CONSTRUCTION AND CHARACTERIZATION OF CYANOBACTERIAL BIOREPORTERS TO ASSESS NUTRIENT (P, FE) AVAILABILITY IN MARINE ENVIRONMENTS
Ramakrishna B. Boyanapalli
A Dissertation
Submitted to the Graduate College of Bowling Green State University in partial fulfillment of the requirements for the degree of
DOCTOR OF PHILOSOPHY
August 2006
Committee:
R. Michael L. McKay, Advisor
Michael A. J. Rodgers Graduate Faculty Representative
George Bullerjahn
Ray Larsen
Paul F. Morris
Neocles Leontis ii
ABSTRACT
R Michael L. McKay, Advisor
Nutrient deficiency especially phosphorus (P) and iron (Fe), are well documented in world oceans, particularly associated with oligotrophic oceanic gyres and “high nutrient, low chlorophyll” (HNLC) regions. As a corresponding approach to identify bioavailable Fe in marine
systems, my research has focused on the development, characterization and implementation of a
whole-cell cyanobacterial Fe bioreporter to be used to assess the bioavailability of Fe in marine
environments.
A Fe responsive whole-cell marine bioreporter was developed by integrating a construct
of the isiAB promoter fused to bacterial luciferase luxAB into the marine cyanobacterium
Synechococcus PCC 7002. Dose-response characterization of the bioreporter was made in trace-
metal buffered synthetic seawater medium containing Fe concentrations in the range of pFe [-log
(Fe3+ free ferric)] 19.4 – 22.4. The luminescent response from the Fe bioreporter was best
described by a sigmoidal dose-response curve. A comprehensive growth and physiological
characterization of the bioreporter was conducted prior to implementing it to assess Fe
bioavailability from various marine samples. The bioreporters response was optimum when it
was incubated at 25 °C under an irradiance of 45 µmol photon m-2 s -1. Varying the amount of
bioreporter inoculum or salinity of the test medium did not affect cellular luminescence over the
12 h assay period. Testing the ability of the bioreporter to acquire Fe3+ bound to ligands, the
bioreporter was able to acquire bound Fe from rhodotorulic acid but, was unable to acquire Fe
from ligands such as desferrioxamine B and N, N’-diethylenediamine-N,N’-diacetic acid. iii
We assessed Fe availability in environmental samples from the Baltic Sea using the
cyanobacterial bioreporter and demonstrated that the bioavailable Fe was one order of magnitude
lower than the chemically-determined dissolved Fe and that samples from depth showed higher
available Fe than at the surface. The Fe bioreporter was also implemented for assessing available
Fe in samples collected during the mesoscale Fe fertilization experiment SERIES conducted in
the HNLC eastern subarctic Pacific Ocean, and in samples collected from oligotrophic waters of
the central north Pacific gyre during the ROMP study. The luminescent response from these open ocean samples was consistently higher than the corresponding calibration standard. As a result, the cyanobacterial Fe bioreporter can only be considered a qualitative tool with which to assess Fe availability in open ocean environments. Despite this constraint, we observed genuine differences in Fe availability from samples collected during each study.
iv
ACKNOWLEDGEMENTS
It is a great privilege to thank all the people who made this achievement possible. First of all, I would like to thank my advisor, Dr. Robert Michael L. McKay for his impeccable leadership and patience. His guidance gave me a wonderful opportunity to grow intellectually and personally, I would like to thank the members of my Ph. D. committee: Dr. George S.
Bullerjahn, Dr. Ray A. Larsen, Dr. Neocles B. Leontis and Dr. Michael A. J. Rodgers for their support and advice on my research project. I also thank Dr. Bullerjahn for his generous help all along my degree. His guidance was critical to complete my research work. I also like to thank
Dr. Larsen for his valuable suggestions.
I would like to thank all the past and present lab members of Dr. McKay and Dr.
Bullerjahn notably: Dr. Porta, Dr. Durham, Dr. Xia, Dr. Vintonenko, Dr. Myshkin, Dr. Popels,
Mamoon, Natalia, Audrey, Maria, Robyn, Irina, Tami, and Korrina who helped me in many ways. I wish to acknowledge the assistance of Captain Murray Stein and his crew, and Dr. Tracy
A. Villareal the chief scientist on the R/V “New Horizon” and also Dr. Phil W. Boyd, chief scientist of the SERIES cruise.
I would like to extend my gratitude to Dr. Stan Smith, Lorraine, Deb, Chris, Linda, Steve and everyone in the office and stock room of Department of Biological Sciences for their patience and help throughout my studies at BGSU. Special thanks to Writers Lab at BGSU for their help. Also my thanks to friends Vijay, Arun, Kamal, Prashanth, John, and all others for their encouragement, humor and support.
Last, but not least, my family, especially my wife Ruby, parents Rudrama Devi and
Pattabhi Rama Rao, brother Rakesh and sister Anupama without their support and encouragement I would not have made it to this extent. v
TABLE OF CONTENTS
Page
CHAPTER I. INTRODUCTION...... 1
1.1. Fe deficiency in cyanobacteria...... 3
1.2. The Fe Hypothesis ...... 4
1.2.1. Mesoscale In situ Fe Fertilization Experiments...... 5
1.3. The Microbial Ferrous Wheel...... 6
1.4. Current tools available to analyze bioavailable Fe ...... 8
1.5 Microbial Bioreporters...... 9
1.5. l. Advantages and limitations of bioreporters...... 11
1.6. Bioreporters to analyze bioavailable Fe...... 11
1.7. Overview of the Research...... 13
CHAPTER II. DEVELOPMENT OF A LUMINESCENT WHOLE-CELL
CYANOBACTERIAL BIOREPORTER FOR MEASURING IRON AVAILABILITY IN
MARINE ENVIRONMENTS...... 16
1. Introduction...... 16
2. Materials and Methods...... 18
2. 1. Media and growth conditions...... 18
2. 2. Construction of pMBB, an insertional promoter probe vector for Synechococcus
PCC 7002...... 19
2. 3. Construction of Fe bioreporter BMB04...... 21
2. 4. Characterization of strain BMB04 as a Fe-responsive bioreporter...... 22
2. 5. Effect of Fe chelators on bioreporter response ...... 23 vi
Page
2. 6. Bioreporter response to oxidative stress ...... 24
2. 7. Assessment of bioavailable Fe in field samples using the bioreporter ...... 24
3. Results and Discussion ...... 29
3. 1. Growth of wild type vs. bioreporter strains ...... 29
3. 2. Assessment of delivery of aldehyde substrate to the bioreporter ...... 29
3. 3. Non-steady state response of the bioreporter to varying free [Fe3+]...... 30
3. 4. Influence of biotic and abiotic factors on the bioreporter luminescent response.34
3. 4. 1. Incubation time ...... 34
3. 4. 2. Temperature ...... 34
3. 4. 3. Growth irradiance ...... 35
3. 4. 4. Macronutrient status...... 35
3. 4. 5. Influence of initial biomass...... 36
3. 4. 6. Salinity ...... 36
3. 5. Effect of Fe chelators on bioreporter response ...... 37
3. 6. Bioreporter response to oxidative stress ...... 38
3. 7. Use of the bioreporter to assess Fe bioavailability in the Baltic Sea...... 42
3. 8. Caveats to Consider in Using the Cyanobacterial Fe Bioreporter ...... 44
CHAPTER III. APPLICATION OF THE BIOREPORTER TO OLIGOTROPHIC OCEAN
ENVIRONMENTS...... 47
1. Introduction...... 47
1.1. Picophytoplankton in the Oligotrophic Ocean...... 47
1.2. The HNLC Subarctic Pacific ...... 48 vii
Page
1.3. The LNLC Central North Pacific Gyre...... 49
2. Materials and Methods...... 52
2.1. Subarctic Ecosystem Response to Iron Enrichment Study (SERIES): Eastern
Subarctic Pacific ...... 52
2.1.1. Site selection and Fe enrichment ...... 52
2.1.2. Monitoring the patch...... 52
2.1.3. Sampling techniques employed ...... 54
2.2. Rhisosolenia Mats in the Pacific (RoMP): Central North Pacific Gyre Fe
deficiency in cyanobacteria...... 54
2.2.1. Sample site...... 52
2.2.2. Sampling ...... 54
2.3. Bioreporter analysis Fe deficiency in cyanobacteria ...... 56
3. Results and Discussion ...... 58
3. 1. Subarctic Ecosystem Response to Iron Enrichment Study (SERIES): Eastern
Subarctic Pacific ...... 58
3.1.1. SERIES Overview ...... 59
3.1.2. Assessment of bioavailable Fe using the Fe Bioreporter BMB04.... 59
3. 2. Rhisosolenia Mats in the Pacific (RoMP): Central North Pacific Gyre ...... 63
3.2.1. RoMP Overview ...... 63
3.2.2. Assessment of bioavailable Fe using the Fe Bioreporter BMB04.... 65
4. Conclusion ...... 70
REFERENCES ...... 71 viii
Page
APPENDIX 1. Development of a marine P bioreporter...... 94
1. Introduction...... 94
1.1. Current tools available to monitor bioavailable P...... 96
1.2. Bioreporters to analyze bioavailable P ...... 96
2. Materials and Methods...... 97
2.1. Media and growth conditions...... 97
2.2. Construction of a marine P bioreporter...... 98
2.3. Bioreporter response to P deficiency ...... 98
3. Results and Discussion ...... 100
3.1. Growth of wild type vs. bioreporter strains ...... 100
3.2. Luminescence response of the bioreporter to external P status ...... 100
3.3. Study of the phoH promoter ...... 100
APPENDIX II. Medium A Composition...... 102
ix
LIST OF TABLES
Table Page
1. Details of in situ Fe enrichment experiments in HNLC waters: 1993 – 2004...... 6
2. Characteristics of some bioreporters employed in environmental biotechnology...... 12
3. Various Fe bioreporters available and their properties...... 14
4. Primers used in this study to amplify various sequences...... 21
5. Physical, chemical and physiological parameters for the Fe bioreporter usage ...... 23
6. Physio-chemical characteristics of Baltic Sea hydrographic stations...... 26
7. Luminescence of BMB04 in response to the Fe chelators...... 40
8. Primers used to amplify pphoH (phoH promoter) ...... 99
9. Medium A composition ...... 102
x
LIST OF FIGURES
Figure Page
1. Map showing the locations of in situ Fe enrichment experiments...... 10
2. Bioreporter responding to an external analyte such as Fe ...... 10
3. Vector and constructs prepared for the design of bioreporter...... 20
4. Map showing The Baltic Sea: stations IOW- 213 and IOW- 271...... 27
5. Conductivity-temperature-depth (CTD) and oxygen (solid dots) cast of the station 271 of the
Baltic Sea...... 28
6. Luminescent response of the bioreporter in varying concentrations of decanal...... 32
7. Standard dose-response curve of bioreporter luminescence measured after 12 hr of
incubation ...... 33
8. Temporal response of luminescence of the bioreporter grown in Medium A ...... 33
9. Influence of biotic and abiotic factors on the Fe bioreporter after incubating for 12 hrs..... 40
10. Effect of oxidative stress on the Fe bioreporter (A and B)...... 41
11. Water column profile of dissolved Fe and pFe, assessed by the Fe bioreporter, at Station
IOW 271 (Gotland Deep) in the Baltic Sea...... 45
12. Map showing the region and sampling sites of the SERIES experiment (A, B and C)...... 53
13. Dose-response curve of the bioreporter derived using synthetic Medium A of known Fe
concentration conveyed as pFe ...... 60
14. Bioreporter response plotted with measured concentrations of DFe...... 61
15. Stations sampled for this study. Stations numbers in bold are 2003 ...... 64
16. Contour plots of nitrate and chlorophyll distributions from Sta. 1 –12...... 64
xi
Page
17. Alkaline phosphatase activity in Ethmodiscus, Pyrocystis and Trichodesmium along the
transect ...... 67
18. Bioreporter response to standards and samples (n = 3) (A and B) ...... 68
19. Restriction digestion on pMBB + PphoH ...... 99
20. Bar graph showing the luminescent response of the P bioreporter grown in P replete and P
deplete Medium A...... 101 1
CHAPTER I. INTRODUCTION
Besides their overall importance to global primary production, phytoplankton contribute
to the biogeochemical cycling of nutrients in aquatic environments. In oligotrophic marine
ecosystems, picoplankton (0.2 – 2 µm), especially the cyanobacteria Synechococcus and
Prochlorococcus, are the dominant members of the phytoplankton community (Partensky et .al.,
1996; Johnson et al. 2006). Picoplankton standing crop in turn is regulated by both “top down”
and “bottom up” factors. “Top down” control is regulated by grazing (Strom et al. 2000) as well
as loss due to viral lysis (Wilhelm and Suttle, 1999). “Bottom up” factors are more
biogeochemical in nature and largely revolve around limitation by nutrients, both macro-
(Scanlan et al. 1999) and micronutrients (McKay et al. 2004). Unlike freshwater ecosystems where limitation by phosphorus (P) is common, marine ecosystems are generally limited by nitrogen (N) (Smith, 1984), despite the ability of some organisms to fix dinitrogen, which can be replaced from the atmosphere. The low occurrence of diazotrophic activity in marine environments may actually result from low availability of iron (Fe) (Mills et al. 2004) due to the
high Fe demand of N-reducing enzymes (nitrogenase, nitratre- and nitrite reductase) and the
requirement of Fe-containing reductant in the form of ferredoxin (Raven, 1988). Thus, low Fe
availability may ultimately constrain the ability of phytoplankton to acquire N in marine
environments. Fe is also essential to photosynthesis, serving as an important redox catalyst
(Raven et al. 1999). Yet Fe is in low supply in most marine systems, despite its abundance as a
key crustal element. This is due to several factors including the low solubility of ferric ion in
oxic waters and the low supply rate of Fe from aeolian dust to many oceanic locations (Fung et
al. 2000; Jickells et al. 2005). As such, in an environmental context, Fe is arguably the most 2 important micronutrient regulating phytoplankton growth and production. This in turn carries implications for global carbon cycling and may indirectly influence climate change. Scientists hypothesize that enhanced flux of Fe into the glacial oceans promoted sequestration of atmospheric carbon through elevated rates of photosynthesis and was perhaps responsible for ca.
50% of the decrease in atmospheric CO2 measured from ice cores that span glacial-interglacial periods (Simon et al. 2004).
Cognizant of the importance of essential nutrients in biological systems, scientists have developed a myriad of chemical approaches to measure the abundance of nutrients in the environment. Yet the chemical approaches that are most commonly adopted are frequently impaired when addressing the issue of nutrient bioavailability. The availability of key nutrients such as Fe could be better understood if a biological system were to be used to estimate nutrient supply. In particular, recent strategies to use genetically altered prokaryotic organisms as biological reporter systems represent powerful tools to assess the bioavailability of a chemical compound (Bachmann, 2003; Belkin, 2003). The recent development of freshwater cyanobacterial bioreporters to assess the availability of Fe (Durham et al. 2002), P (Schreiter et al. 2001) and N (Gillor et al. 2003; Ivanikova et al. 2005) has been met with a great deal of interest by aquatic scientists due to the ability of these tools to offer insight into the availability of an element from the perspective of an important member of the endemic phytoplankton community. Cyanobacteria are a natural choice for such reporter organisms. They are ecologically important and amenable to genetic manipulation and have thus served as model organisms for studies of photosynthesis and other metabolic processes. Further, several strains have been the subject of genome sequencing projects, thus nutrient stress responses are well known. 3
1.1. Fe deficiency in cyanobacteria
Fe in cyanobacteria serves as an essential redox component important to diverse
metabolic pathways. Fe-rich systems in cyanobacteria such as the photosynthetic apparatus and
the respiratory electron transport system are dependent on Fe supply (Raven et al. 1999). Other
important cellular processes such as nitrogen assimilation (Raven, 1988), ribonucleotide
synthesis, chlorophyll synthesis and oxygen radical detoxification are also Fe dependent.
Prokaryotes, including cyanobacteria, have developed several strategies to enhance
survival during periods of Fe deficiency. Some of these include the release of internal Fe stores
contained within proteins such as bacterioferritin (Keren et al. 2004), the production of ferric ion
scavenging molecules known as siderophores (Wilhelm, 1995), and the substitution of Fe
dependent catalysts with isofunctional proteins that do not require Fe (McKay et al. 2004). In
gram negative bacteria and bacteria with chromosomes low in GC content, many of the genes
activated in response to Fe deficiency are globally regulated by the transcriptional repressor Fur
(ferric uptake regulator). Under Fe replete conditions, Fe2+ serves as a coregulator of Fur,
promoting binding of Fur to a consensus sequence (FUR box) on the operator region of Fe-
regulated genes. Fur binding effectively prevents the binding of RNA polymerase and subsequent transcription of these genes (Ochsner and Vasil, 1996). The cyanobacterial Fur homolog controls a regulon which includes genes involved in siderophore production
(Ghassemian and Straus, 1996), the induction of flavodoxin for substitution of ferredoxin in the
photosynthetic electron transport chain, and the production of a novel Fe stress-specific PS I
binding protein IsiA, which forms an 18 mer around PSI to protect it from photooxidation (Bibby
et al. 2001).
4
1.2. The Fe Hypothesis
By the late 1980’s the global scientific community had already been expressing concerns over the potential climatic consequences due to the continued release of carbon dioxide (CO2) into the atmosphere. Annual emissions of 7 billion tons of CO2 from human generated activities
surpass available carbon sinks by several billion tons. Influenced by work reported over a half-
century earlier (Gran, 1931; Hart, 1934), the late John Martin, then Director of the Moss Landing
Marine Lab, hypothesized that phytoplankton production in large expanses of the world oceans
was constrained by low availability of Fe. In July 1988, comments he made during a seminar at
the Woods Hole Oceanographic Institute sparked a debate that continues to this day over the role
of Fe in ocean productivity and community structure. (Martin, 1990; Chisholm and Morel, 1991)
In particular, his comment “with half a ship load of Fe, I could give you an ice age'' has lead to
an examination of the potential for Fe fertilization of the oceans as part of a geoengineering
scheme to mitigate increasing atmospheric CO2 emissions.
Martin speculated that adding 0.3 million tons of the trace metal Fe into the Southern
Ocean would be enough to stimulate the biological carbon pump to sequester 2 billion tons of
CO2 (Martin, 1990). However, until the late 1980’s, the hypothesis was unable to be properly
tested as trace metal clean protocols had not yet been widely adopted among oceanographers.
Once these techniques were adopted and along with the availability of low sensitivity analytical
tools, the Fe hypothesis was tested using bottle experiments conducted with water sampled from
the Southern Ocean (Martin et al. 1990a; 1990b). “With these events, the Fe age in
oceanography had begun.” (de Baar et al. 2005).
5
1.2.1. Mesoscale In situ Fe Fertilization Experiments
Regions of the eastern equatorial Pacific, the ice-free Southern Ocean, and the open subarctic north Pacific, which together constitute >20 % of the world oceans, are reported to
support low chlorophyll biomass despite the presence of abundant macronutrients (de Baar et al.
2005). These regions are characterized as “high-nutrient, low chlorophyll” (HNLC). Stimulation
of phytoplankton growth in Fe-amended seawater from HNLC regions identified Fe as the
growth-limiting nutrient in these areas (Chisholm and Morel, 1991; Martin, 1994; de Baar et al.
2005). However, the on-deck incubation experiments do not necessarily extrapolate to the natural ecosystem. For example, bottle enrichment assays interrupt mixing and light gradients, disrupt grazing and increases in phytoplankton biomass may yield altered water chemistry over the long duration (24 h or more) of the assay (Carpenter, 1996).
To place more confidence in the results from laboratory incubation experiments,
mesoscale in situ Fe fertilizations of whole ecosystems were proposed as a direct test of the Fe
Hypothesis (Martin, 1992). The use of an ultra-trace inert gas, sulfur hexafluoride (SF6), as a
tracer compound made it possible to mark and track a patch of water over a period of days to weeks (Martin et al. 1994).
The first in situ Fe fertilization experiment, IronEx-1, was conducted in October 1993
2 where 7800 mol of Fe together with 0.35 mol of SF6 were introduced over a 64 km patch of
surface waters of the east equatorial Pacific. Within 72 h following Fe enrichment, significant
increases in several algal physiological indices were observed (Martin et al. 1994; Kolber et al.
1994) as was a modest decrease of fugacity of carbon dioxide (fCO2). However, the
phytoplankton response was muted due to subsequent dilution of the patch as it became
subducted beneath a denser water mass by day 3 of the study. In 1995 a second mesoscale 6
Fe enrichment experiment, IronEx -2, was conducted in the same general location but with
multiple infusions of Fe. Promising results from IronEx – 1 & 2 have led to a suite of nine such
experiments (Table 1) in HNLC waters around the globe (Fig. 1) (de Baar et al. 2005).
1.3. The Microbial Ferrous Wheel
It is now well established that microbial communities are integral components of the complex foodwebs of pelagic oceanic waters (DeLong et al. 2006). Microbial communities involved in transformation of carbon (carbon cycling) through grazing, bacterial particle solubilization, and virus-mediated cell lysis, influence the elemental composition of biogenic particulates. In spite of the importance of microbial communities, little is known about how
microbes influence the biogeochemical cycling of trace elements such as Fe (Kirchman, 1996).
Table 1. Details of in situ Fe enrichment experiments in HNLC waters: 1993 – 2004.
No. Acronym Region Latitude. ° Longitude. ° Month(s) Year
1 IronEx-11,2 East equatorial Pacific Ocean −05 −09 10, 11 1993 2 IronEx-23,4 East equatorial Pacific Ocean −04 to −07 −105 to −111 5, 6 1995 3 SOIREE5 Southern Ocean (Australian sector) −61 140 2 1999 4 EisenEX6 Southern Ocean (Australian sector) −48 021 11, 12 2000 5 SEEDS7 Subarctic Northwest Pacific Ocean 49 65 7 2001 6 SOFeX-North8 Southern Ocean (Pacific sector) −56 −172 1, 2 2002 7 SOFeX-South8 Southern Ocean (Pacific sector) −66 −172 1, 2 2002 8 SERIES9 Subarctic Northeast Pacific Ocean 50 −145 7 2002 9 FeCycle10 Subantarctic Pacific Ocean −46 −178 1, 2 2003 10 EIFEX Southern Ocean −50 002 2, 3 2004 a GreenSea 1 Gulf of Mexico 1 1998 b GreenSea 2 Gulf of Mexico 5 1998 1Martin et al. 1994; 2Kolber et al. 1994, 3Coale et al. 1996; 4Behrenfeld et al. 1996;
5Boyd et al. 2000; 6Gervais et al. 2002; 7Tsuda et al. 2003; 8Coale et al. 2004; 9Boyd et
10 al. 2004; Boyd et al. 2005a 7
Various studies conducted in HNLC regions have suggested that up to 50% of primary productivity may be limited by the biological availability of Fe (Moore et al. 2002).
The microbial foodweb is characterized by a tight coupling between prey (both heterotrophs and autotrophs) and predators (microzooplankton) that probably accounts for the constancy of algal stocks within Fe-limited HNLC waters (Strom et al. 2000). Reflecting this tight coupling, the high demand and recycling of Fe within the microbial foodweb has been referred to as the ‘‘Ferrous Wheel’’ (Kirchman, 1996). Indeed it is important to better understand the biogeochemical Fe cycle for concomitant estimates of the pools and fluxes of new versus recycled Fe. Such estimates for the ‘‘Ferrous Wheel’’ also require an assessment of all kinds of planktonic predators such as grazers and viruses in Fe cycling. Regeneration of Fe from phytoplankton represents an important nutrient flux in oligotrophic regions (Hutchins et al.
1993). Both grazing and viral lysis (Gobler et al. 1997; Poorvin et al. 2004) have been demonstrated to mediate the regeneration of Fe from phytoplankton. Considering a regeneration efficiency ([Fe excreted/Fe ingested] × 100) approximating 70% for grazing by mixotrophic nanoflagellates (Maranger et al. 1998) and heterotrophic microflagellates (Chase and Price,
1997) and between 75 and 95% for metazoan grazers (Hutchins et al. 1995), grazing mediated regeneration of Fe is expected to contribute substantially to the cycling of Fe in the oligotrophic ocean.
Over much of the past decade, biological oceanographers have been trying to understand the microbial influence on Fe cycling in the world oceans. Recent reports have demonstrated that in subantarctic (SA) waters, prokaryotes dominated carbon biomass and constitute the largest biogenic pool of Fe (>90%; McKay et al. 2005a; Strzepek et al. 2005). These results are qualitatively similar to the pelagic budget calculations for northeastern subarctic Pacific HNLC 8 waters and the northern Sargasso Sea (Goericke and Welschmeyer, 1993; Mann et al. 2003;
Harrison et al. 2004; Boyd et al. 2005a). However, Strzepek et al. (2005) recently demonstrated that the total biogenic Fe pool for HNLC SA waters during the FeCycle study was 3.5 to 6.8 times larger than for the northeast Pacific and approximately double that reported for the oligotrophic Sargasso Sea (Tortell et al. 1999). The biogenic Fe pool estimated during FeCycle was also reported to be ca.4-fold larger than that measured during the SOIREE mesoscale Fe enrichment conducted in polar HNLC waters (Boyd et al. 2000; Boyd et al. 2005b). The major reason for this difference between the budget derived during FeCycle and previous calculations from other HNLC systems was the high Synechococcus biomass observed during the former
(Strzepek et al. 2005), which was approximately 10-fold greater than that of the northeastern
Pacific and Sargasso Sea (Tortell et al. 1999). Overall, the microbial foodweb is responsible for rapid regeneration of Fe in the upper ocean and between 30 - 100% of biological Fe demand is met by grazer mediated Fe regeneration.
1.4. Current tools available to analyze bioavailable Fe
Although current analytical methods allow for the measurement of Fe in seawater, they provide little information regarding the bioavailability of various complexed organic species of
Fe to phytoplankton and bacteria. Alternative approaches to assessing bioavailability such as microcosm (bottle)nutrient amendment studies can introduce artifacts that may confound interpretation of results.
To overcome these concerns, a number of “molecular” approaches have been suggested such as monitoring the expression of Fe-responsive genes in environmental samples (e.g. Geiβ et al. 2001; 2004), measuring the ratios of the redox catalysts ferredoxin (Fd): flavodoxin (Xia et 9
al. 2004) and assaying variable chlorophyll fluorescence (Geider and La Roche, 1994).
Implementing a living system such as a bioreporter organism might help us gain a better understanding of the availability of Fe from the perspective of a living cell.
1.5. Microbial Bioreporters
Bioreporters can be effective research tools for gaining an understanding of a
microorganisms perception of its environment. A cell is transformed with a fusion of an
inducible promoter to a suitable reporter gene such that the organism is able to communicate its
metabolic or transcriptional behavior thereby reporting with information on the chemical,
physical or biological properties of its immediate surroundings (Daunert et al. 2000; Leveau and
Lindow, 2002; Bachmann, 2003; Belkin, 2003).
Based on the molecular recognition of the promoter, the method of recognition transduced into a measurable signal and the parameters that are sensed, Van der Meer et al.
(2004) have categorized bioreporters into three groups: Class I, in which the bioreporters react specifically to (a) target compound(s) by increasing the output signal; Class II, in which the bioreporter reacts to general stress conditions by an increase in the output signal; and Class III, in which the bioreporter reacts nonspecifically to compound(s) or stress(es) by a decrease in the output signal (Fig. 2).
Since the first scientific reports describing a bioreporter by King et al (1990), the use of whole cell bioreporters has increased enormously from simply detecting promoter activity to an independent research area covering many different aspects of both genetic engineering and environmental microbiology (Table 2) (Van der Meer et al. 2004).
10
Figure 1. Map showing the locations of in situ Fe enrichment experiments. (from de
Baar et al. 2005)
Figure 2. Bioreporter responding to an external analyte such as Fe. A. Analyte can inhibit at any step of reaction resulting in reduction or elimination of reporter signal;
B. Some analytes can induce and activate the reaction. (from Belkin, 2003)
11
1.5.1. Advantages and limitations of bioreporters
Characteristics of bioreporters vary depending on the experimental conditions and detection methods employed. The choice of reporter genes depends on factors such as expression efficiency, stability, background activity, detection method and assay methodology (Daunert et al. 2000). Advantages of using bioreporter technology in environmental monitoring are sensitivity, selectivity and stability, all of which provide ideal conditions to assay environmental samples. Another important advantage is their ability to provide physiological information pertaining to the whole cell, which is not possible with methods involving cell extracts.
Implementing the use of bioreporters can be a cost-effective, simple, and environmentally- friendly process, which facilitates on-site monitoring (Van der Meer et al. 2004). Limitations of bioreporters include concerns pertaining to their ecological relevance to a given system as well as situations where the analyzed compound may interact with extracellular material and alter the chemistry of an environmental sample (Harms et al. 2006). Therefore, when choosing a bacterial reporter strain, it is vital to consider various environmental factors to design an informative bioreporter.
1.6. Bioreporters to analyze bioavailable Fe
To date, only two Fe-responsive marine bioreporters have been reported. Firstly, a transgenic Phaeodactylum tricornutum, a marine diatom, was designed to study the perception of environmental signals (Falciatore et al. 2000). The expression of the reporter protein, aequorin, was in response to physicochemical changes in the extracellular environment such as Fe concentration, using signaling systems based on fluctuations in cytoplasmic calcium 12 ental biotechnology. employed in environm 2004)
(from van der Meer et al. Meer van der (from Table 2. Characteristics of some bioreporters 13
concentrations. Under appropriate conditions, the bioreporter can be considered as responsive to
Fe. Of the various nutrient stresses assessed, the reporter gene was expressed only in response to
Fe deficiency. Although the P. tricornutum bioreporter appears to respond to Fe deficient
conditions, this particular reporter would not be suitable for quantitative assessment or
environmental monitoring since the threshold of reporter gene expression was at a substantially higher [Fe] compared to the low Fe conditions reported in most marine environments.
Secondly, a heterotrophic halotolerant bacterium, Pseudomonas putida, has been used to design a Fe bioreporter for marine waters (Mioni et al. 2003). This bioreporter was designed by
introducing the promoter of an operon containing genes fepA - fes responsible for siderophore
transport and dissociation of Fe from siderophores, respectively. The operon is induced upon
exposure to Fe deficiency and is regulated by Fur binding to FUR consensus sequences in the
promoter. Fe availability as measured by this bioreporter is based on the luminescent response of
the reporter obtained when Fe is titrated from the sample using the trihydroxamate fungal
siderophore, desferrioxamine B.
There are several additional non-marine Fe bioreproters that have been designed either
for environmental monitoring or to gain a better understanding of the process of transcriptional
regulation (Table 3). All of the bioreporters developed are Fe-regulated promoter fusions
upstream to a promoterless reporter gene. Notably absent from this list of Fe-responsive
bioreporters is a representative cyanobacterial strain which would be useful as a proxy to assess
Fe availability in marine environments where the picocyanobacteria are frequently dominant
among photoautotrophs.
14
1.7. Overview of the Research
Numerous reports in recent years have demonstrated that Fe deficiency is widespread,
particularly associated with oligotrophic oceanic gyres and HNLC regions (Singler and Villareal,
2005; Wu et al. 2001; Behrenfeld and Kolber, 1999; Martin and Fitzwater, 1988; Scharek et al.
1997). Whereas concentrations of dissolved nutrients can serve as a first-order proxy for nutrient deficiency, issues of chemical speciation can represent an obstacle in the application of this proxy. There are several techniques that can chemically determine the amount and speciation of
Fe in any given water sample, however, a key question that remains unanswered pertains to the amount of Fe that is actually bioavailable to phytoplankton. Earlier, our group successfully
Table 3. Various Fe bioreporters available and their properties.
Type Gene Fusions Host Strain Environment Detection window Ref. (promoter: reporter) Eukaryotic bioreproters
Plasmidial aequorin Phaeodactylum marine 5 – 10 µM 1 tricornutum (diatom) Bacterial bioreproters -7 -4 Plasmidial tonB::lacZ E. coli KP1022 lab 10 – 10 M Fe:NTA 2.
Genomic fepA-fes::luxCDABE E. coli FeLux freshwater 5 – 150 nM FeCl3 3. and marine Plasmidial desA::amy Streptomyces coelicolor soil N/A 4. -7 -4 Plasmidial Pvd::gfp P. syringae B728a soil 10 – 10 M FeCl3 5, 6. -7 -4 Plasmidial Pvd::inaZ P. fluorescences PF5 soil 10 – 10 M FeCl3 7
Genomic fepA-fes::luxCDABE P. putida seawater 5 – 150 nM FeCl3 3 -7 -4 Plasmidial Pupa::luxCDABE P. putida WCS358 lab 10 – 10 M FeCl3 8 Cyanobacterial bioreporters Genomic isiAB::luxAB Synechococcus PCC7942 freshwater pFe 21.1 – pFe 20.6 9, 10 Genomic irpA::luxAB Synechococcus PCC7942 freshwater pFe 21.1 – pFe 20.6 11
1. Falciatore et al. 2000; 2. Althaus et al. 1999; 3. Mioni et al. 2003; 4. Flores et al. 2003; 5.
Loper et al. 1997; 6. Joyner et al. 2000 ; 7. Loper et al. 1994; 8. Khang et al. 1997; 9.
Durham et al. 2002 ; 10. Porta et al. 2003; 11.. Durham et al. 2003 15 constructed a series of cyanobacterial bioreporters applicable to freshwater ecosystems.
Synechococcus PCC 7942 strain KAS101, a luminescent bioreporter for Fe availability, has been constructed and characterized (Durham et al. 2002; Porta et al. 2003; Hassler et al. 2006 a and b). Moreover, strain KAS101 has been used to assess the availability of Fe in samples collected from the Great Lakes (Porta et al. 2003; McKay et al. 2005b; Porta et al. 2005). The bioreporter was made using a construct comprising the isiAB promoter in vector pAM 1414 containing the
Vibrio harveyi luxAB genes (Andersson et al. 2000). However, due to the inability of this strain to grow in seawater, bioreporter application to marine systems is still unrealized. The objective of this research was to construct an Fe responsive cyanobacterial bioreporter capable of detecting and quantifying those fractions of Fe accessible to phytoplankton in marine environments.
The construction and a detailed characterization of the Fe bioreporter, including its use to assess Fe availability in the Gotland Basin of the Baltic Sea, is described in Chapter II. Chapter
III describes the application of the bioreporter to assess Fe availability in archived samples of filtered water (< 0.2 µm) collected from research cruises to oligotrophic oceanic environments including the central North Pacific (CNP) gyre and the subarctic northeast Pacific, a HNLC region. In appendix I, we describe our preliminary attempt to construct a luminescent marine cyanobacterial phosphorus bioreproter.
16
CHAPTER II. DEVELOPMENT OF A LUMINESCENT WHOLE-CELL
CYANOBACTERIAL BIOREPORTER FOR MEASURING FE AVAILABILITY IN
MARINE ENVIRONMENTS
1. Introduction
The Fe Hypothesis (Martin et al. 1991) has focused a great deal of attention on the role of
Fe as a factor constraining oceanic primary production. Numerous studies, including several open ocean Fe fertilization experiments (de Baar et al. 2005) have demonstrated that Fe deficiency is widespread, encompassing not only oligotrophic oceanic gyres and high nutrient, low chlorophyll (HNLC) regions, but also coastal regions (Hutchins et al. 1998; 2002; Sedwick
et al. 2000).
Whereas concentrations of dissolved nutrients can represent a first-order proxy for
nutrient deficiency, the issue of chemical speciation is a significant obstacle in the interpretation
of Fe bioavailability to plankton. Despite increasing recognition that Fe distribution and
availability is important in terms of aquatic production, the biogeochemistry of this trace element
remains to be fully characterized. Indeed, it is still difficult to determine that fraction of
chemically detectable Fe that is readily available to primary production. Thus, nutrient
bioavailability could be better understood if a biological system were to be used to estimate
nutrient supply.
In this direction, efforts by our group have focused on the development of luminescent
bioreporter constructs to be used to assay nutrient bioavailability in natural systems. We
previously reported the development and characterization of a freshwater cyanobacterial Fe
bioreporter capable of yielding a bioluminescent signal in response to Fe deficiency (Durham et 17
al. 2002; Porta et al. 2003; Hassler et al. 2006a). This prototype reporter employed the
unicellular strain Synechococcus sp. PCC 7942 in a construct bearing a genetic fusion of the Fe responsive isiAB promoter to the Vibrio harveyi luxAB genes encoding bacterial luciferase.
Characterization of this strain, KAS101, demonstrated the luminescent response to be a function of the free ferric ion concentration in metal-buffered synthetic media (Porta et al. 2003). Further standardization of assay conditions has allowed the use of this strain in documenting the occurrence of Fe deficiency in the Laurentian Great Lakes (Porta et al. 2003; 2005, McKay et al.
2005b).
In this chapter, we describe the development of a bioreporter suitable for studies of Fe availability in marine systems. Specifically, we have constructed a Synechococcus sp. strain
PCC 7002 Fe bioreporter in which the PCC 7002 isiAB promoter has been similarly fused to the
V. harveyi luxAB genes. Bioreporter luminescence was characterized with respect to the free ferric ion concentration in trace metal-buffered synthetic medium. Additionally, bioreporter performance was tested on field samples from the Baltic Sea, an environment in which Fe deficiency has been documented by analysis of Fe-responsive gene expression (Gieβ et al. 2001;
2004). Finally, the promoter fusion plasmid developed in this study facilitates the rapid construction of promoter reporter fusions in this species. Such fusions can be employed as bioreporters for the availability of a wide variety of micro- and macronutrients in marine environments.
18
2. Materials and procedures
2. 1. Media and growth conditions
Synechococcus PCC 7002 was cultured in modified Medium A (Appendix-II) (Stevens et
al. 1973) at 25 °C with constant bubbling and continuous illumination of 45 µmol quanta m-2 s-1.
The Fe bioreporter construct, strain BMB04, was grown in trace metal-buffered Medium A containing 10 µg mL-1spectinomycin to select for the integrity of the chromosomal insert. Trace
metal-buffered growth medium was prepared using macronutrient stocks treated with Chelex-
100 resin (Bio-Rad) as described elsewhere (Price et al. 1989). The medium was prepared
containing varying levels of total iron (FeCl3) that corresponded to thermodynamically calculated free ferric ion concentrations (Twiss et al. 2001, pFe (-log[Fe3+ free ferric]): 1 nmol
kg-1 (pFe 22.4), 10 nmol kg-1 (pFe 21.4), 30 nmol kg-1 (pFe 20.9), 70 nmol kg-1 (pFe 20.6), 100
nmol kg-1 (pFe 20.4), 250 nmol kg-1 (pFe 20), 500 nmol kg-1 (pFe 19.7) and 1000 nmol kg-1
(pFe 19.4). Chemical speciation of Fe in Medium A was calculated using MINEQL+ ver. 4.5 software (Environmental Research Software). Escherichia coli strain DH5α, used for maintenance of vectors pMBB and plasmid construct pMBR, was grown in LB medium containing 40 µg mL-1 spectinomycin at 37 °C (Sambrook et al. 1989). All media were prepared
using Milli-Q water (Millipore Corp.).
To minimize metal contamination, polycarbonate bottles used to culture the
Synechococcus bioreporter were soaked in 10% HCl (trace metal grade, Fisher Scientific) for 24
h, rinsed 5 × with Milli-Q water and dried in a HEPA-filtered laminar flow hood. All growth
media were sterilized by filtration through acid-rinsed 0.2 µm nylon membranes. Growth of
Synechococcus was monitored by measuring in vivo chlorophyll (chl)-a fluorescence (model TD-
700 fluorometer; Turner Designs) or by direct enumeration of glutaraldehyde-preserved cells by 19
epifluorescence microscopy (Axiophot microscope with epifluorescence attachment and rhodamine filter; Zeiss). PSII photochemical efficiency was assessed using the ratio Fv/Fm measured according to McKay et al. (1997). Chl-a determination was conducted by fluorometry
(Welschmeyer, 1994) following overnight pigment extraction at 4 ºC in 90 % (v/v) aqueous acetone.
2. 2. Construction of pMBB, an insertional promoter probe vector for Synechococcus PCC
7002
For the development of an insertional vector for Synechococcus PCC 7002, we used as a template plasmid pAM1414, the Synechococcus PCC 7942 promoter probe vector (Fig. 3;
Andersson et al. 2000). The main modification of pAM1414 involved adding Synechococcus
PCC 7002 chromosomal sequences allowing integration of the luxAB promoter fusion into the
Synechococcus PCC 7002 chromosome by homologous recombination. Gene desB, encoding omega-3 fatty acid desaturase, was chosen as a recombination site into the Synechococcus PCC
7002 chromosome for promoter fusion vector pMBB. Insertion of promoter::luxAB sequences into desB will yield a phenotypically neutral construct at the assay temperature (25 oC), yet will be incapable of growth at temperatures below 15 oC (Sakamoto et al. 1998a). Thus, promoter
fusion constructs would be disabled for growth in the event the strain was inadvertently released
into the environment.
To construct pMBB, two consecutive 800 nucleotide fragments of the desB gene
(Genbank accession number U36389) were individually amplified by PCR using primers
desB1_For and desB1_Rev, covering the 5′ half of the gene, and desB2_For and desB2_Rev,
amplifying the 3′ end (Table 4). PCR was performed with Synechococcus PCC 7002 total DNA 20
A
B
C
Figure 3. Vector and constructs prepared for the design of the bioreporter. 1A: vector
pAM1414; 1B: construct pMBB; and 1C: construct pMBR luxAB: promoterless luciferase gene, spR: spectinomycin resistance gene, pisiAB: iron stress inducible
promoter, desB1 & desB2: consecutive desB gene fragments, ORI: E. coli origin of
replication initiation, NSI: neutral sites for Synechococcus PCC 7942. 21
and Taq polymerase (Promega), according to the manufacturers instructions, for 30 cycles of the
following temperatures: 94 °C for 1 min, annealing at 55.5 oC for 2 min, 72 °C for 3 min, with a final extension at 72 °C for 15 min. Prior to PCR, the reaction mixture was preheated for ten minutes at 95 oC. Engineered into the desB1 and desB2 primers were Nhe I and Sac I restriction sites, respectively. Ligation of desB1 and desB2 amplicons into unique Nhe I and Sac I sites of pAM1414 yielded plasmid pMBB (Fig. 3). Thus, transformants bearing a chromosomal copy of the promoter fusion platform of pMBB acquire resistance to spectinomycin and yield luxAB- dependent bioluminescence under the control of a promoter sequence cloned into the unique Not
I /Bam HI restriction sites. pMBB was introduced into Synechococcus PCC 7002 by genetic transformation (Stevens and Porter 1980) and used to generate both the Fe bioreporter BMB04
(see below) and promoterless control strains of Synechococcus PCC 7002.
2. 3. Construction of Fe bioreporter BMB04
The promoter sequence of the Fe-responsive gene isiAB (Leonhardt and Straus 1992),
including nucleotides from the transcription start site to nucleotide 317, was amplified by PCR
using primers isiAB_For and isiAB_Rev, engineered with Not I and Bam HI restriction sites,
respectively (Table 4). PCR conditions were as described above for the desB1/2 amplicons,
Table 4. Primers used in this study to amplify various sequences. Orientation in 5′ → 3′
Name Primer sequence Amplify desB1_For GGCCCGCTAGCCCCTTCACCCTCAAGGATGTGAAAGCAG 800 bp desB1 desB1_Rev CCGGGGCTAGCCCAATATTATGGTGAATTTCGTTGAAAA desB2_For GGCCCGAGCTCCACCCATGTCGCCCACCACATTTTCCATA 800 bp desB2 desB2_Rev CCGGGGAGCTCCTTCGGCAGCGGCAGCATCCTCTGGCTAA isiAB_For GGCCCGCGGCCGCGACTTAGTTAATTTAGCGTAGTTTGCG 327 bp isiAB isiAB_Rev CCGGGGGATCCGGATTGGCTTTATCCTACAATTATTCTCA luxAB_For GGCGCGGTTTACAAGCATAAAGCTCTAGAG 400 bp fragment luxAB_Rev GGCGGGTGAGTTGTTCAAAATCAGGCTCGA 22
except that the annealing temperature was 58 oC. The isiAB promoter fragment was ligated into
the Not I and Bam HI sites of pMBB, and the resulting construct, pMBR, was introduced into
Synechococcus PCC 7002 by genetic transformation.
2. 4. Characterization of strain BMB04 as a Fe-responsive bioreporter
The Fe-dependent luminescent response of strain BMB04 was assessed by incubating the
bioreporter in Medium A containing varying additions of Fe. Exponential-phase cells growing in
Medium A containing 100 nmol kg-1 Fe (pFe = 20.4) were collected by centrifugation at 4000g
for 8 min, washed twice in Fe-free medium, and resuspended into triplicate polycarbonate
containers containing Medium A of defined free ferric ion content (pFe: 19.4 – 21.4). Cultures
were incubated for 12 h under the growth conditions described above prior to measuring
bioluminescence.
Cellular bioluminescence was optimized by testing different concentrations of the
luciferase substrate, n-decyl aldehyde (decanal; Sigma Co.) ranging between 0.005 – 50 % (v/v).
Also compared was the efficacy of acetone vs. methanol [0-100 % (v/v)] as diluents for decanal.
Delivery of 2.66 nmol L-1 decanal in 25 % (v/v) methanol to the bioreporter cells was by direct injection into 2 mL of cell culture followed by immediate measurement of bioluminescence using a portable Femtomaster FB14 luminometer (Zylux Corp.) with settings of 5 s delay and 10 s measurement.
To characterize strain BMB04 and assess its use to measure iron availability under environmentally relevant conditions, a set of physiological, physical and chemical parameters were varied (Table 5). These included time of incubation, growth temperature and irradiance, 23
- the biomass of bioreporter used to seed test media, macronutrient (NO3 and PO4-Pi)
concentrations and variations in salinity.
Statistical analysis of bioluminescence measurements was performed using MINITAB 14
(Minitab, Inc.). Regression equations and curve fitting functions were determined using
SigmaPlot 9.0 (Systat Software, Inc.).
Table 5. Physical, chemical and physiological parameters for the Fe bioreporter usage. Parameter Variables
incubation time (h) 6, 12, 24, 48
temperature (°C) 15, 25, 37
irradiance (µmol quanta m-2 s-1) 20, 45, 80, 250
initial bioreporter cell density (cells mL-1) 1 × 104, 1 × 105, 1 × 106
- -1 NO3 concentration (µmol L ) 0, 8.82, 16.5, 8820
-1 PO4-Pi concentration (µmol L ) 0, 2.87, 9.33, 2870
Salinity (‰)1 10, 20, 28
1derived from conductivity measured using a sensION model 156 portable multi-parameter meter (Hach Co.)
2. 5. Effect of Fe chelators on bioreporter response
Four commercially available Fe chelators were used to assess the influence of organic complexation on Fe bioavailability to the bioreporter. Two fungal trihydroxamate-type Fe (III) chelators, desferrioxamine B (DFB; Sigma Co.) and ferrichrome (Sigma Co.) were tested along with rhodotorulic acid (RA, Sigma Co.), a linear dihydroxamate-containing siderophore from yeast and N,N’-di (2-hydroxybenzyl) ethylenediamine-N,N’-diacetic acid (HBED; Strem
Chemicals, Inc.), a synthetic phenolic aminocarboxylate hexadentate chelator. Primary stocks of 24
chelators were prepared in Milli-Q water, except HBED, which was prepared in solution with a
four fold molar excess of KOH. Chelators were added to Medium A in excess of added Fe by a
2:1 molar ratio. Bioreporter cells growing in Medium A containing 100 nmol kg-1 Fe were
collected by centrifugation as described above and used to inoculate fresh medium providing an
initial cell density of 1 × 105 cells mL-1. Cultures were incubated for 12 h under standard growth
conditions prior to measuring bioluminescence.
2. 6. Bioreporter response to oxidative stress
We attempted to induce oxidative stress by treatment with high light and by incubation
with H2O2 and methyl viologen (MV). To examine the effects of high light on bioreporter
-1 response, strain BMB04 was cultured in Fe-sufficient (5 µmol kg ) Medium A under continuous
irradiance of 80, 100 and 250 µmol quanta m-2 s-1. Control cultures were incubated with continuous irradiance of 45 µmol quanta m-2 s-1. Aliquots were collected at intervals of 12 h for
measurement of growth and bioluminescence.
-1 Oxidative stress was induced by addition of H2O2 at concentrations of 50 mmol L and
200 mmol L-1 or by addition of MV at concentrations of 0.05 mmol L-1 and 5 mmol L-1. Cellular
bioluminescence was measured immediately following addition of the reagents and was
monitored at 10 min intervals thereafter.
2. 7. Assessment of bioavailable Fe in field samples using the bioreporter
Water samples were collected from the Baltic Sea in July and August 2005 (Fig. 4). In
July, depth-resolved samples were collected in triplicate at Station IOW 271 (57°19.20′N,
20°03.00′E) located in the Gotland Basin (238 m depth) on board the FS Professor Albrecht 25
Penck by using a 10 dm3 Teflon-coated GO-FLO bottle (General Oceanics, Inc.). In addition, triplicate samples from 10 m depth were collected from Station IOW 213 (55°14.95′N,
15°58.14′E) located in the Bornholm Basin. Sample manipulation and storage prior to bioreporter assay were as described elsewhere (Pohl and Hennings, 2005). In August, on board the RC Littorina, a sample from 5 m depth was collected by standard Niskin bottle from Station
Bocknis Eck (54°31.2′N, 10°2.5′E), a long-term monitoring station (1957-present: Kiel Bight
Monitoring Program) located at the head of Eckernförder Bight near the base of the Jutland
Peninsula. Sampling at both stations was preceded by a conductivity-temperature-depth (CTD) cast (Fig. 5; Table 6). Concurrent sampling was conducted for basic water chemistry.
For the samples collected from the Gotland and Bornholm Basins, dissolved (< 0.4 µm) Fe (DFe) was determined by graphite furnace atomic absorption spectroscopy (AAnalyst 800;
PerkinElmer, Inc.) with Zeeman correction as described previously (Pohl and Hennings, 2005).
Analytical accuracy was assured by analysis of NASS-4 and CASS-3 reference standards for trace metals in seawater (National Research Council Canada). Long-term internal laboratory QA is shown in Pohl and Hennings (2005) and Pohl et al. (2004). For the sample collected from
Station Bocknis Eck, labile and total dissolvable Fe (< 0.2 µm) was measured by voltammetry using established methods (Croot and Johansson, 2000). Samples for total dissolvable iron were acidified and UV-irradiated to remove organic complexing agents. In each case, triplicate samples for bioreporter assay were collected in acid rinsed polyethylene bottles and immediately frozen.
Bioreporter BMB04 was maintained in trace metal-buffered Medium A containing 100 nmol kg-1 Fe. Bioreporter cells growing at early exponential phase were collected by centrifugation for 8 min at 4000g and rinsed twice in Fe-free Medium A. Triplicate acid rinsed 26
polycarbonate bottles containing 50-mL of seawater sample were inoculated with bioreporter
cells to provide a cell density of 1 x 105 cells mL-1. Samples were assayed with, or without
- amendment with NO3 and PO4-Pi. Bioluminescence was monitored following 12 h of
incubation at 25 °C and 45 µmol quanta m-2 s-1 light. For the sample collected from 225 m depth in the anoxic zone of Station IOW 271, the sample was de-gassed immediately upon thawing by bubbling for 10 min with Ar prior to inoculation with bioreporter cells. Bubbling was conducted using a bacterial air vent and acid rinsed polyethylene tubing. Controls for this sample were
Medium A containing Fe (7.5 and 250 nmol kg-1) with, or without de-gassing.
Table 6. Physio-chemical characteristics of Baltic Sea hydrographic stations.
- Station Date Depth T Salinity O2 [NO3 ] [PO4-Pi] [DFe] (2005) (m) (°C) (‰) (µmol L-1) (µmol L-1) (µmol L-1) (nmol kg-1) IOW 213 6 July 10 16.4 7.55 saturated 0.02 0.38 27.5 IOW 271 8 July 5 17.0 7.13 352.37 0.05 0 12.6 8 July 20 6.3 7.14 324.23 0.06 0.22 13.7 8 July 50 2.7 7.46 353.26 0.45 0.76 16.5 8 July 150 6.0 12.350.45 1.33 2.59 15.3 8 July 225 6.0 12.730 0 4.99 601 Bocknis-Eck 28 July 5 18 14.14 285.1 0.04 0.02 49
27
Figure 4. Map showing the Baltic Sea: Stations IOW 213 and IOW 271: Gotland basin.
(from Pohl and Hennings, 2005 )
28
-1 O 2 ( µ mol L ) 0.0 0.5 1.0 300.0 325.0 350.0 375.0 Salinity ( ‰ ) 6 7 8 9 10 11 12 13 14 Chl-a (fluorescence) 0.0 0.5 1.0 1.5 2.0 2.5 3.0
Temperature ( ο C) 0 4 8 12 16 20 0
25
50
75 temperature salinity Chl- a O 2 100
Depth (m) 125
150
175
200
225
Figure 5. Conductivity-temperature-depth (CTD) and oxygen (circles) profile of
Station IOW 271 (Gotland Deep) in the Baltic Sea. 29
3. Results and Discussion
3. 1. Growth of wild type vs. bioreporter strains
Growth rates at 25° C did not differ between bioreporter strain BMB04 and wild type
Synechococcus sp. strain PCC 7002 when cultured in Fe-sufficient Medium A (two-tailed t-test;
P = 0.29; df = 2). Wild type cells possessed a growth rate of 0.15 ± 0.03 h-1 compared to 0.12 ±
0.02 h-1 for the bioreporter strain. These data suggest that the genetic modification of PCC 7002 with the pisiA::luxAB fusion did not yield any major physiological changes under laboratory culture conditions. Similar results were obtained with a freshwater Fe bioreporter designed using
Synechococcus PCC 7942 (Porta et al. 2003) and reporter constructs designed in Synechocystis
PCC 6803 (Kunert et al. 2000). As a result, subsequent experiments were conducted with the genetically modified strains only.
3. 2. Assessment of delivery of aldehyde substrate to the bioreporter
The bioreporter construct was designed to require exogenous application of decanal substrate for bacterial luciferase since endogenous substrate levels are rarely adequate as produced by strains co-transformed with aldehyde-producing luxCDE genes (e.g. Porta et al.
2003). Whereas some studies, including our prior characterization of a freshwater Fe bioreporter
(Porta et al. 2003), advocate delivery of aldehyde via the vapor phase, in most whole-cell bioreporters that incorporate luxAB promoter fusions, exogenous aldehyde substrate is injected into the medium to elicit a luminescent response (e.g. Gillor et al. 2002; Ivanikova et al. 2005).
To test both the intensity and reproducibility of the luminescent response under low Fe conditions, we tested the efficacy of providing the decanal to BMB04 by both approaches. 30
Consistently, use of vapors to deliver decanal to the bioreporter cells provided high variability
among replicate samples. As a result, we chose substrate delivery by direct injection for
subsequent characterization of the bioreporter. We further optimized the concentration of decanal
substrate and compared the efficacy of acetone vs. methanol as solvents for delivery of the
decanal. Maximum luminescence was observed when decanal was added at 0.05 % (v/v) in 25 %
methanol (Fig. 6). Cellular luminescence was decreased at concentrations of decanal both lower
and higher than this (Fig. 6). Similarly, 25 % methanol proved to be the optimal solvent for
delivery of decanal to the bioreporter cells. When higher concentrations of methanol were tested,
luminescence decreased (Fig. 6). The use of acetone as a solvent provided a similar profile to
methanol, although, absolute luminescence was consistently lower when acetone was substituted
for methanol.
3. 3. Non-steady state response of the bioreporter to varying free [Fe3+]
Whereas no significant differences in growth rate were detected between bioreporter and
WT strains grown under Fe sufficient conditions, differences in growth were observed between
Fe treatments for the bioreporter strain BMB04. Growth rates determined between 6-12 h following inoculation into new medium were highest when the bioreporter was inoculated into
Fe sufficient medium (pFe 19.4: 0.14 ± 0.03 h-1) but declined by ca. 40% when cells were
cultured at pFe 20.4 (0.08 ± 0.01 h-1) and by nearly 70% for cells cultured at pFe 21.4 (0.04 ±
0.03 h-1). Consistent with the low growth rates measured at pFe 21.4 and pFe 20.4, cells became chlorotic, a classic symptom of Fe deficiency in cyanobacteria (Riethman et al. 1988).
Assessing growth between 12 -24 h, cells grown in low pFe (0.15 ± 0.015 h-1 at pFe 21.4) grew marginally faster than did cells cultured in high pFe (0.112 ± 0.016 h-1 at pFe 20.4). It is 31
possible that Fe deficient growth was supplemented by siderophore production. Notably,
Synechococcus PCC 7002 produces two types of siderophores as a compensatory response to Fe
deficiency (Wilhelm et al. 1996).
In contrast, photochemical energy conversion efficiency (Fv/Fm) was ca. 0.5 regardless of
whether cells had been cultured in Medium A of pFe 19.4, 20.4 or 21.4 indicating photochemical
3+ efficiency was little effected by [Fe ]. By comparison, Fv/Fm is > 0.6 in nutrient-replete
phytoplankton (Kolber and Falkowski, 1993).
It appears then, that our measurements of growth rate and Fv/Fm appear to be in conflict.
Indeed, Fv/Fm varied little between Fe amendments, yet growth rates were variable and were a
demonstrable sign of Fe deficiency in the low Fe cultures assessed between 6-12 h. Whereas it has been documented for numerous cyanobacteria that Fe-depletion results in a reduction in
growth rate (Wilhelm, 1995), it is acknowledged that cyanobacteria can present problems in the
measurement and interpretation of variable fluorescence as a result of the characteristics of their
light-harvesting machinery that are different from eukaryotic algae. Such differences generally
yield lower values for Fv/Fm (Campbell et al. 1998; Raateoja et al. 2004). Thus, this proxy may
not be entirely suitable to assess physiological Fe deficiency among cyanobacteria.
A dose-response curve was generated relating bioreporter luminescence to the free ferric
ion content of Medium A between pFe 19.4 to 22.4 (Fig. 7). Through this range of variable
[Fe3+], discernible changes were measured in the luminescent response of cells with
luminescence being > 2 × higher associated with cells growing under low Fe (pFe 22.4) compared to Fe sufficient conditions (pFe 19.4). Adopting cellular luminescence at pFe 19.4 as a baseline response, luminescence initially increased when cells were incubated in Medium A of
pFe 20.4; however, this was consistently followed by a plateau extending through incubation 32
2800
2600 0.05
2400 0.005
-1 2200 0.5 RLU s 2000
1800
5 1600 50
1400 -2 -1 0 1 % log decanal (v / v) in 25% methanol
Figure 6: Luminescent response of the bioreporter in varying concentrations of decanal emulsion made in 25 % methanol. X-axis is in logarithmic scale and appropriate concentrations in % decanal are given below the data point (df = 2).
33
1600
1400
-1 1200 s 5 x 10
-1 1000
RLU cell 800
600
400 19.4 20.4 20.6 20.9 21.4 22.4 pFe Figure 7. Standard dose-response curve of bioreporter luminescence measured after
12 hr of incubation. R2 = 0.957; pFe = - log [Fe +3]
10 nM 2000 100 nM 1000 nM
1500 -1 s 5
x 10 -1
1000 RLU cell
500
0612 Time (hr)
Figure 8. Temporal response of luminescence of the bioreporter grown in Medium A. 34 at pFe 20.6 (Fig. 7). Luminescence again increased, this time linearly, through incubation of cells in Medium A of pFe 20.9 and 21.4.
Luminescence plotted as a function of pFe could be described according to a 3-parameter sigmoidal curve (Fig. 7) with Equation 1 describing the relationship between luminescence and pFe:
1940.2 Equation 1 y = x − 21.06 − ( 1.82 ) {1 + e }
3. 4. Influence of biotic and abiotic factors on the bioreporter luminescent response
3. 4. 1. Incubation time. Temporal resolution of the bioreporter response was monitored at intervals of 6, 12, 24 and 48 h following inoculation in trace metal-buffered Medium A (Fig.
8). Whereas cellular luminescence was indistinguishable between parallel cultures grown in
Medium A containing 10, 100 and 1000 nmol kg-1 Fe following 6 h incubation, distinct differences in luminescence could be resolved by the 12 h sampling point (Fig. 8) and this continued through 24 h of incubation (not shown). Based on this demonstration, we chose a 12 h incubation time for subsequent bioreporter assays.
3. 4. 2. Temperature. Temperature affects nutrient uptake in Synechococcus PCC 7002
(Sakamoto and Bryant, 1998), a feature that was exploited in the design of the Fe bioreporter. At temperatures < 15 ºC, strain BMB04 is incapable of growth as a result of the integration of the promoter fusion vector pMBB into gene desB, encoding omega-3 fatty acid desaturase.
Reflecting this, the bioreporter failed to show net positive growth at 15 °C (Fig. 9). Consistent with previous reports using the wild type strain (Sakamoto and Bryant, 1997), growth was most 35
rapid when cells were grown at 37 °C (0.2 ± 0.05 h-1) whereas growth at 25 °C proceeded ca.
50% of the rate at 37 °C (Fig. 9). By contrast, cellular bioluminescence was highest at 25 °C
whereas cells grown at 37 °C exhibited only ca. 30 % of maximum luminescence (Fig. 9). The lower luminescence recorded at 37 °C in spite of rapid growth rates can be explained by the heat labile properties of bacterial luciferase. Temperature studies on luxAB generated luciferase have demonstrated that the protein is unstable over 30 °C and that 95 % of the protein is degraded at elevated temperature (Cline and Hastings, 1971; Szittner and Meighen, 1990).
3. 4. 3. Growth irradiance. The impact of various light fluence rates (20, 45, 80 and
250 µmol quanta m-2 s-1) on the performance of the bioreporter was assessed. Culture under a
light fluence ratio of 80 µmol quanta m-2 s-1 supported the highest rates of growth whereas
growth rates declined by 40% under each of the other light fluence rates tested (Fig. 9; P < 0.05).
Growth proceeded at the same rate under 20, 45 and 250 µmol quanta m-2 s-1 (Fig. 9; P = 0.78; df
= 2). Bioluminescence was maximal under 45 µmol quanta m-2 s-1 following 12 h incubation
(Fig. 9). A ca. 90% reduction in cellular luminescence that accompanied growth under high light
-2 -1 (250 µmol photon m s ) was likely attributed to the deleterious effects of high light on FMNH2, the flavin cofactor required of bacterial luciferase (personal communication: Y. Hihara, Saitama
University, Japan).
3. 4. 4. Macronutrient status. A range of environmentally relevant concentrations of
- NO3 and PO4-Pi was tested, ranging from no added macronutrients, thus mimicking surface
waters of the Baltic Sea, the site of our field trials (see below), to the high millimolar
-1 - -1 concentrations ascribed to Medium A (8.82 mmol L NO3 and 2.87 mmol L PO4-Pi). An 36
-1 - -1 intermediate concentration of 8.82 µmol L NO3 and 2.87 µmol L PO4-Pi was adopted to
mimic macronutrient concentrations associated with the nutricline of our field site in the Baltic
Sea.
- Predictably, a reduction in NO3 and PO4-Pi resulted in lower growth rates of the
bioreporter. Compared to growth in regular Medium A, growth of strain BMB04 was only
-1 - -1 marginally reduced (11.85 %) when provided 8.3 µmol L NO3 and 2.3 µmol L PO4-Pi
(paired two-tailed t-test, P < 0.05) yet was strongly reduced (ca. 88 % lower) in cultures not
- amended with NO3 and PO4-Pi. The modest growth observed in these cultures was likely a
- result of residual NO3 and PO4-Pi introduced from the inoculum. In these same cultures where
macronutrients were not added, cellular bioluminescence was mainly inhibited, presumably due
to impaired amino acid and nucleic acid synthesis (Steglich et al. 2001; Vaulot et al. 1996). By
contrast, bioluminescence was highest (paired two-tailed t-test, P < 0.05) when the bioreporter
- -1 -1 was grown in Medium A containing reduced NO3 (8.3 µmol L ) and PO4-Pi (2.3 µmol L ).
3. 4. 5. Influence of initial biomass. The initial cell density used in assays was varied from 1 × 104 cells mL-1 to 1 × 106 cells mL-1. This range of cell densities was selected to
represent picophytoplankton concentrations found in natural systems (Veldhuis et al. 2005;
Landry et al. 1996; Bertilsson et al. 2003). Bioluminescence from cultures containing 10 – 1000
nmol kg-1 Fe was monitored at intervals of 0, 6 and 12 h. In each trial, the initial biomass had no
influence on cellular luminescence following 12 h incubation (Fig. 9).
3. 4. 6. Salinity. We assessed growth and bioluminescence of the bioreporter in response
to varying salinity in order to represent a range of relevant salinities encountered in the Baltic 37
Sea, the location of our field application (Fig. 9). Abundant freshwater runoff in combination
with restricted water exchange through the Danish Straits results in a dramatic salinity gradient
in surface waters of the Baltic Sea from almost oceanic conditions in the northern Kattegat to
conditions approximating those of freshwaters in the northern Gulf of Bothnia. On average, over
the past century, the average salinity of the Baltic has been reported as ca. 7.4‰ (Meier &
Kauker, 2003), roughly that which we measured in surface waters of the Gotland (IOW 271) and
Borneholm Basin (IOW 213) stations. By comparison, surface water salinity at Station Bocknis
Eck was elevated to > 14‰, consistent with its location in the western reaches of the basin.
Reflecting the diverse salinity gradient present in our samples, the bioreporter was tested
in Medium A where salinity was varied in the range from 10-28 ‰, the latter being the ambient
salinity of Medium A. Over this range of salinities, there was no change in the growth rate of the
bioreporter (P = 0.087; df = 2) nor was bioluminescence altered (P = 0.85; df = 2). Thus, the
bioreporter appears amenable to monitoring the availability of Fe over an ecologically relevant
range of salinities.
The freshwater cyanobacterium Synechocystis PCC 6803 responds to increasing salinity
by up-regulating transcription of the Fe-responsive gene isiAB, perhaps a response to increased
oxidative stress associated with a shift in salinity (Vinnemeier et al. 1998). That bioluminescence
of Fe bioreporter BMB04 did not respond to changes in salinity further defines the Fe specificity
of this reporter and reaffirms its applicability for use in marine environments.
3. 5. Effect of Fe chelators on bioreporter response
When added to Medium A, three of the organic ligands tested, ferrichrome, DFB and
HBED, elicited an enhanced luminescent response from the cyanobacterial bioreporter compared 38
to a control sample (P < 0.05; Table 7), thereby supporting the characterization of strain BMB04
as a Fe-responsive reporter. Consistently, the synthetic chelator HBED proved to be the most
effective at withholding Fe from the bioreporter (Table 7). This confirms recent reports
demonstrating the efficiency with which this chelator withholds Fe from cyanobacteria (Gress et al. 2004). In contrast, addition of the dihydroxamate-containing siderophore RA failed to elicit a luminescent response greater than the control (unpaired two-tailed t-test, P = 0.87, df = 4) suggesting that Fe bound to RA was available to the Fe bioreporter. This is consistent with a previous report by Wilhelm and Trick (1994) who also demonstrated that Fe bound to RA is available for uptake by Synechococcus PCC 7002.
3. 6. Bioreporter response to oxidative stress
Both Fe deficiency and Fe overload can result in the production of deleterious oxygen radicals, thus, it has been proposed that oxidative stress is the ultimate signal regulating the expression of Fe-responsive genes in prokaryotes (Michel and Pistorius, 2004). Support for this idea has come from the studies of Yousef et al. (2003) and Mazouni et al. (2003) who demonstrated the rapid derepression of isiAB transcription in freshwater cyanobacteria following application of either by H2O2 or MV. Further, microarray and Northern analysis of Synechocystis
PCC 6803 showed that there was 18 times greater induction of isiAB transcript when cells were
exposed to oxidative stress (Singh et al. 2004).
In the present study, bioluminescence was reduced by 95 % within 0.5 min following addition of
200 mM H2O2 (unpaired two-tailed t-test, P < 0.0001, df = 2). The luminescence recovered to 72
% of that of the control within 10 min but by 50 min of incubation, the bioreporter had suffered
irreversible damage and luminescence again decreased (Fig. 10 A). A similar pattern of response 39
was observed in high concentrations of MV with a 50 % decrease in luminescence after 0.5 min
of incubation and eventual recovery with 58 % higher luminescence than the control by 10 min
(P < 0.0001, df = 2). A similar response was observed when the concentration of H2O2 was
reduced to 50 mM (Fig. 10 A). By contrast, luminescence of the bioreporter treated with 0.05
mM MV showed no significant effect on luminescence when compared to the control (P > 0.05,
df = 2). Yousef et al (2003) demonstrated that in Synechococcus PCC 7002, induction of isiAB in
5 mM H2O2 was higher at 10 min and that the transcript degraded after 20 min of incubation.
Similar results were seen using MV.
A second motivation for conducting these trials was to assess whether endogenous levels
of H2O2 found in the ocean might serve to stimulate reporter gene expression and thus result in
misinterpretation of luminescence patterns. In natural environments, H2O2 is measured at rather
low concentrations, especially when compared to the levels adopted in our study. Major
pathways and sources for H2O2 are biological production (Twiner and Trick, 2000), photochemical oxidation (Palenik et al. 1987), and direct input from rainwater (Willey et al.
-1 2004). In the Baltic Sea, the concentration of H2O2 was reported to be ca. 50 nmol L (Herut et
al. 1998), thus several orders of magnitude lower than used in our trials (Fig. 10 B).
Cyanobacteria having elevated levels of superoxide disumtase, an enzyme induced under
oxidative stress to detoxify oxygen radicals, were reported in Baltic waters, although it was
concluded to be due to high light rather than H2O2 (Canini et al. 1998). Rarely do steady state
-1 H2O2 concentrations exceed 100 nmol L anywhere in the ocean (Palenik et al. 1987), thus,
there is little risk that endogenous H2O2 will upregulate promoter gene activity in our bioreporter
construct (Fig. 10 B).
40
RLU Growth Rates 100 N.S N.S 80
60
40 *** *** *** luminescence maximum % 20 *** *** 0 4 5 6 1x104 1x105 1x106 15 25 37 20 45 80 250 10 20 30
-1 −2 −1 Cells ml Temperature (°C) Irradiance (µmol quanta m s ) Salinity (‰)
Figure 9. Influence of biotic and abiotic factors on the Fe bioreporter luminescence after
incubating for 12 hrs. Relative Luminescent Units (RLU) is normalized to cell numbers. N.
S. Not Significant and *** = P < 0.0001.
Table 7. Luminescence of BMB04 in response to the Fe chelators RA, ferrichrome, DFB and
HBED (mean ± SE, n = 3)
Treatment Luminescence (RLU cells-1 × 105 s-1)
Control 1491 ± 213
RA 1515 ± 110
Ferrichrome 1903 ± 48
DFB 2227 ± 108
HBED 3280 ± 470
41
0.5 min ** *** A 150 10 min 50 min
100
*
50
0 Control 200 mM 50 mM 5 mM MV 0.05 mM MV H2O2 H2O2
0.5 min B 150 10 min
% maximum luminescence luminescence % maximum ** 30 min ** ** 50 min ** 100
** 50 ** **
0 Ccontrol 200 µM 200 nM 100 nM 50 nM [H2 O2]
Figure 10. Effect of oxidative stress on the Fe bioreporter. A. Influence of H2O2 and
MV on the Fe bioreporter; B. Influence of variable concentrations of H2O2 on the Fe
bioreporter. * are with P< 0.01, ** are with P< 0.005, and *** are with P< 0.001. 42
3. 7. Use of the bioreporter to assess Fe bioavailability in the Baltic Sea
Hydrographic stations occupied during summer 2005 were stratified and featured distinct
thermal, salinity and redox gradients as demonstrated for Station IOW 271 located in the Gotland
Basin (Fig. 5). The physico-chemical features shown here, including the presence of cold intermediate waters, are typical for the Baltic and are described in more detail elsewhere (Nausch et al. 2003; Pohl and Hennings, 2005).
Macronutrients were depleted from the surface waters at each station (Table 6). Whereas
-1 replenishment of PO4-Pi occurred coincident with the thermocline and reached ca. 5 µmol L in
- anoxic deep waters of Station IOW 271, NO3 remineralization was evident only between the
- halocline and redoxcline (Table 6). Consistent with the depletion of NO3 from surface waters at
Station IOW 271, diazotrophic filamentous cyanobacteria (Aphanizomenon sp. and Nodularia
spumigena) were the visibly dominant photoautotrophs at this site (Stal and Walsby, 2000;
personal communication: M. Nausch, IOW, Germany), where they contributed 15 µg chl a L-1 at
2.5 m depth. Because macronutrient concentrations were low at each of the hydrographic
- stations, we tested the bioreporter response to water samples amended with, or without NO3 and
PO4-Pi. Consistently, bioluminescence was higher in the samples amended with macronutrients
with the enhanced response ranging from 100 – 2000 % (data not shown). As a result,
bioreporter assessment of Fe availability in the Baltic Sea was conducted on samples amended
-1 - -1 with 8.3 µmol L NO3 and 2.3 µmol L PO4-Pi.
Surface water DFe was highest at the nearshore Station Bocknis-Eck (49 nmol kg-1) and lowest in surface waters of the Gotland Basin (12.6 nmol kg-1). Consistent with this, surface
water from the Gotland Basin yielded the highest bioluminescent response from the Fe
bioreporter strain (Fig. 11). However, bioreporter luminescence was not always correlated with 43
the DFe content of samples. DFe measured from Station Bocknis-Eck was nearly two fold
higher than that measured from 10 m depth in the Bornholm Basin (Table 6), yet, luminescence
from the bioreporter was higher associated with the nearshore Bocknis-Eck site (pFe equivalent
= 22.4 ± 0.3 vs. 21.5 ± 0.2 at Station IOW 213). Inconsistencies between bioreporter
luminescence and DFe have similarly been demonstrated using our freshwater Fe bioreporter in
Lake Superior waters (McKay et al. 2005b) and confirms our premise that chemically
determined concentrations of Fe do not necessarily reflect bioavailablity.
We also assessed the depth-resolved response of the bioreporter at the Gotland Basin site.
Whereas luminescence at the surface was elevated, the bioreporter response at 20 m depth and
below was markedly lower, suggestive of higher Fe availability relative to the surface (Table 6).
We also examined Fe availability below the redoxcline. DFe increased by 40-fold at 200 m depth
compared to the surface (Table 6) consistent with the expected higher solubility of Fe2+ under the reducing conditions associated with this depth. Concomitant with this, the bioreporter perceived
Fe sufficient conditions (Fig. 11). De-gassing the sample prior to bioreporter inoculation incurred no apparent deleterious effect on the bioreporter cells as there was no difference in the luminescent response elicited from controls that had been de-gassed compared to those that had not been bubbled with Ar gas (data not shown). Somewhat unexpected was the relatively low
DFe measured in the sample collected from 150 m. Despite oxygen levels that were 300 times
lower than at 50 m (Fig. 5), there was only a modest increase in the DFe at this depth (Fig. 11;
Table 6) which did not result in increased Fe availability compared to 50 m. It is possible that
lower than expected DFe at 150 m was due to high biological Fe demand by heterotrophic
bacteria growing in this hypoxic stratum, 95 % of which presumed to be denitrifying bacteria
(Brettar et al. 2001). Supporting this, bacterial cell abundance at 150 m in the Gotland Basin has 44
been demonstrated to be 2 orders of magnitude higher than at 50 m (Höfle and Brettar, 1995).
Using study state Fe demand values characteristic of marine heterotrophic bacteria reported by
Strzepek et al. (2005), we calculated the biological Fe demand to be 0.03 pmol L-1 d-1 at 50 m depth and 2.31 pmol L-1 d-1 at 150 m depth. Thus, higher steady state Fe demand at 150 m might
be the reason for low DFe.
3.8. Caveats to Consider in Using the Cyanobacterial Fe Bioreporter
The Synechococcus Fe bioreporter used in this study is presented as a novel tool to assess
the bioavailability of Fe in seawater since it provides a measure of nutrient availability from the
perspective of a living organism. Chemical approaches, although providing a first-order
indication of nutrient status, are less flexible in discriminating between biologically available and
more refractory forms of a nutrient.
It is important to bear in mind some of the limitations associated with the use of the Fe
bioreporter. Notable in this respect is that the Fe bioreporter used in this study is a prokaryotic
organism possessing an Fe acquisition strategy distinct from eukaryotes. This does not diminish
the significance of our results, especially considering the sizeable allocation of biomass and
production among picoplanktonic photoautotrophs in marine systems (Stockner, 1988) where
primary production is supported mainly by nutrients regenerated via the microbial loop.
However, by relying solely on a cyanobacterial bioreporter, we cannot comment with
certainty on Fe availability to marine eukaryotic photoautotrophs. Whereas cyanobacteria,
including the Synechococcus sp. PCC 7002 strain used in the construction of our bioreporter,
generally rely upon siderophores to acquire Fe3+ (Wilhelm, 1995), eukaryotic cells more commonly possess a cell surface ferric reductase activity used to reduce Fe3+, including 45
-1 DFe (nmol kg ) 0 5 10 15 20 600 625
pFe 15.0 17.5 20.0 22.5 25.0 27.5 0
pFe 50 DFe
100
Depth (m) 150
200
250
Figure 11. Water column profile of dissolved Fe and pFe, assessed by the Fe
bioreporter, at Station IOW 271 (Gotland Deep) in the Baltic Sea. 46 organically-complexed species, to the ferrous form for uptake (Maldonado and Price 2000,
Weger et al. 2002). Reflecting the inherent differences in prokaryotic vs. eukaryotic Fe acquisition, Hutchins et al. (1999) demonstrated distinct differences in the uptake efficiency of various molecules containing radiolabeled Fe by cyanobacteria and diatoms.
Given this dichotomy in Fe acquisition strategies between prokaryotes and eukaryotes, development of a suitable eukaryotic Fe bioreporter is desired. A diatom is arguably the best candidate for such a eukaryotic bioreporter organism. Diatoms are ecologically important members of the phytoplankton community in oceans as evidenced by their response following Fe infusion during mesoscale fertilization studies (de Baar et al. 2005). Further, recent advances in stable transformation procedures for diatoms (as reviewed by Falciatore and Bowler, 2002;
Poulsen and Kröger, 2005; Walker et al. 2005) combined with ongoing genome sequencing and annotation efforts for two diatom species (Scala et al. 2002; Armbrust et al. 2004) has cleared some of the obstacles to developing a diatom bioreporter organism.
47
CHAPTER III. APPLICATION OF THE BIOREPORTER TO OPEN OCEAN
ENVIRONMENTS
1. Introduction
Oligotrophic regions in the world oceans are characterized as being depleted of surface
nutrients such that surface water nitrate is generally < 0.1 µmol L-1 (Zehr and Ward 2002;
Benitez-Nelson, 2000) and soluble reactive phosphate (SRP) is < 20 n mol L-1 (Benitez-Nelson,
2000). As a result, primary production in oligotrophic waters is usually constrained due to low macronutrient availability. Reflecting this, such regions are often called “Low Nutrient, Low
Chlorophyll” (LNLC). Permanent stratification and a deep nutricline usually associated with
LNLC regions effectively constrains nutrients remineralized at depth from being introduced back to the surface.
Curiously, > 20 % of the world oceans possess elevated levels of macronutrients (N ranging between 10 – 30 µmol L-1 and P ca. 1 µmol L-1), yet do not accumulate high amounts of
chlorophyll (Boyd, 2002). These regions are referred to as “High Nutrient, Low Chlorophyll”
(HNLC). High amounts of biomass fail to accumulate in these regions as a result of Fe deficiency (Moore et al. 2002; Boyd, 2002; de Baar et al. 2005). These HNLC regions are
restricted not only to the open ocean, far removed from coastal influence, but are also reported to
occur in coastal regions such as the California Upwelling (Hutchins et al. 1998; Wells, 1999) and
the upwelling system off the coast of Peru (Hutchins et al. 2002; Frank et al. 2003; Eldridge et al. 2004).
48
1.1. Picophytoplankton in the Oligotrophic Ocean
Picophytoplankton (0.2-2 µm), especially picocyanobacteria are ubiquitous in the oceanic euphotic zone. Various studies have demonstrated that in oligotrophic regions especially, picocyanobacteria are the dominant autotrophic group (Platt et al. 1983; Falkowski et al. 1998;
Marañón et al. 2001; Fernández et al. 2003; Bertilsson et al. 2003; Montoya et al. 2004; Johnson et al. 2006). Picocyanobacteria are abundant in warm surface waters of the tropics and subtropics where they reach densities > 105 cells m L-1 and where the predominant taxa are Synechococcus and Prochlorococcus. They can also be found in cold waters and to depths of up to 200 m
(Bertilsson et al. 2003).
As a result of their large surface area to volume ratios, picocyanobacteria often receive a competitive advantage over large cells with respect to obtaining nutrients from the environment
(Falkowski et al. 1998). The recent discovery of cyanobacterial diazotrophic unicells offers additional insight into mechanisms by which these organisms are able to survive in oligotrophic systems (Zehr et al. 2001; Montoya et al. 2004).
1.2. The HNLC Subarctic Pacific
Fe limitation has been consistently shown to be a major cause for limiting phytoplankton growth in HNLC provinces of the world oceans. The subarctic Pacific is the archetypal HNLC oceanic region and earlier studies demonstrated stimulation of phytoplankton growth following amendment with Fe in bottle experiments in this region (Martin and Fitzwater, 1988; La Roche et al. 1996). In 2001, the first mesoscale Fe fertilization experiment in the subarctic Pacific was conducted by a Japanese team in the western sector of this HNLC region. The Subarctic Pacific 49
Iron Experiment for Ecosystem Dynamics Study (SEEDS) convincingly demonstrated the
control of Fe on primary production in the region (Tsuda et al. 2003).
In 2002, a second mesoscale Fe fertilization study was conducted in the vicinity of ocean
station Papa (50º N, 145º W) in the eastern subarctic Pacific Ocean (Fig. 12a). The Subarctic
Ecosystem Response to Iron Enrichment Study (SERIES) was part of a collaborative project between Canadian and Japanese scientists (Boyd et al. 2004; Boyd et al. 2005a).
The main objectives of SERIES were as follows:
a. To measuring the response of plankton to an Fe fertilization event,
b. To demonstrate photosynthetic depletion of CO2 from surface waters and subsequent
export of organic carbon to depth,
c. To monitor the Fe-stimulated production of biogenic climatic gases such as
dimethylsulfide (DMS) and to assess their influence on the environment.
SERIES facilitated comparison of varying plankton responses along a longitudinal dust
gradient that exists naturally in the North Pacific and which is believed to cause distinct
differences in phytoplankton communities between the western and eastern subarctic gyres
(Harrison et al. 2004; Kienast et al. 2004). Deposition of atmospheric dust is considered to be the
most important source of new Fe to surface waters in HNLC regions (Jickells et al. 2005),
particularly in the northern hemisphere, where dust deposition is eight fold higher than in the
southern hemisphere (Jickells et al. 2005). In the north Pacific Ocean, dust generally originates
from the central desert of China, with dust deposition expected 5-10 days after a meteorological
event in that region. 50
SERIES also provided the first detailed atmospheric study associated with a Fe
enrichment experiment in the ocean with particular focus on interactions between Fe, DMS and
the foodweb. The study was conducted using three ships to create a patch of Fe-fertilized water
for the longest observational period carried out to date. Within this extended time frame,
scientists studied post-phytoplankton bloom particle export not seen in other Fe enrichment
experiments having shorter observational periods.
Studies conducted in association with SERIES detailed phytoplankton bloom dynamics,
the fate of the added Fe, and carbon export; but no studies were carried out to assess the
bioavailability of Fe to phytoplankton. Here, we have conducted laboratory analysis of
bioavailable Fe in water samples collected during SERIES using the whole cell luminescent
cyanobacterial Fe bioreporter whose development and characterization was described in Chapter
II.
1.3. The LNLC Central North Pacific Gyre
The North Pacific gyre is the largest circulation feature on Earth, extending from ca. 15°
N - 35° N latitude and 135° E to 135° W longitude providing a surface area of about 2 x 107 km2
(Karl, 1999). Surface waters of the CNP gyre are permanently stratified with mixed layer temperatures > 24°C and oligotrophic nutrient conditions prevailing. Reflecting this, mixed layer nitrate concentrations are ca. 2 nmol L-1, and surface ammonium concentrations are < 30 n mol
L-1. Likewise, SRP is depleted with concentrations ranging between 21 nmol L-1 – 150 nmol L-1
(average = 45 nmol L-1) reported from the mixed layer at the time-series oceanographic station
ALOHA (22° 45’ N, 158° W) (Karl and Tien, 1997; Bjorkman and Karl, 2003). Such low
macronutrient levels combined with permanently low chlorophyll levels thus characterize this 51
system as LNLC. Dissolved Fe (DFe) concentrations in surface waters of the CNP gyre are also
very low, in the range of ca. 50-80 pmol kg-1 (Martin and Gordon, 1988). Higher concentrations
of DFe are occasionally reported such as the high picomolar levels (380 pmol kg-1) reported at
station VERTEX-IV which is approximately 200 km north of Hawaii (de Baar and de Jong,
2001). Fe inputs into the CNP gyre vary both temporally and spatially. DFe in surface waters can
originate from atmospheric dust, diffusive flux from deep waters and biological regeneration.
Overall, the euphotic zone of the CNP gyre has been described as a ‘‘two-layer’’ system; the
uppermost, light-saturated, nutrient-limited mixed layer extending to ca. 100 m, which supports higher rates of primary production, and a lower, light-limited layer containing elevated nutrient
levels (Karl, 2002).
As with most oligotrophic systems, the surface waters of the CNP are dominated by
picophytoplankton, such as Prochlorococcus and Synechococcus (Karl, 2002; DeLong at al.,
2006; Johnson et al. 2006). These planktonic communities are able to compete effectively for
predominantly regenerated nutrients, in part due to their large surface area to volume ratios
(Chisholm, 1992). Occasional blooms of microplankton (> 20 µm) diatoms such as Hemiaulus
hauckii, and Rhizosolenia spp. have been observed in the late summer (Wilson, 2003; Singler
and Villareal, 2005). In oliogtrophic regimes of various oceans, Fe deficiency is well
documented (Moore et al. 2002; Karl, 2002; Johnson et al. 1997). Yet, in the CNP gyre, Shipe et
al. (1999) and Brzezinksi et al. (1998) reported that low availability of silica rather than Fe is
limiting to diatom growth. The present work is an attempt to understand the availability of Fe to
picophytoplankton using a Fe bioreporter on samples collected in the CNP gyre during the RoMP
(Rhizosolenia Mats in the Pacific) study conducted during August - September 2003.
52
2. Materials and Methods
2.1. Subarctic Ecosystem Response to Iron Enrichment Study (SERIES): Eastern Subarctic
Pacific
Details of the SERIES study have been published (Boyd et al. 2004; 2005a). The
following provides a brief summary of the experimental approach.
2.1.1. Site selection and Fe enrichment. Selection of the mesoscale Fe fertilization site
for SERIES was made following a 48 h oceanographic survey in the vicinity of the archetypal
HNLC locale, Ocean Station Papa. An appropriate HNLC region for the fertilization experiment
was identified 50 km northeast of station Papa located at 50° N, 145° W (Fig. 12a). The site was
fertilized with Fe on 10 July 2002, designated as day 0, with an acidic (pH 2) ferrous sulphate
-1 solution and the tracer SF6 to provide mixed layer concentrations of ca. 1 nmol kg and ca. 400
fmol L-1, respectively over a patch of 4.75 × 4.75 nautical miles. A drogued ARGOS-GPS drifter
was buoyed at the center of the fertilized area to assist in tracking the patch while carrying out the experiment (Fig. 12b). A second Fe infusion was made on day 6 to provide an additional 0.6 nmol kg-1 of DFe in an expanding rectangle of 7.3 x 3.7 nautical miles.
2.1.2. Monitoring the patch. The Fe fertilized patch was monitored for 25 days from 10
July until 4 August 2002. Patch dynamics were mapped each night via underway survey of the
tracer compound SF6 and measures of DFe. Parameters measured routinely included
temperature, salinity, in vivo chlorophyll fluorescence (including Fv/Fm) and macronutrient
concentrations. 53
A
Figure 12: Map showing the region and sampling sites of the SERIES experiment; A. Map of the SERIES site and phytoplankton bloom resulting from
Fe enrichment is denoted by an arrow; B. Survey map of SF6 distribution and sampling sites located by dots; C. Survey of Fv / Fm on day 3 where the dashed line denotes the sampling path (from Boyd et al. 2005a)
54
2.1.3. Sampling techniques employed. The SERIES experiment was coordinated via use of three research vessels. Physical parameters of the water column were monitored daily using a
Seabird CTD thermosalinograph, as was in vivo chlorophyll fluorescence. Photochemical energy
tracka conversion efficiency (Fv / Fm) was measured using a fast repetition–rate fluorometer (FAST ;
Chelsea Instruments) on unfiltered water pumped from 3 m through the bow of one of the
research vessels. Dissolved macronutrients (nitrate, silicic acid, phosphate) were measured by
shipboard automated analysis whereas DFe was determined using chemiluminescence detection
of Fe2+.
Triplicate samples for DFe and bioreporter analysis were collected in acid-rinsed Teflon
bottles using a metal clean Teflon-coated pump and hosing from 10 m depth in the surface mixed
layer. Samples for bioreporter analysis were collected between day 1 to day 11 of the study.
“Out-patch” samples from a location 16 km away from the fertilized patch were collected for
experimental controls. The samples collected were packed in double plastic bags and
immediately frozen for later bioreporter analysis.
2.2. Rhisosolenia Mats in the Pacific (RoMP): Central North Pacific Gyre
One component of the RoMP 2003 study has been published (Singler and Villareal,
2005). The following provides a brief summary of the experimental approach.
2.2.1. Sample site. The LNLC CNP gyre was selected to study vertical migration and
nutrient cycling by buoyant microplankton (> 20 µm) diatoms of the genera Rhizosolenia and
Ethmodiscus. Sampling was conducted on board the Scripps Oceanographic Institute platform
R/V New Horizon during late summer (August-September) 2003, along an east-west transect at 55
28° N. This covered a region extending north from Hawaii to ca. >300 km west of the
International Date Line. Generally calm seas associated with the “horse latitudes” (ca. 30º N and
30º S) favor the accumulation (and sampling) of surface-associated phytoplankton.
2.2.2. Sampling. Sampling at all stations was preceded by a Seabird 911+ CTD cast.
Mats of buoyant Rhizosolenia spp. were collected from the upper 10 m of the surface mixed layer at stations along the transect by SCUBA. Rhizosolenia mats were collected into acid-rinsed
polystyrene containers and returned to the ship where the buoyancy status of the mats was
determined prior to analysis. Cells of Ethmodiscus spp. were collected by horizontal net tow just below the surface as the ship steamed at 1-2 knots. Manuscripts detailing the contributions of both Rhizosolenia (Al-Rshaidat et al.) and Ethmodiscus (Villareal et al.) to nutrient cycling in the
CNP gyre are in preparation.
For measurement of DFe and bioreporter analysis, seawater was collected from 1-2 m
below the surface by divers operating from an Avon inflatable boat at a distance >500 m from
the research vessel. To minimize the possibility of contamination, acid-rinsed 1-L Teflon bottles
(Savillex) were opened only under water in order to collect the samples. Once returned to the main vessel, the water was filtered in a laminar flow bench using a Teflon filtration assembly
(Savillex) with an acid-cleaned 0.2 µm polycarbonate membrane (GEOsmonics). Aliquots of these samples were transferred to triplicate acid-rinsed LDPE (for DFe) or polycarbonate (for
bioreporter) bottles and frozen. Analysis of DFe content in filtered sea water is currently being
conducted in the lab of Dr. Jay Cullen (University of Victoria, Canada) via Flow Injection
Analysis using in-line preconcentration and spectrophotometric detection as described by
Measures et al. (1995). 56
For dissolved macronutrients (N, P), samples were collected from Niskin bottles
deployed on the CTD rosette. Nutrient samples were frozen and analyzed on shore using a
Lachat Quikchem 8000 autoanalyzer at the University of Texas Marine Science Institute, Port
Aransas, Texas. Samples for the determination of extractive chlorophyll were filtered onto 0.7
µm glass fiber filters, extracted overnight in methanol, and analyzed fluorometrically
(Welschmeyer, 1994).
2.3. Bioreporter analysis
The Fe-dependent luminescent response of strain BMB04 was assessed by incubating the bioreporter in Medium A containing varying additions of Fe. Exponential-phase cells growing in
Medium A containing 100 nmol kg-1 Fe (pFe = 20.4) were collected by centrifugation at 4000g
for 8 min, washed twice in Fe-free medium, and resuspended into triplicate polycarbonate
containers containing Medium A of defined free ferric ion content (pFe: 19.4 – 21.4). Cultures
were incubated for 12 h at 25 °C and 45 µmol quanta m-2 s-1 light prior to measuring
bioluminescence. Delivery of decanal substrate to the bioreporter cells was by direct injection
into 2 mL of cell culture followed by immediate measurement of bioluminescence using a
portable Femtomaster FB14 luminometer (Zylux Corp.) with settings of 5 s delay and 10 s
measurement.
For all analyses of open ocean water, bioreporter BMB04 was maintained in trace metal-
buffered Medium A containing 100 nmol kg-1 Fe. Bioreporter cells growing at early exponential phase were collected by centrifugation for 8 min at 4000g and rinsed twice in Fe-free Medium A.
Triplicate acid rinsed polycarbonate bottles containing 50-mL of seawater sample were inoculated with bioreporter cells to provide a cell density of 1 × 105 cells mL-1. Samples were 57
- assayed with, or without amendment with NO3 and PO4-Pi. Cultures were incubated for 12 h under the growth conditions described above prior to measuring bioluminescence.
Statistical analysis of bioluminescence measurements was performed using MINITAB 14
(Minitab, Inc.). Regression equations and curve fitting functions were determined using
SigmaPlot 9.0 (Systat Software, Inc.).
3. Results and Discussion
3.1. Subarctic Ecosystem Response to Iron Enrichment Study (SERIES): Eastern Subarctic
Pacific
3.1.1. SERIES Overview. The Subarctic Ecosystem Response to Iron Enrichment Study
(SERIES) was a successful mesoscale Fe fertilization experiment performed in July – August
2002. The primary results of this experiment are presented elsewhere (Boyd et al. 2004; 2005a).
The endemic phytoplankton community in the HNLC subarctic Pacific is commonly dominated by picocyanobacteria such as Synechococcus as well as autotrophic nanoflagellates
(2-20 µm). Studies of plankton dynamics in waters in the vicinity of ocean station Papa have demonstrated seasonal variation in plankton communities and domination by cells < 5 µm which includes the picocyanobacteria (Boyd and Harrison, 1999). Diatoms make a small contribution to
the standing algal stocks of these waters. A similar community structure is also observed in other
subpolar HNLC waters (McKay et al. 2005b). The abundance of picoplankton can be explained
due to their advantageous small surface area to volume ratios and concomitant rapid growth rates
compared to other plankton (Falkowski et al. 1998). Similar to other Fe enrichment experiments 58
(Martin et al. 1994; Coale et al. 1996; Boyd et al. 2000), Fe infusion in the SERIES experiment resulted in increases in both chlorophyll and Fv / Fm (Fig. 12c) with an initial increase in the abundance of Synechococcus. Subsequently, between days 4 to 11, there was a taxonomic shift in phytoplankton characterized by a 4-fold increase in autotrophic nanoflagellates, especially
Emiliana huxleyi and, to a lesser extent, Phaeocystis spp. Synechococcus abundances returned to ambient levels by day 4, as did nanoflagellate abundances by day 14 (Boyd et al. 2004). Diatom stocks showed few apparent changes between days 1 to 5. Thereafter from day 6, exponential increases in the abundance of diatoms induced a bloom condition (Fig. 12a). The diatom stocks reached their peak on day 17 following which there was a subsequent decline in the stocks. The most dramatic increase was by the small pennate diatom, Pseudo-nitzschia spp. Despite the general decline, diatom stocks remained more abundant than the initial numbers until the end of the experiment on day 25 (Boyd et al. 2005a). By contrast, the small centric diatom Chaetoceros debilis was the dominant diatom responding to Fe enrichment during the SEEDS study conducted in the western subarctic Pacific (Tsuda et al. 2003).
3.1.2. Assessment of bioavailable Fe using the Fe Bioreporter BMB04. The picophytoplankton not only contribute to carbon cycling in the open ocean but also represent an important reservoir of Fe that is released via nanoflagellate grazing and viral lysis (Harrison et al.2004; McKay et al. 2005b; Strzepek et al. 2005). Picocyanobacteria sampled in the vicinity of ocean station Papa are characterized by possessing a high Fe quota satisfied in part through elevated uptake rates for Fe (Tortell et al. 1999).
Assessment of available Fe in samples collected during the SERIES Fe enrichment experiment using the Fe bioreporter adds an important component to our understanding of Fe 59
biogeochemistry of picophytoplankton. Samples for bioreporter analysis were collected from the
euphotic mixed layer (10 m depth) between day 1 and day 11 of the study. A dose-response
curve generated using synthetic Medium A of known free ferric ion concentration was best
characterized by a three parameter sigmoidal standard curve with DFe ranging between pFe 20.6
- 22.4 (Fig. 13). Use of the bioreporter to assess Fe in the SERIES samples demonstrated our
standards to be out of range compared to the environmental samples (Fig. 14). In all cases,
SERIES samples elicited higher luminescence from the bioreporter than did the lowest Fe- containing standard (pFe 22.4). Despite this, the bioreporter resolved genuine differences between samples collected at different times of the study and thus can be considered a qualitative tool to assess differences in Fe availability among these open ocean samples. Reflecting this, the sample collected one day after Fe fertilization (11 July) elicited 20% lower luminescence than did the control sample collected from outside of the patch (two-tailed t-test; P < 0.0005) consistent with the higher DFe (> 1 nmol kg-1) measured at this time. When the “out patch”
sample was spiked with 1000 nmol kg-1 of Fe as a control, bioreporter luminescence was
quenched completely, confirming that the luminescent response was Fe dependent (Fig. 14).
DFe measured during SERIES showed a transient increase to > 1 nmol kg-1 on
day 1 (11 July) following Fe fertilization with levels decreasing thereafter through day 6 (17
July) when additional Fe was infused to the patch (Fig. 14). Consistent with this, the bioreporter
response was lowest associated with the sample from day 1. This was followed by a 32%
increase (two-tailed t-test; P < 0.0005) in bioluminescence through day 6 indicating lower Fe
availability as the study progressed following the initial infusion of Fe. Bioluminescence elicited
60
220
200
-1
s 180 5
x 10 -1 160
RLU cell RLU 140
120
R2 = 0.9671 100 20.4 20.6 20.9 21.4 22.4 pFe
Figure 13. Dose-response curve of the bioreporter derived using synthetic
Medium A of known Fe concentration conveyed as pFe.
[= − log (Fe+3 free ferric)]
61
1200 Bioreporter 1.4 * Dissolved Fe * * * 1.2
-1 1.0 1000 s 5
0.8 x 10 -1
DFe 0.6
RLU cell 800 0.4 **
0.2 50 *** 45 0.0
40 OUT11131415161718192122231000 nM Fe Sample Figure 14. Bioreporter response plotted with measured concentrations of DFe.
Circles represent the bioluminescence generated by the bioreporter and squares
represent DFe in nmol kg-1. A sample collected from the “out” patch on 11 July 2002
is shown at the far left. Asterisks (*. **, ***) demonstrate significance as compared
to the “out” sample (p < 0.005) (n = 5). 1000 nM Fe: negative control where the
“out” sample has been amended with 1000 nmol kg-1 Fe.
62
from samples collected between days 5-8 was higher (two-tailed t-test; P < 0.05) than the “out
patch” sample. On day 6, additional Fe was infused to the patch; however, this did not result in
lowered bioreporter luminescence on day 7 (two-tailed t-test; P = 0.09; df = 3). Whereas the
bioreporter showed seemingly no response to the second Fe infusion, other physiological
parameters (e.g. chlorophyll, Fv / Fm, Fd Index) of the endemic phytoplankton community
increased (Boyd et al. 2004; 2005a).
The lack of response by the bioreporter to the second Fe infusion was unexpected,
although, by this time, the patch may have already contained high levels of Fe binding ligands as
a result of grazing and viral lysis (Hutchins et al. 1999). We submit that the Fe bound to these
dissolved organic ligands may not be readily accessible to the bioreporter. From the IronEx-II
mesoscale Fe enrichment experiment conducted in the equatorial Pacific, it was demonstrated
that classes of both strong and weak Fe binding ligands had increased by 400 times within the
first two days following a Fe infusion (Rue and Bruland, 1997). In spite of the high
concentrations of these ligands, a diatom bloom was observed during IronEx-II. This is
consistent with the specific mechanism of Fe acquisition by diatoms which rely on cell surface
ferri-reductase activity compared to the use of siderophores by cyanobacteria (Hutchins et al.
1999).
3.2. Rhisosolenia Mats in the Pacific (RoMP): Central North Pacific Gyre
3.2.1. RoMP Overview. During the cruise, the ship traversed the atolls of the northwest
Hawaiian Islands at 28 ° N (Fig. 15). Surface water nitrate was generally ca. 2 nmol L-1 whereas surface ammonium was < 30 nmol L-1 (Singler and Villareal, 2005). Surface SRP was near the 63
assay detection limit. Vertical water column profiles showed a deep nutricline extending below
100 m and low phytoplankton biomass typical of the CNP gyre (Fig. 16). The vertically buoyant
diatoms Ethmodiscus and Rhizosolenia were present at most stations. For Ethmosdiscus, abundance varied 20-fold between stations, from < 0.1 to > 2.0 cells m-3 (R.M.L. McKay and
T.A. Villareal, unpublished). Likewise, mats of Rhizosolenia were abundant (average: 0.27 mats
m-3), with R. fallax, R. castracanei H. Peragallo and R. acuminata H. Peragallo being the
dominant species present in mats (Singler and Villareal, 2005). At stations located along the
eastern reaches (154 – 166 °W) of the cruise transect, puffs of the colonial diazotrophic
cyanobacterium Trichodesmium spp. (primarily as T. thiebautii) were common. Consistent with
this observation, reports of Trichodesmium blooms have been recorded in summers during the
past decade near time-series station ALOHA located at 22°45 N, 158° W (Karl et al. 1997;
Wilson, 2003). Elsewhere along the transect, we encountered a high abundance of the
bioluminescent dinoflagellate Pyrocystis spp. at stations in the vicinity of Midway Island and
there was a dense bloom of the diatom Hemiaulus hauckii between 172° W and 180° W.
Coincident with this bloom was an increase in surface water ammonium levels (<200 nmol L-1)
likely associated with dinitrogen fixation by Richelia, a cyanobacterial symbiont of Hemiaulus.
Physiological analyses were conducted along the transect. Whereas cells of Ethmodiscus
showed little evidence of P deficiency as measured by determining rates of alkaline phosphatase
activity (Fig. 17), both Pyrocystis and Trichodesmium possessed high rates of activity diagnostic
of severe P-stress. Likewise, Rhizosolenia was severely P-deficient (data not shown).
Photochemical energy conversion efficiency (Fv/Fm) was measured for both Rhizosolenia and
Ethmodiscus. Whereas Ethmodiscus maintained high efficiency (ca. 0.7) along the entire cruise
64
Figure 15. Stations sampled for this study. Stations numbers in bold are 2003.
Figure 16. Contour plots of nitrate and chlorophyll distributions from Sta. 1 –12. Sta. 9 is approximately 177° W, Sta. 10 is approximately 179° E. A. Nitrate+nitrite. Contour intervals are µmol L-1, B. Chl a. Contour intervals are µg chl a L-1 (plots courtesy of Dr.
T.A. Villareal) 65
track, Rhizosolenia showed a marked decrease in Fv / Fm as we proceeded west, especially past
170° W (Fig. 8), suggesting a gradient of increasing physiological stress.
3.2.2. Assessment of bioavailable Fe using the Fe bioreporter BMB04. Studies of plankton distribution in surface waters of the CNP gyre demonstrate that the picocyanobacteria
Prochlorococcus and Synechococcus are the dominant planktonic autotrophs in terms of biomass
(Karl, 2002; De Long et al. 2006). Picocyanobacteria being the dominant taxa in this region, it was appropriate that we assessed Fe bioavailability using a cyanobacterial bioreporter.
A three parameter sigmoidal dose-response curve was generated using the bioreporter incubated in synthetic Medium A containing free ferric ion between pFe 20.6 - 22.4 (Fig. 18A,
Eq. 1). Consistent with our experience with other open ocean samples (SERIES and FeCycle, data not shown), samples from the RoMP transect elicited higher bioreporter luminescence than did the standards used to generate the dose-response curve. The luminescent response from each of the samples was ca. 5 × higher than the standards. Thus, the Fe bioreporter must once again be considered a qualitative tool when analyzing these samples.
Despite our inability to use the bioreporter quantitatively with samples from RoMP, we observed genuine and meaningful differences in Fe availability along the E→W transect (Fig.
18B). Specifically, as we proceeded west along the transect at ca. 28º N latitude, bioreporter luminescence increased > 4 × from station 5 (168.69° W) to station 9 (175.43° E) (two-tailed t- test; P < 0.0005). Among the most easterly stations, the sample from station 3 (162.92º W) elicited a nearly 2-fold higher response from the bioreporter indicating lower bioavailability at this station compared to station 1 (156.22º W) (paired t-test). 66
Comparing the bioreporter response along the transect with the plot for Rhizosolenia
Fv/Fm, it is striking in that they are nearly inverse images of each other. To the east of 168° W,
Rhizosolenia Fv/Fm was near maximal at ca. 0.6 whereas the bioreporter response was low, indicating higher Fe availability compared to the waters west of 168° W. West of this longitude,
Fv/Fm decreased to ca. 0.4, indicative of cells that were physiologically stressed. Likewise, the
response of the cyanobacterial bioreporter was similarly indicative of physiological stress,
although due to the characterized Fe-responsive nature of the reporter, the specific stress could
be identified as low Fe availability.
Limitation imposed by various nutrients, including Fe, imparts a characteristic signature
on the in vivo chl a fluorescence profile of phytoplankton (Falkowski et al. 1992, Falkowski and
Kolber, 1995). Employing this approach, Falkowski and colleagues successfully developed fast-
repetition rate fluorometry (FRRF) to assess phytoplankton Fe deficiency in laboratory culture
and field studies (Falkowski et al. 1992; Falkowski and Kolber, 1995; Behrenfeld et al. 1996;
Behrenfeld and Kolber, 1999). Thus, the measured pattern of Rhizosolenia Fv/Fm was consistent
with Fe deficiency.
Unfortunately, DFe data are not yet available from our study and at this point, we are forced to
rely on DFe data from other studies in the CNP gyre for a broad interpretation of our results. In
the CNP, the distribution of Fe appears as a macronutrient-type profile (Landing and Bruland,
1987; Martin and Gordon, 1988; Martin et al. 1989; Bruland et al. 1991, 1994; Rue and Bruland,
1995; Butler, 1998; Wu et al. 2001) where concentrations of DFe are elevated in deep waters
compared to levels measured in the upper seasonal thermocline. Surface mixed layer
concentrations of 0.02 – 0.38 nmol kg-1 have been measured at 28° N and 155° W, about 200 m
north of Hawaii (Vertex IV station) (de Baar and de Jong, 2001). Despite this general profile, 67
Figure 17. Alkaline phosphatase activity in Ethmodiscus, Pyrocystis and
Trichodesmium along the transect. Error bars are standard deviation. An error bar of 73 nmol P µg chl-1 min-1 i s left off of the Trichodesmium point above the axis break for clarity.
68
180 A
160
-1 s 5
10 x 140 -1
RLU cell RLU 120
100 178.90 Equation 1 y = − x − 20.33 ( 0.63 ) {1 + e } 80 20.6 20.9 21.4 22.4 pFe
0.8 B Bioreporter response 5250 F / F v m
4500 0.6 -1 s
5 3750 x 10
-1 0.4 3000 yield
RLU cell 2250 0.2 1500
750 0.0
175 25.80 E 25.80 175 111 111 m DCM 179 20.40 W 20.40 179 W 00.00 174 W 20.17 172 W 41.26 168 W 32.40 166 W 55.20 162 W 41.64 159 W 13.29 156 Longitude οW Figure 18. Bioreporter response to standards and samples (n = 3). A. Dose-response curve of bioluminescence expressed by the bioreporter in response to various pFe in synthetic Medium A; B. Circles represent the bioluminescence generated by the
bioreporter and squares represent represent Fv / Fm measured for Rhizosolenia. 69
however, DFe is elevated slightly, to ca. 1 nmol kg-1, in very near surface waters of the CNP
(Bruland et al. 1994; Wu et al. 2001). This is important to note since our sampling was
conducted just below the air-sea interface where such “elevated” concentrations of DFe were
expected to exist.
Despite providing a general framework for estimating DFe concentrations we might
expect to encounter along our transect, the information provided above provides little insight into
longitudinal variability in DFe or on the quantity and quality of Fe-binding ligands. The latter
aspect is especially important since the speciation of Fe in natural waters is dominated by
complexation to naturally-occurring organic ligands. Indeed, upwards of 99.9% of Fe3+ in ocean
surface waters is complexed to organic ligands belonging to two major functional classes
(stronger “L1” and weaker “L2” ligand classes) distinguished by their stability constants (Rue
and Bruland, 1995; 1997; Witter et al. 2000; Wu et al. 2001). Although the Fe-complexing
ligands are generally of unknown type, they possess Fe-specific conditional stability constants
within the range reported for siderophores and for the Fe-porphyrin moiety of cytochrome (Rue
and Bruland, 1995, 1997; Witter et al. 2000). Further, it is becoming clear from our
investigations on Fe availability in freshwater systems that the bioavailability of Fe does not always and reliably relate to the concentration of DFe, but rather, likely varies due to differences in the type (Hutchins et al. 1999) and the recalcitrancy (Maranger and Pullin, 2003) of organic iron-complexing ligands.
We also compared Fe availability at depth with a surface mixed layer sample from one station (Station 8: 174º W). As stated earlier, vertical profiles of DFe generally exhibit a classic nutrient-type profile (Butler, 1998) consistent with remineralization of Fe from detritus at depth.
Consistent with this, bioavailable Fe as determined by the cyanobacterial bioreporter was higher 70 at depth (111 m) compared to the surface water sample. This was reflected by a nearly 4 × lower bioluminescent signal elicited from the deep water sample compared to the surface sample (two- tailed t-test; P < 0.001).
4. Conclusion
Most of the oliogotrophic waters in the world oceans are well documented to be dominated by picophytoplankton. The Fe bioreporter developed and characterized in Chapter II is a member of the picophytoplankton and was demonstrated to be a useful tool in assessing available Fe in the Baltic Sea. Here, we have demonstrated that the Fe bioreporter can also be used to assess Fe availability in oligotrophic marine environments, although not in a quantitative capacity.
HNLC regions of the northeast subarctic Pacific Ocean are Fe-limited and dominated by picophytoplankton. Our attempts to assess Fe bioavailibity using the bioreporter associated with the mesoscale Fe enrichment experiment, SERIES demonstrated clear differences in Fe bioavailability to exist over the course of the experiment.
Oligotrophic waters of the CNP gyre are also dominated by picophytoplankton. The bioreporter response was suggestive of lower Fe availability in western reaches of the transect and was thus consistent with changes we observed in photochemical conversion efficiency
(Fv/Fm) associated with the diatom Rhizosolenia. At this time, chemical analysis of DFe has not yet been completed and thus, we were unable to compare the response of the bioreporter to this parameter.
71
REFERENCES
Althaus, E.W., Outten, C.E., Olson, K.E., Cao, H., and O’Halloran, T.V. The ferric uptake
regulation (Fur) repressor is a zinc metalloprotein. Biochem. 1999, 38: 6559– 6569.
Andersson, C.R., Tsinoremas, N. F., Shelton, J., Lebedeva, N. V., Yarrow, J., Min, H. T.,
and Golden, S. S. Application of bioluminescence to the study of circadian rhythms in
cyanobacteria. Methods Enzymol. 2000, 305: 527-542.
Armbrust, E.V., et al. The genome of the diatom Thalassiosira pseudonana: Ecology, evolution,
and metabolism. Science 2004, 306: 79-86.
Bachmann, T. Transforming cyanobacteria into bioreporters of biological relevance. Trends
Biotechnol. 2003, 21: 247-249
Behrenfeld, M. J., Bale, A. J., Kolber, Z. S., Aiken, J., Falkowski, P. G. Confirmation of iron
limitation of phytoplankton photosynthesis in the equatorial Pacific Ocean. Nature 1996, 383:
508-511.
Behrenfeld, M., and Kolber, Z. Widespread iron limitation of phytoplankton in the south
Pacific ocean. Science 1999, 283: 840–843.
Belkin, S. Microbial whole cell sensing systems of environmental pollutants. Curr. Opin.
Microbiol. 2003, 6:206-212.
Benitez-Nelson, C.R. The biogeochemical cycling of phosphorus in marine systems. Earth Sci.
Rev. 2000, 51: 109-135.
Bertilsson, S., Berglund, O., Karl, D. M., and Chisholm, S. W. Elemental composition of
marine Prochlorococcus and Synechococcus: Implications for the ecological stoichiometry of the
sea. Limnol. Oceanogr. 2003, 48: 1721-1731. 72
Bibby, T. S., Nield, J., and Barber, J. Iron deficiency induces the formation of an antenna ring
around trimeric photosystem I in cyanobacteria adapted. Nature 2001, 412:743-745.
Bjorkman, K. M. and Karl, D. M. Bioavailability of dissolved organic phosphorus in the euphotic zone at Station ALOHA, North Pacific Subtropical Gyre. Limnol. Oceanogr. 2003,
48:1049–1057
Boyd, P.W. and Harrison, P.J. Phytoplankton dynamics in the NE subarctic Pacific. Deep-Sea
Research II 1999, 46: 2405-2432.
Boyd, P.W., et al. A mesoscale phytoplankton bloom in the polar Southern Ocean stimulated by
iron fertilization. Nature 2000, 407:695-702.
Boyd, P. W. The role of iron in the biogeochemistry of the Southern Ocean and equatorial
Pacific: A comparison of in situ iron enrichments. Deep-Sea Res. II 2002, 49: 1803–1822.
Boyd, P. W., et al. The decline and fate of an iron-induced subarctic phytoplankton bloom.
Nature 2004, 428: 549–553.
Boyd P. W., et al. The evolution and termination of an iron-induced mesoscale bloom in the
northeast subarctic Pacific. Limnol. Oceanogr. 2005a, 50: 1872-1886.
Boyd, P.W., et al. FeCycle - attempting an iron biogeochemical budget from a mesoscale SF6
tracer experiment in unperturbed low iron waters. Global Biogeochem. Cycles 2005b, 19:
GB4S20, doi: 10.1029/2005GB002494.
Brennan, C. A., et al. A molecular sensor system based on genetically engineered alkaline phosphatase. Proc. Natl. Acad. Sci. USA 1995, 92: 5783-5787.
Brettar, I., Moore, E. R. B., and Höfle, M. G. Phylogeny and abundance of novel denitrifying bacteria isolated from the water column of the central Baltic Sea. Micro Ecol. 2001, 42: 295-
305. 73
Bruland, K. W., Donat, J. R. and Hutchins, D. A. Interactive influences of bioactive trace
metals on biological production in oceanic waters. Limnol. Oceanogr. 1991, 36: 1555-1577.
Bruland, K.W., Orians, K.J. and Cowen, J.P. Reactive metals in the stratified central North
Pacific. Geochim. Cosmochim. Acta 1994, 58:3171-82.
Brzezinksi, M.A., Villareal, T.A., Lipschulz, F. Silica production and the contribution of diatoms to new and primary production in the central North Pacific. Mar. Ecol. Prog. Ser.
1998, 167: 89-101.
Butler, A. Acquisition and utilization of transition metal ions by marine organisms. Science
1998, 281: 207-210.
Campbell, D., Hurry, V., Clarke., Gustafsson, P., and Oquist, G. Chlorophyll fluorescence
analysis of cyanobacteria photosynthesis and acclimation. Microbiol. Mol. Biol. Rev. 1998, 62:
667-683.
Canini, A., Albertano, P., and Caiola, M.G. Localization of Fe-containing superoxide
dismutase in cyanobacteria from the Baltic Sea: depth and light dependency. New Phytologist
1998, 139: 247–254.
Carpenter, S. R. Microcosm experiments have limited relevance for community and ecosystem
ecology. Ecology 1996, 77: 677-680.
Chase, Z., and Price, N. M. Metabolic consequences of iron deficiency in heterotrophic marine
protozoa. Limnol. Oceanogr. 1997, 42: 1673–1684.
Chisholm, S.W., and Morel, F.M.M. What controls phytoplankton production in nutrient rich
areas of the open sea. ASLO symposium, 22-24 Ferbruary 1991, San Marcos, CA. Preface.
Limnol. Oceanogr. (Special issue) 1991, 36: U1507–U1511.
Chisholm, S. W. What limits phytoplankton growth? Oceanus 1992, 35:36-46. 74
Cline, T., and Hastings J. W. Temperature-sensitive mutants of bioluminescent bacteria. Proc.
Natl. Acad. Sci. USA 1971, 68: 500 -504.
Coale, K. H., et al. A massive phytoplankton bloom induced by an ecosystem-scale iron fertilization experiment in the equatorial Pacific Ocean. Nature, 1996 383, 495– 501.
Coale, K.H., et al. Southern Ocean iron enrichment experiments (SOFeX): carbon and silicon cycling in high- and low-Si waters. Science 2004, 304: 408-414.
Coleman, M. L., Sullivan, M. B., Martiny, A. C., Steglich, C., Barry, K., DeLong, E. F., and
Chisholm, S. W. Genomic islands and the ecology and evolution of Prochlorococcus. Science
2006, 311:1768-1770.
Croot, P.L. and Johansson, M. Determination of iron speciation by cathodic stripping voltammetry in seawater using the competing ligand 2-(2-Thiazolylazo)-p-cresol (TAC).
Electroanalysis 2000, 12: 565-576
Daunert, S., Barrett, G., Feliciano, J.S., Shetty, R.S., Shrestha, S., and Smith-Spencer, W.
Genetically engineered whole-cell sensing systems: coupling biological recognition with reporter genes. Chem. Rev. 2000, 100: 2705–2738. de Baar, H.J.W., and de Jong, J.T.M. Distributions, sources and sinks of iron in seawater. In:
The biogeochemistry of Fe in seawater. Turner, D.R., and Hunter, K.A. [eds.], Wiley, New York,
NY. 2001, p. 123–253. de Baar, H. J. W., et al. Synthesis of iron fertilization experiments: From the Iron Age in the
Age of Enlightenment. J. Geophys. Res., 2005110: C09S16, doi:10.1029/2004JC002601.
DeLong E. F. et al. Community genomics among stratified microbial assemblages in the ocean's interior. Science 2006, 311: 496-503. 75
DePinto, J.V., T.C. Young, and S.C. Martin. Algal-available phosphorus in suspended sediments from lower Great Lakes tributaries. J. Great Lakes Res. 1981, 7:311–325.
Durham, K.A., Porta, D., Twiss, M.R., McKay R.M.L., and Bullerjahn, G.S. Construction and initial characterization of a luminescent Synechococcus sp. PCC7942 Fe-dependent bioreporter. FEMS Microbiol. Letts. 2002, 209: 215-221.
Durham, K.A., D. Porta, R.M.L. McKay and G.S. Bullerjahn. Expression of the iron- responsive irpA gene from the cyanobacterium Synechococcus sp. strain PCC 7942. Arch.
Microbiol. 2003, 179: 131-134.
Dyhrman, S. T., et al. Phosphonate utilization by the globally important marine diazotroph
Trichodesmium. Nature 2006, 439: 68-71.
Eldridge M.L., Trick C.G., Alm M.B., DiTullio G.R., Rue E.L., Bruland K.W., Hutchins
D.A., Wilhelm S.W. Response of the marine phytoplankton community to a manipulation of bioavailable iron in HNLC waters of the subtropical Pacific Ocean. Aquat. Microb. Ecol. 2004,
34: 79-91.
Falciatore A., Ribera d'Alcalà, M., Croot P., Bowler C. Perception of environmental signals by a marine diatom. Science 2000, 288:2363–66.
Falciatore, A., and Bowler, C. Revealing the molecular secrets of marine diatoms. Annu. Rev.
Plant Biol. 2002, 53: 109-130.
Falkowski, P.G., Greene, R.M., Geider, R.J. Physiological limitations on phytoplankton productivity in the ocean. Oceanography 1992, 5: 84-91.
Falkowski, P.G., Kolber, Z. Variations in chlorophyll fluorescence yields in phytoplankton in the world oceans. Aust. J. Plant Physiol. 1995, 22: 341-355. 76
Falkowski, P. G., Barber, R. T., and Smetacek, V. Biogeochemical controls and feedbacks on
ocean primary production. Science 1998, 281: 200-206
Fernández, E., Marañón, E., Serret, P, Morán, X. A. G. Potential causes for the unequal
contribution of picophytoplankton to total biomass and productivity in oligotrophic waters. Mar
Ecol-Prog Ser. 2003, 254: 101-109.
Flores, F.J., Rincón, J., and Martín, J.F. Characterization of the iron-regulated desA promoter of Streptomyces pilosus as a system for controlled gene expression in actionomycetes. Microbial
cell Factories 2003, 2:5. Internet address: www.microbialcellfactories.com/content/2/1/5.
Frank, V.M., Bruland, K.W., Hutchins, D.A., and Brzezinski, M.A. Iron and zinc effects on
silicic acid and nitrate uptake kinetics in three high-nutrient low chlorophyll (HNLC) regions.
Mar Ecol. Prog. Ser. 2003, 252: 15–33.
Fung, I.Y., Meyn, S.K., Tegen, I., Doney, S.C., John, J.G., and Bishop, J.K.B. Iron supply and demand in the upper ocean, Global Biogeochem. Cycles 2000, 14: 281-295.
Geider, R.J., and La Roche, J. The role of iron in phytoplankton photosynthesis, and the potential iron-limitation of primary productivity in the sea. Photosynthesis Res. 1994, 39: 275–
301.
Geiss U., Vinnemeier J., Kunert A., Lindner I., Gemmer B., Lorenz M., Hagemann M., and
Schoor A. Detection of the isiA gene across cyanobacterial strains: Potential for probing iron deficiency. Appl. Environ. Microbiol. 2001, 67: 5247-5253.
Geiss U., Selig U., Schumann R., Steinbruch R., Bastrop R., Hagemann M., and Schoor A.
Investigations on cyanobacterial diversity in a shallow estuary (Southern Baltic Sea) including genes relevant to salinity resistance and iron starvation acclimation. Environ. Microbiol. 2004,
6, 377-387. 77
Gervais, F., Riebesell, U., and Gorbunov, M.Y. Changes in primary productivity and chlorophyll a in response to iron fertilization in the Southern Polar Frontal Zone. Limnol.
Oceanogr. 2002, 47: 1324-1335.
Ghassemian, M., and Straus. N. A. Fur regulates the expression of iron-stress genes in the cyanobacterium Synechococcus sp. strain PCC7942. Microbiology 1996, 142: 1469-1476.
Gillor, O., Hadas, O., Post, A. F., and Belkin, S. Phosphorus bioavailability monitoring by a bioluminescent cyanobacterial sensor strain. J. Phycol. 2002, 38: 107-115.
Gillor O, H.A., Hadas, O, Post A.F, and Belkin, S. A Synechococcus PglnA::luxAB fusion for estimation of nitrogen bioavailability to freshwater cyanobacteria. Appl Environ Microbiol.
2003, 69: 1465-74.
Gobler, C. J., Hutchins, D. A., Fisher, N. S., Cosper, E. M., and Sanudo-Wilhelmy, S. A.
Release and bioavailability of C, N, P, Se, and Fe following viral lysis of a marine chrysophyte.
Limnol. Oceanogr. 1997, 42: 1492– 1504.
Goericke, R., and Welschmeyer, N. A. The marine prochlorophyte Prochlorococcus contributes significantly to phyto plankton biomass and primary production in the Sargasso Sea.
Deep-Sea Res. 1993, 40: 2283–2294.
Gran, H.H. On the conditions for the production of phytoplankton in the Sea. Rapp. P.-V. des
Réunions, Cons. Int. Explor. Mer. 1931, 75: 37–46.
Gress C. D., Treble G.R., Matz J. C., Weger G. H. Biological availability of iron to the freshwater cyanobacterium Anabaena flos-Aquae. J. Phycol. 2004, 40: 879–886
Harms, H., Wells, M. C., van der Meer, J.R. Whole-cell living biosensors-are they ready for environmental application? Appl Microbiol Biotechnol. 2006, Feb 7:1-8
78
Harrison, P.J., Whitney, F.A., Tsuda, A., Saito, H., and Tadokoro, K. Nutrient and plankton
dynamics in the NE and NW gyres of the Subarctic Pacific Ocean. J. Oceanography 2004, 60: 5-
29.
Hart, T.J. On the phytoplankton of the Southwest Atlantic and Bellinghausen Sea. 1929-1931.
Discov. Rep. 1934, 8: 1–268.
Hassler, C.S., Twiss, M.R., McKay, R.M.L., Bullerjahn, G.S. Optimization of iron-dependent
cyanobacterial (Synechococcus, Cyanophyceae) bioreporters to measure iron bioavailability. J.
Phycol. 2006a, 42: 324-335.
Hassler, C. S., Twiss, M.R. Bioavailability of iron sensed by a phytoplanktonic Fe-bioreporter.
Environ. Sci. and Technol. 2006b, in Press.
Herut, B., Shoham-Frider, E., Kress, N., Fiedler, U., Angel, D. L., Hydrogen peroxide production rates in clean and polluted coastal marine waters of the Mediterranean, Red and
Baltic Seas. Mar. Pollut. Bull. 1998, 36: 994-1003.
Höfle, M. G., and Brettar. I. Taxonomic diversity and metabolic activity of microbial
communities in the water column of the central Baltic Sea. Limnol. Oceanogr, 1995, 40:868-874.
Hoppe H. G. Phosphatase activity in the sea. Hydrobiologia 2003, 187: 187-200.
Hutchins D.A., DiTullio, G.R. and Bruland, K.W. Iron and regenerated production: evidence
for biological iron recycling in two marine environments. Limnol. Oceanogr. 1993, 38: 1242 -
1255.
Hutchins, D. A., Wang, W. X., and Fisher, N. S. Copepod grazing and the biogeochemical fate
of diatom iron. Limnol. Oceanogr. 1995, 40: 989– 994.
Hutchins, D.A., Di Tullio, G.R., Zhang, Y., and Bruland, K.W. An iron limitation mosaic in
the California upwelling regime. Limnol. Oceanogr. 1998, 43: 1037–1054. 79
Hutchins, D.A., Witter, A.E., Butler, A., and Luther, G.W. III. Competition among marine
phytoplankton for different chelated iron species. Nature 1999, 400: 858-861.
Hutchins, D.A. et al. Phytoplankton iron limitation in the Humboldt Current and Peru
Upwelling. Limnol. Oceanogr. 2002, 47: 997–1011.
Ivanikova, N. V., McKay, R. M. L., Bullerjahn, G. S. Construction and characterization of a
cyanobacterial bioreporter capable of assessing nitrate assimilatory capacity in freshwaters.
Limnol. Oceanogr.: Methods 2005, 3: 86-93
Jickells, T. D., et al. Global iron connections between desert dust, ocean biogeochemistry, and
climate. Science 2005, 308: 67-71.
Johnson, K. S., Gordon, R. M., and Coale K. H. What controls dissolved iron concentrations
in world ocean? Marine chem. 1997, 57: 137-161.
Johnson, Z.I., Zinser, E.R., Coe A., McNulty N.P., Woodward E.M.S., and Chisholm S.W.
Niche partitioning among Prochlorococcus ecotypes along ocean-scale environmental gradients.
Science 2006, 311: 1737-1740.
Karl, D., Letelier, R., Tupas, L., Dore, J., Christian, J., and Hebel, D. The role of nitrogen
fixation in biogeochemical cycling in the subtropical North Pacific Ocean. Nature 1997, 388:
533-538.
Karl, D.M., and Tien, G. Temporal variability in dissolved phosphorus concentrations in the
subtropical North Pacific Ocean. Mar. Chem. 1997, 56:77–96.
Karl, D. M. A sea of change: biogeochemical variability in the North Pacific Subtropical Gyre.
Ecosystems 1999, 2:181–214
Karl, D. M. Nutrient dynamics in the deep blue sea. Trends Microbiol. 2002, 10: 410-418. 80
Kazakov, A. E., Vassieva, O., Gelfand, M. S., Osterman, A., Overbeek, R. Bioinformatics classification and functional analysis of PhoH homologs. In Silico Biol. 2003, 3: 3-15.
Keren, N., Aurora, R. and Pakrasi, H. B. Critical roles of bacterioferritins in iron storage and proliferation of cyanobacteria. Plant Physiol. 2004, 135: 1666-1673.
Khang, Y.H., Yang, Z.K., and Burlage, R.S. Measurement of iron-dependence of pupa promoter activity by a pup-lux bioreporter. J. Microbiol. Biotechnol. 1997, 7: 352– 355.
Kienast, S. S., Hendy, I. L., Crusius, J., Pedersen T. F., and Calvert, S. E. Export Production in the Subarctic North Pacific over the Last 800 kyrs: No Evidence for Iron Fertilization? J.
Oceanography 2004, 60: 189-203.
Kim, S. K., et al. Molecular analysis of the phoH gene, belonging to the phosphate regulon in
Escherichia coli. J. Bac. 1993, 175: 1316-1324.
King, J. M. H., DiGrazia, P. M., Applegate, B., Burlage, R., Sanseverino, J., Dunbar, P., and others. Rapid, sensitive bioluminescent reporter technology for naphthalene exposure and biodegradation. Science 1990, 249: 778–781.
Kirchman, D. L. Microbial ferrous wheel. Nature 1996, 383: 303–304.
Kolber, Z., Falkowski, P.G. Use of active fluorescence to estimate phytoplankton photosynthesis in situ. Limnol. Oceanogr. 1993, 38: 1646-1665.
Kolber, Z.S., Barber, R.T., Coale, K.H., Fitzwater, S.E., Greene, R.M., Johnson, K.S.,
Lindley, S., and Falkowski, P.G. Iron limitation of phytoplankton photosynthesis in the equatorial Pacific Ocean. Nature 1994, 371: 145-149.
Kunert, A., Hagemann, M., and Erdmann, N. Construction of promoter probe vectors for
Synechocystis PCC 6803 using the light emitting reporter systems Gfp and LuxAB. J. Microbiol.
Methods 2000, 41: 185-194. 81
Landing, W.M., and Bruland, K.W. The contrasting biogeochemistry of iron and manganese
in the Pacific Ocean. Geochim. Cosmochim. Acta. 1987, 51: 29-43.
Landry, M.R., Kirshtein, J., and Costantinou, J. Abundances and distributions of picoplankton populations in the central equatorial Pacific from 12° N to 12° S, 140° W. Deep-
Sea Res 1996, 43: 871–890.
LaRoche, J., Boyd, P. W., McKay, R. M. L., Geider, R. J. Flavodoxin - an in situ diagnostic
marker for phytoplankton iron stress along a transect in the NE Subarctic Pacific. Nature 1996,
382: 802-805
Leonhardt, K., and Straus, N. A. An iron stress operon involved in photosynthetic electron
transport in the marine cyanobacterium Synechococcus sp. PCC 7002. J Gen Microbiol. 1992,
138: 1613-1621.
Leveau, J.H.J, and Lindow, W.E. Bioreporters in microbial ecology. Curr Opin Microbial.
2002, 5:259-265.
Loper, J. E., and Lindow, S. E. A biological sensor for iron available to bacteria in their
habitats on plant surfaces. Appl. Environ. Microbiol. 1994, 60: 1934–1941.
Maldonado, M.T., and Price, N.M. Nitrate regulation of Fe reduction and transport by Fe-
limited Thalassiosira oceanica. Limnol. Oceanogr. 2000, 45: 814-826.
Mann, E. L., Ahlgren, N., Moffett, J. W., and Chisholm, S. W. Copper toxicity and
cyanobacteria ecology in the Sargasso Sea. Limnol. Oceanogr. 2003, 47: 976-988.
Maranger, R., Bird, D. F., and Price, N. M. Iron acquisition by photosynthetic marine
phytoplankton from ingested bacteria. Nature 1998, 396: 248– 251.
Maranger, R., and Pullin, M. J. Elemental complexation by dissolved organic matter in lakes:
Implications for Fe speciation and the bioavailability of Fe and P. In Findlay. S. E. G. and 82
Sinsabaugh, R. L. (eds.), Aquatic ecosystems: Interactivity of dissolved organic matter.
Academic Press, San Diego, CA, 2003, pp. 185-214.
Marañón, E., Holligan, P. M., Barciela, R., González, N., Mouriño, B., Pazó, M. J., Varela,
M. Patterns of phytoplankton size–structure and productivity in contrasting open ocean environments. Mar Ecol-Prog Ser. 2001, 216: 43-56.
Marie-Andree, D., and Billard, P. Whole-cell bacterial sensors for the monitoring of phosphate bioavailability. J. Microb. Methods 2003, 55: 221-229.
Martin J. H., and Gordon R. M. Northeast Pacific iron distributions in related to phytoplankton productivity. Deep-Sea Res. 1988, 35: 177-196.
Martin, J. H., and Fitzwater, S. E. Iron deficiency limits phytoplankton growth in the northeast
Pacific subarctic. Nature 1988, 331: 341–343.
Martin, J. H., Gordon, R. M., Fitzwater, S., and Broenkow, W. W. VERTEX: phytoplankton/iron studies in the Gulf of Alaska. Deep-Sea Res. 1989, 36: 649-680.
Martin, J.H. A new iron age, or a ferric fantasy. U.S. JGOFS News 1990 1: 5–11.
Martin, J. H., Fitzwater, S. E., and Gordon, R. M. Iron limits phytoplankton growth in
Antarctic waters, Global Biogeochem. Cycles 1990a, 4: 5–12.
Martin, J. H., Gordon, R. M., and Fitzwater, S. E. Iron in Antarctic water. Nature 1990b,
345: 156–158.
Martin, J. H. Iron as a limiting factor in oceanic productivity, in Primary Productivity and
Biogeochemical Cycles in the Sea. edited by P. G. Falkowski, and A. D.Woodhead, Springer,
New York 1992 pp. 123– 137.
Martin, J. H., et al. Testing the iron hypothesis in ecosystems of the equatorial Pacific Ocean.
Nature, 1994 371: 123– 129. 83
Mazouni, K., Domain, F., Chauvat, F., and Cassier-Chauvat, C. Expression and regulation of
the crucial plantlike ferredoxin of cyanobacteria. Mol Microbiol. 2003, 49: 1019–1029.
McKay, R. M. L., Geider, R. J., LaRoche, J. Physiological and biochemical response of the
photosynthetic apparatus of two marine diatoms to iron stress. Plant Physiol. 1997, 114: 615-
622.
McKay, R.M.L., Bullerjahn, G.S., Porta, D., Brown, E.T., Sherrell, R.M., Smutka, T.M.,
Sterner, R.W., Twiss M.R., and Wilhelm, S.W. Consideration of the bioavailability of iron in
the North American Great Lakes. Aquat. Ecosystem Health Manage. 2004, 7: 475-490.
McKay, R. M. L., et al.. Bioavailable iron in oligotrophic Lake Superior assessed using
biological reporters. J. Plankton Res. 2005a, 27: 1033-1044
McKay, R.M.L., et al. The impact of phytoplankton on the biogeochemical cycling of iron in
subantarctic waters southeast of New Zealand: Observations from the FeCycle study. Global
Biogeochem. Cycles, 2005b, 19: GB4S24, doi: 10.1029/2005GB002482.
Measures, C. I., Yuan, J., and Resing, J. A. Determination of Iron in Seawater by Flow
Injection-Analysis Using in-Line Preconcentration and Spectrophotometric Detection. Mar
Chem. 1995, 50: 3-12.
Meier H. E.M., Kauker F. Modeling decadal variability of the Baltic Sea: 2. Role of freshwater
inflow and large-scale atmospheric circulation for salinity. J. Geophys. Res. 2003, 108: 3368,
[doi: 10.1029/2003JC001799].
Michel, K. P., and Pistorius E. K. Adaptation of the photosynthetic electron transport chain in
cyanobacteria to iron deficiency: The function of IdiA and IsiA. Physiol Plant 2004, 120: 36-50. 84
Miller, E. S., Heidelberg, J. F., Eisen, J. A., Nelson, W. C., Durkin, A. S., et al. Complete genome sequence of the broad-host-range vibriophage KVP40: Comparative genomics of a T4- related bacteriophage. J. Bacteriol. 2003, 185: 5220–5233.
Mills, M.M., Ridame, C., Davey, M., La Roche J., and Geider, R.J. Iron and phosphorus co- limit nitrogen fixation in the eastern tropical North Atlantic. Nature 2004, 429: 292-294.
Mioni, C. E., Howard, A. M., Debruyn, J. M., Bright, N. G., Twiss, M.R., Applegate, B. M., and Wilhelm, S. W. Characterization and field trials of a bioluminescent bacterial reporter of iron bioavailability. Mar. Chem. 2003, 83: 31–46.
Montoya, J.P., Holl, C.M., Zehr, J.P., Villareal, T.A., and Capone, D.G. High rates of N2- fixation by unicellular diazotrophs in the oliogotrophic Pacific Ocean. Nature 2004, 430: 1027-
1031.
Moore, J.K., Doney, S.C., Glover, D.M., Fung, I.Y. Iron cycling and nutrient limitation patterns in surface waters of the world ocean. Deep-Sea Res. II, 2002 49: 463-508.
Nakamura, H., et al. A chemiluminescent FIA biosensor for phosphate ion monitoring using pyruvate oxidase. Biosens. Bioelectron. 1997, 12: 959-966.
Nausch, G., Matthaus, W., and Feistel, R. Hydro-graphisch-chemische Hydrographic and hydrochemical conditions in the Gotland Deep area between 1992 and 2003. Oceanologia 2003,
45: 557-569.
Ochsner U. A., Vasil M. L. Gene repression by the ferric uptake regulator in Pseudomonas aeruginosa: cycle selection of iron-regulated genes. Proc. Natl. Acad. Sci. USA 1996, 93: 4409-
14.
Palenik, B., Zafiriou, O. C., and Morel, F. M. M. Hydrogen peroxide production by a marine phytoplankter. Limnol. Oceanogr. 1987, 32: 1365–1369. 85
Partensky F, et .al. Vertical structure of Pico phytoplankton at different trophic sites of the
tropical northeastern Atlantic Ocean. Deep-Sea Res. I 1996, 43: 1191- 1199.
Platt T., Subba Rao D. V., and Irwin B. Photosynthesis of picoplankton in the oligotrophic
ocean. Nature 1983, 301: 702-704.
Pohl, C., Lfffler, A., Hennings, U. A sediment trap flux study for trace metals under seasonal
aspects in the stratified Baltic Sea (Gotland Basin, 57°19, 20’N, 20°03, 00’E). Mar. Chem. 2004,
84: 143– 160.
Pohl, C., Hennings, U. The coupling of long-term trace metal trends to internal trace metal
fluxes at the oxic–anoxic interface in the Gotland Basin (57°19, 20’N, 20°03, 00’E) Baltic Sea. J.
Mar. Sys. 2005, 56: 207– 225.
Poorvin, L., Rinta-Kanto, J. M., Hutchins, D. A., and Wilhelm, S. W. Viral release of Fe and its bioavailability to marine plankton, Limnol. Oceanogr. 2004, 49: 1734– 1741.
Porta, D., Bullerjahn, G.S., Durham, K.A., Wilhelm, S.W., Twiss M.R., and McKay,
R.M.L. Physiological characterization of a Synechococcus sp. (Cyanophyceae) strain PCC
7942 iron-dependent bioreporter for freshwater environments. J. Phycol. 2003, 39: 64-73.
Porta D, Bullerjahn, G. S., Twiss, M. R., Wilhelm, S. W., Poorvin, L., and McKay, R. M. L.
Determination of bioavailable Fe in Lake Erie using a luminescent cyanobacterial bioreporters.
J. Great Lakes Res. 2005, 31 (Suppl. 2): 180-194.
Poulsen, N. and N. Kröger. A new molecular tool for transgenic diatoms. Control of mRNA and
protein biosynthesis by an inducible promoter-terminator cassette. FEBS Journal 2005, 272:
3413-3423. 86
Price, N. M., Harrison, G. I., Hering, J. G., Hudson, R. J., Nirel, P. M. V., Palenik, B. &
Morel, F. M. M. Preparation and chemistry of the artificial algal culture medium Aquil. Biol.
Oceanogr. 1989, 6: 443–61.
Raateoja, M., Seppälä J., Ylöstalo P. Fast repetition rate fluorometry is not applicable to
studies of filamentous cyanobacteria from the Baltic Sea. Limnol. Oceanogr. 2004, 49: 1006–
1012.
Raven, J. A. The iron and molybdenum use efficiencies of plant growth with different energy,
carbon and nitrogen sources. New Phytol. 1988, 109: 279-287.
Raven, J. A., Evans, M.C.W., and Korb, R.E. The role of trace metals in photosynthetic
electron transport in O2-evolving organisms. Photosynth. Res. 1999, 60: 111-49.
Rejmankova, E., and Komarkova, J. A function of cyanobacterial mats in phosphorus-limited
tropical wetlands. Hydrobiologia 2000, 431: 135-153.
Riethman, H. C., G. Bullerjahn, K. J. Reddy, and L. A. Sherman. Regulation of
cyanobacterial pigment-protein composition and organization by environmental factors.
Photosyn. Res. 1988, 18: 133-161.
Rohwer, F., Segall, A., Steward, G., Seguritan, V., Breitbart, M., et al. The complete genomic sequence of the marine phage Roseophage SIO1 shares homology with nonmarine phages.
Limnol. Oceanogr. 2000, 45: 408–418.
Rue, E.L., and Bruland, K.W. Complexation of iron (III) by natural organic ligands in the
Central North Pacific as determined by a new competitive ligand equilibration adsorptive cathodic stripping voltammetric method. Mar. Chem. 1995, 50: 117-138. 87
Rue, E.L., Bruland, K.W. The role of organic complexation on ambient iron chemistry in the
equatorial Pacific Ocean and the response of a mesoscale iron addition experiment. Limnol.
Oceanogr. 1997, 42: 901-910.
Sakamoto, T., and Bryant, D. A. Growth at low temperature causes nitrogen limitation in the
cyanobacterium Synechococcus sp. PCC 7002. Arch. Microbiol. 1998, 169: 10-19.
Sakamoto, T., and Bryant, D. A. Temperature-regulated mRNA accumulation and stabilization
for fatty acid desaturase genes in the cyanobacterium Synechococcus sp. strain PCC 7002. Mol.
Microbiol. 1997, 23: 1281-1292.
Sakamoto, T., Shen, G., Higashi, S., Murata, N., and Bryant, D. A. Alteration of low- temperature susceptibility of the cyanobacterium Synechococcus sp. PCC 7002 by genetic
manipulation of membrane lipid unsaturation. Arch. Microbiol. 1998a, 169: 20-28.
Sakamoto,T., Delgaizo,V.B. and Bryant,D.A. Growth on urea can trigger death and
peroxidation of the cyanobacterium Synechococcus sp. strain PCC 7002. Appl. Environ.
Microbiol. 1998b, 64: 2361-2366.
Sambrook, et al. Molecular cloning : A laboratory manual. Cold Spring Harbor Laboratory
Press, 1989.
Scala, S., Carels, N., Falciatore, A., Chiusano, M.L., and Bowler, C. Genome properties of
the diatom Phaeodactylum tricornutum. Plant Physiol. 2002, 129: 993-1002.
Scanlan D. J., et al. Application of molecular techniques to addressing the role of P as a key
effector in marine ecosystems. Molecular Ecology of Aquatic Communities Developments in
Hydrobiol. 1999, 138: 149-175.
Scharek, R., van Leeuwe, M.A., and de Baar, H.J.W. Responses of Southern Ocean
phytoplankton to addition of trace metals. Deep-Sea Research II 1997, 44: 209-227. 88
Schink B. Biological cycling of phosphorus In: Metal ions in biological systems;
Biogeochemical cycles of elements. Sigel, A., Sigel, H., and Sigel, R.K.O. [eds.], Taylor and
Francis, CRC. 2005, 43: p. 131–148.
Schlesinger W. Biogeochemistry: An analysis of global change. Academic Press, London 1997,
2nd ed. pp.383-400.
Schreiter P.P., Gillor, O., Post, A., Belkin S, Schmid R. D., and Bachmann, T.T. Monitoring
of phosphorus bioavailability in water by an immobilized luminescent cyanobacterial reporter
strain. Biosens Bioelectron. 2001, 1: 811-8.
Sedwick, P., DiTullio, G., and Mackey, D. Iron and manganese in the Ross Sea, Antarctica:
Seasonal iron limitation in Antarctic shelf waters. J.Geophys. Res. 2000, 105: 11,321-11,336.
Shipe, R.F., Brzezinski, M.A., Pilskaln, C., and Villareal, T.V. Silica production of
Rhizosolenia mats in the central North Pacific gyre. Limnol. Oceanogr. 1999, 44:1282-1292.
Simon J. Ussher, E.P.A., and Worsfold, .P.J. Marine biogeochemistry of iron. Environmental
Chemistry 2004, 1: 67-80.
Singh, A. K., Li, H., and Sherman, L. A. Microarray analysis and redox control of gene expression in the cyanobacterium Synechocystis sp. PCC 6803. Physiol. Plant. 2004, 120: 27–
35.
Singler, H. R., and Villareal, T. A. Nitrogen inputs into the euphotic zone by vertically
migrating Rhizosolenia mats. J. Plankton Res. 2005, 27: 545-556.
Smith, S.V. Phosphorus versus nitrogen limitation in the marine environment. Limnol.
Oceanogr. 1984, 29: 1149-1160.
Stal, L. J., Walsby A. E. Photosynthesis and nitrogen fixation in a cyanobacterial bloom in the
Baltic Sea. European J. Phycol. 2000, 35: 97–108. 89
Steglich C., Behrenfeld M., Koblizek M., Claustre H., Penno S., Prasil O., Partensky F.,
Hess W. R. Nitrogen deprivation strongly affects Photosystem II but not phycoerythrin level in the divinyl-chlorophyll b-possessing cyanobacterium Prochlorococcus marinus. Bioch. Biophys.
Acta. 2001, 1503: 341-349.
Stevens, Jr., S. E., Patterson, C. O. P., and Myers, J. The production of hydrogen peroxide by blue-green algae: a survey. J. Phycol. 1973, 9: 427-430.
Stevens Jr., S. E., and Porter, R. D. Transformation in Agmenellum quadruplicatum. Proc.
Natl. Acad. USA 1980, 77: 6052-6056.
Stockner, J.G. Phototrophic picoplankton: an overview from marine and freshwater ecosystems.
Limnol. Oceanogr. 1988, 33: 765-775.
Strom, S.L., Miller, C.B., and Frost, B.W. What sets lower limits to phytoplankton stocks in high-nitrate, low-chlorophyll regions of the open ocean? Mar. Ecol. Prog. Ser. 2000, 193: 19-
31.
Strzepek, R. F., M. T. Maldonado, J. L. Higgins, J. Hall, K. Safi, S. W. Wilhelm, and P. W.
Boyd. Spinning the ‘‘Ferrous Wheel’’: The importance of the microbial community in an iron budget during the FeCycle experiment. Global Biogeochem. Cycles 2005, 19: GB4S26, doi:10.1029/2005GB002490.
Sullivan, M. B., Coleman, M. L., Weigele, P., Rohwer, F., Chisholm S. W. Three
Prochlorococcus cyanophage genomes: signature features and ecological interpretations. PLoS
Biol. 2005, 3: e144.
Sundareshwar, P. V., Morris, J.T., Koepfler, E. K., and Fornwalt, B. Phosphorus limitation of coastal ecosystem processes. Science 2003, 299: 563-565. 90
Szittner, R., and Meighen, E. Nucleotide sequence, expression, and properties of luciferase
coded by lux genes from a terrestrial bacterium. J. Biol. Chem. 1990, 265: 16581-16587.
Thingstad, T.F., and Mantoura, R.F.C. Titrating excess nitrogen content of phosphorus- deficient eastern Mediterranean surface water using alkaline phosphatase activity as a bio- indicator. Limnol. Oceanogr.: Methods 2005, 3: 94-100.
Thingstad, T. Frede, M.D. Krom, R.F.C. Mantoura, G.A.F. Flaten, S. Groom, B. Herut, N.
Kress, C.S. Law, A. et al. Nature of phosphorus limitation in the ultraoligotrophic Easter
Mediterranean. Science 2005, 309:1068-1071.
Tortell, P. D., Maldonado, M. T., Granger, J., and Price, N. M. Marine bacteria and biogeochemical cycling of iron in the oceans. FEMS Microbiol. Ecol. 1999, 29: 1–11.
Tsuda, A., et al. A mesoscale iron enrichment in the western subarctic Pacific induces a large centric diatom bloom. Science 2003, 300: 958–961.
Twiner M. J., and Trick, C. G. Possible physiological mechanisms for production of hydrogen
peroxide by the ichthyotoxic flagellate Heterosigma akashiwo. J. Plankton Res. 2000, 22: 1961-
1975.
Twiss, M.R., Err飡lde, O., Fortin, C., Campbell, P.G.C., Jumarie, C., Denizeau, F.,
Berkelaar, E., Hale, B., van Rees, K. Coupling the use of computer chemical speciation models
and culture techniques in laboratory investigations of trace metal toxicity. Chem. Spec.
Bioavailab. 2001, 13: 9-24.
Tyrrell, T. The relative influences of nitrogen and phosphorus on oceanic primary production.
Nature 1999, 400: 525-531.
Van der Meer, J. R., Tropel, D., and Jaspers, M. Illuminating the detection chain of bacterial
bioreporters. Environ. Microbiol. 2004, 6: 1005-1020. 91
Van Donk, E., Faafeng, B.A., Hessen, D.O., and Källqvist, T. Use of immobilized algae for estimating bioavailable phosphorus released by zooplankton. J. Plankton Res. 1993, 15: 761-
769.
Vaulot, D., N. LeBot, D. Marie, and E. Fukai. Effect of phosphorus on the Synechococcus cell cycle in surface Mediterranean waters during summer. Appl. Environ. Microbiol. 1996, 62:
2527-2533.
Veldhuis, M. J. W., Timmermans, K. R., Croot, P., van der Wagt, B. Picophytoplankton; a comparative study of their biochemical composition and photosynthetic properties. J. Sea Res.
2005, 53: 7-24.
Vinnemeier, J., Kunert, A., Hagemann, M. Transcriptional analysis of the isiA/B operon in salt-stressed cells of the cyanobacterium Synechocystis sp. PCC 6803. FEMS Microbiol Lett.
1998, 169: 323-330.
Wagner F., and Falker G. Phosphate limitation In: Algal adaptation to environmental stresses.
Rai, L.C., and Gaur, j.P. [eds.], Springer-Verlgar Berlin Heidelberg New York. 2001, p. 65–110.
Walker, T.L., C. Collet and S. Purton. Algal transgenics in the genomic era. J. Phycol. 2005,
41: 1077-1093.
Weger, H. G., Middlemiss, J. K., and Petterson, C. D. Ferric chelate reductase activity as affected by the iron-limited growth rate in four species of unicellular green algae (Chlorophyta).
J. Phycol. 2002, 38: 513-519.
Wells, M. L. Manipulating iron availability in nearshore waters. Limnol. Oceanogr. 1999, 44:
1002-1008.
Welschmeyer, N.A. Fluorometric analysis of chlorophyll a in the presence of chlorophyll b and pheopigments. Limnol. Oceanogr. 1994, 39: 1985-1992. 92
Wilhelm, S. W., and Trick, C. G. Iron-limited growth in cyanobacteria: multiple siderophore
production is a common response. Limnol. Oceanogr. 1994, 39: 1979-1984.
Wilhelm, S.W. The ecology of cyanobacteria in iron-limited environments: a review of
physiology and implications for aquatic environments. Aqua. Microb. Ecol. 1995, 9: 295-303.
Wilhelm S.W., Maxwell, D. P., and Trick, C. G. Growth rates, iron quotients, and siderophore
production in iron-limited Synechococcus sp. PCC 7002. Limnol. Oceanogr. 1996, 41: 89-97.
Wilhelm, S.W., and Suttle, C.A. Viruses and nutrient cycles in the sea. BioScience 1999, 49:
781-788.
Willey, J.D., Kieber, R.J., and Avery, G.B. Effects of rainwater iron and hydrogen peroxide on iron speciation and phytoplankton growth in seawater near Bermuda. J Atmos Chem. 2004, 47:
209–222.
Wilson, C. Late summer chlorophyll blooms in the oligotrophic North Pacific subtropical gyre.
Geophys. Res. Lett. 2003, 30: 1942, doi:10.1029/2003GL017770.
Witter, A.E., Hutchins, D.A., Butler, A., and Luther, G.W. Determination of conditional
stability constants and kinetic constants for strong model Fe-binding ligands in seawater. Mar.
Chem. 2000, 69: 1–17.
Wu. J. et al. Phosphate depletion in the western North Atlantic Ocean. Science 2000, 289: 759-
762.
Wu, J., Boyle, E.A., Sunda, W., and Wen. L.S. Soluble and colloidal iron in oligotrophic
North Atlantic and North Pacific oceans. Science 2001, 293: 847-849.
Xia, L., Yakunin, A.F., McKay, R.M.L. The Fe-responsive accumulation of redox proteins
ferredoxin and flavodoxin from a marine cryptomonad. Eur. J. Phycol. 2004, 39: 73-82. 93
Yousef, N., Pistorius, E. K.,and Michel, K. P. Comparative analysis of idiA and isiA transcription under iron starvation and oxidative stress in Synechococcus elongatus PCC 7942 wild-type and selected mutants. Arch Microbiol. 2003, 180: 471–483.
Zehr, J. P., Waterbury, J. B., Turner, P. J., Montoya, J. P., Omoregie, E., Steward, G. F.,
Hansen, A., and Karl, D. M. New nitrogen-fixing unicellular cyanobacteria discovered in the
North Pacific subtropical gyre. Nature 2001, 412: 635-638.
Zehr J. P., and Ward B. B. Nitrogen cycling in the ocean: new perspectives on processes and paradigms. Appl. Environ. Microbiol. 2002, 68: 1015–1024.
94
APPENDIX I. Development of a marine P bioreporter
1. Introduction
Phosphorus (P) is an essential constituent of all living cells. This element is an integral
component of the building blocks that constitute nucleic acids, phospholipids and complex
carbohydrates. Phosphorus plays a central role in anabolic and catabolic pathways and in energy
conversion within the cell via transfer of energy-rich phosphoanhydride bonds, a reaction which
is also involved in post-translational regulation of enzyme activities (Wagner and Falker, 2001).
Phosphorus comprises 0.09% of the mass of the Earth’s crust, and it is considered the 14th most abundant element on Earth. In nature, due to its reactivity, P does not occur in a free state.
Rather, it is found in a fully oxidized state typically combined with oxygen, as the phosphate
3- (PO4-Pi) anion (PO4 ). The global P cycle is unique among the cycles of the major
biogeochemical elements in having no significant gaseous components (Schink, 2005). The
redox potential of most soils is too high to allow for the production of phosphine gas, except
under very specialized local conditions. Further, the flux of PO4-Pi through the atmosphere in
soil dust and sea spray is negligible (Tyrrell, 1999). The major reservoirs of PO4-Pi on Earth are
marine and freshwater sediments, the deep ocean and terrestrial soils. The PO4-Pi in terrestrial
ecosystems is originally derived from the weathering of calcium phosphate minerals, especially
-58 apatite [Ca5(PO4)3OH]. Apatite is insoluble, reaching equilibrium at concentrations of ca. 10
mol L-1. In most soils, only a small fraction of the total P is available to biota. Therefore, on both
land and in oceans, organisms are sustained mainly on regenerated forms of P (Schlesinger,
1997).
Phosphorus supply into the world oceans is delivered from continents mainly via riverine
flux. Global estimates of this flux provided in the literature vary considerably, but is in the range 95
of 13 -22 Gt of suspended matter and 3.3 – 4.8 Gt of dissolved components. Due to the very low
solubility of apatite, and strong binding of P to soil particles that are subject to rapid
sedimentation on the continental shelf, only about 10 % of the total P flux is potentially available
to marine biota.
Whereas the concentration of PO4-Pi in surface waters is very low, PO4-Pi concentrations
in the deep ocean are much higher, averaging ca. 3 x 10-6 mol L-1. Reflecting low surface levels
of PO4-Pi associated with much of the world oceans, PO4-Pi limitation has been documented in
many regions. In the eastern tropics (Mills et al. 2004) and the western regions (Wu et al. 2000)
of the North Atlantic Ocean, marine diazotrophic cyanobacteria are reported to be PO4-Pi depleted. Further, PO4-Pi depletion is not restricted to the open ocean but is also found in the
eastern Mediterranean Sea (Thingstad et al. 2005) and in various coastal ecosystems
(Sundareshwar et al. 2003, Rejmankova and Komarkova, 2000).
In ecosystems in which the PO4-Pi supply is variable, phytoplankton must be capable of
reacting to a change in the ambient nutrient status by regulating the cellular P uptake systems.
During PO4-Pi deficiency, organisms upregulate the pho regulon, one aspect of which includes
induction of the exoenzyme alkaline phosphatase, which is used to cleave PO4-Pi from
phosphomonoesters. Phosphonates comprise a separate pool of organically-complexed P.
Originally thought to be recalcitrant compounds owing to the C-P bonds characteristic of these
molecules, recent work demonstrates that some cyanobacteria, including the nitrogen fixing
genera Trichodesmium and Nostoc possess enzymes encoded by the phn locus of the pho regulon
which are capable of metabolizing phosphonates, thereby conferring an advantage to these
organisms living in extremely low PO4-Pi environments (Dyhrman et al. 2006).
96
1.1 Current tools available to monitor bioavailable P
To overcome the difficulty of assessing bioavailable PO4-Pi using chemical
analysis, a number of “biological” approaches have been designed. One of the widely used
methodologies is the “algal bioassay” (DePinto, 1981) whereby a PO4-Pi deficient monoalgal
culture is inoculated in a sample to measure bioavailable PO4-Pi. This method is designed for
samples with relatively high concentrations of P, such as soil or agriculture runoffs and is thus
not applicable for aquatic environments such as open oceans, with low total PO4-Pi. Additional methods using whole cells have been developed: the green alga Selenastrum capricomuxum was
immobilized in permeable alginate beads to prevent the cells from being grazed by zooplankton
(Van Donk, 1993). Algae able to grow in these beads have been used to estimate bioavailable
PO4-Pi released by zooplankton as they graze on endemic phytoplankton in the sample.
Ectoenzyme assays offer a more quantitative method to measure PO4-Pi availability. The
activity of alkaline phosphatase, which is induced by many phytoplankton in response to PO4-Pi
deficiency can be measured fluorometrically by use of a fluorogenic substrate,
methylumbelliferyl phosphate (Hoppe, 2003).
1.2. Bioreporters to analyze bioavailable P
There have been several P bioreporters designed to detect PO4-Pi in various
environments (Brennan et al. 1995; Nakamura et al. 1997; Marie-Andree and Billard, 2003).
Applicable to monitoring PO4-Pi deficiency in aquatic environments, a luminescent
cyanobacterial P bioreporter was designed by Gillor et al. (2002). This bioreporter, appropriate
for use in freshwater environments, was constructed using a phoA::luxAB construct integrated
into the cyanobacterium Synechococcus PCC 7942 and features a detection range of 0.3 – 8.0 97
-1 µmol L PO4-Pi using a sample incubation time of 8 h. The bioreporter was designed using the
promoter for phoA, a P-responsive gene that encodes alkaline phosphatase. The fusion was
integrated into the chromosome of Synechococcus PCC 7942 yielding a strain that responds by
dose-dependent light emission to a wide range of PO4-Pi concentrations. This freshwater P bioreporter has also been adapted for use as an immobilized sensor in microtiter plates called the
“Cyanosensor” (Schreiter et al. 2001). Recently, phoA:: luxCDABE constructs were transformed into E. coli MG1655 and Pseudomonas fluorescens DF57. The resultant P bioreporters were
-1 dosage dependent when exogenous PO4-Pi concentrations fell below 60 and 40 µmol L , respectively (Marie-Andree and Billard, 2003).
The present study represents a first attempt to construct a P bioreporter for marine systems. For this study, Synechococcus PCC 7002, a unicellular marine cyanobacterium, was chosen as the model-organism used to develop the bioreporter. Following several unsuccessful trials to clone phoA from this cyanobacterium, an alternative P deficiency-induced gene, phoH, was selected to design the bioreporter. PhoH is an ATP-binding protein belonging to the pho regulon (Kim et al. 1993) and has been demonstrated previously to be responsive to PO4-Pi deficiency (Kim et al. 1993; Sakamoto et al. 1998b).
2. Materials and Methods
2.1. Media and growth conditions.
Synechococcus PCC 7002 was cultured in modified Medium A (Stevens et al. 1973) at
25 °C with constant bubbling and continuous illumination of 45 µmol quanta m-2 s-1. The P
-1 -1 bioreporter construct was grown in Medium A containing 2.5 nmol L K2HPO4 and 10 µg mL
spectinomycin to maintain the integrity of the chromosomal insert. Escherichia coli strain 98
DH5α, used for transforming vectors PMBB and the plasmid construct used to design the P bioreporter, was grown in LB medium containing 40 µg m L-1 spectinomycin at 37 °C
(Sambrook et al. 1989). All media were prepared using Milli-Q water (Millipore Corp.).
Growth of Synechococcus was monitored by measuring in vivo chl-a fluorescence (model
TD-700 fluorometer; Turner Designs) or by direct enumeration of glutaraldehyde-preserved cells
using chl autofluorescence (Axiophot microscope with rhodamine filter and epifluorescence attachment; Zeiss).
2.2. Construction of a marine P bioreporter
The promoter sequence of the P-stress induced gene phoH (Sakamoto et al. 1998b;
Genbank accession number AF035751), including nucleotides from the transcription starting site to nucleotide 317, was amplified by PCR using primers phoH_For and phoH_Rev, engineered with Not I and Bam HI restriction sites, respectively (Table 8). PCR conditions were as described in Chapter II, except that the annealing temperature was 55.5 oC. The phoH promoter fragment was ligated into the Not I and Bam HI sites of the pMBB vector (Fig. 19). The resulting construct was introduced into Synechococcus PCC 7002 by genetic transformation (Stevens and
Porter, 1980) and transformants selected by plating on Medium A containing 10 µg m L-1 spectinomycin.
2.3. Bioreporter response to P deficiency
The P-dependent luminescent response of the bioreporter was assessed by incubating the
-1 bioreporter in Medium A containing 2.5 nmol L K2HPO4. Exponential-phase cells growing in
Medium A were collected by centrifugation at 4000g for 8 min, washed twice in P-free medium, 99 and resuspended into triplicate polycarbonate containers containing Medium A with reduced
PO4-Pi. Cultures were incubated for 12 h under the growth conditions described above prior to measuring bioluminescence. Cellular bioluminescence was measured following delivery of 2.66 mM decanal in 25 % (v/v) methanol to the bioreporter cells by direct injection into 2 mL of cell culture.
Table 8. Primers used to amplify PphoH (phoH promoter).Orientation in 5′ → 3′
Name Primer sequence Amplify phoH_For GCGGCCGCAATTGCCTAAATAC 130 bp desB1 phoH_Rev GGATCCAGAGATCTGCCAGG
1 2 3 4 5 6
Figure 19: Restriction digestion on pMBB + PphoH with Bgl II (phoH specific) and
EcoR I (1 site in pMBB) endonucleases. Lane 1: 1 kb DNA marker; Line 2-6: P-
bioreporter constructs and Lane 6: pMBB. White arrow shows Bgl II uncut pMBB
and black arrow 1350 bp band specific for pMBB with PphoH. 100
3. Results and Discussion
3.1. Growth of wild type vs. bioreporter strains
Growth rates did not differ between the marine P bioreporter strain and wild type
Synechococcus sp. strain PCC 7002 when cultured in P-sufficient Medium A (two-tailed t-test; p
= 0.108; df = 2). Wild type cells possessed a growth rate of 0.16 ± 0.003 h-1 compared to 0.14 ±
0.01 h-1 for the bioreporter strain. These data show that the genetic modification of
Synechococcus PCC 7002 with the PphoH::luxAB fusion did not yield any major physiological
changes under laboratory culture conditions, similar to the Fe-responsive bioreporter BMB04
described in Chapter II. As a result, subsequent experiments were conducted with the genetically
modified strains only.
3.2. Luminescence response of the bioreporter to external P status
Bioreporter response when grown in P-depleted Medium A (0.5 nmol L-1) was one order
of magnitude higher than when grown in P sufficient (2.5 µmol L-1) Medium A (two-tailed t-test;
P < 0.005) (Fig. 20).
3.3. Study of the phoH promoter
A Clustal-W alignment of Synechococcus PCC 7002 phoH gene showed 53.3 %, 22.2 %
and 24 % similarity to Synechococcus PCC 7942, Synechocystis PCC 6803 and E. coli
respectively (data not shown). Alignments also revealed that there were at least 3 potential PHO
boxes in the promoter region of the phoH promoter. The gene encoding phoH is widely distributed with homologs, albeit of various functions, reported in both eubacteria and archea 101
(Sullivan et al. 2005). The PhoH protein supposedly possesses ATPase activity, although the
detailed function is still unknown (Kazakov et al. 2003). Curiously, genes encoding phoH and
pstS (periplasmic phosphate binding protein) have been observed in various cyanophages where it is predicted that their presence is critical for PO4-Pi uptake during viral infection (Rohwer et al.
2000; Miller et al. 2003; Sullivan et al. 2005; Coleman et al. 2006). Detailed characterization of the phoH gene and P bioreporter is currently underway. Once the P bioreporter is fully characterized in the laboratory, it will be used to assess bioavailable PO4-Pi in marine
environments similar to the Fe bioreporter.
3.5
3.0
2.5 -1
s 5 2.0
x 10 -1 1.5
RLU cell 1.0
0.5
0.0 2.5 µmicroMmol L-1 0.5 nMnmol L-1
[ PO4- Pi ]
Figure 20: Bar graph showing the luminescent response of the P bioreporter
grown in P replete and P deplete Medium A.
102
Appendix II. Medium A composition modified
from Stevens et al. (1973).
Substance g L-1 Final concentration (mmol L-1)
b salts solution I NaCl 25.00 427.8
MgSO4 3.50 14.1 KCl 0.50 6.7
MgCl . 6H O 2.00 9.8 2 2 Nutrient & salt stocks a NaNO3 0.75 8.82 a K2HPO4 0.50 2.87 a CaCl2.2 H2O 0.50 3.4 a Na2CO3 0.19
Disodium EDTAc 0.1 -5 Vitamin B12a 1.5 x 10
Trace Minerals -3 H3BO3 4.6 x 10 -4 MnCl2.4H2O 9.1 x 10 -5 ZnSO4.7H2O 7.7 x 10 -4 Na2 MoO4.2H2O 1.6 x 10 -5 CuSO4 .5H2O 3.2 x 10 -7 CoCl2 . 6H2O 1.7 x 10 a A 1000 x stock is made and added 1 mL for every 1 L. of medium A. b A 10 x stock was made and added 100 mL for every 1 L. of medium A. c A 10 mmol L-1 stock was made -1 • Iron (FeCl3) is added solely as a separate stock with 0.1 mmol L EDTA. • pH of the medium is ca. 8.1 • Stocks were chelexed and filter sterilized when required.