DOCSLIB.ORG

Table 4. 391 Probe Sets Still Rhythmic After Sleep Deprivation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Table 4. 391 Probe Sets Still Rhythmic After Sleep Deprivation Table 4. 391 probe sets still rhythmic after sleep deprivation Affymetrix ID Gene Symbol Description Accession time_sin time_cos adj.P.Val 1438211_s_at Dbp D site albumin promoter binding protein BB550183 -0.013 -0.877 1.44E-13 1418174_at Dbp D site albumin promoter binding protein BC018323 -0.036 -0.880 1.74E-13 1425099_a_at Arntl aryl hydrocarbon receptor nuclear translocator-like BC011080 0.135 0.418 1.02E-11 1416958_at Nr1d2 nuclear receptor subfamily 1, group D, member 2 NM_011584 -0.035 -0.397 7.53E-11 1421087_at Per3 period homolog 3 (Drosophila) NM_011067 -0.119 -0.477 3.46E-10 1450779_at Fabp7 fatty acid binding protein 7, brain NM_021272 0.433 0.404 3.82E-10 1424175_at Tef thyrotroph embryonic factor BC017689 -0.113 -0.279 1.39E-09 1435188_at Gm129 gene model 129, (NCBI) BB407125 -0.097 -0.667 4.17E-09 1417602_at Per2 period homolog 2 (Drosophila) AF035830 -0.460 -0.408 5.97E-09 1425560_a_at S100a16 S100 calcium binding protein A16 BC020031 0.228 0.194 5.97E-09 1435459_at Fmo2 flavin containing monooxygenase 2 BM936480 -0.255 -0.426 6.23E-09 1457350_at Per2 period homolog 2 (Drosophila) BG298986 -0.312 -0.485 7.81E-09 1445892_at Per2 Period homolog 2 (Drosophila) BM238318 -0.300 -0.432 1.50E-08 1448383_at Mmp14 matrix metallopeptidase 14 (membrane-inserted) NM_008608 0.082 0.474 3.74E-08 1456046_at Cd93 CD93 antigen AV319144 0.357 0.320 4.89E-08 1429286_at 1190003M12Rik RIKEN cDNA 1190003M12 gene AK004474 -0.511 -0.245 5.08E-08 similar to Putative RNA-binding protein 3 (RNA- 1422660_at LOC671237 AY052560 -0.269 -0.318 5.40E-08 binding motif protein 3) 1416959_at Nr1d2 nuclear receptor subfamily 1, group D, member 2 NM_011584 -0.053 -0.408 1.45E-07 1458176_at Per3 Period homolog 3 (Drosophila) BB021263 -0.036 -0.474 2.17E-07 1433733_a_at Cry1 cryptochrome 1 (photolyase-like) BG069864 -0.378 0.199 7.43E-07 1447676_x_at S100a16 S100 calcium binding protein A16 AV074236 0.201 0.180 9.29E-07 1417168_a_at Usp2 ubiquitin specific peptidase 2 AI553394 -0.019 -0.360 1.15E-06 1428942_at Mt2 metallothionein 2 AA796766 -0.023 -0.485 2.44E-06 1435854_at Tmem10 transmembrane protein 10 AW490730 0.172 0.366 2.76E-06 1420772_a_at Tsc22d3 TSC22 domain family 3 NM_010286 -0.165 -0.476 2.94E-06 1436263_at Mobp myelin-associated oligodendrocytic basic protein AI839848 -0.024 -0.264 2.94E-06 1451355_at Asah3l N-acylsphingosine amidohydrolase 3-like AF282864 -0.023 -0.574 3.24E-06 1418187_at Ramp2 receptor (calcitonin) activity modifying protein 2 AF146523 0.051 -0.283 3.73E-06 1425281_a_at Tsc22d3 TSC22 domain family 3 AF201289 -0.160 -0.468 7.37E-06 1443952_at Thra thyroid hormone receptor alpha BI525006 0.109 -0.196 7.37E-06 1428288_at Klf9 Kruppel-like factor 9 AW488885 0.029 -0.215 7.86E-06 1416572_at Mmp14 matrix metallopeptidase 14 (membrane-inserted) NM_008608 0.114 0.452 7.94E-06 1460510_a_at Coq10b coenzyme Q10 homolog B (S. cerevisiae) AK006551 -0.119 -0.220 9.54E-06 1417603_at Per2 period homolog 2 (Drosophila) AF035830 -0.267 -0.267 1.08E-05 1453435_a_at Fmo2 flavin containing monooxygenase 2 AK009753 -0.253 -0.471 1.12E-05 1426464_at Nr1d1 nuclear receptor subfamily 1, group D, member 1 W13191 0.373 -0.274 1.24E-05 1422869_at Mertk c-mer proto-oncogene tyrosine kinase NM_008587 -0.012 -0.346 1.25E-05 1457373_at --- Transcribed locus BB495006 -0.267 -0.320 1.25E-05 1428223_at Mfsd2 major facilitator superfamily domain containing 2 AK006096 -0.147 -0.258 1.33E-05 1423306_at 2010002N04Rik RIKEN cDNA 2010002N04 gene BI963682 -0.171 -0.346 1.49E-05 1427883_a_at Col3a1 procollagen, type III, alpha 1 AW550625 0.203 0.305 1.49E-05 1422438_at Ephx1 epoxide hydrolase 1, microsomal NM_010145 0.055 -0.220 1.58E-05 Cables1 /// Cdk5 and Abl enzyme substrate 1 /// similar to Cdk5 1422477_at AF328140 -0.027 -0.298 1.62E-05 LOC635753 and Abl enzyme substrate 1 1422678_at Dgat2 diacylglycerol O-acyltransferase 2 AK002443 0.080 -0.199 1.80E-05 1451527_at Pcolce2 procollagen C-endopeptidase enhancer 2 AF352788 -0.057 -0.308 1.98E-05 1448181_at Klf15 Kruppel-like factor 15 BC013486 -0.045 -0.327 2.02E-05 1423100_at Fos FBJ osteosarcoma oncogene AV026617 -0.272 0.418 2.58E-05 1418932_at Nfil3 nuclear factor, interleukin 3, regulated AY061760 0.111 0.288 3.55E-05 1420502_at Sat1 spermidine/spermine N1-acetyl transferase 1 NM_009121 -0.013 0.218 3.90E-05 1427682_a_at Egr2 early growth response 2 X06746 -0.400 0.452 5.78E-05 1417839_at Cldn5 claudin 5 NM_013805 -0.001 0.310 6.07E-05 solute carrier family 2 (facilitated glucose 1434773_a_at Slc2a1 BM207588 -0.061 -0.268 6.60E-05 transporter), member 1 Adult male medulla oblongata cDNA, RIKEN full- 1435119_at --- length enriched library, clone:6330578N16 BE956710 -0.078 -0.515 7.29E-05 product:unclassifiable, full insert sequence 1442025_a_at --- --- AI467657 0.070 -0.357 8.11E-05 interferon-induced protein with tetratricopeptide 1449025_at Ifit3 NM_010501 -0.190 -0.142 8.50E-05 repeats 3 1438648_x_at 1190003M12Rik RIKEN cDNA 1190003M12 gene AV069898 -0.292 -0.010 8.64E-05 1428332_at 1500004A08Rik RIKEN cDNA 1500004A08 gene AW556858 0.069 -0.193 8.95E-05 1448945_at Pllp plasma membrane proteolipid BC024534 0.178 0.110 9.45E-05 1460662_at Per3 period homolog 3 (Drosophila) NM_011067 -0.109 -0.419 1.01E-04 solute carrier family 6 (neurotransmitter transporter, 1424338_at Slc6a13 BC023117 0.049 0.288 1.04E-04 GABA), member 13 1417169_at Usp2 ubiquitin specific peptidase 2 AI553394 0.013 -0.263 1.14E-04 1416125_at Fkbp5 FK506 binding protein 5 U16959 0.028 -0.386 1.56E-04 1457549_at Ccnd3 Cyclin D3 BB043576 -0.097 -0.382 1.56E-04 1418744_s_at Tesc tescalcin NM_021344 0.153 -0.013 1.82E-04 SI Table4_1 Affymetrix ID Gene Symbol Description Accession time_sin time_cos adj.P.Val solute carrier family 2 (facilitated glucose 1426599_a_at Slc2a1 BM209618 -0.020 -0.287 1.82E-04 transporter), member 1 methylenetetrahydrofolate dehydrogenase (NADP+ 1456653_a_at Mthfd1l AV095209 -0.224 -0.158 1.82E-04 dependent) 1-like 1448807_at Hrh3 histamine receptor H 3 NM_133849 -0.027 -0.212 1.83E-04 1428736_at Gramd3 GRAM domain containing 3 AV259880 0.006 0.200 1.92E-04 1436735_at Nsun3 NOL1/NOP2/Sun domain family 3 BB769111 0.157 -0.125 1.98E-04 1434595_at Trim9 tripartite motif protein 9 BQ174474 0.110 0.142 2.09E-04 1457984_at Crh corticotropin releasing hormone BM933756 0.072 0.304 2.09E-04 1417574_at Cxcl12 chemokine (C-X-C motif) ligand 12 NM_013655 -0.192 0.267 2.28E-04 echinoderm microtubule associated protein like 1 /// Eml1 /// 1428321_at similar to echinoderm microtubule associated AK003593 0.139 0.196 2.76E-04 LOC634102 protein like 1 1428487_s_at Coq10b coenzyme Q10 homolog B (S. cerevisiae) AK002294 -0.133 -0.223 2.88E-04 glutamic pyruvate transaminase (alanine 1455007_s_at Gpt2 BI648645 -0.020 -0.242 2.96E-04 aminotransferase) 2 1449379_at Kdr kinase insert domain protein receptor NM_010612 0.090 0.235 3.30E-04 A2m /// alpha-2-macroglobulin /// hypothetical protein 1434719_at BB185854 0.106 0.190 3.31E-04 LOC677369 LOC677369 1425428_at Hif3a hypoxia inducible factor 3, alpha subunit AF416641 -0.128 -0.258 3.40E-04 1436050_x_at Hes6 hairy and enhancer of split 6 (Drosophila) AI326893 0.143 -0.202 3.44E-04 Leo1, Paf1/RNA polymerase II complex component, 1455293_at Leo1 BG065311 0.054 0.167 3.49E-04 homolog (S. cerevisiae) interleukin 22 /// interleukin 10-related T cell-derived 1427624_s_at Il22 /// Iltifb AJ249492 0.163 0.290 3.65E-04 inducible factor beta 1434735_at Hlf hepatic leukemia factor BB744589 -0.126 -0.155 3.65E-04 solute carrier family 2 (facilitated glucose 1426600_at Slc2a1 BM209618 -0.027 -0.297 3.66E-04 transporter), member 1 1434621_at BC054438 cDNA sequence BC054438 AV298104 0.125 -0.160 3.87E-04 1416101_a_at Hist1h1c histone 1, H1c NM_015786 0.172 0.104 4.17E-04 1426641_at Trib2 tribbles homolog 2 (Drosophila) BB354684 -0.106 0.256 5.26E-04 1447272_s_at Atp10a ATPase, class V, type 10A BM249532 -0.093 -0.366 6.94E-04 1416530_a_at Pnp purine-nucleoside phosphorylase BC003788 0.027 0.210 7.57E-04 1416892_s_at 3110001A13Rik RIKEN cDNA 3110001A13 gene BC021353 0.066 0.165 7.72E-04 protein phosphatase 1, regulatory (inhibitor) subunit 1418086_at Ppp1r14a NM_026731 0.214 0.167 8.07E-04 14A 1448929_at F13a1 coagulation factor XIII, A1 subunit NM_028784 -0.097 -0.237 8.07E-04 1424133_at Tmem98 transmembrane protein 98 BC011208 0.138 0.156 8.42E-04 1416332_at Cirbp cold inducible RNA binding protein NM_007705 -0.052 -0.324 9.12E-04 1437449_at Rsad1 radical S-adenosyl methionine domain containing 1 BB818348 0.152 -0.230 9.12E-04 1436387_at Homer1a RIKEN cDNA C330006P03 gene BB398124 -0.088 0.248 9.44E-04 1416591_at Rab34 RAB34, member of RAS oncogene family AF327929 0.177 -0.064 9.55E-04 nuclear factor of kappa light chain gene enhancer in 1448306_at Nfkbia NM_010907 -0.052 -0.306 9.55E-04 B-cells inhibitor, alpha 1450184_s_at Tef thyrotroph embryonic factor NM_017376 -0.105 -0.296 9.97E-04 1434235_at Slc20a2 solute carrier family 20, member 2 BB765719 0.161 0.102 0.0010 1455445_at Cbln3 cerebellin 3 precursor protein BB800230 0.207 -0.098 0.0010 1452975_at Agxt2l1 alanine-glyoxylate aminotransferase 2-like 1 AK005060 -0.202 -0.015 0.0012 1421086_at Per3 period homolog 3 (Drosophila) NM_011067 -0.047 -0.250 0.0018 1416967_at Sox2 SRY-box containing gene 2 U31967 -0.008 0.244 0.0019 1427683_at Egr2 early growth response 2 X06746 -0.356 0.275 0.0019 1448397_at Gjb6 gap junction membrane channel protein beta 6 BC016507 -0.114 -0.148 0.0019 solute carrier family 7 (cationic amino acid 1418326_at Slc7a5 BC026131 0.033 -0.252 0.0020 transporter, y+ system), member 5 1434736_at Hlf hepatic leukemia factor
Load more

Recommended publications
  • Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Screening and identification of key biomarkers in clear cell renal cell carcinoma based on bioinformatics analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Clear cell renal cell carcinoma (ccRCC) is one of the most common types of malignancy of the urinary system. The pathogenesis and effective diagnosis of ccRCC have become popular topics for research in the previous decade. In the current study, an integrated bioinformatics analysis was performed to identify core genes associated in ccRCC. An expression dataset (GSE105261) was downloaded from the Gene Expression Omnibus database, and included 26 ccRCC and 9 normal kideny samples. Assessment of the microarray dataset led to the recognition of differentially expressed genes (DEGs), which was subsequently used for pathway and gene ontology (GO) enrichment analysis.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Hypoxia and Oxygen-Sensing Signaling in Gene Regulation and Cancer Progression
    International Journal of Molecular Sciences Review Hypoxia and Oxygen-Sensing Signaling in Gene Regulation and Cancer Progression Guang Yang, Rachel Shi and Qing Zhang * Department of Pathology, University of Texas Southwestern Medical Center, Dallas, TX 75390, USA; [email protected] (G.Y.); [email protected] (R.S.) * Correspondence: [email protected]; Tel.: +1-214-645-4671 Received: 6 October 2020; Accepted: 29 October 2020; Published: 31 October 2020 Abstract: Oxygen homeostasis regulation is the most fundamental cellular process for adjusting physiological oxygen variations, and its irregularity leads to various human diseases, including cancer. Hypoxia is closely associated with cancer development, and hypoxia/oxygen-sensing signaling plays critical roles in the modulation of cancer progression. The key molecules of the hypoxia/oxygen-sensing signaling include the transcriptional regulator hypoxia-inducible factor (HIF) which widely controls oxygen responsive genes, the central members of the 2-oxoglutarate (2-OG)-dependent dioxygenases, such as prolyl hydroxylase (PHD or EglN), and an E3 ubiquitin ligase component for HIF degeneration called von Hippel–Lindau (encoding protein pVHL). In this review, we summarize the current knowledge about the canonical hypoxia signaling, HIF transcription factors, and pVHL. In addition, the role of 2-OG-dependent enzymes, such as DNA/RNA-modifying enzymes, JmjC domain-containing enzymes, and prolyl hydroxylases, in gene regulation of cancer progression, is specifically reviewed. We also discuss the therapeutic advancement of targeting hypoxia and oxygen sensing pathways in cancer. Keywords: hypoxia; PHDs; TETs; JmjCs; HIFs 1. Introduction Molecular oxygen serves as a co-factor in many biochemical processes and is fundamental for aerobic organisms to maintain intracellular ATP levels [1,2].
    [Show full text]
  • Distinct RNA N-Demethylation Pathways Catalyzed by Nonheme Iron ALKBH5 and FTO Enzymes Enable Regulation of Formaldehyde Release Rates
    Distinct RNA N-demethylation pathways catalyzed by nonheme iron ALKBH5 and FTO enzymes enable regulation of formaldehyde release rates Joel D. W. Toha,1, Steven W. M. Crossleya,1, Kevin J. Bruemmera, Eva J. Gea, Dan Hea, Diana A. Iovana, and Christopher J. Changa,b,2 aDepartment of Chemistry, University of California, Berkeley, CA 94720; and bDepartment of Molecular and Cell Biology, University of California, Berkeley, CA 94720 Edited by Amy C. Rosenzweig, Northwestern University, Evanston, IL, and approved August 24, 2020 (received for review April 17, 2020) The AlkB family of nonheme Fe(II)/2-oxoglutarate–dependent oxy- m6A (23) is relatively stable compared to other hydroxymethyl- genases are essential regulators of RNA epigenetics by serving as containing nucleobases and has been reported to decay to the free erasers of one-carbon marks on RNA with release of formaldehyde adenosine (A) base over 10 h (22). m6A is the most prominent (FA). Two major human AlkB family members, FTO and ALKBH5, modification of messenger RNA (mRNA) (24, 25) and is installed by both act as oxidative demethylases of N6-methyladenosine (m6A) the S-adenosylmethionine–dependent METTL3/14-WTAP writer but furnish different major products, N6-hydroxymethyladenosine complex (26) and removed by two human AlkB eraser enzymes, fat (hm6A) and adenosine (A), respectively. Here we identify founda- mass and obesity-associated protein (FTO) (4) and AlkB family tional mechanistic differences between FTO and ALKBH5 that pro- member 5 (ALKBH5) (27). Internal m6A modifications control the mote these distinct biochemical outcomes. In contrast to FTO, fate of mRNA (28–32) through translation, splicing, localization, which follows a traditional oxidative N-demethylation pathway stability, and decay and are connected to cancer progression, im- to catalyze conversion of m6A to hm6A with subsequent slow mune responses, and metabolic states (27, 29, 32–36).
    [Show full text]
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
    [Show full text]
  • Potential for and Distribution of Enzymatic Biodegradation of Polystyrene by Environmental Microorganisms
    materials Communication Potential for and Distribution of Enzymatic Biodegradation of Polystyrene by Environmental Microorganisms Liyuan Hou and Erica L.-W. Majumder * Department of Chemistry, SUNY College of Environmental Science and Forestry, Syracuse, NY 13210, USA; [email protected] * Correspondence: [email protected] or [email protected]; Tel.: +1-3154706854 Abstract: Polystyrene (PS) is one of the main polymer types of plastic wastes and is known to be resistant to biodegradation, resulting in PS waste persistence in the environment. Although previous studies have reported that some microorganisms can degrade PS, enzymes and mechanisms of microorganism PS biodegradation are still unknown. In this study, we summarized microbial species that have been identified to degrade PS. By screening the available genome information of microorganisms that have been reported to degrade PS for enzymes with functional potential to depolymerize PS, we predicted target PS-degrading enzymes. We found that cytochrome P4500s, alkane hydroxylases and monooxygenases ranked as the top potential enzyme classes that can degrade PS since they can break C–C bonds. Ring-hydroxylating dioxygenases may be able to break the side-chain of PS and oxidize the aromatic ring compounds generated from the decomposition of PS. These target enzymes were distributed in Proteobacteria, Actinobacteria, Bacteroidetes, and Firmicutes, suggesting a broad potential for PS biodegradation in various earth environments and microbiomes. Our results provide insight into the enzymatic degradation of PS and suggestions for realizing the biodegradation of this recalcitrant plastic. Citation: Hou, L.; Majumder, E.L. Keywords: plastics; polystyrene biodegradation; enzymatic biodegradation; monooxygenase; alkane Potential for and Distribution of hydroxylase; cytochrome P450 Enzymatic Biodegradation of Polystyrene by Environmental Microorganisms.
    [Show full text]
  • Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-Like Mouse Models: Tracking the Role of the Hairless Gene
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 5-2006 Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene Yutao Liu University of Tennessee - Knoxville Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss Part of the Life Sciences Commons Recommended Citation Liu, Yutao, "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino- like Mouse Models: Tracking the Role of the Hairless Gene. " PhD diss., University of Tennessee, 2006. https://trace.tennessee.edu/utk_graddiss/1824 This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a dissertation written by Yutao Liu entitled "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene." I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Doctor of Philosophy, with a major in Life Sciences. Brynn H. Voy, Major Professor We have read this dissertation and recommend its acceptance: Naima Moustaid-Moussa, Yisong Wang, Rogert Hettich Accepted for the Council: Carolyn R.
    [Show full text]
  • The Extracellular Matrix Phenome Across Species
    bioRxiv preprint doi: https://doi.org/10.1101/2020.03.06.980169; this version posted March 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. The extracellular matrix phenome across species Cyril Statzer1 and Collin Y. Ewald1* 1 Eidgenössische Technische Hochschule Zürich, Department of Health Sciences and Technology, Institute of Translational Medicine, Schwerzenbach-Zürich CH-8603, Switzerland *Corresponding authors: [email protected] (CYE) Keywords: Phenome, genotype-to-phenotype, matrisome, extracellular matrix, collagen, data mining. Highlights • 7.6% of the human phenome originates from variations in matrisome genes • 11’671 phenotypes are linked to matrisome genes of humans, mice, zebrafish, Drosophila, and C. elegans • Expected top ECM phenotypes are developmental, morphological and structural phenotypes • Nonobvious top ECM phenotypes include immune system, stress resilience, and age-related phenotypes 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.06.980169; this version posted March 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. 1 Abstract 2 Extracellular matrices are essential for cellular and organismal function. Recent 3 genome-wide and phenome-wide association studies started to reveal a broad 4 spectrum of phenotypes associated with genetic variants. However, the phenome or 5 spectrum of all phenotypes associated with genetic variants in extracellular matrix 6 genes is unknown.
    [Show full text]
  • Polymorphic Human Sulfotransferase 2A1 Mediates the Formation of 25-Hydroxyvitamin
    Supplemental material to this article can be found at: http://dmd.aspetjournals.org/content/suppl/2018/01/17/dmd.117.078428.DC1 1521-009X/46/4/367–379$35.00 https://doi.org/10.1124/dmd.117.078428 DRUG METABOLISM AND DISPOSITION Drug Metab Dispos 46:367–379, April 2018 Copyright ª 2018 by The American Society for Pharmacology and Experimental Therapeutics Polymorphic Human Sulfotransferase 2A1 Mediates the Formation of 25-Hydroxyvitamin D3-3-O-Sulfate, a Major Circulating Vitamin D Metabolite in Humans s Timothy Wong, Zhican Wang, Brian D. Chapron, Mizuki Suzuki, Katrina G. Claw, Chunying Gao, Robert S. Foti, Bhagwat Prasad, Alenka Chapron, Justina Calamia, Amarjit Chaudhry, Erin G. Schuetz, Ronald L. Horst, Qingcheng Mao, Ian H. de Boer, Timothy A. Thornton, and Kenneth E. Thummel Departments of Pharmaceutics (T.W., Z.W., B.D.C., M.S., K.G.C., C.G., B.P., Al.C., J.C., Q.M., K.E.T.), Medicine and Kidney Research Institute (I.H.d.B.), and Biostatistics (T.A.T.), University of Washington, Seattle, Washington; Department of Pharmacokinetics and Drug Metabolism, Amgen Inc., South San Francisco, California (Z.W.); Department of Pharmacokinetics and Drug Metabolism, Amgen Inc., Cambridge, Massachusetts (R.S.F.); St. Jude Children’s Research Hospital, Memphis, Tennessee Downloaded from (Am.C., E.G.S.); and Heartland Assays LLC, Ames, Iowa (R.L.H.) Received September 1, 2017; accepted January 10, 2018 ABSTRACT dmd.aspetjournals.org Metabolism of 25-hydroxyvitamin D3 (25OHD3) plays a central role in with the rates of dehydroepiandrosterone sulfonation. Further analysis regulating the biologic effects of vitamin D in the body.
    [Show full text]
  • Transcriptomic Characterization of Fibrolamellar Hepatocellular
    Transcriptomic characterization of fibrolamellar PNAS PLUS hepatocellular carcinoma Elana P. Simona, Catherine A. Freijeb, Benjamin A. Farbera,c, Gadi Lalazara, David G. Darcya,c, Joshua N. Honeymana,c, Rachel Chiaroni-Clarkea, Brian D. Dilld, Henrik Molinad, Umesh K. Bhanote, Michael P. La Quagliac, Brad R. Rosenbergb,f, and Sanford M. Simona,1 aLaboratory of Cellular Biophysics, The Rockefeller University, New York, NY 10065; bPresidential Fellows Laboratory, The Rockefeller University, New York, NY 10065; cDivision of Pediatric Surgery, Department of Surgery, Memorial Sloan-Kettering Cancer Center, New York, NY 10065; dProteomics Resource Center, The Rockefeller University, New York, NY 10065; ePathology Core Facility, Memorial Sloan-Kettering Cancer Center, New York, NY 10065; and fJohn C. Whitehead Presidential Fellows Program, The Rockefeller University, New York, NY 10065 Edited by Susan S. Taylor, University of California, San Diego, La Jolla, CA, and approved September 22, 2015 (received for review December 29, 2014) Fibrolamellar hepatocellular carcinoma (FLHCC) tumors all carry a exon of DNAJB1 and all but the first exon of PRKACA. This deletion of ∼400 kb in chromosome 19, resulting in a fusion of the produced a chimeric RNA transcript and a translated chimeric genes for the heat shock protein, DNAJ (Hsp40) homolog, subfam- protein that retains the full catalytic activity of wild-type PKA. ily B, member 1, DNAJB1, and the catalytic subunit of protein ki- This chimeric protein was found in 15 of 15 FLHCC patients nase A, PRKACA. The resulting chimeric transcript produces a (21) in the absence of any other recurrent mutations in the DNA fusion protein that retains kinase activity.
    [Show full text]
  • Pulmonary Fibrosis Associated with TINF2 Gene Mutation: Is Somatic Reversion Required?
    Pulmonary fibrosis associated with TINF2 gene mutation: is somatic reversion required? To the Editor: We read with great interest the case reported by FUKUHARA et al. [1] of a 43-year-old female patient with dyskeratosis congenita, pulmonary fibrosis and heterozygous mutation in TINF2 (telomerase repeat binding factor 1-interacting nuclear factor 2). TIN2, the TINF2 gene product, TERT (telomere reverse transcriptase) and TERC (telomerase RNA component) participate in the regulation of telomere elongation, in which mutations have been previously found to be associated with familial pulmonary fibrosis in adults [2]. Indeed mutations of SFTPC, coding for surfactant protein C, were initially described in children before being described in adults as old as 72 years of age who presented with familial pulmonary fibrosis [3]. However, we were surprised that a TINF2 mutation could be evidenced in an adult of that age. As highlighted by FUKUHARA et al. [1], patients with the TINF2 mutation present with severe haematological symptoms before 10 years of age [4]. As mentioned by FUKUHARA et al. [1], the identified mutation is probably not hypomorphic because it is a frame-shift deletion located in the mutational ‘‘hot spot’’ described previously. Furthermore, the patient presented with very short telomeres. The TINF2 mutation was probably inherited from her father because he had abnormal skin pigmentation and aplastic anaemia [1]. Re-analysis of the gene mutation sequencing could provide new hypotheses for this late disease onset. Indeed, the electrophoregram depicted in figure 1b in the study by FUKUHARA et al. [1] probably comes from a PCR product sub-cloned into an expression vector [5], and does not ensure that the deletion is at the heterozygous status usually seen in our patients (fig.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]