A B-Catenin-Driven Switch in TCF/LEF Transcription Factor Binding To
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-Like Mouse Models: Tracking the Role of the Hairless Gene
University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 5-2006 Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene Yutao Liu University of Tennessee - Knoxville Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss Part of the Life Sciences Commons Recommended Citation Liu, Yutao, "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino- like Mouse Models: Tracking the Role of the Hairless Gene. " PhD diss., University of Tennessee, 2006. https://trace.tennessee.edu/utk_graddiss/1824 This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a dissertation written by Yutao Liu entitled "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene." I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Doctor of Philosophy, with a major in Life Sciences. Brynn H. Voy, Major Professor We have read this dissertation and recommend its acceptance: Naima Moustaid-Moussa, Yisong Wang, Rogert Hettich Accepted for the Council: Carolyn R. -
The Extracellular Matrix Phenome Across Species
bioRxiv preprint doi: https://doi.org/10.1101/2020.03.06.980169; this version posted March 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. The extracellular matrix phenome across species Cyril Statzer1 and Collin Y. Ewald1* 1 Eidgenössische Technische Hochschule Zürich, Department of Health Sciences and Technology, Institute of Translational Medicine, Schwerzenbach-Zürich CH-8603, Switzerland *Corresponding authors: [email protected] (CYE) Keywords: Phenome, genotype-to-phenotype, matrisome, extracellular matrix, collagen, data mining. Highlights • 7.6% of the human phenome originates from variations in matrisome genes • 11’671 phenotypes are linked to matrisome genes of humans, mice, zebrafish, Drosophila, and C. elegans • Expected top ECM phenotypes are developmental, morphological and structural phenotypes • Nonobvious top ECM phenotypes include immune system, stress resilience, and age-related phenotypes 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.06.980169; this version posted March 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. 1 Abstract 2 Extracellular matrices are essential for cellular and organismal function. Recent 3 genome-wide and phenome-wide association studies started to reveal a broad 4 spectrum of phenotypes associated with genetic variants. However, the phenome or 5 spectrum of all phenotypes associated with genetic variants in extracellular matrix 6 genes is unknown. -
Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo -
Amplitude Modulation of Androgen Signaling by C-MYC
Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press Amplitude modulation of androgen signaling by c-MYC Min Ni,1,2 Yiwen Chen,3,4 Teng Fei,1,2 Dan Li,1,2 Elgene Lim,1,2 X. Shirley Liu,3,4,5 and Myles Brown1,2,5 1Division of Molecular and Cellular Oncology, Department of Medical Oncology, Dana-Farber Cancer Institute, Boston, Massachusetts 02215, USA; 2Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, Massachusetts 02215, USA; 3Department of Biostatistics and Computational Biology, Dana-Farber Cancer Institute, Boston, Massachusetts 02215, USA; 4Harvard School of Public Health, Boston, Massachusetts 02215, USA Androgen-stimulated growth of the molecular apocrine breast cancer subtype is mediated by an androgen receptor (AR)-regulated transcriptional program. However, the molecular details of this AR-centered regulatory network and the roles of other transcription factors that cooperate with AR in the network remain elusive. Here we report a positive feed-forward loop that enhances breast cancer growth involving AR, AR coregulators, and downstream target genes. In the absence of an androgen signal, TCF7L2 interacts with FOXA1 at AR-binding sites and represses the basal expression of AR target genes, including MYC. Direct AR regulation of MYC cooperates with AR-mediated activation of HER2/HER3 signaling. HER2/HER3 signaling increases the transcriptional activity of MYC through phosphorylation of MAD1, leading to increased levels of MYC/MAX heterodimers. MYC in turn reinforces the transcriptional activation of androgen-responsive genes. These results reveal a novel regulatory network in molecular apocrine breast cancers regulated by androgen and AR in which MYC plays a central role as both a key target and a cooperating transcription factor to drive oncogenic growth. -
An Animal Model with a Cardiomyocyte-Specific Deletion of Estrogen Receptor Alpha: Functional, Metabolic, and Differential Netwo
Washington University School of Medicine Digital Commons@Becker Open Access Publications 2014 An animal model with a cardiomyocyte-specific deletion of estrogen receptor alpha: Functional, metabolic, and differential network analysis Sriram Devanathan Washington University School of Medicine in St. Louis Timothy Whitehead Washington University School of Medicine in St. Louis George G. Schweitzer Washington University School of Medicine in St. Louis Nicole Fettig Washington University School of Medicine in St. Louis Attila Kovacs Washington University School of Medicine in St. Louis See next page for additional authors Follow this and additional works at: https://digitalcommons.wustl.edu/open_access_pubs Recommended Citation Devanathan, Sriram; Whitehead, Timothy; Schweitzer, George G.; Fettig, Nicole; Kovacs, Attila; Korach, Kenneth S.; Finck, Brian N.; and Shoghi, Kooresh I., ,"An animal model with a cardiomyocyte-specific deletion of estrogen receptor alpha: Functional, metabolic, and differential network analysis." PLoS One.9,7. e101900. (2014). https://digitalcommons.wustl.edu/open_access_pubs/3326 This Open Access Publication is brought to you for free and open access by Digital Commons@Becker. It has been accepted for inclusion in Open Access Publications by an authorized administrator of Digital Commons@Becker. For more information, please contact [email protected]. Authors Sriram Devanathan, Timothy Whitehead, George G. Schweitzer, Nicole Fettig, Attila Kovacs, Kenneth S. Korach, Brian N. Finck, and Kooresh I. Shoghi This open access publication is available at Digital Commons@Becker: https://digitalcommons.wustl.edu/open_access_pubs/3326 An Animal Model with a Cardiomyocyte-Specific Deletion of Estrogen Receptor Alpha: Functional, Metabolic, and Differential Network Analysis Sriram Devanathan1, Timothy Whitehead1, George G. Schweitzer2, Nicole Fettig1, Attila Kovacs3, Kenneth S. -
Genetic and Epigenetic Variation in the Human Genome
Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 122 Genetic and Epigenetic Variation in the Human Genome Analysis of Phenotypically Normal Individuals and Patients Affected with Brain Tumors CECILIA DE BUSTOS ACTA UNIVERSITATIS UPSALIENSIS ISSN 1651-6206 UPPSALA ISBN 91-554-6490-4 2006 urn:nbn:se:uu:diva-6629 !" #$ % &' !""( ")*&+ , $ , , -$ $ ./ , 0 12 #$ 3 4 $2 5 62 !""(2 7 4 8 $ 7 2 % , -$ 9 : - %,, 3 $ 5 # 2 % 2 &!!2 (; 2 2 :<59 )&=++>=(>)"=>2 7 , $ $ 2 < $ .<9-1 $ .69-1 $ , , 2 #$ $ $ , = $ 2 6 , , $ 3 $ 2 : : 3 ,, $ , -7/? ,, 3 $ $ @ $ $ $ 2 % , = , $ .!A1 3 , , $ B9/&>;C-7/? $3 $ $ 2 : :: +" 3 @ , 9% 3 $ $ !! 2 D$ !"E , !! ,, , $ !! 3 , &>E , 2 #$ $ , !!F2 - ::: $ , , 'G $ 2 D +&2+E , $ 2 : 3 , 3 , !2! 0 '!" . $ 4 69-12 : 3$ $ 4 69- 3 $ $ $ 3 $ 3 $$= -6 = $ . :812 / $ 3 ! 3$$ $ , 2 #$ $ 3 , 3 $ , 2 H $ 3 @ !)" 2 #$, :=:8 $ <9- 69- = $2 / 8 , 9% $ , ,, I)E , $ $ 2 0 $ $ $ 3 , 3 9% $ , 2 "# $ =67 $ % & & -
Original Article Parathyroid Hormone Induces Epithelial-To-Mesenchymal Transition Via the Wnt/Β-Catenin Signaling Pathway in Human Renal Proximal Tubular Cells
Int J Clin Exp Pathol 2014;7(9):5978-5987 www.ijcep.com /ISSN:1936-2625/IJCEP0001621 Original Article Parathyroid hormone induces epithelial-to-mesenchymal transition via the Wnt/β-catenin signaling pathway in human renal proximal tubular cells Yunshan Guo1*, Zhen Li1*, Raohai Ding1, Hongdong Li1, Lei Zhang1, Weijie Yuan2, Yanxia Wang1 1Department of Nephrology, General Hospital of Ji’nan Military Command, Ji’nan 250031, China; 2Department of Nephrology, Shanghai Jiaotong University Affiliated First People’s Hospital, 85 Wu Jin Road, Shanghai 200080, China. *Equal contributors. Received July 30, 2014; Accepted August 21, 2014; Epub August 15, 2014; Published September 1, 2014 Abstract: Epithelial-to-mesenchymal transition (EMT) has been shown to play an important role in renal fibrogen- esis. Recent studies suggested parathyroid hormone (PTH) could accelerate EMT and subsequent organ fibrosis. However, the precise molecular mechanisms underlying PTH-induced EMT remain unknown. The present study was to investigate whether Wnt/β-catenin signaling pathway is involved in PTH-induced EMT in human renal proximal tubular cells (HK-2 cells) and to determine the profile of gene expression associated with PTH-induced EMT. PTH could induce morphological changes and gene expression characteristic of EMT in cultured HK-2 cells. Suppressing β-catenin expression or DKK1 limited gene expression characteristic of PTH-induced EMT. Based on the PCR array analysis, PTH treatment resulted in the up-regulation of 18 genes and down-regulation of 9 genes compared with the control. The results were further supported by a western blot analysis, which showed the increased Wnt4 protein expression. Wnt4 overexpression also promotes PTH-induced EMT in HK-2 cells. -
Mouse CELA3B ORF Mammalian Expression Plasmid, C-His Tag
Mouse CELA3B ORF mammalian expression plasmid, C-His tag Catalog Number: MG53134-CH General Information Plasmid Resuspension protocol Gene : chymotrypsin-like elastase family, 1. Centrifuge at 5,000×g for 5 min. member 3B 2. Carefully open the tube and add 100 l of sterile water to Official Symbol : CELA3B dissolve the DNA. Synonym : Ela3; Ela3b; AI504000; 0910001F22Rik; 2310074F01Rik 3. Close the tube and incubate for 10 minutes at room Source : Mouse temperature. cDNA Size: 810bp 4. Briefly vortex the tube and then do a quick spin to RefSeq : NM_026419.2 concentrate the liquid at the bottom. Speed is less than Description 5000×g. Lot : Please refer to the label on the tube 5. Store the plasmid at -20 ℃. Vector : pCMV3-C-His Shipping carrier : The plasmid is ready for: Each tube contains approximately 10 μg of lyophilized plasmid. • Restriction enzyme digestion Storage : • PCR amplification The lyophilized plasmid can be stored at ambient temperature for three months. • E. coli transformation Quality control : • DNA sequencing The plasmid is confirmed by full-length sequencing with primers in the sequencing primer list. E.coli strains for transformation (recommended Sequencing primer list : but not limited) pCMV3-F: 5’ CAGGTGTCCACTCCCAGGTCCAAG 3’ Most commercially available competent cells are appropriate for pcDNA3-R : 5’ GGCAACTAGAAGGCACAGTCGAGG 3’ the plasmid, e.g. TOP10, DH5α and TOP10F´. Or Forward T7 : 5’ TAATACGACTCACTATAGGG 3’ ReverseBGH : 5’ TAGAAGGCACAGTCGAGG 3’ pCMV3-F and pcDNA3-R are designed by Sino Biological Inc. Customers can order the primer pair from any oligonucleotide supplier. Manufactured By Sino Biological Inc., FOR RESEARCH USE ONLY. NOT FOR USE IN HUMANS. -
Genome-Wide Linkage and Admixture Mapping of Type 2 Diabetes In
ORIGINAL ARTICLE Genome-Wide Linkage and Admixture Mapping of Type 2 Diabetes in African American Families From the American Diabetes Association GENNID (Genetics of NIDDM) Study Cohort Steven C. Elbein,1,2 Swapan K. Das,1,2 D. Michael Hallman,3 Craig L. Hanis,3 and Sandra J. Hasstedt4 OBJECTIVE—We used a single nucleotide polymorphism (SNP) map in a large cohort of 580 African American families to identify regions linked to type 2 diabetes, age of type 2 diabetes ype 2 diabetes is marked by a clear genetic diagnosis, and BMI. propensity, a high concordance in identical twins, tendencies for both diabetes and age of RESEARCH DESIGN AND METHODS—After removing outli- onset to be familial (1), and marked differences ers and problematic samples, we conducted linkage analysis T in prevalence among ethnic groups (2). Despite consider- using 5,914 SNPs in 1,344 individuals from 530 families. Linkage analysis was conducted using variance components for type 2 able evidence for a genetic predisposition, unraveling the diabetes, age of type 2 diabetes diagnosis, and BMI and nonpara- genetic etiology has been daunting, with few confirmed metric linkage analyses. Ordered subset analyses were con- genes identified from genome-wide linkage scans. Recent ducted ranking on age of type 2 diabetes diagnosis, BMI, waist successes with genome-wide association scans (3) have circumference, waist-to-hip ratio, and amount of European ad- greatly increased the number of confirmed genetic loci, mixture. Admixture mapping was conducted using 4,486 markers but these successes have been limited primarily to Cauca- not in linkage disequilibrium. -
(12) Patent Application Publication (10) Pub. No.: US 2015/0072349 A1 Diamandis Et Al
US 201500 72349A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2015/0072349 A1 Diamandis et al. (43) Pub. Date: Mar. 12, 2015 (54) CANCER BOMARKERS AND METHODS OF (52) U.S. Cl. USE CPC. G0IN33/57484 (2013.01); G0IN 2333/705 (2013.01) (71) Applicant: University Health Network, Toronto USPC ......................................... 435/6.12: 435/7.94 (CA) (57) ABSTRACT A method of evaluating a probability a Subject has a cancer, (72) Inventors: Eleftherios P. Diamandis, Toronto diagnosing a cancer and/or monitoring cancer progression (CA); Ioannis Prassas, Toronto (CA); comprising: a. measuring an amount of a biomarker selected Shalini Makawita, Toronto (CA); from the group consisting of CUZD1 and/or LAMC2 and/or Caitlin Chrystoja, Toronto (CA); Hari the group CUZD1, LAMC2, AQP8, CELA2B, CELA3B, M. Kosanam, Maple (CA) CTRB1, CTRB2, GCG, IAPP, INS, KLK1, PNLIPRP1, PNLIPRP2, PPY, PRSS3, REG3G, SLC30A8, KLK3, NPY, (21) Appl. No.: 14/385,449 PSCA, RLN1, SLC45A3, DSP GP73, DSG2, CEACAM7, CLCA1, GPA33, LEFTY1, ZG16, IRX5, LAMP3, MFAP4, (22) PCT Fled: Mar. 15, 2013 SCGB1A1, SFTPC, TMEM100, NPY, PSCA RLN1 and/or SLC45A3 in a test sample from a subject with cancer; (86) PCT NO.: PCT/CA2O13/OOO248 wherein the cancer is pancreas cancer if CUZD1, LAMC2, S371 (c)(1), AQP8, CELA2B, CELA3B, CTRB1, CTRB2, GCG, LAPP (2) Date: Sep. 23, 2014 INS, KLK1, PNLIPRP1, PNLIPRP2, PPY, PRSS3, REG3G, SLC30A8, DSP GP73 and/or DSG2 is selected; the cancer is colon cancer if CEACAM7, CLCA1, GPA33, LEFTY 1 and/ Related U.S. Application Data or ZG16 is selected, the cancer is lung cancer if IRX5, (60) Provisional application No. -
Oestrogen Receptor α AF-1 and AF-2 Domains Have Cell
ARTICLE DOI: 10.1038/s41467-018-07175-0 OPEN Oestrogen receptor α AF-1 and AF-2 domains have cell population-specific functions in the mammary epithelium Stéphanie Cagnet1, Dalya Ataca 1, George Sflomos1, Patrick Aouad1, Sonia Schuepbach-Mallepell2, Henry Hugues3, Andrée Krust4, Ayyakkannu Ayyanan1, Valentina Scabia1 & Cathrin Brisken 1 α α 1234567890():,; Oestrogen receptor (ER ) is a transcription factor with ligand-independent and ligand- dependent activation functions (AF)-1 and -2. Oestrogens control postnatal mammary gland development acting on a subset of mammary epithelial cells (MECs), termed sensor cells, which are ERα-positive by immunohistochemistry (IHC) and secrete paracrine factors, which stimulate ERα-negative responder cells. Here we show that deletion of AF-1 or AF-2 blocks pubertal ductal growth and subsequent development because both are required for expres- sion of essential paracrine mediators. Thirty percent of the luminal cells are ERα-negative by IHC but express Esr1 transcripts. This low level ERα expression through AF-2 is essential for cell expansion during puberty and growth-inhibitory during pregnancy. Cell-intrinsic ERα is not required for cell proliferation nor for secretory differentiation but controls transcript levels of cell motility and cell adhesion genes and a stem cell and epithelial mesenchymal transition (EMT) signature identifying ERα as a key regulator of mammary epithelial cell plasticity. 1 Swiss Institute for Experimental Cancer Research, School of Life Sciences, Ecole Polytechnique Fédérale de Lausanne, CH-1015 Lausanne, Switzerland. 2 Department of Biochemistry, University of Lausanne, CH-1066 Epalinges, Switzerland. 3 Centre Hospitalier Universitaire Vaudois, Department of Laboratory Medecine, University Hospital of Lausanne, CH-1011 Lausanne, Switzerland. -
Towards an Integrated View of Wnt Signaling in Development Renée Van Amerongen and Roel Nusse*
HYPOTHESIS 3205 Development 136, 3205-3214 (2009) doi:10.1242/dev.033910 Towards an integrated view of Wnt signaling in development Renée van Amerongen and Roel Nusse* Wnt signaling is crucial for embryonic development in all animal Notably, components at virtually every level of the Wnt signal species studied to date. The interaction between Wnt proteins transduction cascade have been shown to affect both β-catenin- and cell surface receptors can result in a variety of intracellular dependent and -independent responses, depending on the cellular responses. A key remaining question is how these specific context. As we discuss below, this holds true for the Wnt proteins responses take shape in the context of a complex, multicellular themselves, as well as for their receptors and some intracellular organism. Recent studies suggest that we have to revise some of messengers. Rather than concluding that these proteins are shared our most basic ideas about Wnt signal transduction. Rather than between pathways, we instead propose that it is the total net thinking about Wnt signaling in terms of distinct, linear, cellular balance of signals that ultimately determines the response of the signaling pathways, we propose a novel view that considers the receiving cell. In the context of an intact and developing integration of multiple, often simultaneous, inputs at the level organism, cells receive multiple, dynamic, often simultaneous and of both Wnt-receptor binding and the downstream, sometimes even conflicting inputs, all of which are integrated to intracellular response. elicit the appropriate cell behavior in response. As such, the different signaling pathways might thus be more intimately Introduction intertwined than previously envisioned.