Figure 4, M and N). The tracker diffused inside
ST and confirmed a drastic loss of BTB sealing in both srKO and prKO (6 weeks of age)
demonstrating that SC failed to provide an appropriate structural dynamic for the GC
maturation across the seminiferous epithelium. Moreover, transcriptomic and RTqPCR
analyses (srKO/prKO testes) highlighted an earlier and huge up-regulation of Dpt expression
in 2-week-old prKO testes which could amplify the BTB alterations, the vacuole formation and
the germ cell loss as it was demonstrated in transgenic mice overexpressing Dpt in SC (25)
(Figure 4O).
PKA overactivation modifies Sertoli signals involved in the control of spermatogenesis
The maintenance of GC within spermatogenic cycle is supported by mature SC through
appropriate production of mitogens and differentiation factors that could be affected by Prkar1a
gene inactivation. The interaction of the growth factor Kit-ligand (KIT-L) produced by SC with
its specific c-KIT receptor expressed on GC from differentiating spermatogonia causes the
PI3K-AKT pathway activation that is required for proliferation and survival of mitotic GC, both
in the embryonic and postnatal testes (26–28). KIT-L also triggers PI3K/AKT and Ras/MAPK
11 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
crosstalk that plays a critical role in the development of germ cell cancers (29). In addition, the
KIT-L/c-KIT/JAK/STAT pathway is the main promoter of mast cell growth and differentiation
from bone marrow and peripheral progenitors (30). Cyclic AMP/PKA-driven mechanisms
leading to increased Kitl transcription in SC have been previously described (31, 32). Consistent
with these previous observations, transcriptomic and RTqPCR analyses in prKO/srKO testes
showed that Prkar1a loss led to a significant and early up-regulation of Kitl transcripts
associated with a positive enrichment of a “reactome signaling by SCF (alias KIT-L)/KIT”
gene set and to an increase in mast cells recruitment in interstitial tissue (Figure 5, A-D).
Surprisingly, further transcriptomic and RTqPCR analyses highlighted a significant up-
regulation of the Wnt4 gene expression that was listed in the common deregulated gene cluster
from adult prKO and srKO models indicating that most of the WNT4 overproduction originated
from adult SC in response to Prkar1a inactivation (Figure 5, E and F). Heatmap of a “WNT
signaling” gene set showed a robust positive enrichment of these molecular signatures in adult
srKO and prKO testes compared with WT, suggesting a functional significance of the WNT
pathway activation. This observation was confirmed by RTqPCR analysis of Axin2, c-Myc,
Ccdc80 and Nr0b1 target gene expression (Figure 5G) (33, 34). Altogether these data revealed
that PKA constitutive activation leads to a new Wnt4 up-regulation in Sertoli cells whereas
PKA dependent Wnt4 gene expression was only previously evidenced in other tissue
differentiations such as kidney tubulogenesis or uterine stromal cells decidualization (35, 36).
Wnt4 inactivation decreases germ cell apoptosis induced by Prkar1a loss
WNT4/β-catenin signaling pathway was involved in stem cell proliferation of several tissues
(37). Although WNT4/-catenin signaling was shown to be essential modulator of female ovary
differentiation (38), Ctnnb1 expression was dispensable for testis development (39). Moreover,
Boyer A, Yeh JR et al , (2012) demonstrated that excessive WNT4 signal repressed the normal
activity of germ stem cells by inducing their apoptosis (40), while forced expression of active
12 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
-catenin in fetal gonocytes deregulated spermatogonial proliferation and apoptosis (41, 42).
Our analyses indicated that the increase GC apoptosis together with disturbed BTB
establishment impaired the spermatozoa accumulation in prKO and srKO mice. In order to
assess the role of WNT4 in GC altered homeostasis triggered by Prkar1a gene loss, we
generated double KO mice for Prkar1a and Wnt4 in somatic cells (prwKO model;
Sf1:Cre,Prkar1afl/fl,Wnt4fl/fl) or restricted to Sertoli cells (srwKO model; Amh:Cre,Prkar1afl/fl,
Wnt4fl/fl) (Figure S7, A and B). As expected, simple mutant mice bearing targeted Wnt4
inactivation in SC (swKO) or in somatic cells (pwKO) were fertile and had a normal testicular
development and physiology (Figure S7C). Unlike the srKO testis, ST from 8-week-old double
mutant srwKO testis maintained a complete germinal epithelium containing all GC types
including spermatozoa, associated with a significant decrease in intratubular apoptosis events
compared with srKO testes (Figure 6, A-J). This indicates that Wnt4 loss in a PKA activation
context allowed the achievement of a complete GC lineage whereas SC junction
disorganization, flacking vacuole and infertility were still maintained (Figure 6, J-M).
Therefore, SC-specific PKA constitutive activity up-regulated the Wnt4 expression which
increased germ cell apoptosis. Nevertheless, several spermatocytes with abnormal mitotic
features not only persisted in srwKO but also were accentuated in prwKO testis despite
normalization of the germ line marker gene Ddx4 (Figure 6A, insets) (Figure S7D). These data
revealed a critical role of SC PKA pathway on spermatogenesis independent from WNT4 signal
that impaired long-term maintenance of GC. Transcriptomic and RTqPCR analyses highlighted
increased Ctnnb1 mRNA levels in the adult testes of both prKO and srKO mice that remained
elevated in srwKO and prwKO (Figure S7E) demonstrating that PKA induced Ctnnb1
expression independently from WNT4 signal.
13 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
Wnt4 inactivation impaired tumor mass formation induced by Prkar1a loss
The human LCCSCT (CNC) tumor masses are the site of proliferative activity mediated by
misunderstood mechanisms. Consistent with LCCSCT in CNC context, from 8 weeks of age,
prKO testis developed early proliferative tumour masses arising from neonatal stromal
hyperplasia. RTqPCR analyses highlighted an up-regulation of Wnt4 and Ctnnb1 expression in
2-month-old prKO mice suggesting, together with WNT signaling heatmap analysis (Figure 5,
F and G) that a PKA induced WNT/-catenin pathway could be involved in the LCCSCT
promotion in CNC patients and prKO mice. In addition to the Wnt4 up-regulation, further
analyses indicated that the loss of Prkar1a led to a chronic increase of both active -catenin
accumulation and gene expression of Fzd6 and Wnt5a in 4-month-old prKO testes (Figure 5F)
(Figure 7, A-C) that were previously demonstrated to exacerbate tumor expansion through
canonical and non-canonical WNT pathways activity in various cancers (43). Histological
examinations of mutant testes revealed that although the oldest double mutant prwKO testes
were still the site of stromal fibrosis, they were devoid of tumor mass compared with single
mutant prKO testes (Figure 7, D-F) (Figure S7E). Comparative PCNA IHC analyses confirmed
that Wnt4 inactivation strongly decreased the stromal proliferation that was triggered by
Prkar1a loss in somatic testis cells (Figure 7, G and H). Moreover, whole testis RTqPCR
analyses confirmed that in these prwKO testes, Ccdc80, Axin2 and Ki67 transcripts were
reduced compared with 4-month-old prKO testes (Figure 7, I and J). All together these results
demonstrate that WNT4 is a testis tumor signal in response to Prkar1a inactivation. Consistent
with our murine models, IHC analyses confirmed that human CNC-LCCSCT tumor mass cells
retained WNT4 huge staining that colocalized with cytoplasmic -catenin accumulation. This
demonstrates that WNT/-catenin activation is likely associated with the human CNC-
LCCSCT expansion (Figure 7K).
14 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
PKA constitutive activation in somatic cells activates growth factor signaling pathways in
CNC-LCCSCT
Unbiased gene ontology and GSEA highlighted additional prKO specific enrichment in
signatures associated with proliferative pathways that could participate in tumor formation
including up-regulated expression for Fgf2, Egf, Igf1, and Tgfb1-3 (Figure 8, A-D). RTqPCR
confirmed Fgf2 up-regulation in prKO testes compared with WT, that was reduced in prwKO
suggesting a possible Wnt4 dependent involvement of the FGF2 signaling pathway in tumour
development. By contrast increased Egf, Igf1 and Tgfb1-3 transcript levels in prKO testes
remained unaffected by Wnt4 loss suggesting that their PKA induced up-regulation was not
sufficient to trigger precocious tumor formation (Figure 8E). Proliferative/oncogenic activities
of the growth factors (IGF1, EGF, FGF2, KIT-L) overexpressed in prKO testes are mainly
mediated by converging signaling pathway including RAS/MAPK and PI3K/AKT/mTOR
signaling pathways (44–47). Immunodetection of activated MAPK modulators and mTOR
targets in WB revealed significant increased levels of phosphorylated forms of ERK, 4EBP1
and S6K in 4-month-old prKO testes compared with WT (Figure 8, F and G) confirming the
prKO gene enrichment analyses. In testis, the mTOR pathway was previously shown to control
SC polarity and spermatogenesis (48, 49). Additionally its overactivity was demonstrated to
mediate SC disruption in mice model lacking Lkb1 gene in Sertoli cells (50). In prKO testes,
IHC analyses revealed increased p4EBP1 accumulation in tubular compartment but also in
tumor mass compared with WT, demonstrating that mTOR pathway was activated in tumor
cells in response of Prkar1a loss (Figure 8H). Consistent with these observations, IHC analyses
revealed that the human LCCSCT samples retained strong p4EBP1 immunostaining restricted
to the majority of tumor cells and absent from non-tumor areas (Figure 8I). Moreover, to a
lesser extent the human LCCSCT masses also displayed numerous foci of pERK accumulation
demonstrating that these two proliferative pathways are activated in CNC-LCCSCT in response
15 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
to PRKAR1A inactivation (Figure 8J). LCCSCT are solid tumors, this implies they could be the
site of hypoxia. This hypothesis was strongly suggested in 2-month-old prKO testes by GO and
GSEA analyses highlighting positive enrichment in hypoxia responsive genes (Figure 8, A and
K). RTqPCR analyses in 4-month-old prKO mice confirmed the increased mRNA levels for
Hif1a, Hif1b, and Hif2a genes that played a central role in O2-dependent transcriptional
response (Figure 8L). Consistent with these observations, IHC analyses in human LCCSCT
revealed increased cytoplasmic and nuclear HIF2A protein accumulation restricted to the tumor
mass cells (Figure 8M). Altogether our data reveal that LCCSCT are the site of multiple
proliferative pathways including mTOR, MAPK and hypoxia, acting with active WNT/-
catenin pathway to promote growth tumor.
16 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
DISCUSSION
To gain a better understanding of the CNC-LCCSCT pathogenesis, we performed Prkar1a
inactivation either targeted in the entire somatic compartment or in main sub-types of testicular
somatic cells in mice. These unique mouse models, offering a more homogeneous sampling
than human biopsies, provide access to the early stages of the pathology as well as to advanced
stages of tumor development. In addition, they constitute unvaluable tools for deciphering
crosstalks between deregulated molecular circuits.
The prKO mice develop all the alterations identified in CNC-LCCSCT patients (bilateral
tumors arranged in solid cords, fibrosis and calcifications associated with the increased
expression of sex cord tumor markers (Calb2, Ctnnb1, Inha and S100)) and therefore they
constitute a reliable model for exhaustive analyses of the molecular alterations caused by the
lack of R1α subunit.
The ontogenic analysis of prKO model showed that major changes in endocrine activities,
histological features and testicular transcriptome did not appear before the pre-pubertal stage,
thus with a delay compared with early fetal inactivation of Prkar1a gene. This suggests that
lack of R1α subunit has little impact on testicular ontogeny during the fetal and perinatal period.
Conversely in the princeps CNC mouse model carrying constitutive homozygous Prkar1a
deletion, lethality occurred as early as E8.5 due to growth defects in mesoderm-derived cardiac
tissues which can be rescued by further inactivation of Prkaca gene encoding the C catalytic
subunit of PKA (10). Possible compensatory mechanisms involving other PKA regulatory
subunits, PKA inhibitor peptides or phosphodiesterases, in the developing fetal prKO testis
remain to be determined. It should be noted that, although the occurrence of LCCSCT in CNC
patients may be observed early in their first decade (5, 6, 51), no case of testicular abnormalities
have been reported at birth, suggesting that in humans, as in our mouse models, the Prkar1a
mutation does not cause abnormal fetal gonadal development. In our models, the total absence
17 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
of tumor in the double mutant testis Sf1:Cre,Prkar1afl/fl,Prkaca+/-, demonstrates that the
induction of testicular lesions of prKO mice relies on the unrepressed catalytic activity of PKA
rather than on a defect of the R1α subunit per se, in agreement with previous observations in
other tissue lesions of the CNC (9, 52, 53).The prKO testes transcriptomic analysis revealed a
modified expression profile for more than 1328 genes in the 2-month-old testis associated with
a tissue and functional homeostasis disruption which reflects the complexity of the mechanisms
resulting from the Prkar1a loss in all gonadal somatic cells. In addition, molecular signatures
and histological analyzes revealed germline damages resulting from paracrine/non autonomous
cell actions. Only very few studies have looked at the infertilities associated with PRKAR1A
mutations in CNC patients, nevertheless they brought out alterations in male GC (53, 54) as
consequences from PRKAR1A loss in somatic cells as well as in GC. The comparison of gene
signatures of prKO testis with those of lrKO and srKO models allowed to demonstrate that
Prkar1a inactivation restricted to Sertoli cells led to a progressive germ line loss from the
prepubertal stages resulting in infertility at puberty. In both prKO and srKO ST, the underlying
mechanisms include an increase in GC apoptosis and formation of GC syncytia containing
flaking vacuoles reminiscent to those observed at the LCCSCT periphery in CNC patients.
These massive apoptosis and desquamation mask the exacerbated increase in germ population
that occurs in the first spermatogenesis waves in srKO testis compared with littermate control
mice. These apoptotic events differ from the phenotypes observed in mouse models bearing
FSHR signaling up-regulation (tgFSH/hpg and MT-hFSHR mice) in which at best, only an
enhancement of spermatogonia proliferation and meiotic/post-meiotic cells survival were
observed (55, 56). Likewise, the activating mutations of FSH signaling described in human
species do not induce any testicular phenotype nor affect the fertility of male patients (57, 58).
While it is well documented that FSH/FSHR/PKA pathway exerts its effects on the germ line
via the production of SC growth signals such as FGF2, GDNF or KIT-L (31, 59–63, 32), our
18 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
data indicate that constitutive activation of PKA in the SC triggers additional circuits that
oppose actions normally arising from FSH/FSHR signaling. Indeed, the transcriptomic analysis
of prKO and srKO testes allowed us to point out a very strong WNT4 signal overproduction by
mutant SC. This observation is reminiscent to a previously described mouse model showing
that SC-specific -catenin constitutive activation leads to WNT4 overproduction and
subsequent decrease in the spermatogonial stem cells activity responsible for apoptosis and loss
of GC (40). Interestingly, in response to Prkar1a inactivation, our models also show WNT/-
catenin activation attested by up-regulation of Wnt4 and Ctnnb1 expression and by increased
accumulation of the -catenin active form (i.e. dephosphorylated). In CNC patients, we also
observed intracytoplasmic accumulation of -catenin in Sertoli cells from testicular biopsies.
Moreover, we found that about 36% of the genes up-regulated in Sertoli cells from the
Ctnnb1tm1Mmt/+;Amhr2tm3(cre)Bhr/+ model (40) are also up-regulated in srKO testis indicating the
establishment of partially common molecular alterations resulting from the mobilization of the
WNT/-catenin signaling pathway in the 2 models. Finally, Wnt4 inactivation, suppressing
germ line apoptosis in srwKO mice, definitely confirms the hypothesis of a converging
phenotype between these different mutant models, and demonstrates the cooperation between
overactive PKA and WNT/-catenin signaling in triggering germ line alteration. However,
unlike the observations from Boyer and coll., our analyzes of prKO and srKO mutants indicate
that the PKA-induced Wnt4 up-regulation is not associated with acquisition of granulosa Fst
marker. Moreover SC maintain high Sox9 expression while both Foxl2 and Rspo1 expression
are absent from all Prkar1a mutant testis (40). Altogether, the comparison of
Ctnnb1tm1Mmt/+;Amhr2tm3(cre)Bhr/+ and prKO or srKO models suggests that constitutive activation
of PKA both triggers massive overexpression of Wnt4 and opposes its female identity
programming function probably by reinforcing the maintenance of pro-testicular factors such
as SOX9 which regulates its own expression and represses Foxl2 expression (16, 64–67).
19 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
Transcriptomic and IHC analyses reveal an increased production of the BTB proteins and SC
associated cytoskeleton components in both mutant murine and CNC human ST. These
junctional proteins are known to be positively controlled by various factors including SOX9,
but also androgen and mTOR signaling pathways that are enhanced in our models (49, 64, 68).
However, an alteration of GC progression into the adluminal tubular compartment due to
paracellular extension of sertolian BTB proteins is unlikely to contribute to GC apoptosis in
PRKAR1A/Prkar1a mutant human and murine testes. Indeed, in double mutant prwKO ST, the
extended distribution of BTB proteins persists, while the GC apoptosis blockade partially
restores the accumulation of elongated spermatids. This indicates that structural changes in the
BTB induced by Prkar1a loss are mostly independent from WNT4 action and do not prevent
spermatogenesis achievement. Nevertheless, the SC nuclei delocalization and the BTB
functional failure are loss of polarity criteria suggestive of SC maturity disturbance in the srKO
and prKO testes. However, unlike the Ctnnb1tm1Mmt/+; Amhr2tm3(cre)Bhr/+ model (69), SC do not
proliferate in the srKO and prKO ST and no overproduction of AMH persists at adulthood.
These data indicate that activation of PKA in Sertoli cells induces specific pro-differentiating
actions that counteract some exacerbated effects of WNT/-catenin signaling observed in
mouse models developed by Tanwar and coll. and Boyer and coll (40, 69). In particular, the
Prkar1a mutant SC early display much higher increase of Inha transcripts than any other TGF
family genes. This could play a major role in limiting the SC proliferation induced by the
WNT/-catenin pathway, as suggested by previous studies on inhibinα autocrine actions (70,
71). In addition, previously defined molecular signatures attesting the Sertoli cells maturation
under the control of androgens (68, 72, 73) and TH (74, 75) remain unchanged in srKO and
prKO transcriptomes at the pre-pubertal stage (2 weeks) but increase at adulthood. Finally,
whether PKA-induced Wnt4 expression results from PKA-dependent increased Ctnnb1
expression and/or PKA-mediated -catenin activation mechanisms as described in ovarian
20 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
granulosa and luteal cells (76–78) remains to be explored for the Prkar1a-/- SC. By contrast to
the srKO and lrKO models, the prKO mice develop testicular tumors with similar histological
and molecular characteristics to LCCSCT of CNC patients. This indicates that tumor onset is
dependent on both SC and stromal proliferative signals activated by Prkar1a loss in both
testicular compartments. This unprecedent situation in genetic models of testicular tumors
underlines the role of paracrine interactions in the CNC-LCCSCT pathogenesis . Among the
up-regulated signals in response to Prkar1a loss, Wnt4 expression is present at significantly
higher levels in the prKO than in the srKO model and increases in parallel with the tumor
development suggesting that tumor cells could be an additional source of WNT4 signal. Indeed,
our IHC analyses on human CNC-LCCSCT biopsies confirm that WNT4 is accumulated into
the cells of the tumor mass. This increase in the WNT4 signal is associated with an increase in
the expression of WNT/-catenin responsive genes and therefore raised the question of its
involvement in tumor promotion of LCCSCT. The double mutant prwKO model study
demonstrates for the first time that the WNT4 signal is a limiting component in the growth
factors set that conditions the CNC-LCCSCT development. Indeed, in the prwKO testis, the
Wnt4 loss abolishes the tumor formation and drastically reduces the stromal proliferation rate
compared with prKO testis. Importantly, the Wnt4 loss does not prevent the overall WNT/-
catenin pathway activation in the prwKO testis, given that the WNT5A ligand remains produced
in excess, and that PKA-dependent phosphorylation can directly favor -catenin stabilization
(79). In this context, it can be assumed that Wnt4 inactivation sufficiently reduces the strength
of the pathway to limit stromal proliferation below a limiting threshold for tumor formation.
Residual stromal hyperplasia in the double mutant testis also confirms the impact of additional
PKA-activated growth signals independently from Wnt4 expression. Previously, a mouse model
(Ctnnb1tm1Mmt/+;Tg(AMH-cre)1Flor) expressing a stabilized form of -catenin targeted in
Sertoli cells developed testicular cancers with molecular and invasive characteristics different
21 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
from tumors of the prKO model and human CNC-LCCSCT and which arise independently of
the influence of stromal compartment (80). In human XY, while WNT4 duplications have been
associated with 46, XY testicular dysgenesis and ambiguous external genitalia occurring from
fetal development, and despite the recurrent CTNNB1 activating mutations in Sex Cord Stromal
Tumor (SCST) cells (81), WNT4 activating mutations remains poorly documented in testis
cancer incidence unlike other tissues including ovaries (82). These observations reinforce the
idea that although WNT4 signal is a mandatory actor, it does not support on its own the
formation of the LCCSCT.
Comparative analyses of the prKO and srKO testis transcriptomes at 2 months suggested an
overproduction of other proliferation signals in the prKO tumor among which FGF2 signal is
of particular interest since Fgf2 mRNA levels are closely associated with the tumor and
decrease with Wnt4 inactivation in prwKO testis. In healthy testis, Fgf2 expression was shown
to be responsive to FSH in SC (59) and to be expressed in Leydig cells where it promotes
Leydig stem cell proliferation and commitment (83). Moreover, our analyzes indicate that the
prKO testes exhibit increased expression of the Fgfr1, Fgfr2, and Scd1 genes compared with
srKO and WT testes suggesting the coregulation of these key partners in appropriate amounts
to optimize transduction of the FGF2 signaling in the tumor (84). In agreement with a possible
FGF2 involvement in human testis cancer, a study pointed significant increases in serum FGF2
levels in patients with testis tumors associated with positive expression inside tumors biopsies
(85). Although, Egf, Igf1 and Tgfb1-3 gene expressions were also strongly up-regulated in prKO
testes, they remained elevated in prwKO testes, suggesting that they could participate in
maintaining the moderate proliferation observed in the prwKO residual stromal hyperplasia. A
functional cooperation of WNT4 and TGF pathways in tumor growth and in its fibrotic
enrichment, is not excluded. Indeed, studies showed that the TGF/SMAD3 pathway mobilized
the WNT/-catenin pathway in the smooth muscle cells proliferation (86) and in the
22 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
development of pathological dermal fibrosis in a p38-dependent manner by decreasing the
accumulation of WNT pathway negative regulators (87). In the prwKO testis, the tumor
suppression is associated with a systematic reduction in the fibrotic areas that characterize the
LCCSCT. Consistent with the increase of FGF2, EGF, IGF1 and KIT-L, their converging
signaling pathways (MAPK and PI3K/AKT/mTOR) (88) are activated in the LCCSCTs of CNC
patients and prKO mice supporting their involvement in the tumoral expansion. In addition,
several studies in different tissues have shown that TGF signaling activates the expression of
miR-21 targeting PTEN production and activity, lifting the inhibition of the AKT/mTORC1
signaling which in turn amplifies oncogenic signal, matrix protein synthesis and fibrosis (89,
90). As revealed by the prKO transcriptomic analyses, the miR-21 up-regulation argues in favor
of such a TGF/mTOR crosstalk in the development of the CNC-LCCSCT. The mTOR
pathway was previously shown to be activated in SC in response to Lkb1 inactivation in a study
aiming to understand the molecular mechanisms involved in testicular alterations in Peutz-
Jeghers syndrome (PJS) (50). In this study, the mTOR pathway activation induced by disruption
of the LKB1/AMPK pathway resulted in SC polarity and BTB alterations, resumption of their
proliferative activities and loss of gem cells. However, no LCCSCT-type tumorigenesis was
shown in this work, suggesting that, as in CNC-LCCSCT, the LCCSCT-PJS development could
be dependent on signals activated by the mutation that should be present both in SC and other
testicular compartments. In the prKO model, the PKA-induced mTORC1 pathway activation
in the tumor and in SC, does not imply any alteration of the expression nor activity of AMPK,
indicating that the Prkar1a and Lkb1 mutations lead to mTOR pathway mobilization by a
different way. In previous work examining the molecular consequences of Prkar1a loss in
adrenal cortex leading to PPNAD lesions, we showed that PKA activity triggers an increase in
TGF family members expression and directly activates mTORC1 to promote cell survival (91,
92). Intriguingly and by contrast with our present results in testis, we previously showed a
23 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
marked reciprocal antagonism of the WNT/-catenin and PKA pathways in adreno-cortical
zonation and tumorigenesis (93) since Prkar1a inactivation in the adrenal cortex represses zona
glomerulosa identity and opposes the pro-oncogenic action of WNT/-catenin signaling.
Altogether, our works therefore suggest that in the CNC, the molecular modalities of PKA
action in PPNAD and LCCSCT expansion do not fully overlap. This would probably rely in
non-identical PKA controlled key networks involved in the tissue homeostasis of adrenal and
testis that yet arise from common primordium. In this context, the question of WNT-PKA
cooperation in the pathogenesis of the CNC ovary remains unanswered.
In conclusion, our data demonstrate that the chronic unrepressed PKA activity in somatic testis
cells of CNC patients unbalances testicular homeostasis by generating gonadal paracrine
networks crisis that include an aberrant post-natal WNT4 signal acting as a driving force for
shaping intratubular lesions and tumor expansion.
24 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
METHODS
Mice
Sf1:Cre (93), Amh:Cre (22), or Scc:Cre (23), Prkar1afl/fl (9) Wnt4fl/fl (94) and Prkaca+/- mice
(95) have been described previously. Mouse crossings enabled to generate multiple models:
prKO (Sf1:Cre,Prkar1afl/fl with testis somatic cell Prkar1a inactivation), prKO/Prkaca+/-
(Sf1:Cre,Prkar1afl/fl,Prkaca+/- with global Prkaca haploinsufficiency), srKO,
(Amh:Cre,Prkar1afl/fl, Sertoli cell Prkar1a inactivation), lrKO, (Scc:Cre,Prkar1afl/fl, Leydig
cell Prkar1a inactivation), double mutant prwKO, (Sf1:Cre,Prkar1afl/fl,Wnt4fl/fl) and srwKO,
(Amh:Cre,Prkar1afl/fl,Wnt4fl/fl). Mouse models are enriched with Rosa26R-mtmg system to
follow recombination events. Littermate control animals were used in all experiments. Control
animals were Prkar1afl/fl or Prkar1afl/fl,Wnt4fl/fl depending on experiments. All mice were
maintained on a mix genetic background of C57BL/6J and 129. Harvested testes were either
frozen in liquid nitrogen or fixed in 4% PFA. For the BTB integrity analysis, intratesticular
injection of EZ-Link Sulfo-NHS-LC-Biotin (15µl, 7.5mg/mL) was performed in the left testis
(21335, Thermo Scientific). Testes were harvested 30 min after injection and fixed in 4% PFA.
For embryonic analyses, the morning of vaginal plug detection was considered as E0.5. For
fertility test, males were mated each night with two females for fifteen days.
Samples from patients
Histological slides of testis lesions from 3 CNC patients were obtained from CS and HL. Human
adult normal testis sections were used as control for histological analyses (UM-HuFPT151,
CliniSciences). The clinical data summary of CNC patients is provided in table S1.
Hormonal measurements
Mice were euthanized by decapitation and blood was collected between 9:00(a.m.) and
10:00(a.m.) since animals were maintained with 12h light (07:00-19:00) / dark cycle. Plasma
testosterone concentrations were determined using ELISA kit for srKO/ lrKO models
25 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
(MBS267437, MyBioSource) and by LC-MS/MS for prKO model (Collab. IP). Plasma LH and
FSH concentrations were determined using a multiplex assay (MPTMAG-49K, Merck
Millipore).
Histology
Testes were embedded in paraffin and 5µm section were prepared. H&E, Masson’s trichrome,
Red Alizarine S or Toluidine Blue stainings were performed depending on experiments.
Immunohistochemistry and TUNEL staining were performed according to conditions described
in table S2. Images were acquired with a Zeiss Axioplan 2, Zeiss AxioImager or Zeiss Axioscan
Z1 slide scanner. A detailed description of materials and methods is provided in Supplementary
material.
Micro-array analyses
Gene expression profiles for 2-weeks and 2-month-old WT, prKO, srKO and lrKO testes were
analyzed using Affymetrix Mouse Gene 2.0 ST Arrays. Raw and processed data are deposited
on NCBI Gene Expression Omnibus (GEO) platform. Gene expression was normalized by
RMA (Affy R package) and genotype comparisons were performed using the Limma package.
All p-values were adjusted by the Benjamini-Hochberg correction method. Genes with adjusted
p-value<0.05 were considered significantly deregulated and highly deregulated if
abs(Log2FC)>1.0 (Datafiles S1). Heatmaps were generated with R and represent colour-coded
individual median centered gene expression levels. Gene set enrichment analyses were
conducted using GSEA 4.0.2 with MSigDB or custom gene sets (Datafiles S2). Permutation
were set to 1000 and were performed on gene sets. Enrichment analyses of GO and KEGG
terms were conducted using DAVID 6.8 (Datafiles S3). Dotplot and Volcanoplot were
generated with R.
26 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
RTqPCR
Total mRNAs were extracted using RNAII nucleotide extraction kit (Macherey Nagel) and
reverse transcribed as previously described (93).Primers used are listed in table S3. For each
primer pairs, efficiency of PCR reactions was evaluated by amplification of serial dilutions of
a mix of cDNAs. Relative gene expression was obtained by the ΔΔCt method with
normalization to average expression of Actin.
Western blot
Thirty micrograms of total proteins were loaded on 8% SDS-page gel, transfer on nitrocellulose
and detected with primary antibodies (table S2). Signals were quantified with ChemiDoc MP
Imaging System camera system (Bio-rad) and Image Lab software (Bio-rad). Expression of
phosphorylated or active proteins were normalized to expression of the corresponding total
protein.
Statistics
Statistical analyses were performed using R and GraphPad Prism 8. Number of mice per group
are reported in the figures. All bars represent the mean ± SD. Normality of data was assessed
using Shapiro-Wilk normality test. For comparison of two groups, variance equality was tested
using F test. Statistical analysis of two groups was performed by two-tailed Student’s t test with
or without Welch’s correction (as a function of variance) for normally distributed data or by
Mann-Whitney’s test for not normally distributed data. For comparison of multiple groups,
variance equality was tested using Brown-Forsythe test. Statistical analysis of multiple groups
was performed by one-way ANOVA followed by Tukey multiple correction test or Welch’s
one-way ANOVA followed by Games-Howell multiple correction test (as a function of
variance) for normally distributed data or by Kruskal-Wallis’ test followed by Dunn’s multiple
correction test for not normally distributed data. Statistical analysis of hyperplasia/tumor
proportion was performed by two proportion Fisher’s test.
27 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
Study approval
All patients undergo tumor resection and gave informed consent for the use of their resected
tissues for research purposes. Mouse experiments were conducted according to French and
European directives for the use and care of animals for research purposes and was approved by
the local ethic committee (C2E2A).
28 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
AUTHOR CONTRIBUTIONS
CD, AMLM and AM designed research. FG, A.Swain and SV provided Cre expressing and
Wnt4-floxed mice. CAS, CK, FRF, HL and AGL provided human tumor samples and clinical
data. CD, DD, AL, AMLM, NM, IP, JCP, ISB and JW performed experiments. CD, AMLM,
AM, ISB and A.Septier analyzed data. CD, AMLM wrote the paper. AM, IT and PV edited the
paper.
29 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
ACKNOWLEDGMENTS
We acknowledge Dr. C.Lyssikatos (now at the University of Indiana, Indianapolis, IN, USA)
and Dr. E.Belyavskaya (NICHD, NIH, Bethesda, MD, USA) for the coordination of the clinical
studies and sample retrieval and shipment, under protocol 95CH0059. We thank A.François,
Professor J.C.Sabourin (Head of the CRB-TMT in Rouen) and the CRB-TMT in Rouen to
provide us human tumor samples. We thank K.Ouchen, S.Plantade and P.Mazuel for animal
care, C.Damon-Soubeyrand (Anipath-Clermont), and J.P.Saru for their technical assistance,
Y.Renaud for management of bioinformatic platform. Funding: This work was funded through
institutional support from Université Clermont-Auvergne, CNRS, INSERM, the French
government IDEX-ISITE initiative 16-IDEX-0001 (CAP 20-25), and grants from Fondation
Association pour la Recherche sur le Cancer (to C.D.) and Agence Nationale pour la Recherche
(ANR-14-CE12-0007-01-DevMiCar, to A.M.). This work was in part funded by the NICHD,
NIH (Bethesda, MD, USA) intramural research program (to CA. S.). Competing interests:
The authors declare no conflict of interest. Data and materials availability: The microarray
data have been deposited in the Gene Expression Omnibus (GEO) Database.
30 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
REFERENCES
1. Bertherat J et al. Mutations in regulatory subunit type 1A of cyclic adenosine 5’-
monophosphate-dependent protein kinase (PRKAR1A): phenotype analysis in 353 patients and
80 different genotypes. J. Clin. Endocrinol. Metab. 2009;94(6):2085–2091.
2. Stratakis CA, Kirschner LS, Carney JA. Clinical and Molecular Features of the Carney
Complex: Diagnostic Criteria and Recommendations for Patient Evaluation. J Clin Endocrinol
Metab 2001;86(9):4041–4046.
3. Boikos SA, Stratakis CA. Carney complex: the first 20 years. Curr Opin Oncol
2007;19(1):24–29.
4. Correa R, Salpea P, Stratakis CA. Carney complex: an update. Eur. J. Endocrinol.
2015;173(4):M85-97.
5. Ulbright TM, Amin MB, Young RH. Intratubular large cell hyalinizing sertoli cell neoplasia
of the testis: a report of 8 cases of a distinctive lesion of the Peutz-Jeghers syndrome. Am. J.
Surg. Pathol. 2007;31(6):827–835.
6. Gourgari E, Saloustros E, Stratakis CA. Large-cell calcifying Sertoli cell tumors of the testes
in pediatrics. Curr. Opin. Pediatr. 2012;24(4):518–522.
7. Carney JA, Gordon H, Carpenter PC, Shenoy BV, Go VL. The complex of myxomas, spotty
pigmentation, and endocrine overactivity. Medicine (Baltimore) 1985;64(4):270–283.
8. Kratzer SS et al. Large cell calcifying Sertoli cell tumor of the testis: contrasting features of
six malignant and six benign tumors and a review of the literature. Am. J. Surg. Pathol.
1997;21(11):1271–1280.
9. Kirschner LS et al. A Mouse Model for the Carney Complex Tumor Syndrome Develops
Neoplasia in Cyclic AMP–Responsive Tissues. Cancer Res 2005;65(11):4506–4514.
10. Amieux PS, McKnight GS. The essential role of RI alpha in the maintenance of regulated
PKA activity. Ann. N. Y. Acad. Sci. 2002;968:75–95.
31 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
11. Mesa H et al. Comparative immunomorphology of testicular Sertoli and sertoliform tumors.
Hum. Pathol. 2017;61:181–189.
12. Idrees MT et al. The World Health Organization 2016 classification of testicular non-germ
cell tumours: a review and update from the International Society of Urological Pathology Testis
Consultation Panel. Histopathology 2017;70(4):513–521.
13. Roth LM, Lyu B, Cheng L. Perspectives on testicular sex cord-stromal tumors and those
composed of both germ cells and sex cord-stromal derivatives with a comparison to
corresponding ovarian neoplasms. Hum. Pathol. 2017;65:1–14.
14. Toppari J et al. Inhibin gene expression in a large cell calcifying Sertoli cell tumour and
serum inhibin and activin levels. APMIS 1998;106(1):101–112; discussion 112-113.
15. Sato K et al. Large cell calcifying Sertoli cell tumor of the testis: comparative
immunohistochemical study with Leydig cell tumor. Pathol. Int. 2005;55(6):366–371.
16. Rotgers E, Jørgensen A, Yao HH-C. At the Crossroads of Fate—Somatic Cell Lineage
Specification in the Fetal Gonad. Endocr Rev 2018;39(5):739–759.
17. Nordhoff V, Gromoll J, Simoni M. Constitutively active mutations of G protein-coupled
receptors: the case of the human luteinizing hormone and follicle-stimulating hormone
receptors. Arch. Med. Res. 1999;30(6):501–509.
18. Huhtaniemi I et al. Genetically modified mouse models in studies of luteinising hormone
action. Mol. Cell. Endocrinol. 2006;252(1–2):126–135.
19. Casarini L, Pignatti E, Simoni M. Effects of polymorphisms in gonadotropin and
gonadotropin receptor genes on reproductive function. Rev Endocr Metab Disord
2011;12(4):303–321.
20. McGee SR, Narayan P. Precocious puberty and Leydig cell hyperplasia in male mice with
a gain of function mutation in the LH receptor gene. Endocrinology 2013;154(10):3900–3913.
32 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
21. Bingham NC, Verma‐Kurvari S, Parada LF, Parker KL. Development of a steroidogenic
factor 1/Cre transgenic mouse line. genesis 2006;44(9):419–424.
22. Lécureuil C, Fontaine I, Crepieux P, Guillou F. Sertoli and granulosa cell-specific Cre
recombinase activity in transgenic mice. genesis 2002;33(3):114–118.
23. Buaas FW, Gardiner JR, Clayton S, Val P, Swain A. In vivo evidence for the crucial role of
SF1 in steroid-producing cells of the testis, ovary and adrenal gland. Development
2012;139(24):4561–4570.
24. Mruk DD, Cheng CY. The Mammalian Blood-Testis Barrier: Its Biology and Regulation.
Endocr Rev 2015;36(5):564–591.
25. CAI J, LIU W, HAO J, CHEN M, LI G. Increased expression of dermatopontin and its
implications for testicular dysfunction in mice. Mol Med Rep 2016;13(3):2431–2438.
26. Ohta H, Yomogida K, Dohmae K, Nishimune Y. Regulation of proliferation and
differentiation in spermatogonial stem cells: the role of c-kit and its ligand SCF. Development
2000;127(10):2125–2131.
27. Dolci S, Pellegrini M, Di Agostino S, Geremia R, Rossi P. Signaling through extracellular
signal-regulated kinase is required for spermatogonial proliferative response to stem cell factor.
J. Biol. Chem. 2001;276(43):40225–40233.
28. Sato T et al. Testis tissue explantation cures spermatogenic failure in c-Kit ligand mutant
mice. Proc. Natl. Acad. Sci. U.S.A. 2012;109(42):16934–16938.
29. Cardoso HJ, Figueira MI, Socorro S. The stem cell factor (SCF)/c-KIT signalling in testis
and prostate cancer. J Cell Commun Signal 2017;11(4):297–307.
30. Morales JK, Falanga YT, Depcrynski A, Fernando J, Ryan JJ. Mast cell homeostasis and
the JAK-STAT pathway. Genes Immun. 2010;11(8):599–608.
31. Yan W, Linderborg J, Suominen J, Toppari J. Stage-specific regulation of stem cell factor
gene expression in the rat seminiferous epithelium. Endocrinology 1999;140(3):1499–1504.
33 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
32. Grimaldi P, Capolunghi F, Geremia R, Rossi P. Cyclic adenosine monophosphate (cAMP)
stimulation of the kit ligand promoter in sertoli cells requires an Sp1-binding region, a canonical
TATA box, and a cAMP-induced factor binding to an immediately downstream GC-rich
element. Biol. Reprod. 2003;69(6):1979–1988.
33. Walczak EM et al. Wnt signaling inhibits adrenal steroidogenesis by cell-autonomous and
non-cell-autonomous mechanisms. Mol. Endocrinol. 2014;28(9):1471–1486.
34. Mizusaki H et al. Dax-1 (Dosage-Sensitive Sex Reversal-Adrenal Hypoplasia Congenita
Critical Region on the X Chromosome, Gene 1) Gene Transcription Is Regulated by Wnt4 in
the Female Developing Gonad. Mol Endocrinol 2003;17(4):507–519.
35. Gallegos TF et al. A protein kinase A and Wnt-dependent network regulating an
intermediate stage in epithelial tubulogenesis during kidney development. Dev. Biol.
2012;364(1):11–21.
36. Yu H-F et al. Bmp2 regulates Serpinb6b expression via cAMP/PKA/Wnt4 pathway during
uterine decidualization. J. Cell. Mol. Med. 2020;24(12):7023–7033.
37. Clevers H, Loh KM, Nusse R. Stem cell signaling. An integral program for tissue renewal
and regeneration: Wnt signaling and stem cell control. Science 2014;346(6205):1248012.
38. Vainio S, Heikkilä M, Kispert A, Chin N, McMahon AP. Female development in mammals
is regulated by Wnt-4 signalling. Nature 1999;397(6718):405–409.
39. Liu C-F, Bingham N, Parker K, Yao HH-C. Sex-specific roles of beta-catenin in mouse
gonadal development. Hum. Mol. Genet. 2009;18(3):405–417.
40. Boyer A et al. CTNNB1 Signaling in Sertoli Cells Downregulates Spermatogonial Stem
Cell Activity via WNT4. PLOS ONE 2012;7(1):e29764.
41. Kimura T et al. The stabilization of beta-catenin leads to impaired primordial germ cell
development via aberrant cell cycle progression. Dev. Biol. 2006;300(2):545–553.
34 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
42. Chassot A-A et al. Constitutive WNT/CTNNB1 activation triggers spermatogonial stem
cell proliferation and germ cell depletion. Dev. Biol. 2017;426(1):17–27.
43. Corda G, Sala A. Non-canonical WNT/PCP signalling in cancer: Fzd6 takes centre stage.
Oncogenesis 2017;6(7):e364.
44. Pitetti J-L et al. An essential role for insulin and IGF1 receptors in regulating sertoli cell
proliferation, testis size, and FSH action in mice. Mol. Endocrinol. 2013;27(5):814–827.
45. Khan SA, Ndjountche L, Pratchard L, Spicer LJ, Davis JS. Follicle-stimulating hormone
amplifies insulin-like growth factor I-mediated activation of AKT/protein kinase B signaling in
immature rat Sertoli cells. Endocrinology 2002;143(6):2259–2267.
46. Wandzioch E, Edling CE, Palmer RH, Carlsson L, Hallberg B. Activation of the MAP
kinase pathway by c-Kit is PI-3 kinase dependent in hematopoietic progenitor/stem cell lines.
Blood 2004;104(1):51–57.
47. Cannarella R, Condorelli RA, La Vignera S, Calogero AE. Effects of the insulin-like growth
factor system on testicular differentiation and function: a review of the literature. Andrology
2018;6(1):3–9.
48. Boyer A et al. mTOR Regulates Gap Junction Alpha-1 Protein Trafficking in Sertoli Cells
and Is Required for the Maintenance of Spermatogenesis in Mice. Biol. Reprod. 2016;95(1):13.
49. Mok KW, Mruk DD, Cheng CY. Regulation of blood-testis barrier (BTB) dynamics during
spermatogenesis via the “Yin” and “Yang” effects of mammalian target of rapamycin complex
1 (mTORC1) and mTORC2. Int Rev Cell Mol Biol 2013;301:291–358.
50. Tanwar PS, Kaneko-Tarui T, Zhang L, Teixeira JM. Altered
LKB1/AMPK/TSC1/TSC2/mTOR signaling causes disruption of Sertoli cell polarity and
spermatogenesis. Hum. Mol. Genet. 2012;21(20):4394–4405.
51. Washecka R, Dresner MI, Honda SAA. Testicular tumors in Carney’s complex. J. Urol.
2002;167(3):1299–1302.
35 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
52. Griffin KJ et al. Down-regulation of regulatory subunit type 1A of protein kinase A leads
to endocrine and other tumors. Cancer Res. 2004;64(24):8811–8815.
53. Burton KA et al. Haploinsufficiency at the protein kinase A RI alpha gene locus leads to
fertility defects in male mice and men. Mol. Endocrinol. 2006;20(10):2504–2513.
54. Wieacker P et al. Male infertility as a component of Carney complex. Andrologia
2007;39(5):196–197.
55. Kumar TR et al. Transgenic models to study gonadotropin function: the role of follicle-
stimulating hormone in gonadal growth and tumorigenesis. Mol. Endocrinol. 1999;13(6):851–
865.
56. Haywood M et al. An activated human follicle-stimulating hormone (FSH) receptor
stimulates FSH-like activity in gonadotropin-deficient transgenic mice. Mol. Endocrinol.
2002;16(11):2582–2591.
57. Huhtaniemi IT, Aittomäki K. Mutations of follicle-stimulating hormone and its receptor:
effects on gonadal function. Eur. J. Endocrinol. 1998;138(5):473–481.
58. Siegel ET, Kim H-G, Nishimoto HK, Layman LC. The molecular basis of impaired follicle-
stimulating hormone action: evidence from human mutations and mouse models. Reprod Sci
2013;20(3):211–233.
59. Mullaney BP, Skinner MK. Basic fibroblast growth factor (bFGF) gene expression and
protein production during pubertal development of the seminiferous tubule: follicle-stimulating
hormone-induced Sertoli cell bFGF expression. Endocrinology 1992;131(6):2928–2934.
60. Rossi P et al. Follicle-stimulating hormone induction of steel factor (SLF) mRNA in mouse
Sertoli cells and stimulation of DNA synthesis in spermatogonia by soluble SLF. Dev. Biol.
1993;155(1):68–74.
36 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
61. Tadokoro Y, Yomogida K, Ohta H, Tohda A, Nishimune Y. Homeostatic regulation of
germinal stem cell proliferation by the GDNF/FSH pathway. Mechanisms of Development
2002;113(1):29–39.
62. Plotton I, Sanchez P, Durand P, Lejeune H. Decrease of both stem cell factor and clusterin
mRNA levels in testicular biopsies of azoospermic patients with constitutive or idiopathic but
not acquired spermatogenic failure. Hum. Reprod. 2006;21(9):2340–2345.
63. Bhattacharya I et al. A switch in Sertoli cell responsiveness to FSH may be responsible for
robust onset of germ cell differentiation during prepubartal testicular maturation in rats. Am. J.
Physiol. Endocrinol. Metab. 2012;303(7):E886-898.
64. Li Y, Zheng M, Lau Y-FC. The Sex-Determining Factors SRY and SOX9 Regulate Similar
Target Genes and Promote Testis Cord Formation during Testicular Differentiation. Cell
Reports 2014;8(3):723–733.
65. Barrionuevo F et al. Homozygous Inactivation of Sox9 Causes Complete XY Sex Reversal
in Mice. Biol Reprod 2006;74(1):195–201.
66. Moniot B et al. The PGD2 pathway, independently of FGF9, amplifies SOX9 activity in
Sertoli cells during male sexual differentiation. Development 2009;136(11):1813–1821.
67. Gonen N et al. Sex reversal following deletion of a single distal enhancer of Sox9. Science
2018;360(6396):1469–1473.
68. Willems A et al. Selective ablation of the androgen receptor in mouse sertoli cells affects
sertoli cell maturation, barrier formation and cytoskeletal development. PLoS ONE
2010;5(11):e14168.
69. Tanwar PS et al. Constitutive WNT/Beta-Catenin Signaling in Murine Sertoli Cells Disrupts
Their Differentiation and Ability to Support Spermatogenesis. Biol Reprod 2010;82(2):422–
432.
37 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
70. Cai K et al. Action mechanism of inhibin α-subunit on the development of Sertoli cells and
first wave of spermatogenesis in mice. PLoS ONE 2011;6(10):e25585.
71. Namwanje M, Brown CW. Activins and Inhibins: Roles in Development, Physiology, and
Disease. Cold Spring Harb Perspect Biol 2016;8(7). doi:10.1101/cshperspect.a021881
72. Vija L et al. Ligand-dependent stabilization of androgen receptor in a novel mouse ST38c
Sertoli cell line. Mol. Cell. Endocrinol. 2014;384(1–2):32–42.
73. Edelsztein NY, Rey RA. Importance of the Androgen Receptor Signaling in Gene
Transactivation and Transrepression for Pubertal Maturation of the Testis. Cells 2019;8(8).
doi:10.3390/cells8080861
74. Meroni SB et al. Molecular Mechanisms and Signaling Pathways Involved in Sertoli Cell
Proliferation [Internet]. Front. Endocrinol. 2019;10. doi:10.3389/fendo.2019.00224
75. Hernandez A, Martinez ME. Thyroid hormone action in the developing testis:
intergenerational epigenetics. J. Endocrinol. 2020;244(3):R33–R46.
76. Parakh TN et al. Follicle-stimulating hormone/cAMP regulation of aromatase gene
expression requires beta-catenin. Proc. Natl. Acad. Sci. U.S.A. 2006;103(33):12435–12440.
77. Roy L et al. Convergence of 3’,5’-cyclic adenosine 5’-monophosphate/protein kinase A and
glycogen synthase kinase-3beta/beta-catenin signaling in corpus luteum progesterone synthesis.
Endocrinology 2009;150(11):5036–5045.
78. Boyer A et al. WNT4 is required for normal ovarian follicle development and female
fertility. FASEB J. 2010;24(8):3010–3025.
79. Hino S, Tanji C, Nakayama KI, Kikuchi A. Phosphorylation of beta-catenin by cyclic AMP-
dependent protein kinase stabilizes beta-catenin through inhibition of its ubiquitination. Mol.
Cell. Biol. 2005;25(20):9063–9072.
80. Chang H, Guillou F, Taketo MM, Behringer RR. Overactive Beta-Catenin Signaling Causes
Testicular Sertoli Cell Tumor Development in the Mouse. Biol Reprod 2009;81(5):842–849.
38 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
81. Perrone F et al. Frequent mutation and nuclear localization of β-catenin in sertoli cell tumors
of the testis. Am. J. Surg. Pathol. 2014;38(1):66–71.
82. McMellen A, Woodruff ER, Corr BR, Bitler BG, Moroney MR. Wnt Signaling in
Gynecologic Malignancies. Int J Mol Sci 2020;21(12). doi:10.3390/ijms21124272
83. Liu H et al. Basic fibroblast growth factor promotes stem Leydig cell development and
inhibits LH-stimulated androgen production by regulating microRNA expression. J. Steroid
Biochem. Mol. Biol. 2014;144 Pt B:483–491.
84. Cotton LM, O’Bryan MK, Hinton BT. Cellular signaling by fibroblast growth factors
(FGFs) and their receptors (FGFRs) in male reproduction. Endocr. Rev. 2008;29(2):193–216.
85. Aigner A et al. Marked increase of the growth factors pleiotrophin and fibroblast growth
factor-2 in serum of testicular cancer patients. Ann. Oncol. 2003;14(10):1525–1529.
86. DiRenzo DM et al. A crosstalk between TGF-β/Smad3 and Wnt/β-catenin pathways
promotes vascular smooth muscle cell proliferation. Cell. Signal. 2016;28(5):498–505.
87. Akhmetshina A et al. Activation of canonical Wnt signalling is required for TGF-β-
mediated fibrosis. Nat Commun 2012;3:735.
88. Witsch E, Sela M, Yarden Y. Roles for growth factors in cancer progression. Physiology
(Bethesda) 2010;25(2):85–101.
89. Woodcock HV et al. The mTORC1/4E-BP1 axis represents a critical signaling node during
fibrogenesis. Nat Commun 2019;10(1):6.
90. Dey N et al. microRNA-21 governs TORC1 activation in renal cancer cell proliferation and
invasion. PLoS ONE 2012;7(6):e37366.
91. Sahut-Barnola I et al. Cushing’s Syndrome and Fetal Features Resurgence in Adrenal
Cortex–Specific Prkar1a Knockout Mice. PLoS Genetics 2010;6(6):e1000980.
39 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
92. de Joussineau C et al. mTOR pathway is activated by PKA in adrenocortical cells and
participates in vivo to apoptosis resistance in primary pigmented nodular adrenocortical disease
(PPNAD). Human Molecular Genetics 2014;23(20):5418–5428.
93. Drelon C et al. PKA inhibits WNT signalling in adrenal cortex zonation and prevents
malignant tumour development. Nature Communications 2016;7(1):1–14.
94. Shan J, Jokela T, Peltoketo H, Vainio S. Generation of an allele to inactivate Wnt4 gene
function conditionally in the mouse. Genesis 2009;47(11):782–788.
95. Skålhegg BS et al. Mutation of the Calpha subunit of PKA leads to growth retardation and
sperm dysfunction. Mol. Endocrinol. 2002;16(3):630–639.
40 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
SUPPLEMENTARY METHODS
Histology
Images were minimally processed for global levels with ZEN. Images settings and processing
were identical across genotypes. Tumor scoring was performed on H&E stained sections. Testis
was noted (1) either normal if any modification of stromal cell number has been observed (2)
either hyperplastic if cell number is increased and (3) either tumoral if testis developed stromal
nodules representing at least 20% of total section area. 25 random ST were counted to assess
the percentage of ST with spermatozoa, with vacuoles, with biotin or filled of germ cells in
mice; or the number of G9A+, SYCP3+, ZBTB16+ or TUNEL+ per ST in mice. Epithelium
thickening and CLDN11 expression domain were measured in 25 ST per mouse. 500 stromal
cells were counted to assess the PCNA proliferation index. Mast cells were detected following
toluidine blue staining and were counted in a whole testis section. In human samples, the
number of germ cell per tubule and the CLDN11 expression domain were quantified in 50 ST
whereas 200 ST were counted to assess the percentage of ST with spermatozoa or with
vacuoles.
41
Bars representthemeanpergroup±SD.Scalebars, 100µm. ns,notsignificant, (n=4). FC, fold change. (H), Top 10 enriched GO and KEGG terms using 2-mo-old prKO significant deregulated genes. gulated genes (abs(log2FC>1)&adj.p-val<0.05) in 2-wk(F)and2-mo-old(G)prKOtestes(n=3-4)compared with WT performed using Welch’s t-test. (F quantification represented as apercentage of cells in 2-wkand4-mo-old WT andprKO testes.Statistical analysis was test (hyperplasia/tumor proportions between 2-mo and 4-mo-old prKO testes). Number ofeachhistological defect isindicated in bars. Statistical analysis wasperformedusingtwoproportion Fisher’s Relative proportionofhyperplasiaandtumorfrom2-wk-oldto4-mo-old S100a1) in4-mo-old WT andprKOtestes.Statistical analysis wasperformed using Student’s t-test or Welch’s t-test. (D), areas bothinST andstroma(inset).(C),RTqPCR analysisforLCCSCT markerstranscripts(Calb2, spermatozoa. (B), testis. Dashedlinesdelineate staining in2-mo-oldprKOthecalcium accumulation Alizarine RedS Sf1:Cre,Prkar1a b), 2-mo(c,d)and4-mo-old (e, f) WT andPrkar1a Figure 1.Prkar1alossinmousetesticular somaticcellsinducesLCCSCT-like lesions.(A),HEstainingof2-wk(a,
+4.6 G A HE 4 months 2 months 2 weeks e c a bioRxiv preprint upregulated genes(676) preprint (whichwasnotcertifiedbypeerreview)istheauthor/funder.Allrightsreserved.Noreuseallowedwithoutpermission. WT adj. p-val.<0.05,abs(Log2FC)>1.0 fl/fl ). Red arrowheads indicate prKO hyper-vascularization. Hy., hyperplasia; Tu., tumor; Ø, absence of doi: d b f https://doi.org/10.1101/2020.12.21.423735 2 months Hy. downregulated genes(652) Sf1:Cre,Prkar1a Hy. Tu. and G), Heatmap representing the median centered expression of significantly dere- fl/fl FIGURES AND FIGURELEGENDS Tu. Hy. Hy. 2−1 −2 -3.3
Ro Prkar1a
w Z−Score Sf1:Cre, log2FC B
D WT 0 Alizarine red S
1 fl/fl 1 00 2 Complement andcoagulationcascades Complement andcoagulationcascades
0 % of hyperplasia/tumor H positive regulationofcellmigration positive regulationofcellmigration 2 wk 1 6 Protein digestionandabsorption Protein digestionandabsorption extracellular matrixorganization extracellular matrixorganization intracellular signaltransduction intracellular signaltransduction ; tumor hyperplasia unaffected WT oxidation-reduction process oxidation-reduction process PI3K-Akt signalingpathway PI3K-Akt signalingpathway this versionpostedDecember22,2020. collagen fibrilorganization collagen fibrilorganization Biosynthesis ofantibiotics Biosynthesis ofantibiotics 17
42 2 mo ECM-receptor interaction ECM-receptor interaction 3 Proteoglycans incancer Proteoglycans incancer regulation ofcellgrowth regulation ofcellgrowth somatic progenitor cell knockout testes (noted as prKO, lipid metabolicprocess lipid metabolicprocess * Metabolic pathways Metabolic pathways Carbon metabolism Carbon metabolism lung development lung development cell differentiation cell differentiation 4 mo spermatogenesis spermatogenesis 6 7 Focal adhesion Focal adhesion sperm motility sperm motility angiogenesis angiogenesis cell adhesion cell adhesion Lysosome Lysosome aging aging E . . 5.0 2.5 0.0 . . 5.0 2.5 0.0
. 5 2.5 0 % stromal PCNA+ cells Sf1:Cre,Prkar1a 1 1 20 25 Top en CALCIFIED AREA ST 0 5 0 5 WT -log n -log -log10(adj.p.val.) -log10(adj.p.val.) prKOtestesevaluatedfollowingHEstaining. 1 2 wk 1 r 0(adj.p-value) i x 2.97 0(adj. p-val.) c *** hed GO te 56 Sf1:Cre,Prkar1a 7.5 4 mo fl/fl x 23.82 7.5 7.5 r ms * *p<0.05, ***p<0.001. 56 ST 10 p=0.0259. (E), Stromal PCNA+ cells 10.0 10.0 Complement andcoagulationcascades C fl/fl
positive regulationofcellmigration Rel. mRNA quant. 1 Protein digestionandabsorption extracellular matrixorganization 20 40 60 80 00 F intracellular signaltransduction 0 n oxidation-reduction process PI3K-Akt signalingpathway collagen fibrilorganization Biosynthesis ofantibiotics ECM-receptor interaction Calb2 Proteoglycans incancer regulation ofcellgrowth 9 8 9 8 9 8 9 8 x 43.25 lipid metabolicprocess +3.9 *** The copyrightholderforthis Metabolic pathways Carbon metabolism lung development cell differentiation spermatogenesis up/downregulated genes(903) Focal adhesion sperm motility angiogenesis cell adhesion 0 1 2 3 4 Lysosome Term enrichedindownregulatedgenelist Term enrichedinupregulatedgenelist abs(Log2FC)>1.0 adj. p-val.<0.05 aging Ctnnb1 WT 2 weeks x 2.12 *** . . 5.0 2.5 0.0 Top en . 5 2.5 0 Sf1:Cre,Prkar1a -log -log10(adj.p.val.) r 0 2 4 6 8 i c 1 hed KEGG te 0(adj. p-val.) Ctnnb1, Inha x 5.33 *** 7.5 -1.7
7.5 Prkar1a fl/fl
2−1 −2 Sf1:Cre, r log2FC ms
Ro WT 10 0 2 4 6 w Z−Score 10.0 Enrichment
S100a1 fl/fl 0 x 3.47 Inha, Fold *** 10.0 1 7.5 5.0 2.5 2 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
A WT Sf1:Cre,Prkar1afl/fl Amh:Cre,Prkar1afl/fl Cyp11a1:Cre,Prkar1afl/fl F deregulated genes 93 2 3 a b c d Sf1:Cre,Prkar1afl/fl upregulated genes 90 2 1 2 wk downregulated genes 3 0 2
Amh:Cre,Prkar1afl/fl 2 wk 91 88 2 3 2 3
HE fl/fl e f g h Cyp11a1:Cre,Prkar1a 3 2 wk adj. p-val.<0.05 abs(Log2FC)>1.0
G Sf1:Cre,Prkar1afl/fl 2 mo 1328 560 22 676 150 17 Amh:Cre,Prkar1afl/fl 652 410 5 2 mo B * C D ns E 200 100 ns 100 100 *** 3 *** **
µm ) 852 473 83 80 80 150 *** 559 114 33 293 359 50 ns 60 60 100 ns 40 40
Testis weight ( mg ) 50 2 / 0 / 1 / 1 20 20 % spz producing tub. % of hyperplasia/tumor
Epithelium thickness ( 17 13 12 17 / 14 / 3 0 0 0 0 1 / 1 2 / 2 FC 1.00 0.490.39 0.79 FC 1.00 0.390.340.89 % 95.3 0.00.094.4 Cyp11a1:Cre,Prkar1afl/fl Sf1:Cre,Prkar1afl/fl n 33 10 12 6 n 6 6 6 5 n 6 6 6 5 no hyperplasia 2 mo hyperplasia Amh:Cre,Prkar1afl/fl adj. p-val.<0.05 abs(Log2FC)>1.0 WT Sf1:Cre,Prkar1afl/fl Amh:Cre,Prkar1afl/fl Cyp11a1:Cre,Prkar1afl/fl tumor Cyp11a1:Cre,Prkar1afl/fl H
WT
Cyp11a1:Cre, Prkar1afl/fl
Amh:Cre, Prkar1afl/fl
Sf1:Cre, Prkar1afl/fl
upregulated genes (559) downregulated genes (293) (114) (359) (33) (50)(14/3)
specific Sf1:Cre,Prkar1aFl/Fl deregulated genes common Sf1:Cre,Prkar1afl/fl and Amh:Cre,Prkar1afl/fl deregulated genes Row Z−Score adj. p-val.<0.05 specific Amh:Cre,Prkar1afl/fl deregulated genes −2 0 2 abs(Log2FC)>1.0 specific Cyp11a1:Cre,Prkar1afl/fl deregulated genes Figure 2. Seminiferous defects are associated with Prkar1a loss in Sertoli cells. (A), HE staining of 2-mo-old WT (a,e), prKO (Sf1:Cre,Prkar1afl/fl; somatic progenitor cell Prkar1a inactivation) ((b,f), srKO (Amh:Cre,Prkar1afl/fl; Sertoli cell Prkar1a inactivation) (c,g), lrKO (Cyp11a1:Cre,Prkar1afl/fl; Leydig cell Prkar1a inactivation) testes (d,h). Dashed black lines delineate the tumor developed in prKO testis, blue arrowheads show spermatozoa and black lines limit semi- niferous epithelium thickness. Ø, absence of spermatozoa. Scale bars, 100µm. (B), Testis weight of 4-mo-old WT, prKO, srKO and lrKO mice. One-way ANOVA was followed by Tukey multiple correction test. (C), Epithelium thickness quantified following HE staining in 2-mo-old WT, prKO, srKO and lrKO testes. Kruskal-Wallis’ test was followed by Dunn’s multiple correction test. (D), Quantification of ST with elongated spermatids represented as a percentage of positive tubules quantified following HE staining in 2-mo-old WT, prKO, srKO and lrKO testes. Statistical analysis was performed using Student’s t-test. (E), Relative proportion of hyperplasia and tumor in 2-mo-old prKO, srKO and lrKO testes. Numbers for each histological defect and genotype are indicated in bars. (F and G), Venn diagram of the signifi- cantly deregulated genes (abs(log2FC>1) & adj.p-val<0.05) in 2-wk-old (F) and 2-mo-old (G) prKO, srKO and lrKO testes compared with WT (n=3-4 mice per group). (H), Heatmap representing the median centered expression of signifi- cantly deregulated genes in 2-mo-old prKO, srKO and lrKO testes compared with WT. Bars represent the mean per group ± SD. *p<0.05, **p<0.01, ***p<0.001.
43 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
A B HALLMARK_SPERMATOGENESIS HALLMARK_SPERMATOGENESIS HALLMARK_APOPTOSIS HALLMARK_APOPTOSIS 0.7 0 0.6 NES: 2.64 NES: 2.67 -0.1 0.5 FDR: 0 FDR: 0 -0.2 0.4 -0.3 0.3 -0.4 0.2 Enrichment score Enrichment score NES: -1.90 NES: -2.00 0.1 -0.5 FDR: 0.001 FDR: 0 0
UP Sf1:Cre,Prkar1afl/fl vs WT DOWN UP Amh:Cre,Prkar1afl/fl vs WT DOWN UP Sf1:Cre,Prkar1afl/fl vs WT DOWN UP Amh:Cre,Prkar1afl/fl vs WT DOWN
C 5 weeks D E 7 weeks F G fl/fl fl/fl WT Amh:Cre,Prkar1a 20 WT Amh:Cre,Prkar1a 80 100 ** *** x 8.74 µm ) x 0.50 15 * 60 x 9.32
10 40 50 Hoechst
HE 5 20 TUNEL+ cells / tub. % spz producing tub. TUNEL 0 Epithelium thickeness ( 0 0 n 6 6 6 6 n 6 6 6 6 5 wk 7 wk 7 wk 7 wk H 7 weeks I J 7 weeks K WT Amh:Cre,Prkar1afl/fl WT Amh:Cre,Prkar1afl/fl 50 6 ** *** x 0.50 x 0.61 40
4 30 WT Amh:Cre,Prkar1afl/fl
Hoechst 20
Hoechst
2 G9A+ cells / tub. 10 ZBTB16+ cells / tub. G9A
ZBTB16 0 0 n 6 5 n 5 6 7 wk 7 wk L 7 weeks M N Normal adult human testis CNC-LCCSCT 2 O 500 P 100 WT Amh:Cre,Prkar1afl/fl 120 ns 400 80 x 0.96 300 60 80 Pt-1 200 40
Hoechst Pt-2
Germ cells / tub. Hoechst 40 100 20 Pt-1 Pt-2 % spz producing tub. SYCP3+ cells / tub. DDX4 0 0 FC 1.00 0.200.49 % 88.5 0.03.0 SYCP3 0 n 6 6 Normal human testis CNC-LCCSCT 7 wk Figure 3. PKA overactivation in Sertoli cells triggers increased germ cell apoptosis from prepubertal age. (A and B), GSEA of microarray gene expression data showing a negative enrichment of hallmark-spermatogenesis gene list (A) and a positive enrichment of hallmark-apoptosis gene list (B) both in 2-mo-old prKO and srKO testes compared with WT. (C), TUNEL staining highlighting apoptotic cells in 5-wk-old WT and srKO testes. White arrowheads indicate TUNEL+ cells. (D), Quantification of TUNEL+ cells in 5-wk and 7-wk-old srKO testes compared with WT. Statistical analysis was performed using Welch’s t-test or Mann-Whitney’s test. (E), HE staining of 7-wk-old WT and srKO testes. Blue arrowheads, spermatozoa; Ø, absence of spermatozoa. (F and G), Epithelium thickness quantification (F) and percentage of ST with elongated spermatids (G) in 7-wk-old WT and srKO testes. Statistical analysis was performed using Student’s test. (H-M), Immunohistochemical detection and quantification of ZBTB16 (spermotogonia-A) (H and I), G9A (spermotogonia-B) (J and K) and SYCP3 (spermotocytes) (L and M) in 7-wk-old WT and srKO testes. White arrowheads indicate ZBTB16+ cells. Quantification is based on the number of positive cells per tube. Statistical analysis was performed using Student’s test. (N and O), DDX4 immunohistochemical detection (N) and germ cell loss quantifi- cation in CNC-LCCSCT compared with normal adult human testis (O). (P), Percentage of ST with elongated spermatids quantified following HE staining dropped in CNC-LCCSCT compared with normal adult human testis. Bars represent the mean per group ± SD. Scale bars, 100µm. *p<0.05, **p<0.01, ***p<0.001.
44 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this A WT Sf1:Cre,Prkar1afl/fl Amh:Cre,Prkar1afl/fl 100 preprint (which was not certified by peer review) is the author/funder.C All rights reserved.Normal humanNo reuse testis allowed without Cellpermission. junctions a b c Pt-1 F 80 Pt-2 CNC-LCCSCT Log2FC Log2FC 60 Itgav 1.01 1.66 Itga5 0.69 1.31 40 Itgb1 0.69 1.20 Cdh5 0.64 1.19 Ctnna1 0.79 1.02 6 weeks % vacuolized tub. 20 Itgam 0.55 0.97 Cldn11 0.78 0.92 0 F11r 0.27 0.91 % 3.5 72.581.5 Cldn26 0.80 0.90 * Itgbl1 0.32 0.85 D 100 ns Itga6 0.35 0.85 HE d e f Itgb2 0.49 0.84 80 Itgb8 0.69 0.80 Jam2 0.76 0.80 Itgb5 0.55 0.75 60 Itga8 -0.02 0.74 Ocln 0.10 0.74 40 Itga4 0.60 0.72 Gja1 -0.01 0.71 2 months Pvrl2 0.43 0.68 % vacuolized tub. 20 Ctnnb1 0.46 0.61 Jam3 0.45 0.52 0 Itga9 0.62 0.48 % 0.0 0.063.4 0.0 25.048.8 0.0 96.0 77.3 n 13 7 6 12 5 6 9 6 6 Itgb3 0.19 0.44 Pvrl1 0.17 0.41 2 weeks 5 weeks 2 months Itfg3 0.40 0.36 WT Sf1:Cre,Prkar1afl/fl Amh:Cre,Prkar1afl/fl Itga3 0.39 0.35 Normal adult human testis CNC-LCCSCT 1 CNC-LCCSCT 2 Cldn3 -0.55 0.34 B Itga2 -0.23 0.24 a b c E KEGG_FOCAL_ADHESION Pkp4 0.37 0.19 Itfg1 0.23 0.15 Cldn12 0.35 0.14 KEGG_CELL_ADHESION_MOLECULES_CAMS Cldn5 0.47 0.11 Dsg1b -0.59 -0.05 KEGG_REGULATION_OF_ACTIN_CYTOSKELETON Cdh18 0.28 -0.21 Pvrl3 -0.08 -0.34 HE 1 Ctnna2 -0.82 -0.43 KEGG_ADHERENS_JUNCTION 2 Jup -0.70 -0.59 3 Ctnnd2 -0.48 -0.67 4 KEGG_GAP_JUNCTION Ctnna3 -0.74 -0.79 >5 Cldnd2 -0.45 -1.05 -log10(FDR) KEGG_TIGHT_JUNCTION Row Z−Score 0 1 2 3 adj. p-val.<0.05 Sf1:Cre,Prkar1afl/fl Amh:Cre,Prkar1afl/fl NES −3 −2 −1 0 1 2 3
G WT Sf1:Cre,Prkar1afl/fl Amh:Cre,Prkar1afl/fl H WT Sf1:Cre,Prkar1afl/fl Amh:Cre,Prkar1afl/fl I 80 *** a b c a b c * µm ) *** 60
Hoechst 40 Hoechst
20 CLDN11 localization ( CLDN11 CLDN11 β-catenin 0 FC 1.00 2.723.70 n 6 5 6
J Normal adult human testis CNC-LCCSCT 1 LCNC-CCSCT 2 K Normal adult human testis CNC-LCCSCT 1 CNC-LCCSCT 2 L a b c a b c 80 Pt-2 Pt-1 µm ) 60 Hoechst Hoechst
40
20 CLDN11 β-catenin CLDN11 localization ( CLDN11 0 FC 1.00 2.542.04 Normal human testis CNC-LCCSCT M WT Sf1:Cre,Prkar1afl/fl Amh:Cre,Prkar1afl/fl N O Dpt a b c 100 10 ns 50 ** *** 80 8 *** 40 *** *** 60 6 30 Hoechst
40 4 20 % BIOTIN+ tub.
20 Rel. mRNA quant. 2 10 BIOTIN
0 0 0 % 0.0 58.080.0 FC 1.005.30 1.19 FC 1.0026.63 3.37 n 7 2 4 n 12 6 8 n 9 7 8 2 weeks 2 months Figure 4. PKA overactivation alters Sertoli cell polarity. (A), HE staining of 6-wk (a-c) and 2-mo-old (d-f) WT, prKO and srKO testes. Black dashed lines delineate multinucleated giant cells at 6-wk resulting in vacuole formation (black arrowhead) at 2-mo. (B), Normal adult human testis (a) and CNC-LCCSCT (b,c) HE staining. (C and D), Quantification of vacuolized tubules represented as a percentage of positive tubules quantified following HE staining of normal adult human testis, LCCSCT CNC (C), 2-wk-old, 5-wk-old and 2-mo-old WT, prKO and srKO testes (D). Statistical analysis was performed using Welch’s t-test. (E), GSEA enrichment scores of microarray gene expression data using KEGG gene lists associated with junction/cytoskeleton in 2-mo-old prKO or srKO testes compared with WT. (F), Heatmap represen- ting the median centered expression of significantly deregulated regulators of cell junctions (adj.p-val.<0.05) in 2-mo-old prKO and srKO testes (n=3-4) compared with WT (n=4). (G-L), Immunohistochemical detection of β-catenin (G and J), CLDN11 (H and K) and quantification of CLDN11 expression domain (I and L) based on the distance between basal lamina and apical CLDN11 accumulation in 5-wk-old WT, prKO, srKO testes (G-I) and in normal adult human testis and CNC-LCCSCT (J-L). White line delineates β-catenin or CLDN11 expression domain. One-way ANOVA was followed by Tukey multiple correction test. (M), Biotin tracer detection after injection underneath the testis capsule in 6-wk-old WT, prKO and srKO testes. White dashed line marks intra-seminiferous biotin diffusion in prKO and srKO testes. (N), Blood-testis barrier integrity loss evaluation based on the percentage of tube with intra-seminiferous biotin accumulation. (O), RTqPCR analysis of Dpt transcripts in 2-wk and 2-mo-old WT, srKO and prKO testes. Welch’s one-way ANOVA was followed by Games-Howell multiple correction test. Bars represent the mean per group ± SD. Scale bars, 100µm. *p<0.05, ***p<0.001.
45 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
Kitl A B REACTOME_SIGNALING_BY_SCF_KIT REACTOME_SIGNALING_BY_SCF_KIT *** 6 ** *** 0.6 NES: 1.98 NES: 2.04 *** ns -4 -4 0.5 FDR: 2.87 x 10 FDR: 3.87 x 10 *** 0.4 4 0.3 ** ns 0.2 * Enrichment score 0.1 2 0.0 Rel. mRNA quant.
0 FC 1.00 1.301.22 1.003.60 2.74 1.00 3.213.37 fl/fl fl/fl n 12 6 8 9 7 8 10 9 6 UP Sf1:Cre,Prkar1a vs WT DOWN UP Amh:Cre,Prkar1a vs WT DOWN 2 weeks 2 months 4 months
4 months 6 months C D P=0.11 fl/fl fl/fl WT Sf1:Cre,Prkar1a WT Amh:Cre,Prkar1a 15 x 12.30 a b c d ** x 15.81 mm² 10
5 toluidine+ cells / Toluidine blue Toluidine 0 n 6 12 6 7 4 months 6 months E F WNT signaling G Wnt4 Ccdc80 Myc a Sf1:Cre,Prkar1afl/fl vs WT 300 15 4 Log2FC * * ns Sfrp1 0.45 2.23 ns ** Wnt4 250 ns *** Wls 0.99 2.21 *** Frzb 1.24 1.96 3 200 10 Sfrp4 0.65 1.49 ** Wnt4 1.03 1.41 150 2 Lgr4 0.75 1.16 Dkk3 0.55 1.03 100 5 Lrp6 0.23 0.87 Rel. mRNA quant. Nr0b1 0.51 0.76
-log10(adj. p-val.) 1 50 Ccdc80 0.35 0.66 Fzd6 0.50 0.66 0 0 Fzd1 0.10 0.62 FC 1.0 116.2 80.6 FC 1.00 2.855.24 1.00 3.646.00 0 Ctnnb1 0.47 0.62 n 9 7 8 n 9 7 8 9 7 8 Dact1 0.44 0.57 -4 -2 0 2 4 Grb10 0.08 0.55 logFC Wnt5a 0.09 0.55 Axin2 Ctnnb1 Nr0b1 Myc 0.43 0.54 4 ** 3 Amh:Cre,Prkar1afl/fl vs WT Amer1 0.10 0.54 ns * b *** ns Dvl3 0.26 0.50 P=0.06 ns 4 Rspo1 0.02 0.47 ns Wnt4 3 Porcn -0.69 0.44 2 *** Fzd5 0.40 0.42 3 Wisp2 0.39 0.36 2 Chd8 0.25 0.28 Wif1 0.22 0.18 1 2 Apcdd1 -0.68 -0.08 1 Wnt3 -0.63 -0.56 Rel. mRNA quant. Amer2 -0.35 -0.67
-log10(adj. p-val.) 1 Frat1 -0.25 -0.80 0 0 Dixdc1 -0.33 -0.85 FC 1.00 1.351.50 FC 1.00 1.531.48 1.00 1.531.43 n 9 7 8 n 9 7 8 9 7 8 Row Z−Score 0 adj. p-val.<0.05 −3 −2 −1 0 1 2 3 WT Sf1:Cre,Prkar1afl/fl Amh:Cre,Prkar1afl/fl -4 -2 0 2 4 logFC Figure 5. PKA overactivation modifies Sertoli signals involved in control of spermatogenesis. (A), Kitl transcripts RTqPCR analysis in 2-wk, 2-mo and 4-mo-old WT, prKO and srKO testes. One-way ANOVA was followed by Tukey multiple correction test and Welch’s one-way ANOVA was followed by Games-Howell multiple correction test. (B), GSEA of microarray gene expression data using REACTOME-signaling by SCF KIT gene list in 2-mo-old prKO and srKO testes compared with WT. (C), Toluidine blue staining showing mast cell recruitment in 4-mo-old prKO (a,b) and 6-mo-old srKO (c,d) testes. Scale bars, 100µm. (D), Mast cells quantification based on the toluidine+ cell number per histological section. Statistical analysis was performed using Welch’s t-test. (E), Volcano plot showing differential gene expression in 2-mo-old prKO (a) and srKO (b) testes compared with WT. Significantly deregulated genes (abs(log2F- C>1) & adj.p-val<0.05) are highlighted in blue (down) or in red (up). Wnt4 (yellow point) up-regulated gene. (F), Heat- map representing the median centered expression of significantly deregulated WNT pathway regulators and target genes (adj.p-val.<0.05) in 2-mo-old prKO and srKO testes (n=3-4) compared with WT (n=4). (G), RTqPCR analysis of WNT pathway regulators (Wnt4, Ctnnb1) and target genes (Axin2, Ccdc80, Myc, Nr0b1) expression in 2-mo-old WT, prKO and srKO testes. One-way ANOVA was followed by Tukey multiple correction test, Welch’s one-way ANOVA was followed by Games-Howell multiple correction test and Kruskal-Wallis’ test was followed by Dunn’s multiple correc- tion test. Bars represent the mean per group ± SD. *p<0.05, **p<0.01, ***p<0.001.
46 WTtestes (Sf1:Cre,Prkar1a(b,g), doublemutantprwKO (a,f),prKO Figure 6.Wnt4inactivation decreases germ cell apoptosis inducedbyPrkar1aloss.(A),HEstaining of 2-mo-old **p<0.01, ***p<0.001. followed by Tukey multiple correction test. Bars represent the mean per group±SD.Scale bars, 100µm.*p<0.05, testis compared with WT and srKO. Statistical analysis was performed using Student’s t-test or one-way ANOVA M), Quantification of CLDN11 expression domain (L) andpercentage of vacuolized tubules (M)in2-mo-old srwKO med Welch’s t-test. (K), Immunohistochemical detection of CLDN11 in2-mo-old WT,testes. (Land srKOandsrwKO spermatids quantifiedfollowing HEstainingin2-mo-old WT,testes. Statistical perfor- analysis was and srwKO srKO one-way ANOVA was followed by Games-Howell multiple correction test. (J), Percentage of ST with elongated and SYCP3(I)basedonthe number of positive cells per tube. White arrowheads indicate ZBTB16+ cells. Welch’s detection of ZBTB16 (F) andSYCP3(H)in2-mo-old WT,testes andquantification srKOandsrwKO of ZBTB16(G) indicate TUNEL+ cells. One-way ANOVA was followed by Tukey multiple correction test. ( F-I), Immunohistochemical TUNEL+ cells quantification (E) in 2-mo-old srwKO testis compared with WT andsrKOtestes. Yellow arrowheads by Games-Howell multiple correction test. (D-E), TUNEL staining in 2-mo-old WT, srKOand srwKO testes (D) and following HEstainingin2-mo-old WT,testes. and srwKO srKO prwKO, prKO, Welch’s one-way ANOVA wasfollowed one-way ANOVA wasfollowed by Games-Howell multiple correction test. (C), Epithelium thickness quantified features. (B), RTqPCR analysis of Wnt4 (Amh:Cre,Prkar1a bioRxiv preprint preprint (whichwasnotcertifiedbypeerreview)istheauthor/funder.Allrightsreserved.Noreuseallowedwithoutpermission. K D B A H F
Hoechst Hoechst Hoechst Hoechst doi: fl/fl CLDN11 SYCP3 ZBTB16 TUNEL HE a a a a a f
,Wnt4 Rel. mRNA quant. https://doi.org/10.1101/2020.12.21.423735 1 200 300 400 00 0 FC n .01.131571.00 07777 7 7 7 10 WT WT WT WT WT *** fl/fl ns ) *** *** Wnt4
ns (e,j). Arrowheads, spermatozoa; Ø, absenceofspermatozoa; insets, abnormal mitotic *** *** 1.34108 b b b b b g C Amh:Cre,Prkar1a Amh:Cre,Prkar1a Amh:Cre,Prkar1a Amh:Cre,Prkar1a Amh:Cre,Prkar1a transcripts in 2-mo-old WT, prKO, prwKO, srKOandsrwKOtestes. Welch’s Epithelium thickness (µm) 1 1 50 00 50 0 FC n 1.00 6 6 fl/fl fl/fl fl/fl fl/fl fl/fl *** ns *** *** 0.880.32 ns 7 c c c c h c Amh:Cre,Prkar1a Amh:Cre,Prkar1a Amh:Cre,Prkar1a Amh:Cre,Prkar1a Amh:Cre,Prkar1a 6 * ; 1.030.37 this versionpostedDecember22,2020. 7 47 fl/fl fl/fl fl/fl fl/fl fl/fl ,Wnt4 ,Wnt4 ,Wnt4 ,Wnt4 ,Wnt4 fl/fl fl/fl fl/fl fl/fl fl/fl WT Sf1:Cre,Prkar1a Sf1:Cre,Prkar1a Amh:Cre,Prkar1a Amh:Cre,Prkar1a d i G E L I
fl/fl SYCP3+ cells / tub.
CLDN11 localization (µm) 1 1 200
ZBTB16+ cells / tub. Sf1:Cre,Prkar1a 1 1 50 1 20 30 40 00 50
FC TUNEL+ cells / tub. FC 0 2 4 6 8 0 2 FC 0 0 0 1 2 3 4 0 n FC n n n ,Wnt4 fl/fl, fl/fl .01.921.881.00 .01.040.411.00 1.00 .01.11 1.00 fl/fl fl/fl 6 6 6 ,Wnt4 6 6 6 6 6 6 6 6 6 ,Wnt4 *** *** *** *** 13.00 ns ns 0.43 *** ns *** fl/fl ns fl/fl ** * fl/fl 5.65 fl/fl ) (c,h), srKO (d,i) and srwKO testes (d,i) and srwKO ) (c,h),srKO M J e j
1 % spz producing tub. 1
% vacuolized tub. Sf1:Cre,Prkar1a 50 00 20 40 60 80 00 0 0 % % n n The copyrightholderforthis 3344.30.093.3 . 42.0 0.0 6 6 6 6 x 0.47 77.3 ** x 0.54 * fl/fl 7 7 ,Wnt4 fl/fl bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
fl/fl fl/fl fl/fl A B * C Wnt5a D WT Sf1:Cre,Prkar1a Sf1:Cre,Prkar1a ,Wnt4 3 x 1.99 fl/fl 15 a b c Control Sf1:Cre,Prkar1a *** ST x 6.17 total 92 β-catenin Hy. 2 10 ST active 92
β-catenin HE 1 5 Rel. prot. quant. GAPDH 38
Rel. mRNA quant. Tu. active /total β-catenin ST fl/fl WT Sf1:Cre,Prkar1a 0 0 n 4 4 n 10 9
Wnt4 G WT Sf1:Cre,Prkar1afl/fl Sf1:Cre,Prkar1afl/fl,Wnt4fl/fl E 400 F 100 3 a b c * ns unaffected 300 *** 7 hyperplasia tumor 200 7 9 Hoechst
fl/fl 100 Sf1:Cre,Prkar1a ST 6 Sf1:Cre,Prkar1afl/fl,Wnt4fl/fl PCNA % of hyperplasia/tumor 17 Tu. 0 0 Hy. FC 1.00 130 2.52 2 mo 4 mo n 10 9 9 Ki67 Axin2 Ccdc80 J CNC-LCCSCT 1 CNC-LCCSCT 2 H 50 I 2.0 P=0.06 4 25 K x 0.65 *** * ** * * 20 *** 40 * 1.5 3 *** *** 30 15 Hoechst
1.0 2 Hoechst 20 10 0.5 1
10 Rel. mRNA quant. 5 % stromal PCNA+ cells
0 0.0 0 0 β-catenin FC 1.00 5.2930.35 n 9 5 FC 1.00 1.281.93 FC 1.00 10.79 6.55 n 6 6 5 n 10 9 8 n 10 9 9 β-catenin WNT4 WT Sf1:Cre,Prkar1afl/fl Sf1:Cre,Prkar1afl/fl,,Wnt4fl/fl Figure 7. Wnt4 inactivation impairs tumor mass formation induced by Prkar1a loss. (A), Active β-catenin accumu- lation in 4-mo-old WT and prKO testes. (B), Active β-catenin quantification over total β-catenin. Statistical analysis was performed using Student’s t-test. (C), Wnt5a transcripts in 4-mo-old WT and prKO testes. Statistical analysis was perfor- med using Welch’s t-test. (D), HE staining of 4-mo-old WT, prKO and prwKO testes. Dashed lines delineate ST. Tu., tumor; Hy.,hyperplasia. (E), Wnt4 transcripts in 4-mo-old WT, prKO and prwKO testes. One-way ANOVA was followed by Tukey multiple correction test. (F), Relative proportion of testicular hyperplasia and tumor in 2-mo and 4-mo-old prKO and prwKO testes was evaluated following HE staining. Numbers for each histological defect and genotype are indicated in bars. (G), Immunohistochemical analysis of PCNA in 4-mo-old WT, prKO and prwKO testes. (H), Quantifi- cation of stromal PCNA+ cells represented as a percentage of cells in 4-mo-old WT, prKO and prwKO testes. Welch’s one-way ANOVA was followed by Games-Howell multiple correction test. (I), Ki67 transcripts RTqPCR analysis in 4-mo-old prKO and prwKO testes. Statistical analysis was performed using Student’s t-test. (J), Axin2 and Ccdc80 trans- cripts RTqPCR analysis in 4-mo-old WT, prKO and prwKO testes. One-way ANOVA was followed by Tukey multiple correction test and Welch’s one-way ANOVA was followed by Games-Howell multiple correction test. (K), Coimmu- nostaining for β-catenin and WNT4 in CNC-LCCSCT. Bars represent the mean per group ± SD. Scale bars, 100µm. *p<0.05, **p<0.01, ***p<0.001.
48 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
Enriched terms associated with Growth factors A tumor development D E Egf Fgf2 Igf1 Tgfb1 Tgfb2 Tgfb3 Log2FC 5 8 25 6 15 10 *** fl/fl 2.17 * *** Sf1:Cre,Prkar1a vs WT Igf1 *** ns *** ns 2.07 ns ns ns *** Fgfr2 4 20 ns 8 positive regulation of cell migration Figf 1.75 *** *** 6 *** *** *** response to hypoxia Pdgfra 1.61 4 10 *** 1.32 3 15 6 regulation of cell proliferation Egfr Tgfb3 1.27 4 endothelial cell proliferation Tgfbr2 1.21 2 10 4 regulation of cell growth Fgfr1 1.13 2 5 Insr 1.02 2 positive regulation of MAPK cascade Rel. mRNA quant. 1 5 2 Igf1r 1.00 angiogenesis Tgfb2 0.99 blood vessel development Tgfbr3 0.82 0 0 0 0 0 0 FC 1.00 1.881.86 1.00 2.433.33 1.00 9.11 8.66 1.00 3.463.03 1.004.64 5.47 1.00 4.525.04 Pdgfrb 0.63 cellular response to insulin stimulus n 10 9 9 10 9 9 10 9 9 10 9 9 10 9 9 10 9 9 positive regulation of insulin-like growth factor Igf2r 0.56 receptor signaling pathway GO fl/fl fl/fl, fl/fl Proteoglycans in cancer Row Z−Score WT Sf1:Cre,Prkar1a Sf1:Cre,Prkar1a ,Wnt4 adj. p-val.<0.05 PI3K-Akt signaling pathway KEGG −1 0 1 Control Sf1:Cre,Prkar1afl/fl 0 2.5 5 7.5 10 fl/fl H Control Sf1:Cre,Prkar1a p4EBP1 pS6K pERK -log10(adj. p-val.) F G 4 4EBP1 20 * Term enriched in upregulated gene list p4EBP1 20 x 2.90 15 3 ** ** S6K 70 x 1.85 x 1.76 Fold 70 2 Enrichment 5 10 15 pS6K p4EBP1 ERK 42/44 Rel. prot. quant. 1 pERK 42/44
HALLMARK_MTORC1_SIGNALING Actin 0 B 42 n 4 4 4 4 4 4 0.6 NES: 2.34 0.5 FDR: 0 I CNC-LCCSCT 1 CNC-LCCSCT 2 CNC-LCCSCT 3 J CNC-LCCSCT 1 CNC-LCCSCT 3 0.4 0.3 ST ST 0.2 0.1 Enrichment score 0 p4EBP1 pERK Hoechst UP Sf1:Cre,Prkar1afl/fl vs WT DOWN
C KEGG_MAPK_SIGNALING_PATHWAY K HALLMARK_HYPOXIA 0.7 Hif1a Hif1b Hif2a CNC-LCCSCT 1 CNC-LCCSCT 3 0.5 NES: 1.95 NES: 2.59 L M -4 0.6 4 *** 0.4 FDR: 3.78 x 10 FDR: 0 x 2.34 ST 0.5 *** 0.3 0.4 *** x 2.53 3 x 2.08 0.2 0.3 0.2 0.1 0.1 2 Enrichment score Enrichment score Hoechst 0 0 1 Rel. mRNA quant. HIF2A
0 UP Sf1:Cre,Prkar1afl/fl vs WT DOWN UP Sf1:Cre,Prkar1afl/fl vs WT DOWN n 8 9 8 9 8 9 Figure 8. PKA activation induces mTOR, MAPK and hypoxia pathways in tumor of human LCCSCT. (A), Gene ontology enrichment scores of tumor development associated pathways based on gene list specifically deregulated in 2-mo-old prKO testis compared with srKO and lrKO testes. (B and C), GSEA of microarray gene expression data showing positive enrichment of hallmark-MTORC1 signaling gene list (B) and KEGG-MAPK signaling pathway gene list (C) in 2-mo-old prKO testis compared with WT. (D), Heatmap representing the median centered expression of signi- ficantly deregulated growth factors and associated receptors (adj.p.val.<0.05) in 2-mo-old prKO (n=3-4) compared with WT (n=4). (E), RTqPCR analysis of Egf, Fgf2, Igf1, Tgfb1, Tgfb2 and Tgfb3 transcripts in 4-mo-old WT, prKO and prwKO testes. One-way ANOVA was followed by Tukey multiple correction test, Welch’s one-way ANOVA was followed by Games-Howell multiple correction test and Kruskal-Wallis’ test was followed by Dunn’s multiple correc- tion test. (F), Western blot analysis of p4EBP1, pS6K and pERK accumulation in 4-mo-old WT and prKO testes. (G), Phosphorylated protein quantification over total proteins. Statistical analysis was performed using Student’s t-test. (H), Immunohistochemical detection of p4EBP1 in 4-mo-old WT and prKO testes. (I and J), Immunohistochemical detection of p4EBP1 and pERK in CNC-LCCSCT. (K), GSEA of microarray gene expression data showing positive enrichment of hallmark-hypoxia gene list (genes upregulated in response to hypoxia) in 2-mo-old prKO testis compared with WT. (L), Hif1a, Hif1b and Hif2a transcripts analysis in 4-mo-old WT and prKO testes. Statistical analysis was performed using Welch’s or Student’s t-test. (M), Immunohistochemical detection of HIF2A in CNC-LCCSCT. Bars represent the mean per group ± SD. Scale bars, 100µm. *p<0.05, **p<0.01, ***p<0.001.
49 D R26R Figure S1related toFigure 1.(A ***p<0.001. represent the mean per group±SD. sis ofPCNA in2-wkand4-mo-old WTtestes. (L),HEstainingofcentraltestis. Bars and prKOtumorin4-mo-old show peritubular thickening both in 4-mo-old prKO testis and human CNC-LCCSCT. (K),Immunohistochemical - analy performed using Mann-Whitney’s test. (H-J), Immunohistochemical detection of LAMB(H)and TCM staining (I-J) mice compared with and LH concentrations in 3-mo-oldprKO G), PlasmaFSH WT mice.Statistical analysis was t-test or Welch’s t-test.(E),Plasmatestosteroneconcentration mice comparedwith in 3-mo-oldprKO WT mice.(F ding (PMC); redarrowheads,Leydigcells(LC).Scalebars,100µmand50µm.(D),RTqPCRlevels enco - analysis ofmRNAs 2-mo-old WT andprKOtestes. White arrowheads, Sertoli cells (SC); yellow arrowheads, peritubular myoid cells prKO testis(Sf1:Cre,mTmG,Prkar1a Prkar1a somaticprogenitorcellknockout A K I PCNA Hoechst expression E10.5 2 weeks TCM Rel. mRNA quant. Cre 0.0 0.5 1 1 a .0 .5 Prkar1a in1-d,2-wk,2-mo,4-mo-old WTtestes. Statistical andprKO analysis wasperformedusingStudent’s bioRxiv preprint n mTmG 4 9 .5x04 x0.46 x0.43 x 0.55 preprint (whichwasnotcertifiedbypeerreview)istheauthor/funder.Allrightsreserved.Noreuseallowedwithoutpermission. 1 d *** locusfollowingSf1:Cre-mediated recombination from E10.5inboth WT (Sf1:Cre,mTmG,Prkar1a WT WT 1 d 7 7 7 k2mo 2 wk *** Prkar1a k5wk 2 wk (prKO) doi: *** b Sf1 9 https://doi.org/10.1101/2020.12.21.423735 Sf1:Cre,Prkar1a Dissection Sf1:Cre,Prkar1a Sf1:Cre,Prkar1a Cre x 0.35 9 8 4 mo *** o4mo 2 mo fl/fl fl/fl fl/fl E and Scale bars, 100µm(inset 50µm, (L)500µm).ns,notsignificant, Testosterone (ng/mL) Prkar1a mT fl/fl 1 1 20 25 J 0 5 0 5
4 months TCM n B), ). (C),Immunohistochemical detection of GFP localized in SF1+derived cells in c 6 x 11.33 SUPPLEMENTARY FIGURES mG ** Prkar1a floxedalleles were deleted in SF1+cells. GFP isexpressedfromthe 7 CNC-LCCSCT 1 WT B
F GFP E10.5
LH (pg/mL) 1 200 300 400 00 0 n d ; this versionpostedDecember22,2020. 50 3 5 x 0.33 WT AGP Sf1:Cre,Prkar1a * CNC-LCCSCT 2 Sf1:Cre,mTmG Sf1:Cre,Prkar1a G E14.5 fl/fl
FSH1 (pg/mL)2000 3000 fl/fl 000 0 L HE n x 0.04 Ad 3 5 * T H C
WT LAMB Hoechst GFP Hoechst SC The copyrightholderforthis Sf1:Cre,mTmG PMC WT LC *p<0.05, SC Sf1:Cre,Prkar1a Sf1:Cre,Prkar1a Tu. Sf1:Cre,Prkar1a PMC **p<0.01, +/+ fl/fl fl/fl ,mTmG ) and LC fl/fl and bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
A Prkar1a somatic progenitor cell knockout, Sf1 Cre Prkar1a Prkaca - E10.5 2 mo Prkaca+/- Cre fl/fl +/- Prkaca + Sf1:Cre,Prkar1a ,Prkaca expression Dissection
B WT Prkarca+/- Sf1:Cre,Prkar1afl/fl Sf1:Cre,Prkar1afl/fl,Prkaca+/- a b c d
Tu.
HE e f g h
C D ns E ns 100 100 100 ns 7 3 ***
µm ) 80 ns *** 60 unaffected 50 hyperplasia 40 tumor
Sf1:Cre,Prkar1afl/fl 20 % of hyperplasia/tumor % spz producing tub. 6 2 Sf1:Cre,Prkar1afl/fl,Prkarca+/- 0 0 Epithelium thickness ( 0 % 95.3 0.095.068.8 FC 1.00 1.05 0.34 0.86 n 6 4 6 5 n 6 4 6 5
WT Prkaca+/- Sf1:Cre,Prkar1afl/fl Sf1:Cre,Prkar1afl/fl,Prkaca+/-
Figure S2 related to Figure 1. (A), Prkar1a floxed alleles were deleted in SF1+ cells and Prkaca heterozygosity context (noted as prKO/Prkaca+/-, Sf1:Cre,Prkar1afl/fl,Prkaca+/-). (B), HE staining of 2-mo-old WT, Prkaca+/-, prKO and prKO/Prkaca+/- testis. Dashed black lines delineate tumor developed in prKO testis, blue arrowheads show restored spermatozoa differentiation in prKO/Prkaca+/- testis and black lines limit seminiferous epithelium thickness. Ø, absence of spermatozoa. Scale bars, 100µm. (C), Relative proportion of testicular hyperplasia and tumor in 2-mo-old Prkaca+/-, prKO and prKO/Prkaca+/- testes. (D and E), Percentage of ST with elongated spermatids (D) and epithelium thickness (E) quantified following HE staining in 2-mo-old WT, Prkaca+/-, prKO and prKO/Prkaca+/- testes are restored in prKO/Prkaca+/- testis. Bars represent the mean value per group ± SD. Statistical analysis was performed using one-way ANOVA followed by Tukey multiple correction test. ***p<0.001.
51 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
Normal adult human testis CNC-LCCSCT 1 CNC-LCCSCT 2 CNC-LCCSCT 3 a b c d
Tu.1
Tu.
Tu. Tu.2
Tu.1 HE
Tu. Tu. Tu.2
Tu. Tu. Tu.1 Tu.2
IT ST
Figure S3 related to Figure 1. HE staining of reconstituted normal adult human testis (a) and human LCCSCT biopsy sections (b-d). Dashed lines delineate primary tumor mass. CNC-LCCSCT 3 section (d) presents two distinct tumor masses (T1, T2) and is devoid of ST. Blue square, tumor; red square, ST. Blue arrowheads, spermatozoa; Ø, disorganized ST devoid of spermatozoa. Scale bars reconstituted biopsies, 1mm; scale bars insets, 100µm.
52 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
A C Amh:Cre,mTmG Amh:Cre,Prkar1afl/fl,mTmG
Prkar1a Sertoli cell knockout Amh Cre Prkar1a (srKO) Amh:Cre,Prkar1afl/fl mT mG Hoechst
E15 2 wk 5wk 2 mo 4 mo 12 mo GFP Cre expression Dissection
B D Cyp11a1:Cre,mTmG Cyp11a1:Cre,Prkar1afl/fl,mTmG
Prkar1a Leydig cell knockout Cyp11a1 Cre Prkar1a (lrKO) Cyp11a1:Cre,Prkar1afl/fl mT mG Hoechst
E13.5 2 wk 2 mo 4 mo 12 mo GFP GFP Cre expression Dissection
E FG H 12 months 10 12 25 WT Amh:Cre,Prkar1afl/fl Cyp11a1:Cre,Prkar1afl/fl 1 10 *** a b c 8 20 8 6 15 6 ns 4 10
4 HE 2 5
2 Testosterone (ng/mL) Number of fertile males Number of pups per litter 9 18 0 0 0 FC 1.000.56 7.68 n 33 10 12
Figure S4 related to Figure 2. (A and B), Prkar1a floxed alleles were deleted in AMH+ cells (A) or CYP11A1+ cells (B). GFP is expressed from the R26RmTmG locus following Amh:Cre-mediated recombination from E14.5 in srKO testis (Amh:Cre,mTmG,Prkar1afl/fl) or following Cyp11a1:Cre-mediated recombination from E15.0 in lrKO testis (Cyp11a1:Cre,mTmG,Prkar1afl/fl). (C and D), Immunohistochemical detection of GFP localized in AMH+ derived cells (Sertoli cells) in 2-mo-old srKO testis (C) and in CYP11A1+ derived cells (Leydig cells) in 2-mo-old lrKO testis (D). (E and F), Number of fertile males (E) and pups per litter (F) in 2-mo-old lrKO male mice. (G), Plasma testosterone concentrations in 2-mo-old WT, srKO and lrKO mice. Bars represent the mean per group ± SD. Statistical analysis was performed using Kruskal-Wallis’ test followed by Dunn’s multiple correction test. (H), HE staining of 12-mo old WT, srKO and lrKO testes showing the absence of tumor in all three genotypes. ***p<0.001. Scale bars, 100µm.
53 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
fl/fl 2 weeks 5 weeks WT Amh:Cre,Prkar1a A B ns *** 12 80 200 x 2.11 WT Amh:Cre,Prkar1afl/fl WT Amh:Cre,Prkar1afl/fl x 1.09 ** a b c d ** x 1.50 ** 60 x 1.18 150 8 x 1.29
40 100 ns 4 x 0.88 HE
G9A+ cells / tub. 20 50 ZBTB16+ cells / tub. SYCP3+ cells / tub.
0 0 0 n 5 6 6 6 n 4 6 6 5 n 5 6 6 6 2 wk 5 wk 2 wk 5 wk 2 wk 5 wk C 25 200 e f g h WT Amh:Cre,Prkar1afl/fl 20 *** ns 150 *** ns *** Hoechst ***
*** *** 15 ns 100 ns 10 ZBTB16 *** Testis weight (mg) Testis 50 5 ns i j k l ns ns 0 1 d 5 d 9 d 2 w Age 2 w 3 w 4 w 5 w 6 w 7 w 2 m 4 m 6 m 12 m FC 1.020.87 1.53 1.32 1.32 1.78 2.09 2.05 1.64 1.41 0.85 0.50 0.40 0.22 Hoechst n 4 6 15 10 10 14 15 6 9 127 12 17 9 n 8 5 12 8 8 16 15 9 14 9 7 12 18 8 G9A D 5 weeks E fl/fl ** WT Amh:Cre,Prkar1a 100 x 28.86 m n o p
50 Hoechst
HE % full tubules SYCP3 0 n 6 6 5 wk 2 weeks 5 weeks 7 weeks F G SOX9+ cells / tub. WT Amh:Cre,Prkar1afl/fl WT Amh:Cre,Prkar1afl/fl WT Amh:Cre,Prkar1afl/fl 50 ** a b c d e f x 1.17 40
30 ns x 0.93 * x 0.85
Hoechst 20
10 SOX9 0 n 6 6 6 6 6 5 2 wk 5 wk 7 wk Figure S5 related to Figure 3. (A), HE staining (a-d) and immunohistochemical detection of ZBTB16 (e-h), G9A (i-l), SYCP3 (m-p) in 2-wk and 5 wk-old WT and srKO testes. Blue arrowheads, spermatozoa. (B), Quantification of ZBTB16, G9A and SYCP3 based on the number of positive cells per tube. Statistical analysis was performed using Student’s test or Welch’s t-test. (C) WT and Prkar1a mutant testis weight from 3-wk to 4-mo. Welch’s one-way ANOVA was followed by Games-Howell multiple correction test. (D), Representative HE of 5-wk-old WT and srKO sections. (E), Quantification of full tubules represented as a percentage of positive tubules quantified following HE staining in 5-wk-old WT and srKO testes. Statistical analysis was performed using Mann-Whitney’s test. (F), Immunohistochemi- cal detection of SOX9 in 2-wk (a,b), 5-wk (c,d) and 7-wk-old (e,f) WT and srKO testes. (G), Quantification of SOX9 based on the number of positive cells per tube. Statistical analysis was performed using Student’s test or Welch’s t-test. *p<0.05, **p<0.01, ***p<0.001. Bars represent the mean per group ± SD. Scale bars, 100µm.
54 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
A 2 weeks 5 weeks WT Sf1:Cre,Prkar1afl/fl Amh:Cre,Prkar1afl/fl WT Sf1:Cre,Prkar1afl/fl Amh:Cre,Prkar1afl/fl a b c d e f HE HE
B Cdh5 Cldn11 Ctnna1 F11r Gja1 Itgav Jup Ocln Pvrl2 Tubb3 Vcl Vim
6 *** **ns * *** *** ** 5 *** *** ns *** ns ns *** ns * *** 4 * * * *** ns ** ** ns ** * *** ** 3 *** ns *** *** ** *** 2 **
Rel. mRNA quant. 1
0 FC 1.00 1.872.74 1.002.09 2.13 1.002.36 2.01 1.00 1.361.56 1.00 1.261.97 1.00 3.77 2.94 1.00 0.360.33 1.002.00 1.40 1.00 1.231.46 1.00 1.95 2.04 1.00 1.301.68 1.00 2.523.45 n 9 7 8 9 7 8 9 7 8 9 7 8 9 7 8 9 7 8 9 7 8 9 7 8 9 7 8 9 7 8 9 7 8 9 7 8
WT Sf1:Cre,Prkar1afl/fl Amh:Cre,Prkar1afl/fl C WT Sf1:Cre,Prkar1afl/fl Amh:Cre,Prkar1afl/fl WT Sf1:Cre,Prkar1afl/fl Amh:Cre,Prkar1afl/fl a b c d e f Hoechst Hoechst VIM TUBB3
Figure S6 related to Figure 4. (A), HE staining of 2-wk (a-c) and 5-wk-old (d-f) WT, srKO and prKO testes. Arrowheads indicate vacuoles. (B), RTqPCR analysis of mRNAs levels encoding genes involved in cell junction assem- bly (Cdh5, Cldn11, Ctnna1, F11r, Gja1, Itgav, Jup, Ocln, Pvrl2, Tubb3, Vcl, Vim) in 2-mo-old WT, srKO and prKO testes. Bars represent the mean per group ± SD. Statistical analysis was performed using one-way ANOVA followed by Tukey multiple correction test, Welch’s one-way ANOVA followed by Games-Howell multiple correction test or Kruskal-Wallis’ test followed by Dunn’s multiple correction test. *p<0.05, **p<0.01, ***p<0.001. (C), Immunohisto- chemical detection of TUBB3 (a-c) and VIM (d-f) in 5-wk-old WT, prKO and srKO testes. White line delineates VIM expression domain.
55 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
WT Sf1:Cre,Wnt4fl/fl Amh:Cre,Wnt4fl/fl Ddx4 A C D 2.5 a b c ns 2.0 * Prkar1a/Wnt4 somatic progenitor cell knockout (prwKO) Sf1 Cre Prkar1a 1.5 ** Sf1:Cre,Prkar1afl/fl,Wnt4fl/fl Wnt4 1.0 HE
E10.5 2 mo. Rel. mRNA quant. 0.5 Cre expression 0.0 Dissection FC 1.00 0.880.48 n 10 7 7
WT WT Sf1:Cre,Prkar1afl/fl Sf1:Cre,Prkar1afl/fl,Wnt4fl/fl B E Sf1:Cre,Prkar1afl/fl a b c fl/fl, fl/fl ST Sf1:Cre,Prkar1a ,Wnt4 Prkar1a/Wnt4 Sertoli cell knockout (srwKO) Amh Cre Prkar1a ST ST Hy. Amh:Cre,Prkar1afl/fl,Wnt4fl/fl Wnt4 TCM E14.5 2 mo. Cre ST expression Dissection Tu.
Figure S7 related to Figure 5. (A and B), Prkar1a and Wnt4 floxed alleles were deleted in SF1+ cells (noted as prwKO, Sf1:Cre,Prkar1afl/fl,Wnt4fl/fl) (A) or in AMH+ cells (noted as srwKO, Amh:Cre,Prkar1afl/fl,Wnt4fl/fl) (B). (C), HE staining of 2-mo-old WT, Wnt4 somatic progenitor cell knockout (noted as pwKO, Sf1:Cre,Wnt4fl/fl) and Wnt4 Sertoli cell knoc- kout testis (noted as swKO, Amh:Cre,Wnt4fl/fl). (D), RTqPCR analysis of mRNAs levels encoding Ddx4 in 4-mo-old WT, prKO and prwKO testes. Bars represent the mean expression per group ± SD. Statistical analysis was performed using Welch’s one-way ANOVA followed by Games-Howell multiple correction test. (E), TCM staining of 2-mo-old WT, prKO and prwKO testes. Scale bars, 100µm. *p<0.05, **p<0.01, ***p<0.001.
56 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
CNC-LCCSCT 1 CNC-LCCSCT 2 CNC-LCCSCT 3
Iden�fica�on number BH14 16096 SI-109-208 N518-740 Associated center Rouen, France Bethesda, USA Bethesda, USA Carney complex Yes Yes Yes
Yes Yes PRKAR1A gene�c tes�ng was indeterminate, due Prkar1a muta�on ex7, c.695dup, p.Arg233LysfsX15 c.891+3A>G p.Glu297Glu to lack of peripheral DNA tes�ng. Age 25 years 7 years 6 years Bilateral Orchiectomy Orchiectomy Par�al - right tes�s (le� orchiectomy at age 7 and Par�al – le� tes�s right orchiectomy at age 10) LCCSCT LCCSCT Cardiac myxomas Cardiac myxomas LCCSCT CNC associated manifesta�ons Cutaneous myxomas Len�gines and conjunc�val pigmenta�on Pigmentary lesions Pituitary microadenomas PPNAD Thyroid nodules LH 4UI/l (N: 1.7-8.6) FSH 3.8UI/l (N: 1.5-12.4) LH 0.1 U/L Testosterone 3.77ng/ml (N : 3-9) FSH <0.1 U/L Hormonal manifesta�ons Not available Estradiol 20pg/ml (N : 10-60) Testosterone 1.14 ng/mL (Tanner II) TeBG 26nmol/l (N : 17-34) Estradiol <10 pg/mL Delta-4-androstenedione 2.3ng/ml (N : 0.9-2.4)
Table S1. Clinical data of CNC patients
57 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
IHC
Unmasking Amplifica�on An�body Supplier Reference Host Dilu�on (boiling = 25 min.) An�body Substrat Sodium Citrate 10mM, ImmPRESS Polymer Detec�on Kit TSA Alexa-coupled Kit CLDN11 Invitrogen 36-4500 Rabbit 1/500 Tween 0.05%, pH 6.0 MP-7401, Vector Laboratories Invitrogen Vector Unmasking Solu�on ImmPRESS Polymer Detec�on Kit TSA Alexa-coupled Kit β-catenin BD Biosciences 610153 Mouse 1/500 H-3300, Vector Laboratories MP-2400, Vector Laboratories Invitrogen Vector Unmasking Solu�on ImmPRESS Polymer Detec�on Kit TSA Alexa-coupled Kit DDX4 Abcam ab13840 Rabbit 1/500 H-3300, Vector Laboratories MP-7401, Vector Laboratories Invitrogen ImmPRESS Polymer Detec�on Kit TSA Alexa-coupled Kit G9A Cell Signaling 3306S Rabbit 1/100 Tris 10mM, EDTA 1mM, pH 9.0 MP-7401, Vector Laboratories Invitrogen Sodium Citrate 10mM, ImmPRESS Polymer Detec�on Kit TSA Alexa-coupled Kit GFP Abcam ab5450 Goat 1/1000 Tween 0.05%, pH 6.0 MP-7405, Vector Laboratories Invitrogen ImmPRESS Polymer Detec�on Kit TSA Alexa-coupled Kit HIF2A R&D Systems NB100-132 Mouse 1/200 Tris 10mM, EDTA 1mM, pH 9.0 MP-2400, Vector Laboratories Invitrogen Sodium Citrate 10mM, ImmPRESS Polymer Detec�on Kit TSA Alexa-coupled Kit LAMB Novus Biologicals L9393 Rabbit 1/200 Tween 0.05%, pH 6.0 MP-7401, Vector Laboratories Invitrogen Sodium Citrate 10mM, ImmPRESS Polymer Detec�on Kit Vector NovaRED Kit p4EBP1 Cell Signaling 2855 Rabbit 1/200 Tween 0.05%, pH 6.0 MP-7401, Vector Laboratories SK-4800, Vector Laboratories Sodium Citrate 10mM, ImmPRESS Polymer Detec�on Kit TSA Alexa-coupled Kit pERK Cell Signaling 4370 Rabbit 1/50 Tween 0.05%, pH 6.0 MP-7401, Vector Laboratories Invitrogen Sodium Citrate 10mM, PCNA Santa Cruz sc-56 Mouse 1/500 Tween 0.05%, pH 6.0 Sodium Citrate 10mM, ImmPRESS Polymer Detec�on Kit TSA Alexa-coupled Kit SOX9 Milipore AB5535 Rabbit 1/5000 Tween 0.05%, pH 6.0 MP-7401, Vector Laboratories Invitrogen Sodium Citrate 10mM, SYCP3 Abcam ab97672 Mouse 1/2000 Tween 0.05%, pH 6.0 Sodium Citrate 10mM, ImmPRESS Polymer Detec�on Kit TSA Alexa-coupled Kit SYCP3 Abcam ab150292 Rabbit 1/1000 Tween 0.05%, pH 6.0 MP-7401, Vector Laboratories Invitrogen ImmPRESS Polymer Detec�on Kit TSA Alexa-coupled Kit TUBB3 Sigma T2200 Rabbit 1/5000 MP-7401, Vector Laboratories Invitrogen ImmPRESS Polymer Detec�on Kit TSA Alexa-coupled Kit VIM Cell Signaling 5741 Rabbit 1/500 Tris 10mM, EDTA 1mM, pH 9.0 MP-7401, Vector Laboratories Invitrogen Sodium Citrate 10mM, ImmPRESS Polymer Detec�on Kit TSA Alexa-coupled Kit WNT4 Abcam Ab91226 Rabbit 1/200 Tween 0.05%, pH 6.0 MP-7401, Vector Laboratories Invitrogen Sodium Citrate 10mM, ImmPRESS Polymer Detec�on Kit TSA Alexa-coupled Kit ZBTB16 R&D Systems AF2944 Goat 1/1000 Tween 0.05%, pH 6.0 MP-7405, Vector Laboratories Invitrogen Sodium Citrate 10mM, ImmPRESS Polymer Detec�on Kit TSA Alexa-coupled Kit ZBTB16 Santa Cruz sc-22839 Rabbit 1/1000 Tween 0.05%, pH 6.0 MP-7401, Vector Laboratories Invitrogen
WB
An�body Supplier Reference Host Dilu�on
4EBP1 Cell Signaling 9644 Rabbit 1/1000
Ac�n Sigma A2066 Rabbit 1/5000
β-catenin (ac�ve) BD Biosciences 610153 Mouse 1/1000
β-catenin (total) Cell Signaling 8814 Rabbit 1/500
ERK Cell Signaling 9102 Rabbit 1/1000
GAPDH Sigma G9545 Rabbit 1/5000
p4EBP1 Cell Signaling 2855 Rabbit 1/1000
pERK Cell Signaling 9106 Mouse 1/2000
pS6K Cell Signaling 9208 Rabbit 1/1000
S6K Cell Signaling 9202 Rabbit 1/1000
Table S2. Antibodies and conditions for immunohistochemistry and western blot
58 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423735; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
Forward Reverse Actb TCATCACTATTGGCAACGAGC AGTTTCATGGATGCCACAGG Axin2 ATGGGGAGTAAGAAACAGCTCC CCAGCTCCAGTTTCAGTTTCTC Calb2 GGAAGCACTTTGATGCTGACG TCTCCAGCTCCTGGAAGAAGT Ccdc80 AGGCATGCAATTTTGGTCTGC ACATCTTCCCGCTCAACGAT Cdh5 ATTGGCCTGTGTTTTCGCAC CACAGTGGGGTCATCTGCAT Cldn11 CAGGCTTGTAGAGCCCTCAT GTGGGCACATACAGGAAACC Ctnna1 CAGTTCGCTGCAGAAATGAC CAGCCAAAACATGGGCCTTC Ctnnb1 AGTGCAGGAGGCCGAGG GAGTAGCCATTGTCCACGCA Ddx4 AGAGGGTTTTCCAAGCGAGG CTGAATCACTTGCTGCTGGTTT Dpt TGCCGCTATAGCAAGAGGTG CTTCCACTGGCGATCCCTTT Egf TGGAACCCAGTGGAATCACG TGGGATAGCCCAATCCGAGA F11r TTGGCGTCTGGTTTGCCTAT CACTTCGAGTACTGGGCTGG Fgf2 CGCGAGAAGAGCGACCCACAC GGCACACACTCCCTTGATAGACACAA Gja1 AGGAGTTCCACCACTTTGGC AGCGAAAGGCAGACTGTTCA Hif1a AGATGACGGCGACATGGTTT GATGTTCATCGTCCTCCCCC Hif1b GGCGACTACAGCTAACCCAG GGCAAACCGCTCTTTGTCATT Hif2a GGAGCTACTTGGACGCTCTG GTTGCGGGGGTTGTAGATGA Igf1 CTGGACCAGAGACCCTTTGC CCGGAAGCAACACTCATCCA Inha TCCTGGTAGCCCACACTAGG GAAACTGGGAGGGTGTACGA Itgav CGTCCTCCAGGATGTTTCTCC CCAAACCACTGGTGGGACTT Jup GTCCCTTTGCCTTTTGTTCGG ACCTTGATGGGCTGCTCAAT Ki67 AGTCTCTTGGCACTCACAGC ATGGATGCTCTCTTCGCAGG Kitl ACGTCTGAGTGCTGAAAACCC CACCATCCAGGCTGAAATCTAC Myc GGCTGGATTTCCTTTGGGCG CGGAGTCGTAGTCGAGGTCA Nr0b1 GGTCCAGGCCATCAAGAGTTT CCGGATGTGCTCAGTAAGGAT Ocln ACGGACCCTGACCACTATGA TCCTGCAGACCTGCATCAAA Prkar1a CGGGAATGCGAGCTCTATGT CTCGAGTCAGTACGGATGCC Pvrl2 GCGTCAAGGTCACGTGTAGA ATAGTCTGTGGGCTCTGGGT S100a1 AGGTCGGTAGGGAAAGACGA CCAGCTCAGAGCCCATTTCA Tgfb1 AGGGCTACCATGCCAACTTC CCACGTAGTAGACGATGGGC Tgfb2 GGGTCTTCCGCTTGCAAAAC GAAGGAGAGCCATTCACCCT Tgfb3 AGCGCTACATAGGTGGCAAG CCATTGGGCTGAAAGGTGTG Tubb3 TTGGACACCTATTCAGGCCC ACTCTTTCCGCACGACATCT Vcl CCTCCTCCACCAGACCTTGA TGTCATTGCCCTTGCTAGACC Vim GGATCAGCTCACCAACGACA AAGGTCAAGACGTGCCAGAG Wnt4 CCCTGTCTTTGGGAAGGTGGTG CACCTGCTGAAGAGATGGCGTATAC Wnt5a CGCCCAGGTTGTTATAGAAGCTAATTCTTG GGCTGCAGAGAGGCTGTGCAC Table S3. Primers used for RTqPCR
59