University of Florida Thesis Or Dissertation Formatting Template

Home , Glycine tabacina, Impatiens balsamina, Impatiens glandulifera, Impatiens pallida

IMPROVING DOWNY MILDEW RESISTANCE IN IMPATIENS (IMPATIENS WALLERIANA) THROUGH CHROMOSOME DOUBLING AND GENETIC TRANSFORMATION

WEINING WANG

A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE

UNIVERSITY OF FLORIDA

2016

To my family and friends

ACKNOWLEDGMENTS

I would like to first thank Dr. Deng for giving me the opportunity to pursue my master’s degree. I truly appreciate my committee members, Dr. Zhanao Deng, Dr.

David G. Clark, Dr. Aaron J. Palmateer, and Dr. Sydney G. Park Brown for their guidance on my research projects and coursework. I thank Yinghong Wang, Zhe Cao and Krishna Bhattarai for teaching me how to conduct genetic transformation, chromosome counting, and designing primers for polymerase chain reactions. I would also thank Dr. Yanhong He, Joyce Jones, Gail Bowman and other lab members for assisting me in various lab activities and Dr. Zhonglin Mou for providing the

Agrobacterium strain carrying the expression vector used in this study. Research described in this thesis was supported in part by grants from the American Floral

Endowment, the Fred C. Gloeckner Foundation, and the Florida Department of

Agriculture and Consumer Services (FDACS) Specialty Crop Block Grant. I am grateful to my family and my friends at Balm for their love and support, without which I could not have finished this research project.

TABLE OF CONTENT

page

ACKNOWLEDGMENTS ...... 4

LIST OF TABLES ...... 7

LIST OF FIGURES ...... 9

LIST OF ABBREVIATIONS ...... 10

ABSTRACT ...... 12

CHAPTER

1 LITERATURE REVIEW AND JUSTIFICATION ...... 14

Impatiens walleriana ...... 14 Impatiens Downy Mildew ...... 14 Management of Impatiens Downy Mildew ...... 17 Breeding for Downy Mildew Resistance...... 18

2 IMPROVING DOWNY MILDEW RESISTANCE IN IMPATIENS THROUGH CHROMOSOME DOUBLING ...... 20

Introduction ...... 20 Materials and Methods...... 22 Polyploid Induction ...... 22 Identifying Putative Tetraploids ...... 23 Determining Nuclear DNA Contents and Confirming Ploidy Levels ...... 23 Morphological Characterization ...... 24 Determining DM Resistance ...... 26 Statistical Analysis ...... 29 Results ...... 29 Polyploid Induction, Identification and Confirmation ...... 29 Changes in Morphology...... 30 Changes in DM Resistance ...... 31 Discussion ...... 33 Tetraploid Induction, Identification and Confirmation ...... 33 Morphological Changes ...... 33 Changes in DM Resistance ...... 35

3 IMPROVING DOWNY MILDEW RESISTANCE IN IMPATIENS THROUGH GENETIC TRANSFORMATION ...... 50

Introduction ...... 50 Genetic Transformation ...... 50

Agrobacterium-mediated Transformation ...... 50 Impatiens Regeneration and Transformation ...... 51 Selectable Markers and Reporter Genes ...... 52 Systemic Acquired Resistance and the NPR1 Gene ...... 54 Materials and Methods...... 56 Establishing an Efficient Plant Regeneration System Using Cotyledonary Nodes and True Leaf Nodes as Explants ...... 56 Determination of Optimal Concentrations of Kanamycin and G418 for Selecting Transformants ...... 58 Agrobacterium Culture, Transformation and Recovery of Impatiens Transformants ...... 59 Confirming the Presence of the NPR1 Transgene in Impatiens ...... 60 Characterizing the Morphology and DM Resistance of Transgenic Impatiens...... 61 Results ...... 61 Development of Plant Regeneration Protocols ...... 61 Effect of Kanamycin and G418 on Impatiens Cultures ...... 63 Transformation and Confirmation of Transgenic Plants ...... 64 Morphological Characterization ...... 65 Downy Mildew Resistance ...... 65 Discussion ...... 67 Development of Plant Regeneration Protocols ...... 67 G418 as an Alternative Selective Agent for Impatiens Transformation ...... 68 Morphological Changes in Transgenic Lines ...... 69 Partial DM Resistance in Transgenic Lines ...... 70

LIST OF REFERENCES ...... 93

BIOGRAPHICAL SKETCH ...... 104

LIST OF TABLES

Tables page

2-1 Effects of colchicine treatments on seedling survival and tetraploid induction in Impatiens walleriana...... 38

2-2 Morphological differences between diploid (2x) and tetraploid (4x) Impatiens walleriana...... 39

2-3 Differences in downy mildew severity between diploid (2x) and tetraploid (4x) Impatiens walleriana from 6dpi (days post inoculation) to 10 dpi...... 40

2-4 Differences in sporangia density of P. obducens (103/cm2) on the abaxial side of leaf discs between diploid (2x) and tetraploid (4x) Impatiens walleriana from 6 dpi to 10 dpi...... 41

2-5 Differences in downy mildew incidence between diploid (2x) and tetraploid (4x) Impatiens walleriana from 10 dpi to 12 dpi after in-vivo inoculation of live plants ...... 42

3-1 Components of germination medium, basal media for multiple bud induction, root induction, and inoculation medium...... 73

3-2 Effect of different combinations of BA and TDZ on the induction of multiple bud culture from cotyledonary node explants...... 74

3-3 Effect of different combinations of BA and TDZ on the induction of multiple bud culture from true leaf node explants...... 75

3-4 Effect of IBA on the induction of roots using cotyledonary nodes as initial explants...... 76

3-5 Effect of different concentrations of IBA on the induction of roots using true leaf nodes as initial explants...... 77

3-6 Effect of different concentrations of kanamycin on the growth of multiple bud culture that produced from cotyledonary nodes...... 78

3-7 Effect of different concentrations of kanamycin on the growth of multiple bud culture that produced from true leaf nodes...... 79

3-8 Effect of different concentrations of G418 on the growth of multiple bud culture that produced from cotyledonary nodes...... 80

3-9 Effect of different concentrations of G418 on the growth of multiple bud culture that produced from true leaf node...... 81

3-10 Morphological differences between transgenic impatiens and wild type Impatiens walleriana...... 82

3-11 Differences in downy mildew severity between transgenic impatiens and wild type Impatiens walleriana from 6 dpi to 10 dpi...... 83

3-12 Differences in sporangia density of P. obducens (103/cm2) on the abaxial side of leaf discs between transgenic impatiens and wild type Impatiens walleriana from 6 dpi to 10 dpi...... 84

3-13 Comparison of downy mildew incidence of in-vivo inoculation among wild type and transgenic lines from 10 dpi to 12 dpi...... 85

LIST OF FIGURES

Figure page

2-1 Flow cytometric histograms of impatiens and rye...... 43

2-2 Metaphase spread of impatiens root tip cells...... 44

2-3 Impatiens grown in plastic pots...... 45

2-4 Nail polish imprints taken from the abaxial surface of mature impatiens leaves...... 46

2-5 Stained impatiens pollen grains under a stereomicroscope...... 47

2-6 Leaf discs of diploid and induced tetraploid impatiens in leaf disc inoculation assay showing white downy mildew sporulation emerging from the abaxial surface of impatiens leaf discs...... 48

2-7 Histological survey of Plasmopara obducens (causal agent of downy mildew) development inside impatiens leaf discs from 1 dpi to 6 dpi by trypan blue staining...... 49

3-1 Regeneration of Impatiens walleriana cv. Super Elfin Lipstick in-vitro using cotyledonary node and true leaf node as initial explants...... 86

3-2 The T-DNA region of pK7WG2D,1 plasmid with NPR1, nptII and gfp genes...... 88

3-3 Effect of kanamycin and G418 on the growth of multiple bud culture...... 89

3-4 GFP expression in transformed tissues and transgenic plant...... 90

3-5 PCR analysis of genomic DNA from non-transgenic and ten transgenic impatiens lines using primers for the NPR1 gene...... 92

LIST OF ABBREVIATIONS

ANOVA Analysis of variance

AS Acetosyringone avr factor Avirulence factor

BA Benzylaminopurine

BM1 Basal medium 1

BM2 Basal medium 2

CDE Cotyledonary node explant

DM Downy mildew dpi Day post inoculation

FCM Flow cytometry

FCR Fluorochromatic procedure

FDA Fluorescein diacetate

G418 Geneticin

GCREC Gulf Coast Research and Education Center

GFP Green fluorescent protein

GM Germination medium

HCl Hydrochloric acid

HR Hypersensitive response

HSCCN Hypocotyl segment containing cotyledonary node

IBA Indole-3-butyric acid

IFAS Institute of Food and Agricultural Sciences

MBC Multiple bud culture

MBCE Multiple bud culture explant

NADCC Dichloroisocyanuric acid sodium salt solution

NGI New Guinea impatiens

NPR1 Non-expressor of PR gene

NPTII Neomycin phosphotransferase II gene

PCR Polymerase chain reaction

PR gene Pathogenesis-related gene

QTL Quantitative trait loci

R gene Resistance gene

RIM Root induction medium

SA Salicylic acid

SAR Systemic acquired resistance

SIM Shoot induction medium

T-DNA Transfer DNA

TDZ Thidiazuron

Ti plasmid Tumor-inducing plasmid

TLNE True leaf node explant

U.K. United Kingdom

U.S. United States

Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science

IMPROVING DOWNY MILDEW RESISTANCE IN IMPATIENS (IMPATIENS WALLERIANA) THROUGH CHROMOSOME DOUBLING AND GENETIC TRANSFORMATION

Weining Wang

December 2016

Chair: Zhanao Deng Cochair: David G. Clark Major: Horticultural Sciences

Impatiens (Impatiens walleriana), a very important floriculture crop in the United

States, has been plagued by impatiens downy mildew (DM) caused by Plasmopara obducens. In an effort to improve DM resistance in impatiens, chromosome doubling and genetic transformation were conducted to induce auto-tetraploids and generate transgenic lines expressing the Arabidopsis thaliana NPR1 gene. Results showed that newly induced impatiens auto-tetraploids exhibited significant changes in leaf size, stomatal size, stomatal density, branching habit, days to flowering, flower size, pollen size, and pollen stainability. An efficient tissue culture and plant regeneration protocol, an essential prerequisite for genetic transformation of impatiens, was developed using two types of impatiens nodes (true leaf and cotyledonary) as initial explants and optimum concentrations of two cytokinins BA and TDZ. Neither of the antibiotic kanamycin nor geneticin proved to be effective for suppressing the growth and development of non-transformed impatiens tissues. Transgenic impatiens lines containing the NPR1 gene were not significantly different from the non-transformed

wildtype in nine characteristics evaluated, but six lines displayed changes in days to flower, flower production, and/or pollen production or stainability. P. obducens in infected leaf tissues showed a similar infection and development process in induced tetraploids, transgenic lines, and the non-transgenic impatiens. Nevertheless, tetraploids and a number of transgenic lines exhibited improved DM resistance in both leaf disc and in-vivo inoculation assays. Transgenic line 2 not only showed increased

DM resistance but also produced more flowers, thus offering potential value for future genetic improvement of impatiens.

CHAPTER 1 LITERATURE REVIEW AND JUSTIFICATION

Impatiens walleriana

Impatiens (Impatiens walleriana) is one of the top floriculture crops in the United

States (U.S.) and was the most commonly cultivated species in the genus Impatiens

(family Balsaminaceae) (Morgan, 2007). It is a perennial species in its natural habitat, but is often cultivated as an annual bedding plant (Grey-Wilson, 1980). The popularity of impatiens is attributed to its wide range of flower colors, long flowering season and shade tolerance. The flowers of impatiens often come in red, pink, orange, salmon, lilac, mauve, and white, with special coloration patterns such as starburst, picotee-edged, and mosaic coloration (Morgan, 2007). The seed-grown nature of impatiens made it easier and less costly for growers to cultivate compared with vegetatively propagated interspecific cultivars. The introduction of new impatiens cultivars, such as the double and semi-double cultivars and cultivars with variegated flowers, has made this species an increasingly popular garden plant for use in containers, window boxes, and hanging baskets (Morgan, 2007). It was estimated that commercial impatiens plants in the U.S. in 2010 had a wholesale value of approximately $114 million (USDA/NASS, 2011).

Impatiens Downy Mildew

Impatiens downy mildew (DM) is a serious disease for Impatiens, which had devastating effects on its production worldwide. So far, there have been three types of

DM reported on Impatiens and they are caused by distinct species of oomycetes. The first type of DM is caused by Pseudoperonospora cubensis on the host Impatiens irvingii. This type of DM was first reported in Cameroon in 2007; infected plants showed epiphyllous blood red spots on leaves and necrotic plant tissues, and sporangiophores

emerged from stomata on the underside of infected leaves. P. cubensis is considered polyphagous since it has a broad host range (from Balsaminaceae to Cucurbitaceae and Cannabaceae) (Voglmayr et al., 2008). The other two parasites causing DM on

Impatiens are Plasmopara constantinescui and P. obducens. These two pathogens share some common hosts and are partially sympatric with each other, thus they are easily confused. P. constantinescui differs from P. obducens by its dichotomous sporangiophores with flexuose branches, globose sporangia, and associated leaf lesions with well-defined margins (Constantinescu, 1991). Among these three pathogens, DM caused by P. obducens is the one that is causing the greatest economic loss in the U.S. and in many other countries and is the one most studied.

The original isolates of P. obducens were first described in 1877 by J. Schroeter, but it was not until the 21st century that this pathogen became active in the United

Kingdom (U.K.) (Lane et al., 2005), Australia (Cunnington et al., 2008), Norway (Toppe et al., 2010), Hungary (Vajna, 2011), Serbia (Bulajic et al., 2011), Italy (Garibaldi et al.,

2013), Japan (Satou et al., 2013) and other parts of the world. It is possible that the recent isolates have evolved genetic differences from the original ones (Schubert,

2012). There have been sporadic reports about this disease in the U.S. since 2004

(Wegulo et al., 2004); regional outbreaks have been observed since 2011 in Ohio

(Baysal-Gurel et al., 2012), Kentucky (Ward et al., 2013), Florida (Palmateer et al.,

2013), Alabama (Conner et al., 2014), Hawaii (Crouch et al., 2014), and other states.

These regional outbreaks have made serious impacts on the production and use of impatiens in the U.S. and other countries.

P. obducens is an oomycete and is obligate biotroph, thriving under cool, moist conditions. Unlike P. cubensis, P. obducens only has a narrow host range, including I. walleriana, hybrids of I. walleriana, Impatiens balsamina, Impatiens pallida, Impatiens carpensis, Impatiens glandulifera, etc. This pathogen produces two types of spores, zoospores and oospores. The zoospores, which can be air-borne and swim in water, are produced inside sporangia that are formed inside the leaf tissues and emerge from the underside of the leaves. Under suitable temperature and/or humidity conditions, the zoospores can be released and infect other plants through wind or rain (Warfield, 2011).

The oospores are thick-walled and may overwinter in plant debris and be released into the soil as infected plants decay. Resting oospores can survive in soil for up to several years and infect impatiens plants that are grown in following growing seasons. No evidence has shown the DM caused by P. obducens is seed-borne (Warfield, 2011).

Downy mildew symptoms on susceptible species of Impatiens initially appear as chlorosis on upper leaves and leaves curling downwards. Under cool and humid conditions (about 60 °F to 73 °F), white-colored sporulation can be seen from the underside of infected leaves. Sporangia may not be present if the weather is warm and dry. Infected impatiens plants become stunted and the leaves and flowers drop off, leaving the plants bare-stemmed, and eventually the plants collapse and die.

Depending on the age of plants, temperature and humidity, it may take about five to 14 days from infection to the appearance of visible symptoms. Young plants, immature leaves, and seedling cotyledons are more susceptible to DM (Catlin, 2012; Hansen et al., 2013; Warfield, 2011).

Management of Impatiens Downy Mildew

Management of DM caused by P. obducens has been marginally achieved through applying preventive fungicides and modifying cultural practices. In order to gain maximum efficacy, fungicides have to be applied protectively and preventively as a spray or a drench. Fungicides including Adorn (active ingredient fluopicolide), Alude

(potassium salts of phosphorous acid), Aliette (fosetyl-Al), Fenstop (fenamidone),

Heritage (azoxystrobin), Micora (mandipropamid), Orvego (ametoctradin and dimethomorph), Pageant Intrinsic (boscalid and pyraclostrobin), Stature

(dimethomorph), and Segway (cyazofamid) have provided very good to excellent control of DM when applied as foliar sprays prior to inoculation in replicated trials. After sparse sporulation of P. obducens becomes visible, only Adorn provided acceptable levels of disease control (Warfield, 2011). Effective fungicide treatment programs in the greenhouse can have a carryover protection for the plants when they are installed in the landscape, but such protection generally does not last beyond one month (Hansen et al., 2013).

Several cultural practices have been used to reduce the incidence of DM and minimize the chance for impatiens to get infected. Good air circulation, adequate drainage, and appropriate plant spacing are often recommended for use in greenhouses or nurseries. Frequent scouting for early DM symptoms is critical for early detection.

Irrigation should be applied early during the daytime, and large temperature swings should be avoided to reduce leaf wetness and condensation on the foliage. To prevent the disease from spreading, infected impatiens plants and plants of other Impatiens spp. nearby should be removed immediately and should not be composted (Catlin, 2012;

Hansen et al., 2013; Warfield, 2011). 17

Breeding for Downy Mildew Resistance

The overuse of fungicides and other chemical controls as well as the limited effect of cultural practices for DM control, especially under disease conducive conditions, have solicited significant public concerns of multiple issues including fungicide resistance and environmental contamination. Frequent applications of fungicides have also increased production costs. There is an urgent need for more cost- effective, environmentally friendly approaches to managing DM in impatiens.

The identification and use of disease-resistant cultivars have been crucial for managing numerous devastating diseases in economically important crops. For example, breeding and introduction of disease-resistant cultivars played a significant role in controlling grapevine downy mildew caused by P. viticola, a pathogen in the same genus as the impatiens downy mildew pathogen P. obducens (Gessler et al.,

2011). Downy mildew-resistant grapevines allowed P. viticola to complete its life cycle in leaf tissues, but inhibited its hyphal growth and sporangia formation, resulting in no visible symptoms or sporulation (Bellin et al., 2009; Dίez-Navajas et al., 2008).

A study by Moreira et al., (2011) showed that the DM resistance trait in grapevine is quantitatively inherited, and quantitative trait loci (QTL) with major DM resistance effects have been identified through comparative genetic mapping (Bellin et al., 2009;

Fischer et al., 2004; Welter et al., 2007). Using conventional breeding techniques, grapevine breeders have produced several DM-resistant interspecific grapevine hybrids, and one of these cultivars ‘Regent’ was once the most popular hybrid grape cultivar in Germany (Gessler et al., 2011). Another white grape bred in Hungary,

‘Bianca’, also possesses DM resistance (Gessler et al., 2011). These cultivars have served as a very important component in the integrated disease management of DM 18

in grapevine production (Kast, 2011; Peressotti et al., 2010).

In impatiens, several studies have shown that all cultivars of I. walleriana and interspecific hybrids with I. walleriana in parentage are highly susceptible to DM

(Warfield, 2011). New Guinea impatiens (NGI) (I. hawkeri), another species in the

Impatiens genus that is widely produced in the U.S. floriculture industry, is reported to be highly resistant/tolerant to DM (Catlin, 2012). Although resistance to DM is widely available in NGI, it has not been possible to transfer such resistance into I. walleriana cultivars. This is because the two species have different chromosome numbers (2n = 2x

= 32 in NGI vs. 2n = 2x = 16 in impatiens), morphology, and sizes (Uchneat, 2007), and cross-pollinations between the two species have not succeeded in producing hybrids.

As impatiens could be cheaply produced from seeds whereas NGI are slow to produce from seeds and the costs associated with vegetative production are higher, NGI are not as popular as impatiens for growers in commercial production. Therefore, it is necessary to explore various genetic approaches to improve DM resistance in I. walleriana. Efforts are being made at Cornell University (J. Keach, personal communication) to identify other Impatiens species that are resistant to DM, crossable with I. walleriana, and can produce viable seeds and offspring when crossed with I. walleriana. The purpose of this study was to explore two other genetic approaches, chromosome doubling and genetic transformation, to improve DM resistance in I. walleriana.

CHAPTER 2 IMPROVING DOWNY MILDEW RESISTANCE IN IMPATIENS THROUGH CHROMOSOME DOUBLING

Introduction

A given organism is referred to as a polyploid when more than two sets of chromosomes are present in its somatic cells. Polyploids are broadly categorized into two groups, autopolyploids and allopolyploids. Autopolyploids contain multiple sets of chromosomes derived from a single species, whereas allopolyploids contain multiple sets of chromosomes from different species (Osborn et al., 2003). Masterson (1994) estimated that 30% to 80% of the plant species in nature are polyploids. Polyploidy has long been recognized as a prominent driving force in the evolution of flowering plants

(Stebbins, 1971). In addition to its role in plant evolution and speciation, polyploidy also serves as an important source of phenotypic diversity (Chen, 2007). New phenotypes often arise with the formation of allopolyploids due to the combination of genomes of different species whose phenotypes and life histories could differ substantially (Pikaard,

2001). In autopolyploids, new phenotypic variations might come from the following aspects: (1) certain genes in polyploids may be expressed at higher levels as the gene copy number increases, giving rise to variation in a dosage-dependent fashion; (2) duplicated genes in some cases acquire new functions through neofunctionalization or sub-divide their functions (Lynch and Conery, 2000); (3) as the set of chromosomes increases, autopolyploids have increased allelic diversity and heterozygosity and increased genome buffering capacity against mutant alleles; (4) autopolyploids, as allopolyploids do, may have altered regulatory interactions and rapid genetic and epigenetic changes compared to their diploid counterparts (Udall and Wendel, 2006;

Osborn et al., 2003).

Phenotypic variations induced by autopolyploidy (or chromosome doubling) have been utilized in plant breeding for decades. In general, newly-formed autopolyploid

(neo-autopolyploid) plants may produce larger organs and biomasses (Hamill et al.,

1992; Majdi and Karimzadeh, 2010; Stupar et al., 2007; Wu et al., 2012), have higher biological yields (Ogawa et al., 2012), show changes in anatomical structures (primarily in stomatal length and density) (Chen et al., 2011; Sajjad et al., 2013; Xu et al., 2016;

Yang et al., 2006), and be accompanied with improved ornamental value (Cai et al.,

2015; Takamura and Miyajima 1996). With regard to disease resistance, the tetraploid

Glycine tabacina was more resistant against the leaf-rust fungus Phakopsora pachyrhizi

(Burdon and Marshall, 1981), and tetraploid accession C24 of Arabidopsis thaliana showed increased tolerance against the necrotrophic pathogen Botrytis cinerea (Fort,

2013). Using mathematical models, Oswald and Nuismer (2007) showed that, compared to diploids, neopolyploids could be more resistant to multiple diseases.

Autopolyploidization has been proposed as a means to improve disease resistance in banana (Hamill et al., 1992). In impatiens, Arisumi (1973) studied the morphology and breeding behavior of colchicine-induced polyploids in several Impatiens species, but there have been no reports in the literature about the effects of polyploidization on I. walleriana, particularly on disease resistance.

Due to the lack of resistance against DM in I. walleriana and its incompatibility with DM-resistant I. hawkeri, there has been a strong need to find alternative approaches to improve DM resistance in I. walleriana. One of the potential alternative approaches could be by inducing autopolyploidy, followed by identifying autotetraploids and characterizing their DM resistance. This study was designed to assess the

effectiveness of this alternative approach. The hypothesis of this study was that autotetraploid impatiens may show increased resistance to DM and differences in certain morphological aspects.

Materials and Methods

Polyploid Induction

Seeds of impatiens (I. walleriana cv. Super Elfin Lipstick) (Ball Horticultural Company,

West Chicago, IL) were germinated on filter paper in 100 mm × 15 mm Petri dishes

(Fisher Scientific, Pittsburgh, PA) at 25 °C. Germinating seeds were treated with 0

(control), 0.05%, 0.10%, 0.15%, or 0.20% (w/v) colchicine (Sigma-Aldrich, St. Louis,

MO) for 2.5 days. Each treatment consisted of three replicates with 40 seeds per replicate, and the different treatments were arranged in a completely randomized design. After treatment, seeds were rinsed in water and then germinated in 20-row seeder trays (model P-SEED20; Landmark Plastic Co., Orlando, FL) [53.8 × 27.5 × 3.1 cm] that were filled with a commercial soilless potting mix (Fafard Germination Mix;

Conrad Fafard, Inc., Agawam, MA). The seeder trays were covered with plastic lids to retain moisture and placed in a growth room with the temperature between 22 and 25

°C and a photoperiod of 16 h light/8 h dark. After true leaves emerged, seedlings were transplanted into Todd planter flats (model TR72D; Speedling Inc., Sun City, FL) filled with the commercial potting mix (Fafard 3B Mix; Conrad Fafard, Inc.) and grown in the greenhouse at temperatures between 25 and 30 °C and a photoperiod of 16 h light/8 h dark for 4 weeks at University of Florida/IFAS/Gulf Coast Research and Education

Center (UF/IFAS/GCREC). Subsequently, seedlings were transferred into 6-inch plastic containers filled with Fafard 3B Mix, with one seedling per container. A water-soluble

fertilizer (SA-50; 16N-3.5P-16K; Southern Agricultural Insecticides Inc., Palmetto, FL) was applied at 75 ppm once a day until plants came into flowering.

Identifying Putative Tetraploids

The ploidy level of treated impatiens plants was determined using an Accuri C6 flow cytometer (Accuri, Ann Arbor, MI, USA) at the University of Florida’s

Interdisciplinary Center for Biotechnology Research, following the procedure described by Doležel et al., (2007) and modified by Cao et al. (2014). Leaves were collected from colchicine-treated impatiens plants, and co-chopped, using a sharp blade, with a similar amount of leaf tissues of the original diploid impatiens in 1 mL of cold LB01 lysis buffer

(Doležel et al., 2007). Ploidy analysis was repeated two to three times for each plant.

Solid tetraploids were identified as those that showed only one peak in the flow cytometry analysis and whose peak of relative fluorescence was nearly twice of that of diploids.

Determining Nuclear DNA Contents and Confirming Ploidy Levels

The absolute nuclear DNA content of impatiens tetraploids (as well as diploids) were determined using a CyFlow® Ploidy Analyzer (Sysmex Partec GmbH, Germany), following the procedure described by Doležel et al., (2007) and modified by Cao et al.,

(2014). Mature impatiens leaf segments (about 0.5 × 0.5 cm2) were co-chopped with a similar amount of leaf pieces of rye (Secale cereal cv. Daňkovské) in 1 mL of cold LB01 lysis buffer (Doležel et al., 2007). The nuclear DNA content of ‘Daňkovské’ is 16.19 pg/2C (Doležel et al. 2007). The nuclear DNA content of impatiens samples were calculated as follows: 2C DNA content of impatiens samples = (mean sample fluorescence peak ÷ mean standard fluorescence peak) × 2C DNA content of the

standard. For each tetraploid and diploid, at least three replicates of leaf samples from different shoots were analyzed, and in each run, at least 3,000 nuclei were analyzed.

Chromosome counting was done following a protocol described by Cao et al.,

(2014). Briefly, root tips (about 1 cm in length) were excised from vigorously growing roots of impatiens plants grown in containers, pre-treated in a 0.02 M 8- hydroxyquinoline (Sigma-Aldrich) solution in the dark for 4 h, and then fixed in a fixative solution (3 methanol: 1 glacial acetic acid, v/v) at 4 °C overnight. Fixed root tips were rinsed under running water for 1 min, and then digested in 1 N hydrochloric acid (HCl)

(Fisher Scientific) at room temperature (approximately 24 °C ) for 10 min. The root tips were rinsed with deionized water three times, and then stained in an aceto-carmine staining solution (Carolina Biology Supply Company, Burlington, NC) for 3 h. The meristematic tissue of stained root tips was squashed in a drop of aceto-carmine on a clean glass slide using a dissecting needle. A glass coverslip was gently placed on the meristematic tip using a pair of tweezers and the meristematic tissue was further squashed firmly with a thumb on the coverslip. Slides were slightly heated over an alcohol lamp to increase the contrast between the cytoplasm and the chromosomes in cells. All slides were examined under a bright field microscope (BH-2, Olympus, Tokyo,

Japan). Cells with darkly stained and well-spread chromosomes were photographed under a BX41 microscope (Olympus, Tokyo, Japan) at 1000× magnification using an

Olympus Q-Color 5 camera and the Q-imaging software (Olympus America Inc.,

Melville, NY).

Morphological Characterization

Three diploids and three tetraploids were characterized to reveal potential morphological differences between them. Cuttings were taken from each diploid and 24

tetraploid and rooted to produce at least three clonal plants of each. Cuttings were made from mature shoots and placed upright with their basal ends stuck into the commercial potting mix Fafard 3B mix in the Todd planter flats (model TR72D). All flower buds on the cuttings were removed. The flats were placed in a plastic tent until roots emerged from the basal ends of the cuttings. Approximately 4 weeks later, rooted cuttings were transplanted to 6-inch plastic containers filled with Fafard 3B mix.

For each diploid and tetraploid, three uniform rooted cuttings were selected and used as three biological replicates. Ten mature leaves were collected from each clonal plant (30 leaves total per diploid and per tetraploid) and used to measure leaf length, width, and thickness. Leaf length and width were measured with a household stainless steel ruler as the distance from the tip to the bottom of the basal end of the leaf and the widest distance across the leaf blade area, respectively. Leaf thicknesses were measured with an electronic digital caliper (Fowler & NSK Max-Cal, Japan). Nail polish imprints were taken from the abaxial surface of mature leaves and observed under the

BX41 microscope at 400× and 100× magnification for stomatal length and density.

Digital images of the imprints were taken using an Olympus Q-Color 5 camera and analyzed using the Q-imaging software to measure the length and density of stomata.

For each clonal plant, five leaves were sampled and for each leaf, five fields of the imprints were examined, resulting in a total of 75 fields on 15 leaves for a given diploid or tetraploid.

Days to flower for each clonal plant were recorded as the number of days from sticking cuttings into the potting mix to the opening of the first flower for the plant. The number of fully-opened flowers produced per plant was counted every 10 days during

the full-bloom period of the plant. Flower counting was repeated four times, and the number of flowers in each 10-day interval were averaged to obtain the number of flowers per clonal plant. The size of flowers was measured at the widest distance between the two opposite lateral petals of a fully-opened flower. Ten flowers were sampled for each clonal plant, and 30 flowers total for each diploid and tetraploid.

The total number of flowering shoots and the thickness of flowering shoots were used as parameters to evaluate plant architecture. The thickness of flowering shoots was measured at the midpoint of each shoot using an electronic digital caliper.

Pollen stainability was determined using the fluorochromatic procedure (FCR) described by Heslop-Harrison and Heslop-Harrison (1970) with minor modifications.

Fresh pollen grains in fully-opened flowers were collected into a microcentrifuge tube

(1.5 mL) and stained with fluorescein diacetate (FDA) (Fisher Science Education,

Nazareth, PA) that was dissolved in acetone (2 mg/ mL) and 10% sucrose (Fisher

Science Education). After staining at 25 °C in dark for 1.5 hours, pollen grains were observed under a stereomicroscope (SZX16, Olympus, Tokyo, Japan). Pollen grains emitting green fluorescence were counted as stainable. Five flowers were sampled for each clonal plant, 15 flowers for each diploid or tetraploid, and pollen grains in three microscopic fields were examined for each flower. The length of pollen grains was measured by analyzing digital images of stained pollen grains with the Q-imaging software. Fifteen pollen grains were measured for each clonal plant, and 45 pollen grains total for each diploid and tetraploid.

Determining DM Resistance

Three diploids and three tetraploids were evaluated for their resistance to DM. A single-spore isolate of P. obducens was obtained from DM-infected I. walleriana leaves 26

in the experimental field at GCREC in 2014. The isolate was maintained on live plants of I. walleriana cv. Super Elfin Lipstick in a growth room and transferred onto new live plants monthly. Two complementary resistance assays were used: leaf disc assay and in-vivo inoculation assay. In leaf disc assays, fresh mature impatiens leaves were harvested from plants grown in the growth room and rinsed with autoclaved deionized water three times under a laminar hood. Leaf discs (1.5 cm in diameter) were excised from the leaves using a cork borer and placed, with the adaxial side up, on a 0.8% water agar plate in a 100 mm × 15 mm plastic Petri dish. Leaf discs were inoculated by pipetting 20 µL of the P. obducens spore suspension (1 × 105 sporangia/mL) on each leaf disc. The inoculated leaf discs in the Petri dishes were left in the hood at 22 °C in dark for 24 h, and then the droplets of spore suspension, if still present, were blotted dry with filter paper and the leaf discs were turned over so that the abaxial side was up. The leaf discs in the Petri dishes were incubated at 22 °C with a photoperiod of 12 h light/12 h dark and a light intensity approximately 100 µmol m-2 s-1. Assessment of DM severity began 6 days post inoculation (dpi) and ended at 10 dpi. Disease severity was visually scored on a scale of 0 to 4, with 0 = no visible sporulation, and 1, 2, 3 and 4 = 1% to

25%, 26% to 50%, 51% to 75%, and 76% to 100% of the leaf area with visible sporulation, respectively. Each Petri dish contained ten leaf discs and was considered as an experimental unit. For each diploid and tetraploid, at least four replicates (40 leaf discs total) were examined at each point of time.

To determine sporangia densities on inoculated leaf discs, the leaf discs were immersed in 400 µL autoclaved deionized water containing 0.05% Tween 20 (Sigma-

Aldrich) in a 1.5 mL centrifuge tube. The microcentrifuge tubes were placed on a mini-

shaker (Vortex-Genie; Fisher Scientific) for 5-10 s to dislodge sporangia from leaf surfaces. Approximatey 10 µL of the suspension was loaded onto a hemocytometer, which was then observed under a BH-2 microscope (Olympus) to count sporangia.

Sporangia counts were converted into sporangia densities as the number of sporangia per square centimeter of leaf surface. Sporangia counting was performed at 6 dpi, 8 dpi, and 10 dpi. Two leaf disc assay experiments were conducted for the three diploids and three tetraploids. In each experiment, ten leaf discs were inoculated and examined for each diploid or tetraploid.

In the in-vivo inoculation assays, five randomly chosen mature leaves on each clonal plant were labeled and inoculated by pipetting 100 µL of a P. obducens spore suspension (2 × 105 sporangia/ mL) onto the adaxial leaf side. The inoculated plants were enclosed in a plastic bag and placed in the growth room at 22 °C with a photoperiod of 12 h light/12 h dark and a light intensity level approximately 100 µmol m-2 s-1. Inoculated leaves were rated on a binary scale where 0 = no visible sporulation and

1 = visible sporulation, and a disease incidence was calculated for each clonal plant.

The experimental unit was a single containerized plant with five leaves inoculated per plant. Two independent in-vivo inoculation experiments were conducted using three replicates for each diploid and tetraploid, arranged in a completely randomized design.

The pathogen structures of P. obducens in inoculated impatiens leaves were examined using a modified trypan-blue staining protocol described by Vélez (2005).

Briefly, inoculated leaf discs were collected at 1, 2, 3, 4, or 6 dpi and cleared in 50-mL centrifuge tubes, first with 5 mL of the clearing solution A [acetic acid (EMD Chemicals

Inc., Gibbstown, NJ): absolute ethanol (> 99.5%) (Fisher Scientific) at 1: 3, v/v] on a

shaker at about 80 rpm overnight, and then with 5 mL of the clearing solution B [acetic acid: absolute ethanol: glycerol (Fisher Scientific) at 1: 5: 1, v/v/v] for at least 3 hours.

Cleared leaf discs were stained in 5 mL of 0.01 % trypan blue (Sigma-Aldrich) staining solution [trypan blue: lactic acid (Fisher Scientific): phenol (Fisher Scientific): distilled water=0.003:1:1:1, w/v/v/v] overnight while they were shaken at about 80 rpm. Stained leaf discs were rinsed with autoclaved 60% glycerol to remove the staining solution.

Finally, the stained leaf discs were placed on a clean slide with a drop of 60% glycerol, covered with a cover slip, and observed under a BX41 microscope (Olympus). For each time point, three leaf discs were sampled, cleared, stained, and observed for each diploid and tetraploid.

Statistical Analysis

The software package SPSS v 22.0 (IBM SPSS Statistics for Windows, ver. 22.0;

IBM Corp., Armonk, NY, USA) was used for analysis of variance (ANOVA) and mean separation. The significance of mean differences was tested using the Tukey’s Test at P

< 0.05.

Results

Polyploid Induction, Identification and Confirmation

Impatiens seeds germinated readily under the conditions described above.

Radicles emerged on all seeds by 4 days after sowing. At this stage the germinating seeds were subjected to colchicine treatment (0.05% to 0.20%). Many of the treated seedlings stopped further growth after extending cotyledons and did not produce any true leaves. Presumably the growing point of these seedlings was destroyed by the colchicine treatment and therefore were eliminated from the seedling survival count.

Colchicine treatments reduced seedling survival rate dramatically. Even at 0.05%

colchicine, the lowest concentration used, the impatiens seedling survival rate was reduced by as much as 83.7% (Table 2-1). By approximately 2 months after colchicine treatment, a number of the treated seedlings looked quite different from the untreated seedlings, with larger and thicker leaves and thicker stems. All the growing seedlings were analyzed for their ploidy levels, and eleven tetraploids were identified. In addition to tetraploids, mixoploids and some octoploids were observed. This study focused on characterizing the solid tetraploids.

The average nuclear DNA content of impatiens diploids was 3.94 pg/2C. The average nuclear DNA content of tetraploids based on analyzing leaf tissue samples was

7.90 pg/2C, approximating twice the nuclear DNA content of the diploids (Table 2-2). All selected tetraploids displayed one peak in flow cytometry analysis, indicating that they were solid tetraploids (Figure 2-1). The tetraploids were propagated by cuttings, and resulted clonal tetraploids were used in chromosome counting. Squashing of root meristematic tissue showed that the induced tetraploids had 2n = 4x = 32 chromosomes while the diploids had 2n = 2x = 16 chromosomes (Figure 2-2).

Changes in Morphology

The induced tetraploids showed significant changes in a number of morphological aspects compared to diploids (Figure 2-3). Tetraploids produced significantly larger, thicker leaves (25.1%, 27.0% and 48.4% increase in leaf length, width, and thickness, respectively) and larger flowers (57.5% increase in flower diameter on average), but produced fewer flowers per plant (37.4% reduction on average). Significantly thicker shoots (53.7% increase on average) were observed in tetraploids, but on average the number of shoots produced per plant by tetraploids was

33.8% of that by diploids. Tetraploids took more days to flower (9.7% increase on 30

average). The length of stomata on tetraploid leaves was on average 50.0% greater, while the density of their stomata was reduced by an average of 42.2%. Pollen grains of tetraploids were larger (28.6% increase on average) and showed 32.2% increase in stainability. No significant differences were observed among tetraploids or diploids (P <

0.05, Table 2-2).

Changes in DM Resistance

In the leaf disc assays, white sporulation began to appear from the abaxial side of the inoculated leaf discs at 6 dpi for both diploids and tetraploids. The sporulation became denser as the incubation progressed and eventually spread across the whole discs (Figure 2-6). Evaluation of DM severity on these leaf discs began at 6 dpi and repeated daily until 10 dpi. On diploid leaf discs, the DM severity increased by 147.6% from 6 dpi to 7 dpi, and then by 12.2% to 23.6% daily from 7 dpi to 10 dpi. On tetraploid leaf discs, the DM severity increased by 92.7% from 6 dpi to 7 dpi, and then by 20.1% to 31.1% daily from 7 dpi to 10 dpi. The DM severity on tetraploid leaf discs was, on average, significantly lower than the DM severity on diploid leaf discs, by 32.9% to

47.8% at 6 dpi through 10 dpi (Table 2-3). No significant differences in DM severity were observed among plants within the same ploidy level.

Sporangia densities on both diploid and tetraploid leaf discs increased as the incubation extended from 6 dpi to 10 dpi. On diploid leaf discs, the sporangia density increased by, on average, 512.2% between 6 dpi and 8 dpi and then by 170.2% between 8 dpi and 10 dpi. On tetraploid leaf discs, the sporangia density increased by, on average, 387.1% between 6 dpi and 8 dpi and by 170.4% between 8 dpi and 10 dpi.

At 8 dpi and 10 dpi, the sporangia density on tetraploid leaf discs was significantly lower

(by 43.7%) than that on diploids. No significant differences were ultimately observed among tetraploids or diploids (Table 2-4).

The pathogen structures of P. obducens in the inoculated diploid and tetraploid leaf discs were examined at 1, 2, 3, 4, and 6 dpi. The pathogen seemed to go through a similar germination and development process inside both diploid and tetraploid leaves. Vesicles, hyphae, and haustoria were observed in leaf epidermal cells at 2 dpi; more hyphae and haustoria appeared in the leaf tissues from 3 to 6 dpi. By 6 dpi, monopodially branched sporangiophores began to emerge from the stomata on the abaxial side of the leaves, and white sporulation became visible to the naked eyes

(Figure 2-7).

In the in-vivo inoculation assays, DM sporulation was not visible until 10 dpi on diploid or tetraploid leaves, even though the leaves were challenged with a P. obducens spore suspension containing two times more spores than the spore suspension used in leaf disc assays. No significant differences in DM incidence were observed among diploids or tetraploids in any of the three evaluations (Table 2-5). However, tetraploid

4x-1 showed a significantly lower DM incidence (30.0% to 69.6% lower) at 10 dpi, and tetraploid 4x-2 had a significantly lower DM incidence (by 21.9% to 34.5%) at 11 dpi.

Tetraploid 4x-3 showed a lower DM incidence than the three diploids at all three time points (10 dpi through 12 dpi). The differences between tetraploid 4x-3 and the three diploids in DM incidence diminished between 10 dpi and 12 dpi: 30% to 69.6% lower at

10 dpi, to 21.9% to 34.5% lower at 11 dpi, and to 13.0% lower at 12 dpi.

Discussion

Tetraploid Induction, Identification and Confirmation

Chromosome doubling is a powerful ploidy manipulation tool for plant breeding and genetic improvement. Colchicine is a chemical widely used to induce chromosome doubling. It is an antimitotic agent that functions by destroying the spindle fibers during mitosis. Colchicine also inhibits seed germination and shoot growth (Petersen et al.,

2003). Thus, a decrease of seedling survival rate in impatiens following colchicine treatment was expected. Similar observations have been reported in other plants (Majdi et al., 2010; Yang et al., 2006). Tetraploid induction efficiency is an important parameter to select the best colchicine treatment for tetraploid induction as it takes into account both the seedling survival rate and the tetraploid induction rate (Lehrer et al., 2008). In this study, the application of 0.05% colchicine yielded the largest number of tetraploids, thus this concentration could be a good starting point to determine accurate colchicine concentrations and durations for inducing additional impatiens tetraploids in the future.

In this study, the observed seedling survival rates were much below 50%, which suggests lower colchicine concentrations and/or shorter durations in future tetraploid induction experiments.

Morphological Changes

Results from this study showed that induced tetraploids produced thicker stems, larger leaves, and larger flowers, and had larger stomata but lower densities of stomata.

These results agreed well with the morphological changes in New Guinea and Java impatiens reported by Arisumi (1973). The induced tetraploids produced larger flowers, which may be desirable, however, they produced fewer shoots and fewer flowers per

plant. It will be interesting to see if these morphological changes affect the ornamental values and performance of induced tetraploids in the landscape.

Stomatal size and density have been used as an indicator of plant ploidy levels

(Kadota and Niimi, 2002; Thao et al., 2003), and the length of stomata has been used as an indicator of stomatal sizes (Wang and Clarke, 1992). As observed in this study, stomata on induced impatiens tetraploids were significantly longer than those on impatiens diploids, and the density of stomata on impatiens tetraploids was significantly lower than that on diploids. These differences may provide an efficient way to identify putative tetraploids in future impatiens studies and breeding should ploidy analyzers be unavailable.

The FCR test protocol has been widely used to assess pollen stainability

(Heslop-Harrison et al., 1984). In this study, pollen grains from impatiens tetraploids showed 32.2% higher stainability than those from diploids. This differs from the results by Arisumi (1973), where New Guinea and Java impatiens tetraploids had higher percentages of abortive pollen grains. Lower pollen stainabilities have been reported in many tetraploids in other species. For example, tetraploids of Lantana camara had lower pollen stainabilities than diploids (Czarnecki et al., 2014). Similarly, Cohen et al.

(2013) found that autotetraploid lines of Hylocereus species had lower pollen viability than the diploids. Lower pollen stainabilities in induced autotetraploids are often associated with the formation of polyads instead of tetrads during meiosis. However, a study in Lippia alba revealed that large numbers of meiotic abnormal cells (triads and diads) had no significant effects on the stainability of pollen grains (Reis et al., 2014).

Further studies are necessary to understand why the induced impatiens tetraploids in this study showed higher pollen stainabilities.

Changes in DM Resistance

Downy mildew disease severity, disease incidence, and sporangia density of P. obducens were used in this study as parameters to characterize the differences between induced tetraploids and diploids in DM resistance. Compared to diploids, all three tetraploids had significantly lower DM disease severity from 6 to 10 dpi and lower sporangia densities at 8 and 10 dpi. A significant reduction of DM disease incidence was also observed in one of the tetraploids (4x-3) in in-vivo inoculation assays. Unlike the resistance to P. viticola in grapevine where resistant cultivars or species exhibited localized necrosis and a hypersensitive response (HR) at the infection site or retarded pathogen development (Bellin et al., 2009; Dίez-Navajas et al., 2008), no obvious signs of defense responses were observed in the inoculated tetraploid impatiens leaves. We noted similar pathogen development in the leaf tissues of diploids and induced tetraploids.

Increased disease resistance has been reported in induced polyploids of other plant species, however the mechanisms of such changes remain to be elucidated. Fort

(2013) suggested that the increased resistance to pathogens in tetraploid A. thaliana accession C24 could be the result of changes in the expression of defense-related genes or that it could be contributed to leaf architecture or cuticle that provides more physical barriers against pathogen infection.

Cuticles, trichomes, and stomata are anatomical leaf structures that can play an important role in disease defense. Thick cuticles have been shown to be important structures against the penetration of pathogens (Archer and Cole, 1986). Levin (1973) 35

discussed the role trichomes play in insect defense and suggested they may also protect plants against pathogen penetration. Stomata, as natural surface openings on the leaves, often serve as important entry sites for plant pathogens (Melotto et al.,

2008). Previous studies have shown the existence of complicated relationships between plant disease resistance and leaf morphology and anatomical structures. However, the literature is contradictory. Ramos and Volin (1987) revealed that Lycopersicon spp. had lower incidence and severity of Xanthomonas campestris pv. vesicatoria when leaf stomatal closure was physiologically induced and stomatal opening was chemically suppressed, and that the stomatal density was positively correlated with the number of spot lesions produced after the infection. Potato (Solanum tuberosum) cultivars resistant against the late blight disease (Phytophthora infestans) had thicker cuticles, smaller stomata, lower stomatal densities, and larger trichomes compared with susceptible cultivars (Mahajan and Dhillon, 2003). However, in grapevine genotypes

(Vitis vinifera and Vitis riparia), no clear relationships were observed between the density and morphology of trichomes and stomata and their resistance to P. viticola

(Boso et al., 2010). In this study, impatiens leaves were inoculated on the adaxial side where no stomata existed, thus it seems unlikely that the difference in DM resistance between diploids and tetraploids resulted from the differences in stomatal size and density. As shown by our histological survey, the sporangiophores of P. obducens, the causal agent of DM, emerged from stomata on the abaxial side at the end of the disease cycle. A question could be asked as to whether or not the much larger but much fewer stomata on the abaxial side of tetraploid leaves could reduce the emergence of P. obducens sporangiophores and reduce DM disease severity and

incidence. Future studies may focus on understanding the changes in leaf architecture and other anatomical structures (cuticle, trichome, etc.) as well as gene expression in these tetraploids.

Table 2-1. Effects of colchicine treatments on seedling survival and tetraploid induction in Impatiens walleriana. Colchicine Seedling survival rate Tetraploid Tetraploid impatiens (%) (%)z impatiens induction induction efficiency (%)x rate (%)y 0 100.0 ± 0.0 aw 0.0 ± 0.0 NS 0.0 ± 0.0 NS 0.05 16.7 ± 8.2 b 5.8 ± 3.3 1.5 ± 1.3 0.10 6.7 ± 1.7 b 2.5 ± 0.0 0.2 ± 0.04 0.15 4.2 ± 3.0 b 0.0 ± 0.0 0.0 ± 0.0 0.20 1.7 ± 1.7 b 0.8 ± 0.8 0.04 ± 0.04 z Seedling survival rate = the no. of seedlings with true leaf / the total no. of seeds treated. y Tetraploid impatiens induction rate = the no. of solid tetraploid / the total no. of seeds treated. x Tetraploid induction efficiency = seedling survival rate × tetraploid induction rate (Bouvier et al., 1994). w Mean separation in columns by Tukey’s Method at p <0.05.

Table 2-2. Morphological differences between diploid (2x) and tetraploid (4x) Impatiens walleriana. Leaf Leaf Leaf Stomatal Stomatal Shoots Thickness Flower Days Flowers Pollen Pollen Nuclear length width thickness length density per of shoots diameter to (no.) size stainability DNA (cm) (cm) (mm) (µm) (no./mm2) plant (mm) (cm) flower (µm) (%) content (no.) (no.) (pg/2C) 2x-1 4.40 ± 3.24 0.83 ± 24.02 ± 340.80 ± 64.00 ± 4.29 ± 4.11 ± 39.33 42.08 ± 52.88 30.82 ± 3.93 ± 0.07 ± 0.02 b 0.66 b 5.66 a 2.65 a 0.04 b 0.02 b ± 0.33 0.87 a ± 0.92 2.51 b 0.12 b bz 0.02 b b b 2x-2 4.41 ± 3.21 0.86 ± 25.38 ± 336.86 ± 64.33 ± 4.10 ± 4.05 ± 38.67 43.00 ± 52.59 30.33 ± 3.96 ± 0.06 b ± 0.02 b 0.54 b 6.99 a 2.60 a 0.08 b 0.02 b ± 0.33 0.58 a ± 0.65 0.76 b 0.33 b 0.01 b b b 2x-3 4.35 ± 3.32 0.84 ± 23.07 ± 337.72 ± 62.33 ± 4.17 ± 4.12 ± 39.00 42.67 ± 51.69 30.57 ± 3.95 ± 0.05 b ± 0.02 b 0.71 b 7.12 a 2.60 a 0.09 b 0.05 b ± 0.00 0.22 a ± 0.37 0.78 b 0.33 b 0.03 b b b 4x-1 5.64 ± 4.14 1.24 ± 36.59 ± 194.56 ± 20.67 ± 6.44 ± 4.73 ± 43.33 26.25 ± 69.38 41.22 ± 7.89 ± 0.05 a ± 0.02 a 1.74 a 6.83 b 2.03 b 0.20 a 0.03 a ± 0.33 0.25 b ± 1.89 0.89 a 0.15 a 0.01 a a a 4x-2 5.39 ± 4.15 1.27 ± 36.23± 197.45 ± 20.67 ± 6.37 ± 4.70 ± 42.33 27.00 ± 67.28 40.60 ± 7.91 ± 0.04 a ± 0.03 a 1.44 a 4.42 b 0.88 b 0.13 a 0.03 a ± 0.33 0.38 b ± 2.52 1.01 a 0.18 a 0.04 a a a 4x-3 5.43 ± 4.13 1.23 ± 35.92 ± 194.95 ± 23.00 ± 6.51 ± 4.67 ± 42.67 26.67 ± 67.03 39.39 ± 7.92 ± 0.06 a ± 0.03 a 1.62 a 4.04 b 1.15 b 0.17 a 0.02 a ± 0.33 0.55 b ± 1.68 0.56 a 0.12 a 0.05 a a a z Mean separation in columns by Tukey’s Method at p <0.05.

Table 2-3. Differences in downy mildew severity between diploid (2x) and tetraploid (4x) Impatiens walleriana from 6dpi (days post inoculation) to 10 dpi. 6 dpi 7 dpi 8 dpi 9 dpi 10 dpi 2x-1 0.85 ± 0.05 2.01 ± 0.07 2.51 ± 0.07 2.79 ± 0.08 3.18 ± 0.09 az a a a a 2x-2 0.81 ± 0.09 2.05 ± 0.12 2.51 ± 0.09 2.89 ± 0.07 3.24 ± 0.08 a a a a a 2x-3 0.80 ± 0.06 2.04 ± 0.06 2.50 ± 0.07 2.90 ± 0.07 3.21 ± 0.08 a a a a a 4x-1 0.55 ± 0.05 0.96 ± 0.04 1.34 ± 0.05 1.60 ± 0.08 1.98 ± 0.06 b b b b b 4x-2 0.55 ± 0.04 1.10 ± 0.06 1.40 ± 0.07 1.71 ± 0.08 2.05 ± 0.05 b b b b b 4x-3 0.55 ± 0.04 1.13 ± 0.05 1.44 ± 0.04 1.71 ± 0.06 2.04 ± 0.07 b b b b b z Mean separation in columns by Tukey’s Method at p <0.05. Means were calculated from data from two independent experiments.

Table 2-4. Differences in sporangia density of P. obducens (103/cm2) on the abaxial side of leaf discs between diploid (2x) and tetraploid (4x) Impatiens walleriana from 6 dpi to 10 dpi. 6 dpi 8 dpi 10 dpi 2x-1 3.34 ± 0.61 NS 20.16 ± 2.58 az 55.26 ± 6.17 a 2x-2 3.17 ± 0.61 20.10 ± 2.19 a 54.30 ± 6.17 a 2x-3 3.34 ± 0.58 19.99 ± 1.86 a 53.22 ± 3.96 a 4x-1 2.04 ± 0.34 10.42 ± 1.26 b 30.63 ± 2.50 b 4x-2 2.60 ± 0.43 12.34 ± 1.33 b 31.03 ± 1.89 b 4x-3 2.32 ± 0.43 11.15 ± 1.33 b 30.00 ± 2.81 b z Mean separation in columns by Tukey’s Method at p <0.05. Means were calculated from data from two independent experiments.

Table 2-5. Differences in downy mildew incidence between diploid (2x) and tetraploid (4x) Impatiens walleriana from 10 dpi to 12 dpi after in-vivo inoculation of live plants 10 dpi 11 dpi 12 dpi 2x-1 0.17 ± 0.03 abz 0.73 ± 0.04 ab 1.00 ± 0.00 a 2x-2 0.23 ± 0.03 a 0.87 ± 0.04 a 1.00 ± 0.00 a 2x-3 0.10 ± 0.04 ab 0.73 ± 0.04 ab 1.00 ± 0.00 a 4x-1 0.07 ± 0.04 b 0.70 ± 0.04 ab 0.93 ± 0.04 ab 4x-2 0.17 ± 0.03 ab 0.57 ± 0.03 b 0.90 ± 0.04 ab 4x-3 0.07 ± 0.04 b 0.57 ± 0.06 b 0.87 ± 0.04 b z Mean separation in columns by Tukey’s Method at p <0.05. Means were calculated from data from two independent experiments.

A B

Figure 2-1. Flow cytometric histograms of impatiens and rye. A) Diploid impatiens and rye. B) Tetraploid impatiens and rye. The y-axis indicates the nuclei counts and the x-axis indicates the fluorescence peaks of impatiens (left) and rye (internal reference) (right).

A B Figure 2-2. Metaphase spread of impatiens root tip cells. A) Diploid impatiens cell with 2n = 2x = 16 chromosomes. B) Tetraploid impatiens cell with 2n = 4x = 32 chromosomes. Bars = 5 μm. (Photo courtesy of author.)

A B

Figure 2-3. Impatiens grown in plastic pots. A) Diploid impatiens. B) Induced tetraploid impatiens. (Photo courtesy of author.)

A B

Figure 2-4. Nail polish imprints taken from the abaxial surface of mature impatiens leaves. A) Diploid impatiens has a higher stomatal density and a smaller stomatal size. B) Induced tetraploid impatiens has a lower stomatal density and a larger stomatal size. Bars = 20 μm. (Photo courtesy of author.)

A B

Figure 2-5. Stained impatiens pollen grains under a stereomicroscope. A) Pollen grains of a diploid impatiens. B) Pollen grains of an induced tetraploid impatiens. Bars = 250 μm. (Photo courtesy of author.)

A B C

D E F

Figure 2-6. Leaf discs of diploid and induced tetraploid impatiens in leaf disc inoculation assay showing white downy mildew sporulation emerging from the abaxial surface of impatiens leaf discs. A, B, C) downy mildew progression on diploid leaf discs; D, E, F) downy mildew progression on tetraploid leaf discs. (Photo courtesy of author.)

Ve Ha Sp Sp Ha Hy Hy

A B C D St

Hy Sp StSt Sp Ha

Hy Ha E F G H

Figure 2-7. Histological survey of Plasmopara obducens (causal agent of downy mildew) development inside impatiens leaf discs from 1 dpi to 6 dpi by trypan blue staining. A) Sporangia inoculated on the adaxial surface of a diploid impatiens leaf disc at 1 dpi. B, C) Vesicle, hyphae, and haustoria observed inside a diploid impatiens leaf disc from 2 to 6 dpi. D) Sporangiophore emerging from stomata on the abaxial surface of diploid impatiens at 6 dpi with sporangia borne on sporangiophore branches. E) Sporangia inoculated on the adaxial surface of tetraploid impatiens leaf discs at 1 dpi. F, G) Vesicle, hyphae, and haustoria observed inside tetraploid impatiens leaf discs from 2-6 dpi. H) Sporangiophore emerging from stomata on the abaxial surface of tetraploid impatiens leaf discs at 6 dpi with sporangia borne on sporangiophore branches. Bars = 50 μm. Abbreviations: Sp = sporangia, Ve = vesicle, Hy = hypha, Ha = haustoria, St = stomata. (Photo courtesy of author.)

CHAPTER 3 IMPROVING DOWNY MILDEW RESISTANCE IN IMPATIENS THROUGH GENETIC TRANSFORMATION

Introduction

Genetic Transformation

Genetic transformation has become a very valuable tool for genetic improvement of plants (Gasser and Fraley, 1989; Sharma and Ortiz, 2000). Compared to traditional plant breeding techniques, genetic transformation can overcome the limitation that gene transfer only occurs in closely-related plant species and can avoid the introgression of undesirable genes, thus providing a better control of the gene modification and expression process (Gepts, 2002). Genetic transformation has offered a wide range of possibilities for crop improvement in terms of insect resistance (Vaeck et al., 1987), herbicide resistance (Comai et al., 1985; Haugnh et al., 1988), modified biomass property and improved biomass yield (Torney et al., 2007), and disease resistance

(Shah, 1997; Salmeron and Vernooij, 1998; Rommens and Kishore, 2000; Stuiver and

Custers, 2001).

Agrobacterium-mediated Transformation

The Agrobacterium-mediated transformation system has been commonly used in genetic transformation of plants. It takes advantage of the ability of Agrobacterium tumefaciens, a soil dwelling bacterium, to infect a wide range of host plants (primarily eudicots) through wound sites and transfer part of its DNA (known as the transfer DNA or T-DNA) into plant genomes. T-DNA is part of Agrobacterium’s tumor-inducing (Ti) plasmid and contains genes that code for enzymes synthesizing opines and phytohormones. Opines are utilized by the Agrobacterium as a source of nitrogen and carbon (Raven et al., 1999; Gelvin, 2000). The synthesis of plant hormones (auxin and

cytokinin) causes plant cells to grow uncontrollably and form crown gall tumors. In genetic engineering, the genes in the T-DNA that confer the crown gall formation are replaced by desireable genes, which are incorporated into the plant genome for desired phenotypes (Dale and von Schantz, 2002; Gelvin, 2000). Relative to other transformation systems, such as the microprojectile bombardment and electroporation,

Agrobacterium-mediated transformation is more efficient and less costly, and the foreign genes will be stably integrated into the plant genome and transmitted on to progenies

(De Block, 1993). To use Agrobacterium-mediated transformation in a targeted plant, it is necessary to have an efficient tissue culture and plant regeneration system and an effective selection scheme that will suppress the growth and multiplication of non- transformed cells. An efficient and practical plant regeneration system and selection scheme are of particular importance to plant breeding and large-scale production of transgenic plant.

Impatiens Regeneration and Transformation

A reliable and efficient system for culturing plant tissue and regenerating plants is required. Although a few in planta protocols exist that allow Agrobacterium-mediated transformation to be conducted in vivo (Rohini and Rao, 1999, 2000; Seol et al., 2008;

Zhang et al., 2006), most transgenic plants are generated by infecting in vitro cultured plant cells/tissues. With respect to impatiens, there are very few reports in the literature that deal with tissue culture and transformation of I. walleriana. Baxter (2005) used cotyledonary nodes as explant in impatiens tissue culture and showed that 1 µM of thidiazuron (TDZ) yielded a greater number of shoots per explant and a higher frequency of plant regeneration. Unfortunately, this regeneration system could not be readily utilized in impatiens transformation as the inoculated Agrobacterium often 51

damaged the cotyledonary node explant (CDE) and prevented the regeneration of transformed shoots. Dan et al. (2010) optimized Baxter’s regeneration and transformation protocol by using the hypocotyl segment containing cotyledonary nodes

(HSCCN) as explants to regenerate plants and a combination of 2.3 µM TDZ and 1.8

µM 6-benzylaminopurine (BA) in the induction medium. These changes resulted in a much higher frequency of responding explants and a larger number of shoots produced per explant. Subsequently, the multiple bud culture explants (MBCE) derived from

HSCCN were used in Agrobacterium-mediated transformation of impatiens. This system overcame the problem of explant necrosis and rotting and produced transgenic impatiens at a transformation frequency up to 58.9% (Dan et al., 2010).

Several studies in other plants have shown that true leaf nodes may also serve as good explants for plant regeneration and Agrobacterium-mediated transformation

(Agrawal et al., 2002; Chen et al., 2002; Sangwan et al., 2007; Udayakumar et al.,

2014). In our preliminary experiments, impatiens nodal explants grew into multiple bud cultures (MBC) that were morphologically similar to those induced from impatiens cotyledonary nodes. Therefore, it was decided to assess the regeneration capacity of impatiens nodal explants and their potential for use in impatiens transformation.

Selectable Markers and Reporter Genes

In Agrobacterium-mediated transformation, selectable marker genes are frequently used. They confer transformed cells/tissues resistance to certain antibiotics, herbicides, or other selective agents. One of the widely used selectable marker genes is the neomycin phosphotransferase II gene (NPTII) that can confer plant cells/tissues resistance to a range of aminoglycoside antibiotics, such as kanamycin, neomycin, geneticin (G418), and paromomycin. Theoretically, under antibiotic or herbicide 52

selection, non-transformed cells/tissues will not multiply or survive and participate in the shoot regeneration process (Dan, 2008). In reality, however, kanamycin-based selection often results in regeneration of non-transgenic shoots (“shoot escapes”) (Dan, 2008).

This situation was alleviated in some studies where kanamycin was replaced by G418, a more stringent antibiotic (Maziah et al., 2007; Xie and Hong, 2002). Dan et al. (2010) used kanamycin at 50 mg/L to select transgenic impatiens shoots although the escape rate of non-transgenic shoots under such selection scheme was unclear. In our preliminary study, as high as 80% of the regenerated impatiens shoots were non- transgenic under kanamycin selection. This high rate of escapes prompted us to explore more stringent antibiotics to suppress the growth and development of non-transformed impatiens cells/tissues.

Reporter genes are commonly used to rapidly identify transgene-expressing tissues, shoots, or plantlets. The green fluorescent protein (GFP) gene isolated from jellyfish (Aequorea victoria) has become one of the most commonly used reporter genes. The GFP gene is advantageous over other reporter genes as it requires no exogenous substrate for detection and does not cause damage to plant tissues

(Molinier et al., 2000). Plant cells/tissues transformed with the GFP gene will emit intensive visible green fluorescence when excited by blue/UV light (Molinier et al.,

2000). Reporter genes are extremely important especially when selection cannot provide adequate suppression of untransformed cells. In impatiens, transformation events could be selected at early stages by visualizing GFP expression, thus saving both time and labor (Dan et al., 2010).

Systemic Acquired Resistance and the NPR1 Gene

Plants have developed a broad range of defense mechanisms against microbial pathogens (Vale et al., 2001) and evolved an innate immune system to counter their attack (Jones and Dangl, 2006). Resistance (R) genes in a plant species encode hundreds of resistance (R) proteins that can recognize corresponding avirulence (avr) factors from pathogens. This R-avr recognition between plant and pathogen often triggers a localized resistance reaction known as the hypersensitive response (HR) characterized by rapid cell death at the site of infection. HR prevents the spread of the pathogen to other parts of the plant, leading to host-pathogen incompatibility and disease resistance (Dangl and Jones, 2001). Concomitant with this resistance mechanism, plants have also developed a secondary resistance response known as the systemic acquired resistance (SAR), which confers protection against a broad-spectrum of pathogens (Sticher et al., 1997). This defense response requires salicylic acid (SA) as a signal molecule and is associated with elevated expression of pathogenesis- related (PR) genes (Durrant and Dong 2004). Due to the limited protection provided by a single R gene or PR gene in terms of spectrum, degree and duration (Jach et al.,

1995; Jongedijk et al., 1995), defense reactions that are more closely related to the natural SAR defense mechanisms are expected to provide more durable resistance to a broader spectrum of pathogens (Lin et al., 2004). Such mechanism has been well elucidated in the model species Arabidopsis thaliana, where the NPR1 (non-expressor of PR gene) gene product proves to be an essential regulator of SAR (Cao et al., 1994).

In response to SA treatment or pathogen infection, the level of NPR1 gene expression is upregulated in Arabidopsis (Cao et al., 1997; Ryals et al., 1997), and the NPR1 protein goes through a redox change to the monomeric form (Mou et al., 2003) and 54

moves to the nucleus where it interacts with TGA transcription factors (Zhang et al.,

1999) to induce a wide array of PR genes expression, thus activating SAR.

It has been reported that overexpression of Arabidopsis NPR1 or its orthologs could enhance resistance to biotrophic and necrotrophic fungal, bacterial and oomycete pathogens in a number of plants, including Arabidopsis, rice, grape, tomato, citrus, and strawberry (Cao et al., 1998; Chern et al., 2005; Dutt et al., 2015; Henanff et al., 2009;

Lin et al., 2004; Silva et al., 2015; Zhang et al., 2010). These results suggest that the

NPR1-mediated resistance may involve a conserved signal transduction pathway that may be shared by monocot and dicot plants (Chern et al., 2001; Zhang et al., 1999).

These results also suggest that Arabidopsis NPR1 and its orthologs may be good candidate genes for transgenic manipulation for enhanced disease resistance in crops

(Cao et al., 1998; Chern et al., 2001; Friedrich et al., 2001; Lin et al., 2004).

The reported success in utilization of the NPR1 in increasing disease resistance in other plants prompted the idea of introducing the NPR1 gene into impatiens and determining if it can enhance impatiens resistance to DM. The objectives of this study were to: 1) Develop a plant regeneration system using impatiens true leaf nodes as initial explants; 2) Test the efficacy of G418 as an alternative selective agent to assist impatiens transformation; and 3) Introduce the Arabidopsis NPR1 into impatiens and characterize the resistance of transgenic impatiens to DM.

Materials and Methods

Establishing an Efficient Plant Regeneration System Using Cotyledonary Nodes and True Leaf Nodes as Explants

Explant Preparation

Seeds of I. walleriana cv. Super Elfin Lipstick (Ball Horticultural Company) were surface-sterilized in 70% (v/v) ethanol (Decon Laboratories Inc., King of Prussia, PA) for

60 s followed by 0.5% (w/v) dichloroisocyanuric acid sodium salt solution (NADCC)

(Phyto-Technology Laboratories, Shawnee Mission, KS) [containing one drop of Tween

20 (Sigma-Aldrich)] for 30 min. Seeds were germinated in glass baby food jars that each contained 30 mL of a germination medium (GM) (Table 3-1) (Figure 3-2, A). The baby food jars were capped and sealed with Parafilm (Parafilm M, Chicago, IL) and placed on a shelf in the tissue culture room set at 24 °C, 16 h photoperiod and light intensity of approximately 100 µmol m-2 s-1. Cotyledonary node and true leaf node explants (TLNE) were prepared from 28 day-old seedlings by removing cotyledons and true leaves, and hypocotols and hypercotols above and below the cotyledonary nodes or true leaf nodes (Figure 3-2, B). The nodes were cut through vertically using a scalpel blade (Feather Safety Razor Co. LTD Medical Division, Japan) to produce 2 explants from each cotyledonary node or true leaf node (4 explants from each seedling).

Induction of Multiple Bud Cultures

Previously, Dan et al. (2010) showed that 1.8 µM BA and 2.3 µM TDZ in the induction medium resulted in the highest percentage of responding explants and an increase in the number of shoots per HSCCN explant. In this study, nine BA + TDZ combinations were designed to test their effects on inducing MBC from CNE and TLNE

(Table 3-2). CNEs and TLNEs were cultured upright with their basal ends inserted into

approximately 60 mL of the solidified basal medium 1 (BM1) in each Magenta culture vessel (Sigma-Aldrich) (Table 3-1). The BM1 medium was supplemented with one of the nine BA + TDZ combinations. Cotyledonary node explants and TLNE were transferred to fresh media of the same formula three weeks post inoculation. Six weeks post inoculation, the fresh weight of the induced MBC and the number of shoots produced by each explant were recorded. One Magenta culture vessel containing four explants was an experimental unit. Treatments were replicated 5 times (a total of 5 vessels per treatment), and all Magenta vessels were arranged on the same shelf following a completely randomized design. The experiment was repeated one more time. At the end of the experiment, analysis of variance was conducted, and multiple mean comparisons were done using the Tukey’s Test at P < 0.05. The best combination of BA and TDZ was used in subsequent shoot induction medium (SIM) for transformation experiments.

Root Induction

Shoots (approximately 1 cm in length) were separated from the MBC (derived from either CNE or TLNE) and cultured upright with the basal ends inserted into the basal medium 2 (BM2) in 100 mm × 20 mm Petri dishes (Table 3-1). The medium was supplemented with indole-3-butyric acid (IBA) (Phyto-Technology Laboratories) at one of five concentrations (Table 3-4, 3-5). The percentage of shoots that formed roots, the number of days to root emergence, the number of roots induced on each shoot, and the length of roots induced were recorded as parameters to determine the efficiency of root induction. The experimental unit was a single Petri dish containing five shoots. Each treatment was replicated 6 times. All Petri dishes were arranged on the shelf in the tissue culture room following a completely randomized design. Analysis of variance was 57

performed and multiple mean comparisons were done using the Tukey’s Test at P <

0.05. All experiments were conducted two times, and the best concentration of IBA was used in the root induction medium (RIM) for transformation experiment.

Determination of Optimal Concentrations of Kanamycin and G418 for Selecting Transformants

To determine the potential of G418 as an alternative selective agent for kanamycin and their optimal concentrations for shoot selection, 3-week old MBCs

(derived from either CNE or TLNE), approximately 1 cm in diameter, were isolated and grown on the SIM medium containing kanamycin (Phyto-Technology Laboratories) or

G418 (Phyto-Technology Laboratories) for 3 weeks (Table 3-6, 3-8). Subsequently, the cultures were transferred onto and grown on fresh media containing the same concentration of kanamycin or G418 for another 3 weeks. After the cultures were exposed to kanamycin or G418 for 6 weeks, their size was measured, and the number of shoots induced on the cultures were recorded. The size of MBCs was determined by calculating a mean diameter following a method described by Jiang et al. (2012) for plant callus. The formula used in the calculation was mean diameter = SQRT (Dmax2 +

Dmin2), where Dmax and Dmin were the maximum and minimum diameters of the MBC, respectively. The inhibitory effect of kanamycin or G418 were characterized as the number of shoots induced and the increase of MBC in size compared to the control. The experimental unit was 10 cultures placed in a 100 × 20 mm Petri dish, and each treatment was replicated four times. The experiment was repeated once. Analysis of variance was conducted, and multiple mean comparisons were done using the Tukey’s

Test at P < 0.05.

Agrobacterium Culture, Transformation and Recovery of Impatiens Transformants

The Agrobacterium tumefaciens strain GV3101 containing the Gateway T-DNA vector pK7WG2D,1 (Karimi et al., 2002) was used in this study. The vector was constructed by Dr. Zhonglin Mou in the University of Florida/IFAS’s Department of

Microbiology and Cell Science, and it contains the NPR1, NPTII and GFP genes (Figure

3-1). Ten colonies of the Agrobacterium were pooled and inoculated into a glass flask containing 100 mL of 2.5 % (w/v) LB broth (Fisher Scientific) supplemented with 0.2 µm acetosyringone (AS) (Phyto-Technology Laboratories). The Agrobacterium was cultured in an incubator shaker at 200 rpm, 28 °C in dark overnight. The bacterial culture was transferred to a 50 mL centrifuge tube and centrifuged at 4000 rpm for 8 min. The bacterial pellet at the bottom of the centrifuge tube was re-suspended in the inoculation medium (IM) (Table 3-1). The OD600 value of the bacterial suspension was adjusted to approximately 0.5 using a spectrophotometer (Evolution 60S, Thermo Scientific,

Hudson, NH).

Six-week old MBCs (derived from either CNE or TLNE) were cut into pieces (0.5 cm in diameter) and then immersed in the bacterial cell suspension for 30 min.

Subsequently, the bacterial suspension was decanted and the MBCs were blotted dry.

The inoculated MBCs were then co-cultivated in sterile 100 × 15 mm Petri dishes

(Fisher Scientific) each containing two pieces of filter paper (Fisher Scientific) moistened with 100 µL of the IM. The Petri dishes were sealed and kept at 24 °C in dark for 5 days. After co-cultivation, the MBCs were cultured on solid SIM supplemented with

500 mg/L cefotaxime (Phyto-Technology Laboratories) and either 50 mg/L kanamycin or

20 mg/L G418 for selection, shoot induction and elongation. The SIM was replaced on a

weekly basis to minimize the overgrowth of Agrobacterium. The MBCs under selection were regularly examined under a stereomicroscope (SZX16, Olympus, Tokyo, Japan) for GFP expression. Individual GFP-positive shoots (approximately 1 cm in length) were separated from MBCs and transferred onto fresh RIM supplemented with 500 mg/L cefotaxime for rooting. Rooted plantlets were transferred to plastic containers filled with a commercial potting mix (Fafard 3B Mix) and grown in a growth room at temperatures between 22 and 25 °C and a photoperiod of 16 h light/8 h dark.

Confirming the Presence of the NPR1 Transgene in Impatiens

Impatiens genomic DNA was extracted from leaf tissues of putative transgenic impatiens lines using the CTAB method described by Fulton et al. (1995). The forward and reverse primers used to amplify the NPR1 transgene in transgenic impatiens were

5’ – TCTTGCCGATGTCAACCATA – 3’ and 5’ – TCTGTCAGGGACGAATTTCC – 3’, respectively. Primers were designed using the Primer-BLAST software tool at https://www.ncbi.nlm.nih.gov/tools/primer-blast/ (Ye et al., 2012). Polymerase chain reaction (PCR) was run in a total volume of 20 µL, containing 2 µL of template genomic

DNA (30 ng), 2 µL of 10× reaction buffer (New England Biolabs, Ipswich, MA), 0.4 µL of dNTP stock (200 µM) (New England Biolabs), 0.4 µL of the forward primer (0.2 µM), 0.4

µL of the reverse primer (0.2 µM), 0.1 µL of Taq DNA polymerase (1.0 units/50 µL PCR)

(New England Biolabs), and 14.7 µL of autoclaved deionized water. The prepared reactions were first denatured at 94 °C for 5 min, followed by 35 cycles of amplification at 95 °C for 30 s, 56 °C for 1 min, and 68 °C for 1 min, and a 5 min final extension at 68

°C. Non-transformed wildtype impatiens was used as a negative control and the Ti plasmid DNA prep (50 ng) was used as a positive control in PCR analysis. The amplified DNA products were separated in 1.5% agarose gel (Bio-Rad Laboratories 60

Inc., Hercules, CA) through gel electrophoresis at 110 v for 90 min, stained with Gel

Red (USA Scientific Inc., Orlando, FL), and visualized with a commercial gel documentation system.

Characterizing the Morphology and DM Resistance of Transgenic Impatiens.

Transgenic impatiens lines and the wildtype impatiens were propagated by cuttings (refer to Chapter 2) to produce at least six clonal plants per transgenic line. To reveal potential differences between the transgenic lines and the wildtype, leaf length, leaf width, leaf thickness, stomatal length, stomatal density, number of shoots on each plant, thickness of shoots, days to flower, flower diameter, number of open flowers on each plant, pollen size, and pollen stainability were measured or recorded as described in Chapter 2. Leaf disc assays, in-vivo inoculation assays, and histological staining were conducted as described in Chapter 2 to assess the resistance of transgenic lines to DM.

In leaf disc assays, the DM severity and sporangia density of P. obducens on inoculated leaf discs were determined, whereas in the in-vivo inoculation assays, the disease incidence was recorded for each transgenic plant. Statistical analyses were conducted on all collected data, as described in Chapter 2.

Results

Development of Plant Regeneration Protocols

Previous studies have shown that both BA and TDZ are required for efficient induction of buds from impatiens explants (Dan et al., 2010). In this study, three concentrations of BA (0.9, 1.8 and 3.6 µM ) and TDZ (1.15, 2.3 and 4.6 µM ) were combined in nine media. Impatiens CNEs and TLNEs cultured on these media showed similar morphological changes during the culture, and both types of explants developed multiple buds (Figure 3-2 C, D). However, different combinations of BA and TDZ had

significant effects on the number of buds induced per explant and the fresh weight of the MBC (Table 3-2, 3-3). Based on the number of buds induced and the fresh weight of the MBC, the best combinations of BA and TDZ for inducing MBCs were 1.8 µM BA and

2.3 µM TDZ for the CNEs and 1.8 µM BA and 4.6 µM TDZ for the TLNEs, respectively.

CNEs cultured under 1.8 µM BA and 2.3 µM TDZ produced an average of 32.4 buds per explant, which is 18.7% to 349.3% more than the number of buds induced with other eight combinations of BA and TDZ (Table 3-2). The fresh weight of MBCs under

1.8 µM BA and 2.3 µM TDZ was 8.4% to 1195.5% greater than the fresh weights of

MBCs with other eight combinations of BA and TDZ. It seems that TLNEs required a higher concentration of TDZ (4.6 µM rather than 2.3 µM ) for efficient bud induction.

When cultured with 1.8 µM BA and 4.6 µM TDZ, TLNEs produced an average of 26.2 buds per explant, which is 16.8% to 133.6% more than the number of buds induced with other eight combinations of BA and TDZ (Table 3-3). The fresh weight of the MBCs under 1.8 µM BA and 4.6 µM TDZ was also the greatest and 6.9% to 372.9% greater than the fresh weights under other eight combinations of BA and TDZ (Table 3-2, 3-3).

On the SIM containing BA and TDZ, small impatiens buds elongated further and developed into shoots (Figure 3-2, E, F, G, H). These shoots readily formed roots after they were transferred onto the RIM.

Five concentrations of IBA (0.1, 0.25, 0.5, 0.75, and 1 mg/L) were tested for effect on induction of roots from shoots produced by two types of explants. Based on the number of roots produced per shoot, the length of induced roots, and the time needed for root emergence, 1 mg/L of IBA seemed to be the most effective for root induction from shoots that were produced by CNE and TLNE. This concentration of IBA

induced significantly greater number of roots (from 31.0% to 118.5% increase for shoots produced by CNE, and from 47.0% to 154.1% increase for shoots produced by TLNE, respectively) and average length of roots (from 7.4% to 118.1% increase for CNE, and from 29.5% to 139.1% increase for TLNE, respectively). At this concentration of IBA, impatiens shoots formed multiple roots and developed into complete plantlets (Figure 3-

2, I, J) that were ready for transplanting into containers for acclimation.

Effect of Kanamycin and G418 on Impatiens Cultures

To assess the effectiveness of kanamycin and G418 as selective agents for impatiens transformation, MBCs induced from CNEs and TLNEs were cultured on the

SIM containing kanamycin at 0 (control), 25, 50, 75 or 100 mg/L, or G418 at 0 (control),

10, 20, 40 or 60 mg/L for six weeks. At the end of the six-week culture, the average size of the MBCs and the number of shoots produced by the MBCs were recorded. Results showed that kanamycin at 50, 75 and 100 mg/L and G418 at 20, 40 and 60 mg/L inhibited impatiens shoot growth and development (Table 3-6, 3-7, 3-8, and 3-9). MBCs cultured under these selection conditions were significantly smaller and produced significantly fewer shoots (Figure 3-3). For example, kanamycin at 50 mg/L reduced the increase in tissue size by 33.9% to 54.5% and the number of shoots by 39.2% to

53.6%; G418 at 20 mg/L reduced the increase in tissue size by 38.8% to 74.0% and the number of shoots by 41.4% to 57.5%. Kanamycin at 50 mg/L and G418 at 20 mg/L were chosen for use in subsequent transformation experiments. These concentrations were non-lethal and allowed the recovery of transgenic shoots expressing the NPTII gene but inhibited the growth of non-transformed shoots.

Transformation and Confirmation of Transgenic Plants

Four weeks after co-cultivation, GFP-positive cell masses became evident under the fluorescent stereomicroscope (Figure 3-4, A). When calculated on the basis of the percentage of MBCs showing GFP-positive cell masses, the observed transformation efficiency ranged from 10.6% to 12.9%. No significant differences were observed between the MBCs from the two types of initial explants (CNE and TLNE) or between two different selective agents (kanamycin and G418) in transformation efficiency. Only part of these GFP-positive cell masses developed into GFP-positive buds (Figure 3-4,

B), and the process took 2 to 3 months (Figure 3-4, C, D). Up to 81.2% of MBCs that survived kanamycin or G418 selection turned out to be non-transformed or escapes.

GFP-positive shoots of 1-1.5 cm in length were separated from the MBCs and transferred onto the rooting medium. These shoots formed multiple roots within a month

(Figure 3-4, E). Plantlets with a well-developed root system and 5-10 leaves were transplanted into 6-inch containers and then grown in a growth room.

The presence of the NPR1 transgene in established impatiens plants was confirmed by PCR analysis of their genomic DNA with NPR1-specific primers and gel electrophoresis (Figure 3-5). The two primers used amplified one DNA fragment of 756 base pairs from the expression vector, as expected, and did not amplify any DNA in the wildtype impatiens, thus the primers were specific to the NPR1 transgene. A total of 10 independent transgenic impatiens lines (5 derived from CNE and 5 derived from TLNE) were positive.

GFP expression was detected in various tissues and organs of all these transgenic lines but not in wild type plant (Figure 3-4, F-I).

Morphological Characterization

The 10 transgenic impatiens lines evaluated were not significantly different from the wildtype in leaf length, width and thickness, stomatal length and density, number of flowering shoots, shoot thickness, and flower size (Table 3-10). However, six transgenic lines showed significant differences from the wildtype in: days to flower (one line), flower production (four lines), and/or pollen stainability (three lines) (Figure 3-1, K, L), i.e. three characteristics closely related to flowering and reproduction. Specifically, transgenic lines 1 and 2 produced three to four more flowers per plant than the wildtype (7.1% to

8.3% increase). Transgenic lines 4 and 7 produced three to four fewer flowers per plant than the wildtype (6.7% to 7.9% reduction) and did not produce pollen grains (male sterility). Transgenic line 3 showed 34% lower pollen stainability than the wildtype, indicating partial male sterility. Transgenic line 10 delayed flowering and took 51 days from cutting to first open flowers, which was 12 days later than the wildtype in terms of flowering time (Table 3-10). Four transgenic lines (5, 6, 8, and 9) showed little or no differences to the wildtype in all characteristics evaluated.

Downy Mildew Resistance

Histological surveys of inoculated leaf discs revealed a similar pathogen infection and development process in the leaf discs from transgenic lines and the wildtype impatiens. Vesicles, hyphae, and haustoria became evident in leaf epidermal cells at 2 dpi; more hyphae and haustoria appeared inside the leaf tissues from 3 dpi to 6 dpi. By

6 dpi, sporangiophores began to emerge from the stomata on the abaxial side of the inoculated leaf discs, and white sporulation became visible to naked eyes (refer to

Figure 2-7). The white sporulation of the pathogen on the abaxial leaf side expanded and grew thicker from 6 to 10 dpi, regardless of the nature of the plants (transgenic or

non-transgenic). Localized necrosis was not observed on any of the inoculated leaf discs (refer to Figure 2-6).

In the in-vivo inoculation assays, DM symptoms began to appear at 10 dpi on transgenic leaves as well as the wildtype leaves, and white sporulation became visible on the abaxial side of some inoculated leaves. At 12 dpi, white sporulation was observed on all inoculated leaves of the wildtype impatiens and on most of the inoculated leaves of transgenic impatiens lines.

Three parameters (DM severity, sporangia density and DM incidence) were used to evaluate the resistance of transgenic lines to DM. Results showed that several transgenic lines were more resistant to DM than the wildtype. In the leaf disc assays, transgenic lines 2, 4 and 5 had significantly lower disease severity scores from the beginning to the end of evaluation (Table 3-11). Among the three lines, transgenic line 4 received the lowest disease severity scores at 6, 7, 8, and 10 dpi (38.0% to 55.2% lower compared to the wildtype), and transgenic line 5 had the lowest disease severity score at 9 dpi (49.0% lower than the wildtype). Transgenic lines 1, 3, 6 and 7 also had significantly lower disease severity scores than the wildtype between 7 dpi and 10 dpi

(Table 3-11).

In terms of sporangia density, transgenic lines were not significantly different from the wildtype at 6 dpi when P. obducens sporulation just began to appear on the leaf discs. At this point of time, only low densities of sporangia were observed on leaf discs of transgenic lines as well as the wildtype (Table 3-12). But transgenic line 1 showed a significantly lower sporangia density at 8 dpi compared to the wildtype (51.1% reduction). So did transgenic line 2 at 10 dpi (a 45.6% lower sporangia density than the

wildtype). Other transgenic lines had similar sporangia densities with the wildtype (Table

3-12).

In the in-vivo inoculation assays, transgenic line 2 showed significantly lower DM disease incidence at 11 dpi (39.7% lower) and 12 dpi (27% lower) than the wildtype

(Table 3-13). Transgenic line 4 had a significantly lower disease incidence at 11 dpi

(44.9% lower than the wildtype) (Table 3-13). No significant differences were observed in disease incidence between transgenic lines and the wildtype at 10 dpi.

Discussion

Development of Plant Regeneration Protocols

The general recalcitrance of impatiens to tissue culture and transformation is a big hurdle to genetic manipulations of this crop. It is very important to continue improving the efficiency of impatiens tissue culture and plant regeneration and increasing the effectiveness of selection schemes to suppress the growth and development of non-transformed cells/tissues in impatiens transformation. Dan et al.

(2010) made significant progress in these areas, and this study aimed to make further progress.

In this study, TLNEs proved to be equally totipotent as CNEs in term of bud induction and plant regeneration. This finding can broaden the source of explants for impatiens tissue culture and transformation. Simultaneous use of cotyledonary and true leaf nodes doubles the number of explants produced per seedling, which could save plant material and reduce costs and labor, especially in large-scale production of transgenic plants where large quantities of in-vitro seedlings are needed on a regular basis.

CNEs produced the largest number of MBCs when cultured on media containing

1.8 µM BA and 2.3 µM TDZ, which agreed with the result of Dan et al. (2010). TLNEs required 1.8 µM BA and 4.6 µM TDZ to produce the highest number of buds per explant. This might be because different types or ages of plant organs (tissues) respond to plant growth regulators differently. The impatiens regeneration protocol reported by

Dan et al. (2010) consists of induction of MBCs on a shoot induction medium and shoot elongation on a separate medium containing 0.22 µM BA and 0.23 µM TDZ, In the preliminary study, no obvious shoot elongation was observed with 0.22 µM BA and 0.23

µM TDZ, even after several weeks of culture. It was assumed that this was because of the older aged MBCs and their inability to efficiently uptake and transport the plant growth regulators. Therefore, a higher concentration of cytokinin was used in our protocol to achieve shoot elongation, allowing us to simplify the regeneration protocol into a two-step process.

Compared to the previous report on impatiens transformation (Dan et al., 2010), the transformation efficiency observed in this study was much lower and it took a longer time to regenerate plants and to detect GFP-positive tissues and transgenic plants. A different impatiens cultivar was used in this study, which, together with other different experimental conditions, could be the reason for the lower transformation efficiency and longer regeneration process.

G418 as an Alternative Selective Agent for Impatiens Transformation

When the NPTII gene was used as the selectable marker gene, significant numbers of non-transgenic shoots often survived kanamycin selection and regenerated plants which significantly reduced transformation efficiencies (Dan et al., 2008). In this study, G418 was tested as an alternative agent, and it proved to be more stringent than 68

kanamycin for suppressing non-transformed impatiens cells/tissues. Use of a relatively low concentration of G418 achieved similar inhibition as higher concentrations of kanamycin on MBC growth and shoot induction. In a banana transformation study reported by Maziah et al. (2007), only transgenics survived G418 selection, whereas none of the regenerated plants under kanamycin selection were transgenic. In this study, both kanamycin and G418-based selection resulted in a very high occurrence of escapes (around 80%). Non-transformed cells could compete with transformed cells, and even eliminate the latter, if they are not suppressed effectively. This might be the reason that only part of the observed GFP-positive impatiens cells regenerated into

GFP-positive shoots in this study. It thus seems necessary to find other antibiotics or use other selectable marker genes into the expression vector to achieve a higher transformation efficiency. The GFP gene has been used extensively as a reporter gene in transformation (Chiu et al., 1996), and it proved to be extremely useful in impatiens transformation, especially when the selective agent could not provide adequate suppression on the non-transformed impatiens cells.

Another observation in this study was that both kanamycin and G418 seemed to have a stronger inhibitory effect on TLNE-derived MBCs than on CNE-derived MBCs.

The TLNE-derived MBCs generally produced fewer shoots than CNE-derived MBCs.

The minor difference in response to antibiotic selection between CNE-derived MBCs and TLNE-derived MBCs was potentially due to their differences in type and age of the explant.

Morphological Changes in Transgenic Lines

Four of the 10 transgenic impatiens lines evaluated were similar to the wildtype in all 12 characteristics assessed, but the remaining lines showed some significant 69

changes in three reproduction-related characteristics (days to flower, flower number, and pollen production or stainability). The delayed flowering in one line, the reduced flower production in two lines, and the reduced or eliminated pollen production in three lines would be considered deleterious changes to I. walleriana as it is propagated by seed and grown for flower beds. However, two transgenic lines (line 1 and 2) produced more flowers per plant and did not exhibit changes in other morphological characteristics, thus their increased flower production may be considered highly positive.

Arabidopsis, citrus, and tomato transgenic plants overexpressing NPR1 did not show significant changes in morphology (Cao et al., 1998; Dutt et al., 2015; Lin et al.,

2004), whereas many strawberry transgenic lines expressing NPR1 did not produce fruits (Silva et al., 2015). Thus, the overexpression of NPR1 might affect plant reproductive characteristics in some cases. Presumably, the extent of such effects may be dependent upon the promotor used to drive NPR1, copy number, position of NPR1 integrated, level of NPR1 expression, plant species, characteristics evaluated, etc. For practical use of the NPR1 in impatiens improvement, such collateral effects of NPR1 on plant growth and development are worthy of further investigation.

Partial DM Resistance in Transgenic Lines

Several transgenic impatiens lines showed improved resistance to DM in leaf disc and in-vivo inoculation assays, where they had lower DM severity scores, sporangia densities, and/or lower disease incidence compared to the wildtype. Among these lines, the improved DM resistance in transgenic line 2 seemed to be quite consistent: It received a lower disease severity score and had a lower sporangia density in leaf disc assays, and it also showed a lower disease incidence in the in-vivo 70

inoculation assays. Other transgenic lines, by contrast, did not exhibit such consistency.

For example, transgenic line 5 showed a lower disease severity in the leaf disc assay but it was not significantly different from the wildtype in disease incidence after in-vivo inoculations. Similar phenomena have been reported in the literature, where the same cultivars or transgenic lines showed different levels of resistance in different types of assays. Brown et al. (1999) reported that the ratings of leaf disc chlorosis on grapevine caused by P. viticola were not correlated with field ratings. Such inconsistency highlighted the importance of uniform testing of transgenic lines in multiple environments where the experimental material, concentration of the inoculum, and environmental conditions prior to and during the course of infection might all be variables contributing to the experimental error (Bellin et al., 2009). Also, the different levels of disease resistance in different impatiens transgenic lines might be due to different locations and/or copy numbers of the NPR1 gene inserted into the impatiens genome. Southern blot analysis, real-time PCR, and genome sequencing could help explain such differences in DM resistance among impatiens transgenic lines.

In A. thaliana, NPR1 regulated resistance to DM caused by Peronospora parasitica in a dosage-dependent fashion, and transgenic plants overexpressing NPR1 could be categorized into three levels of resistance: low, medium, and high. Fully developed disease symptoms were observed in the wildtype and transgenic lines showing low levels of resistance, whereas very few hyphae were detected in the leaves exhibiting medium or high levels of resistance (Cao et al., 1998). In this study, similar pathogen structures of P. obducens and similar pathogen development were observed inside the leaf discs of transgenic and the wildtype impatiens. Potentially, this might be

due to the existence of only low levels of resistance against DM in the transgenic impatiens lines. However, this study generated and assessed only a small number of transgenic lines, thus it is difficult to reach a conclusion at this point.

Transgenic plants overexpressing NPR1 might show resistance to multiple pathogens. For example, some strawberry transgenic lines overexpressing NPR1 exhibited resistance to powdery mildew caused by Podosphaera aphanis and resistance to anthracnose caused by Colletotrichum gloeosporioides (Silva et al., 2015).

As overexpression of NPR1 could provide non-specific protection against multiple diseases, it would be worthwhile to test if the obtained impatiens transgenic lines possess any resistance to other important pathogens.

In summary, introduction and overexpression of NPR1 seems to hold good potential to improve impatiens resistance to DM caused by P. obducens. Use of impatiens with increased DM resistance could significantly reduce growers’ dependence on fungicides, lower impatiens production costs, minimize the negative impacts of fungicide use to the environment, and improve impatiens performance in the landscape.

Future studies may focus on generating more transgenic impatiens lines overexpressing

NPR1, assessing their resistance to DM and other important diseases, identifying potential changes in plant growth, development and morphology in transgenic lines, and understanding the expression patterns and levels of the introduced NPR1 and associated plant defense genes. Such studies should help translate our findings to practical uses and real benefits to the floriculture industry and consumers.

Table 3-1. Components of germination medium, basal media for multiple bud induction, root induction, and inoculation medium. Medium component Medium name and concentration (g/L)

Germination Basal Basal Inoculation medium medium 1 medium 2 medium (IM) (GM) (BM1) (BM2) MS basal medium with 4.43 4.43 4.43 2.22 vitamins (Phyto-Technology Laboratories) MES 0.5 0.5 0.5 - Sucrose 30 30 25 30 Agar 8 6 6 - pH 5.6 5.7 5.7 5.4

Table 3-2. Effect of different combinations of BA and TDZ on the induction of multiple bud culture from cotyledonary node explants. BA (µM) TDZ (µM) Fresh weight (g) Induced buds (no.) 3.6 4.6 1.76 ± 0.24 bcz 27.25 ± 1.73 ab 3.6 2.3 0.93 ± 0.10 cd 13.98 ± 1.22 de 3.6 1.15 0.22 ± 0.02 d 7.20 ± 0.32 e 1.8 4.6 1.87 ± 0.21 abc 17.80 ± 2.22 cd 1.8 2.3 2.85 ± 0.29 a 32.35 ± 2.52 a 1.8 1.15 1.59 ± 0.24 bc 17.40 ± 0.95 cd 0.9 4.6 2.63 ± 0.37 ab 21.95 ± 1.98 bc 0.9 2.3 1.98 ± 0.24 abc 20.48 ± 1.76 bcd 0.9 1.15 1.69 ± 0.24 bc 19.08 ± 2.03 cd Z Mean separation in columns by Tukey’s Method at p <0.05. Means were calculated from data from two independent experiments.

Table 3-3. Effect of different combinations of BA and TDZ on the induction of multiple bud culture from true leaf node explants. BA (µM) TDZ (µM) Fresh weight (g) Induced buds (no.) 3.6 4.6 1.49 ± 0.05 bz 22.45 ± 1.72 ab 3.6 2.3 1.21 ± 0.15 bc 15.90 ± 1.68 cd 3.6 1.15 0.59 ± 0.08 c 11.23 ± 0.60 d 1.8 4.6 2.79 ± 0.08 a 26.23 ± 1.31 a 1.8 2.3 1.47 ± 0.09 b 21.73 ± 1.36 abc 1.8 1.15 1.61 ± 0.14 b 17.95 ± 1.33 bc 0.9 4.6 2.61 ± 0.30 a 17.83 ± 1.42 bc 0.9 2.3 2.35 ± 0.09 a 19.03 ± 0.63 bc 0.9 1.15 1.70 ± 0.08 b 18.33 ± 1.22 bc Z Mean separation in columns by Tukey’s Method at p <0.05. Means were calculated from data from two independent experiments.

Table 3-4. Effect of IBA on the induction of roots using cotyledonary nodes as initial explants. IBA Days to root Roots (no.) Root length Shoots forming (mg/L) emergence (no.) (cm) roots (%) 0.1 7.0 ± 0.4 abz 8.13 ± 0.96 b 1.99 ± 0.67 b 100.0 NS 0.25 6.9 ± 0.9 b 8.97 ± 2.08 b 3.52 ± 1.03 a 100.0 0.5 6.8 ± 0.9 b 5.78 ± 0.98 c 2.40 ± 0.93 b 100.0 0.75 7.8 ± 0.7 a 9.64 ± 2.75 b 4.04 ± 1.53 a 100.0 1 7.8 ± 0.8 a 12.63 ± 3.90 a 4.34 ± 0.92 a 100.0 z Mean separation in columns by Tukey’s Method at p <0.05. Means were calculated from data from two independent experiments.

Table 3-5. Effect of different concentrations of IBA on the induction of roots using true leaf nodes as initial explants. IBA Days to root Roots (no.) Root length Shoots forming (mg/L) emergence (no.) (cm) roots (%) 0.1 7.3 ± 1.22 bz 9.37 ± 1.73 b 4.34 ± 1.15 b 100.0 ± 0.0 a 0.25 10.0 ± 3.87 b 5.42 ± 2.51 c 3.86 ± 1.67 bc 70.0 ± 9.0 b 0.5 12.8 ± 3.53 a 5.56 ± 2.24 c 2.99 ± 1.26 cd 85.0 ± 5.0 ab 0.75 14.4 ± 3.51a 6.86 ± 2.50 c 2.35 ± 1.35 d 91.7 ± 3.0 a 1 10.6 ± 4.10 b 13.77 ± 4.13 a 5.62 ± 0.73 a 98.3 ± 1.7 a Z Mean separation in columns by Tukey’s Method at p <0.05. Means were calculated from data from two independent experiments.

Table 3-6. Effect of different concentrations of kanamycin on the growth of multiple bud culture that produced from cotyledonary nodes.

Kanamycin (mg/L) Tissue size increase (cm) Shoots (no.) 0 1.21 ± 0.10 az 18.1 ± 1.6 a 25 1.13 ± 0.30 a 15.0 ± 5.9 ab 50 0.80 ± 0.31b 11.0 ± 2.1 bc 75 0.60 ± 0.12 b 8.5 ± 1.2 c 100 0.20 ± 0.13 b 6.9 ± 0.9 c z Mean separation in columns by Tukey’s Method at p <0.05. Means were calculated from data from two independent experiments.

Table 3-7. Effect of different concentrations of kanamycin on the growth of multiple bud culture that produced from true leaf nodes.

Kanamycin (mg/L) Tissue size increase (cm) Shoots (no.) 0 1.23 ± 0.26 az 18.1 ± 3.3 a 25 1.05 ± 0.07 a 14.1 ± 4.3 a 50 0.56 ± 0.16 b 8.4 ± 2.2 b 75 0.25 ± 0.22 b 5.7 ± 1.0 b 100 0.09 ± 0.21 b 5.4 ± 0.8 b z Mean separation in columns by Tukey’s Method at p <0.05. Means were calculated from data from two independent experiments.

Table 3-8. Effect of different concentrations of G418 on the growth of multiple bud culture that produced from cotyledonary nodes.

G418 (mg/L) Tissue size increase (cm) Shoots (no.) 0 1.21 ± 0.10 az 18.1 ± 1.6 a 10 1.10 ± 0.22 a 16.0 ± 6.7 ab 20 0.74 ± 0.12 b 10.6 ± 1.9 bc 40 0.45 ± 0.23 bc 8.8 ± 3.4 c 60 0.10 ± 0.26 c 6.1 ± 1.5 c z Mean separation in columns by Tukey’s Method at p <0.05. Means were calculated from data from two independent experiments.

Table 3-9. Effect of different concentrations of G418 on the growth of multiple bud culture that produced from true leaf node.

G418 (mg/L) Tissue size increase (cm) Shoots (no.) 0 1.23 ± 0.26 az 18.1 ± 3.3 a 10 0.96 ± 0.14 a 12.6 ± 1.0 a 20 0.32 ± 0.17 b 7.7 ± 0.8 b 40 0.08 ± 0.11 b 5.9 ± 1.1 b 60 0.02 ± 0.26 b 5.5 ± 1.7 b z Mean separation in columns by Tukey’s Method at p <0.05. Means were calculated from data from two independent experiments.

Table 3-10. Morphological differences between transgenic impatiens and wild type Impatiens walleriana. Flower Leaf Leaf Leaf Stomatal Stomatal Flower Pollen Pollen Branches branch Days to Flowers length width thickness length density diameter size stainability (no.) thickness flower (no.) (cm) (cm) (mm) (µm) (no./mm2) (cm) (µm) (%) (mm)

4.40 ± 3.24 ± 0.83 ± 24.02 ± 340.80 ± 64.00 ± 4.29 ± 4.11 ± 39.33 ± 42.08 ± 52.88 ± 30.82 ± Wild type 0.07 NS 0.02 NS 0.02 NS 0.66 NS 5.66 NS 2.65 NS 0.04 NS 0.02 NS 0.33 bz 0.87 bc 0.92 NS 2.51 ab Transgenic 4.43 ± 3.28 ± 0.79 ± 24.03 ± 336.30 ± 66.00 ± 4.21 ± 4.07 ± 38.67 ± 45.08 ± 52.89 ± 30.06 ± line 1 0.04 0.04 0.01 0.92 3.78 3.21 0.10 0.02 0.33 b 0.60 a 1.81 0.87 ab Transgenic 4.43 ± 3.27 ± 0.84 ± 24.90 ± 341.80 ± 62.67 ± 4.14 ± 4.10 ± 39.00 ± 45.58 ± 50.05 ± 26.41 ± line 2 0.01 0.01 0.03 0.65 4.54 2.91 0.02 0.03 0.00 b 0.36 a 0.77 0.77 abc Transgenic 4.50 ± 3.34 ± 0.78 ± 24.64 ± 338.89 ± 64.00 ± 4.20 ± 4.05 ± 39.33 ± 43.67 ± 48.91 ± 20.34 ± line 3 0.04 0.03 0.02 0.89 4.62 2.08 0.03 0.01 0.33 b 0.22 ab 1.69 1.45 c Transgenic 4.42 ± 3.34 ± 0.84 ± 24.59 ± 336.60 ± 63.67 ± 4.31 ± 4.10 ± 38.67 ± 38.75 ± _ _ line 4 0.04 0.07 0.02 0.88 3.39 2.19 0.13 0.01 0.33 b 0.63 e Transgenic 4.44 ± 3.24 ± 0.80 ± 25.33 ± 338.70 ± 62.33 ± 4.18 ± 4.13 ± 39.33 ± 41.75 ± 51.99 ± 32.02 ± line 5 0.03 0.02 0.03 0.41 5.23 2.03 0.11 0.01 0.33 b 0.43 bcd 1.64 1.27 a Transgenic 4.48 ± 3.21 ± 0.55 ± 24.72 ± 339.49 ± 63.33 ± 4.07 ± 4.08 ± 38.67 ± 40.42 ± 52.18 ± 25.13 ± line 6 0.01 0.02 0.03 0.65 3.07 0.89 0.07 0.01 0.33 b 0.22 cde 2.71 1.37 abc Transgenic 4.48 ± 3.26 ± 0.80 ± 24.51 ± 339.30 ± 63.33 ± 4.19 ± 4.11 ± 39.67 ± 39.25 ± _ _ line 7 0.04 0.07 0.03 0.96 3.75 0.89 0.14 0.02 0.33 b 0.25 de Transgenic 4.48 ± 3.25 ± 0.82 ± 24.55 ± 341.24 ± 65.67 ± 4.17 ± 4.06 ± 39.33 ± 44.33 ± 53.95 ± 26.13 ± line 8 0.05 0.02 0.02 0.07 1.44 2.19 0.10 0.01 0.33 b 0.87 ab 0.94 1.83 abc Transgenic 4.50 ± 3.29 ± 0.82 ± 24.54 ± 339.00 ± 62.33 ± 4.20 ± 4.07 ± 38.67 ± 42.25 ± 53.95 ± 30.36 ± line 9 0.04 0.03 0.02 1.02 5.51 1.76 0.08 0.01 0.33 b 0.76 bc 1.46 2.03 ab Transgenic 4.47 ± 3.21 ± 0.85 ± 24.65 ± 339.42 ± 63.67 ± 4.13 ± 4.07 ± 51.33 ± 40.50 ± 51.86 ± 24.00 ± line 10 0.01 0.05 0.02 0.78 4.31 1.76 0.04 0.01 0.33 a 0.14 cde 0.07 1.03 bc z Mean separation in columns by Tukey’s Method at p <0.05.

Table 3-11. Differences in downy mildew severity between transgenic impatiens and wild type Impatiens walleriana from 6 dpi to 10 dpi. 6 dpi 7 dpi 8 dpi 9 dpi 10 dpi Wild type 0.82 ± 0.04 2.03 ± 0.05 2.51 ± 0.04 2.86 ± 0.04 3.21 ± 0.05 az a a a a Transgenic 0.66 ± 0.04 1.54 ± 0.05 2.00 ± 0.05 2.35 ± 0.07 2.63 ± 0.08 line 1 ab b b c c Transgenic 0.54 ± 0.07 1.13 ± 0.06 1.44 ± 0.07 1.78 ± 0.09 2.18 ± 0.08 line 2 b c cd de d Transgenic 0.64 ± 0.04 1.54 ± 0.05 2.10 ± 0.06 2.54 ± 0.05 2.88 ± 0.06 line 3 ab b b bc bc Transgenic 0.48 ± 0.05 0.91 ± 0.06 1.19 ± 0.05 1.54 ± 0.04 1.99 ± 0.04 line 4 b c d ef d Transgenic 0.53 ± 0.05 1.00 ± 0.46 1.24 ± 0.05 1.46 ± 0.07 1.99 ± 0.08 line 5 b c cd f d Transgenic 0.68 ± 0.05 1.45 ± 0.05 1.86 ± 0.06 2.05 ± 0.06 2.26 ± 0.06 line 6 ab b b d d Transgenic 0.66 ± 0.06 1.15 ± 0.05 1.51 ± 0.06 1.93 ± 0.08 2.24 ± 0.08 line 7 ab c c d d Transgenic 0.83 ± 0.04 2.13 ± 0.08 2.56 ± 0.07 2.85 ± 0.06 3.05 ± 0.06 line 8 a a a a ab Transgenic 0.86 ± 0.06 2.03 ± 0.06 2.45 ± 0.07 2.76 ± 0.07 3.11 ± 0.05 line 9 a a a ab ab Transgenic 0.71 ± 0.11 1.90 ± 0.05 2.40 ± 0.04 2.79 ± 0.05 3.07 ± 0.05 line 10 ab a a ab ab z Mean separation in columns by Tukey’s Method at p <0.05. Means were calculated from data from two independent experiments.

Table 3-12. Differences in sporangia density of P. obducens (103/cm2) on the abaxial side of leaf discs between transgenic impatiens and wild type Impatiens walleriana from 6 dpi to 10 dpi. 6 dpi 8 dpi 10 dpi Wild type 3.36 ± 0.50 NS 20.16 ± 1.97 az 53.94 ± 5.32 a Transgenic line 1 2.83 ± 0.56 9.86 ± 1.85 b 37.93 ± 3.06 ab Transgenic line 2 2.55 ± 0.45 13.19± 1.66 ab 29.33 ± 3.50 b Transgenic line 3 2.26 ± 0.44 17.95 ± 2.14 ab 45.92 ± 4.23 ab Transgenic line 4 1.70 ± 0.38 17.16 ± 1.98 ab 40.99 ± 3.66 ab Transgenic line 5 2.09 ± 0.38 17.95 ± 2.07 ab 46.82 ± 4.51 ab Transgenic line 6 3.06 ± 0.48 19.70 ± 2.08 a 47.33 ± 3.62 ab Transgenic line 7 2.49 ± 0.43 17.89 ± 1.62 ab 47.22 ± 3.88 ab Transgenic line 8 2.77 ± 0.43 20.67 ± 1.89 a 48.29 ± 3.28 a Transgenic line 9 3.17 ± 0.51 20.50 ± 1.86 a 49.77 ± 3.35 a Transgenic line 10 3.11 ± 0.41 19.19 ± 1.82 a 47.10 ± 3.60 ab z Mean separation in columns by Tukey’s Method at p <0.05. Means were calculated from data from two independent experiments.

Table 3-13 Comparison of downy mildew incidence of in-vivo inoculation among wild type and transgenic lines from 10 dpi to 12 dpi. 10 dpi 11 dpi 12 dpi Wild type 0.17 ± 0.02 NS 0.78 ± 0.03 az 1.00 ± 0.00 a Transgenic line 1 0.13 ± 0.04 0.50 ± 0.04 abc 0.80 ± 0.05 ab Transgenic line 2 0.13 ± 0.04 0.47 ± 0.10 bc 0.73 ± 0.07 b Transgenic line 3 0.20 ± 0.00 0.60 ± 0.05 abc 0.83 ± 0.06 ab Transgenic line 4 0.13 ± 0.04 0.43 ± 0.08 c 0.80 ± 0.07 ab Transgenic line 5 0.13 ± 0.04 0.60 ± 0.05 abc 0.87 ± 0.04 ab Transgenic line 6 0.20 ± 0.00 0.53 ± 0.07 abc 0.80 ± 0.05 ab Transgenic line 7 0.13 ± 0.04 0.53 ± 0.04 abc 0.80 ± 0.05 ab Transgenic line 8 0.30 ± 0.05 0.73 ± 0.07 ab 0.90 ± 0.07 ab Transgenic line 9 0.17 ± 0.03 0.53 ± 0.10 abc 0.83 ± 0.06 ab Transgenic line 10 0.17 ± 0.03 0.60 ± 0.07 abc 0.90 ± 0.04 ab z Mean separation in columns by Tukey’s Method at p <0.05. Means were calculated from data from two independent experiments.

Figure 3-1. Regeneration of Impatiens walleriana cv. Super Elfin Lipstick in-vitro using cotyledonary node and true leaf node as initial explants. A) Seeds sown in MS basal medium. B) Seedling one month after germination in-vitro, arrows showing cotyledonary node (CN) and true leaf node (N). C) Multiple bud production approximately 6 weeks after cotyledonary nodes were initially cultured on SIM, D) multiple bud production approximately 6 weeks after true leaf nodes were initially cultured on SIM. E) Multiple bud production approximately 9 weeks after cotyledonary nodes were initially cultured on SIM, F) multiple bud production approximately 9 weeks after true leaf nodes were initially cultured on SIM. G) Multiple shoot production (after division) approximately 12 weeks after cotyledonary nodes were initially cultured on SIM, H) multiple shoot production (after division) approximately 12 weeks after true leaf nodes were initially cultured on SIM. I) Regenerated plant one month after shoots derived from cotyledonary nodes were initially cultured on RIM, J) regenerated plant one month after shoots derived from true leaf nodes were initially cultured on RIM. K) A transgenic plant in pot derived from cotyledonary node as explant, (L) a transgenic plant in pot derived from true leaf node as explant. (Photo courtesy of author.)

A C D

E F

G H

I J K L

L Prol npt II T35S attR2 DNA attR1 P35S EgfpER T35S RB B D

Figure 3-2. The T-DNA region of pK7WG2D,1 plasmid with NPR1, nptII and gfp genes. Abbreviations: P35S = CaMV 35S promoter; Prol D = rhizogenes rolD promoter; nptII = neomycine phosphotransferase under the control of the P35S promoter; EgfpER = green fluorescent protein with the ER signal sequence under the control of the Prol D promoter; T35S = CaMV 35S terminator; LB = left border; RB = right border; attR1 and attR2 = attR sites of Gateway® recombination reactions. DNA: short fragment (269 bp) of Taxus DNA introduced to eliminate ccdB gene from destination plasmid. The NPR1 gene is cloned in between attR1 and attR2 by recombination.

A B C

D E F

Figure 3-3. Effect of kanamycin and G418 on the growth of multiple bud culture. (A) Multiple bud culture derived from cotyledonary node 6 weeks on SIM, (B) multiple bud culture derived from cotyledonary node 6 weeks on SIM supplemented with 50 mg/L kanamycin, (C) Multiple bud culture derived from cotyledonary node 6 weeks on SIM supplemented with 20 mg/L G418, (D) multiple bud culture derived from true leaf node 6 weeks on SIM, (E) multiple bud culture derived from true leaf node 6 weeks on SIM supplemented with 50 mg/L kanamycin (F) multiple bud culture derived from true leaf node 6 weeks on SIM supplemented with 20 mg/L G418. (Photo courtesy of author.)

Figure 3-4. GFP expression in transformed tissues and transgenic plant. (A) Transgenic buds expressing GFP 4 weeks after selection on SIM, (B) transgenic buds expressing GFP 6 weeks after selection on SIM, (C) transgenic buds expressing GFP 8 weeks after selection on SIM, (D) transgenic shoots showing GFP 3-4 months after selection on SIM, (E) transgenic plantlet expressing GFP in stem and roots in RIM. (F)- (I) Comparison between wild type (non-transgenic) plant and transgenic plant in flower bud, leaf, stem and root. Wild type plant organs show no fluorescence (left) and transgenic plant organs show GFP (right). (Photo courtesy of author.)

A B C

D E F

H I

(GV 3101)/pK7WG2D,1 (GV

9 8 7 5 4 3 2

genic

s transgenic

nsgenic6

Transgenic 1 Transgenic Transgenic Tran Tra Transgenic Transgenic Transgenic Transgenic Transgenic1

Agrobacterium DNA ladder DNA Non

756 bp (product of NPR1) 700 bp 500 bp

Figure 3-5. PCR analysis of genomic DNA from non-transgenic and ten transgenic impatiens lines using primers for the NPR1 gene. (Photo courtesy of author.)

LIST OF REFERENCES

Agrawal V, Prakash S, Gupta S. 2002. Effective protocol for in vitro shoot production through nodal explants of Simmondsia chinensis. Biologia Plantarum 45: 449- 453.

Archer KJ, Cole ALJ. 1986. Cuticle, cell-wall ultrastructure and disease resistance in maidenhair fern. New Phytologist 103: 341–348.

Arisumi T. 1973. Morphology and breeding behavior of colchicine-induced polyploid Impatiens spp. Journal of the American Society for Horticultural Science 98: 599- 601.

Baxter A. 2005. Regeneration and transformation of Impatiens walleriana using cotyledonary node culture. Master of Science.

Baysal-Gurel F, Taylor NJ, Chatfield J, Miller SA. 2012. First report of impatiens downy mildew caused by Plasmopara obducens in Ohio. Plant Disease 96: 1699–1699.

Bellin D, Peressotti E, Merdinoglu D, Wiedemann-Merdinoglu S, Adam-Blondon A, Cipriani G, Morgante M, Testolin R, Di Gaspero G. 2009. Resistance to Plasmopara viticola in grapevine 'Bianca' is controlled by a major dominant gene causing localised necrosis at the infection site. Theoretical and Applied Genetics 120: 163-176.

Boso S, Alonso-Villaverde V, Santiago J, Gago P, Durrenberger M, Duggelin M, Kassemeyer H, Martinez M. 2010. Macro- and microscopic leaf characteristics of six grapevine genotypes (Vitis spp.) with different susceptibilities to grapevine downy mildew. Vitis 49: 43-50.

Bouvier L, Fillon FR, Lespinasse Y. 1994. Oryzalin as an efficient agent for chromosome doubling of Haploid apple shoots in vitro’. Plant Breeding 113: 343– 346.

Brown M, Moore J, Fenn P, McNew R. 1999. Comparison of leaf disk, greenhouse, and field screening procedures for evaluation of grape seedlings for downy mildew resistance. Hortscience 34: 331-333.

Bulajić A, Vučurović A, Stanković I, Ristić D, Jović J, Stojković B, Krstić B. 2011. First report of Plasmopara obducens on Impatiens walleriana in Serbia’. Plant Disease 95: 491–491.

Burdon JJ, Marshall DR. 1981. Inter- and intra-specific diversity in the disease- response of Glycine species to the leaf-rust fungus Phakopsora pachyrhizi’. The Journal of Ecology 69: 381-390.

Cai X, Cao Z, Xu S, Deng Z. 2015. Induction, regeneration and characterization of tetraploids and variants in 'Tapestry' caladium'. Plant Cell Tissue and Organ Culture 120: 689-700.

Cao H. 1994. Characterization of an Arabidopsis mutant that is nonresponsive to inducers of systemic acquired resistance. The Plant Cell Online 6: 1583–1592.

Cao H, Glazebrook J, Clarke J, Volko S, Dong X. 1997. The Arabidopsis NPR1 gene that controls systemic acquired resistance encodes a novel protein containing ankyrin repeats. Cell 88: 57-63.

Cao H, Li X, Dong X. 1998. Generation of broad-spectrum disease resistance by overexpression of an essential regulatory gene in systemic acquired resistance. Proceedings of the National Academy of Sciences of the United States of America 95: 6531-6536.

Cao Z, Deng Z, Mclaughlin M. 2014. Interspecific genome size and chromosome number variation shed new light on species classification and evolution in Caladium. Journal of the American Society for Horticultural Science 139: 449- 459.

Catlin N. 2012. Downy mildew of impatiens—some (but not all) questions answered [online], available: http://www.e-gro.org/pdf/Bulletin_1- 8_Impatiens_Downy_Mildew.pdf [accessed 25 Sep 2016].

Chen C, Hou X, Zhang H, Wang G, Tian L. 2011. Induction of Anthurium andraeanum “Arizona” tetraploid by colchicine in vitro. Euphytica 181: 137–145.

Chen T, Chen J, Chang W. 2002. Multiple shoot formation and plant regeneration from stem nodal explants of Paphiopedilum orchids. In Vitro Cellular & Developmental Biology-Plant 38: 595-597.

Chen Z. 2007. Genetic and epigenetic mechanisms for gene expression and phenotypic variation in plant polyploids. Annual Review of Plant Biology 58: 377-406.

Chern M, Fitzgerald H, Canlas P, Navarre D, Ronald P. 2005. Overexpression of a rice NPR1 homolog leads to constitutive activation of defense response and hypersensitivity to light. Molecular Plant-Microbe Interactions 18: 511-520.

Chern M, Fitzgerald H, Yadav R, Canlas P, Dong X, Ronald P. 2001. Evidence for a disease-resistance pathway in rice similar to the NPR1-mediated signaling pathway in Arabidopsis. Plant Journal 27: 101-113.

Chiu W, Niwa Y, Zeng W, Hirano T, Kobayashi H, Sheen J. 1996. Engineered GFP as a vital reporter in plants. Current Biology 6: 325-330.

Cohen H, Fait A, Tel-Zur N. 2013. Morphological, cytological and metabolic consequences of autopolyploidization in Hylocereus (Cactaceae) species. Bmc Plant Biology 13.

Comai L, Facciotti D, Hiatt W, Thompson G, Rose R, Stalker D. 1985. Expression in plants of a mutant aroA gene from Salmonella typhimurium confers tolerance to glyphosate. Nature 317: 741-744.

Conner KN, Olive J, Hagan AK, Zhang L, Bloodworth ME. 2014. First report of impatiens downy mildew caused by Plasmopara obducens in Alabama. Plant Disease 98: 1006–1006.

Constantinescu O. 1991. Bremiella sphaerosperma sp. nov. and Plasmopara borreriae comb. Nov. Mycologia 83: 473-479.

Crouch JA, Ko MP, McKemy JM. 2014. First report of impatiens downy mildew outbreaks caused by Plasmopara obducens throughout the Hawai’ian islands. Plant Disease 98: 696–696.

Cunnington J, Aldaoud R, Loh M, Washington W, Irvine G. 2008. First record of Plasmopara obducens (downy mildew) on impatiens in Australia. Plant Pathology 57: 371-371.

Czarnecki D, Hershberger A, Robacker C, Clark D, Deng Z. 2014. Ploidy levels and pollen stainability of Lantana camara cultivars and breeding lines. Hortscience 49: 1271-1276.

Dale JW, von Schantz M, Plant ND. 2011. From genes to genomes: Concepts and applications of DNA technology. 3rd ed. Oxford: Wiley-Blackwell (an imprint of John Wiley & Sons Ltd).

Dan Y. 2008. Biological functions of antioxidants in plant transformation. In Vitro Cellular & Developmental Biology-Plant 44: 149-161.

Dan Y, Baxter A, Zhang S, Pantazis C, Veilleux R. 2010. Development of efficient plant regeneration and transformation system for impatiens using Agrobacterium tumefaciens and multiple bud cultures as explants. Bmc Plant Biology 10: 165- 176.

Dangl J, Jones J. 2001. Plant pathogens and integrated defence responses to infection. Nature 411: 826-833.

Deblock M. 1993. The cell biology of plant transformation: current state, problems, prospects and the implications for the plant breeding. Euphytica 71: 1-14.

Dίez-Navajas A, Wiedemann-Merdinoglu S, Greif C, Merdinoglu D. 2008. Nonhost versus host resistance to the grapevine downy mildew, Plasmopara viticola, studied at the tissue level. Phytopathology 98: 776-780.

Doležel J, Greilhuber J, Suda J. 2007. Estimation of nuclear DNA content in plants using flow cytometry. Nature Protocols 2: 2233-2244.

Durrant W, Dong X. 2004. Systemic acquired resistance. Annual Review of Phytopathology 42: 185-209.

Dutt M, Barthe G, Irey M, Grosser J. 2015. Transgenic citrus expressing an Arabidopsis NPR1 gene exhibit enhanced resistance against Huanglongbing (HLB; Citrus Greening). Plos One 10.

Fischer B, Salakhutdinov I, Akkurt M, Eibach R, Edwards K, Topfer R, Zyprian E. 2004. Quantitative trait locus analysis of fungal disease resistance factors on a molecular map of grapevine. Theoretical and Applied Genetics 108: 501-515.

Fort A. 2013. Genome dosage and parent of origin effects in a ploidy series of Arabidopsis thaliana. Doctor of Philosophy.

Friedrich L, Lawton K, Dietrich R, Willits M, Cade R, Ryals J. 2001. NIM1 overexpression in Arabidopsis potentiates plant disease resistance and results in enhanced effectiveness of fungicides. Molecular Plant-Microbe Interactions 14: 1114-1124.

Fulton T, Chunwongse J, Tanksley S. 1995. Microprep protocol for extraction of DNA from tomato and other herbaceous plants. Plant Molecular Biology Reporter 13: 207-209.

Garibaldi A, Gilardi G, Matic S, Gullino M. 2013. First report of downy mildew (Plasmopara obducens) on Impatiens walleriana in Italy. Journal of Plant Pathology 95: 449-449.

Gasser C, Fraley R. 1989. Genetically engineering plants for crop improvement. Science 244: 1293-1299.

Gelvin S. 2000. Agrobacterium and plant genes involved in T-DNA transfer and intergration. Annual Review of Plant Physiology and Plant Molecular Biology 51: 223-256.

Gepts P. 2002. A comparison between crop domestication, classical plant breeding, and genetic engineering. Crop Science 42: 1780-1790.

Gessler C, Pertot I, Perazzolli M. 2011. Plasmopara viticola: a review of knowledge on downy mildew of grapevine and effective disease management. Phytopathologia Mediterranea 50: 3-44.

Grey-Wilson C. 1980. Impatiens of Africa: Morphology, pollination and pollinators, ecology, phytogeography, hybridisation, keys and a systematic treatment of all African species, with a note on collecting and cultivation. Rotterdam: A. A. Balkema Publishers.

Hamill S, Smith M, Dodd W. 1992. In vitro induction of banana autotetraploids by colchicine treatment of micropropagated diploids. Australian Journal of Botany 40: 887-896.

Hansen MA, Bush E, Latimer J, Hong C. 2013. Impatiens downy mildew [online], available: http://pubs.ext.vt.edu/PPWS/PPWS-19/PPWS-19-pdf.pdf [accessed 25 Sep 2016].

Haughn G, Smith J, Mazur B, Somerville C. 1988. Transformation with a mutant Arabidopsis acetolactate synthase gene renders tobacco resistant to sulfonylurea herbicides. Molecular & General Genetics 211: 266-271.

Heslop-Harrison J, Heslop-Harrison Y. 1970. Evaluation of pollen viability by enzymatically induced fluorescence; intracellular hydrolysis of fluorescein diacetate. Stain Technology 45: 115–120.

Heslopharrison J, Heslopharrison Y, Shivanna K. 1984. The evaluation of pollen quality, and a further appraisal of the fluorochromatic (FCR) test procedure. Theoretical and Applied Genetics 67: 367-375.

Jach G, Gornhardt B, Mundy J, Logemann J, Pinsdorf P, Leah R, Schell J, Maas C. 1995. Enhanced quantitative resistance against fungal disease by combinatorial expression of different barley antifungal proteins in transgenic tobacco. Plant Journal 8: 97-109.

Jiang Q, Zhang Y, Zhong C, Zeng B, Bogusz D, Franche C. 2011. Establishment of an in vitro plant regeneration protocol for Casuarina cunninghamiana Miq. Via indirect organogenesis. New Forests 43: 143–154.

Jones J, Dangl J. 2006. The plant immune system. Nature 444: 323-329.

Jongedijk E, Tigelaar H, van Roekel JSC, Bres-Vloemans SA, Dekker I, van den Elzen PJM, Cornelissen BJC, Melchers LS. 1995. Synergistic activity of chitinases and β-1, 3-glucanases enhances fungal resistance in transgenic tomato plants. Euphytica 85: 173–180.

Kadota M, Niimi Y. 2002. In vitro induction of tetraploid plants from a diploid Japanese pear cultivar (Pyrus pyrifolia N. cv. Hosui). Plant Cell Reports 21: 282-286.

Karimi M, Inze D, Depicker A. 2002. GATEWAYTM vectors for Agrobacterium-mediated plant transformation. Trends in Plant Science 7: 193-195.

Kast WK, Stark-Urnau M, Gemmrich AR, Seidel M. 2011. Inter-isolate variation of virulence of Plasmopara viticola on resistant vine varieties. Mitteilungen Klosterneuburg. Bulletin. 50.

Lane C, Beales P, O'Neill T, McPherson G, Finlay A, David J, Constantinescu O, Henricot B. 2005. First report of Impatiens downy mildew (Plasmopara obducens) in the UK. Plant Pathology 54: 243-243.

Le Henanff G, Heitz T, Mestre P, Mutterer J, Walter B, Chong J. 2009. Characterization of Vitis vinifera NPR1 homologs involved in the regulation of Pathogenesis-Related gene expression. Bmc Plant Biology 9.

Lehrer JM, Brand MH, Lubell JD. 2008. Induction of tetraploidy in meristematically active seeds of Japanese barberry (Berberis thunbergii var. Atropurpurea) through exposure to colchicine and oryzalin. Scientia Horticulturae 119: 67–71.

Levin DA. 1973. The role of trichomes in plant defense. The Quarterly Review of Biology 48: 3–15.

Lin W, Lu C, Wu J, Cheng M, Lin Y, Yang N, Black L, Green S, Wang J, Cheng C. 2004. Transgenic tomato plants expressing the Arabidopsis NPR1 gene display enhanced resistance to a spectrum of fungal and bacterial diseases. Transgenic Research 13: 567-581.

Loureiro J, Pinto G, Lopes T, Dolezel J, Santos C. 2005. Assessment of ploidy stability of the somatic embryogenesis process in Quercus suber L. using flow cytometry. Planta 221: 815-822.

Lynch M, Conery J. 2000. The evolutionary fate and consequences of duplicate genes. Science 290: 1151-1155.

Mahajan M, Dhillon M. 2003. Relation of leaf epidermal characteristics with susceptibility and resistance of potato (Solanum tuberosum) to late blight disease (Phytophthora infestans). Indian Journal of Agricultural Sciences 73: 656-660.

Majdi M, Karimzadeh G, Malboobi M, Omidbaigi R, Mirzaghaderi G. 2010. Induction of tetraploidy to feverfew (Tanacetum parthenium Schulz-Bip.): morphological, physiological, cytological, and phytochemical changes. Hortscience 45: 16-21.

Masterson J. 1994. Stomatal size in fossil plants: evidence for polyploidy in majority of angiosperms. Science 264: 421-424.

Maziah M, Sariah M, Sreeramanan S. 2007. Transgenic banana Rastali (AAB) with β- 1, 3-glucanase gene for tolerance to fusarium wilt race 1 disease via Agrobacterium-mediated transformation system. Plant Pathology Journal 6: 271– 282.

Melotto M, Underwood W, He SY. 2008. Role of stomata in plant innate immunity and foliar bacterial diseases. Annual Review of Phytopathology 46: 101–122.

Molinier J, Himber C, Hahne G. 2000. Use of green fluorescent protein for detection of transformed shoots and homozygous offspring. Plant Cell Reports 19: 219-223.

Moreira F, Madini A, Marino R, Zulini L, Stefanini M, Velasco R, Kozma P, Grando M. 2011. Genetic linkage maps of two interspecific grape crosses (Vitis spp.) used to localize quantitative trait loci for downy mildew resistance. Tree Genetics & Genomes 7: 153-167.

Morgan RJ. 2007. Impatiens: The vibrant world of busy Lizzies, balsams, and Touch- me-nots. United States: Timber Press.

Mou Z, Fan W, Dong X. 2003. Inducers of plant systemic acquired resistance regulate NPR1 function through redox changes. Cell 113: 935-944.

Ogawa D, Ishikawa K, Mii M. 2012. Difference in the polysomaty degree during fruit development among plants with different ploidy levels produced by artificial chromosome doubling of a pepper (Capsicum annuum) cultivar 'Shishitou No. 562'. Scientia Horticulturae 134: 121-126.

Osborn T, Pires J, Birchler J, Auger D, Chen Z, Lee H, Comai L, Madlung A, Doerge R, Colot V, Martienssen R. 2003. Understanding mechanisms of novel gene expression in polyploids. Trends in Genetics 19: 141-147.

Oswald B, Nuismer S. 2007. Neopolyploidy and pathogen resistance. Proceedings of the Royal Society B-Biological Sciences 274: 2393-2397.

Palmateer AJ, Lopez P, Seijo TE, Peres NAR. 2013. Severe outbreak of downy mildew caused by Plasmopara obducens on Impatiens walleriana in Florida. Plant Disease 97: 687–687.

Peressotti E, Wiedemann-Merdinoglu S, Delmotte F, Bellin D, Di Gaspero G, Testolin R, Merdinoglu D, Mestre P. 2010. Breakdown of resistance to grapevine downy mildew upon limited deployment of a resistant variety. Bmc Plant Biology 10.

Petersen K, Hagberg P, Kristiansen K. 2003. Colchicine and oryzalin mediated chromosome doubling in different genotypes of Miscanthus sinensis. Plant Cell Tissue and Organ Culture 73: 137-146.

Pikaard C. 2001. Genomic change and gene silencing in polyploids. Trends in Genetics 17: 675-677.

Ramos LJ, Volin RB. 1987. Role of stomatal opening and frequency on infection of Lycopersicon spp. by Xanthomonas campestris pv. Vesicatoria. Phytopathology 77: 1311-1317.

Raven PH, Evert RF, Eichhorn SE, Eichorn SE. 2012. Biology of plants (international edition). 8th ed. New York: W.H. Freeman & Co.

Reis A, Sousa S, Vale A, Pierre P, Franco A, Campos J, Vieira R, Viccini L. 2014. Lippia alba (verbenaceae): a new tropical autopolyploid complex? American Journal of Botany 101: 1002-1012.

Rohini V. 2000. Embryo transformation, a practical approach for realizing transgenic plants of Safflower (Carthamus tinctorius L.). Annals of Botany 86: 1043–1049.

Rohini V, Rao K. 2000. Transformation of peanut (Arachis hypogaea L.): a non-tissue culture based approach for generating transgenic plants. Plant Science 150: 41- 49.

Rommens C, Kishore G. 2000. Exploiting the full potential of disease-resistance genes for agricultural use. Current Opinion in Biotechnology 11: 120-125.

Ryals J, Weymann K, Lawton K, Friedrich L, Ellis D, Steiner HY, Johnson J, Delaney TP, Jesse T, Vos P, Uknes S. 1997. The Arabidopsis NIM1 protein shows homology to the mammalian transcription factor inhibitor IkB. The Plant Cell 9: 425.

Sajjad Y, Jaskani M, Mehmood A, Ahmad I, Abbas H. 2013. Effect of colchicine on in vitro polyploidy induction in African marigold (Tagetes erecta). Pakistan Journal of Botany 45: 1255-1258.

Salmeron J, Vernooij B. 1998. Transgenic approaches to microbial disease resistance in crop plants. Current Opinion in Plant Biology 1: 347-352.

Satou M, Sugawara K, Nagashima S, Tsukamoto T, Matsushita Y. 2013. Downy mildew of busy lizzie caused by Plasmopara obducens in Japan. Journal of General Plant Pathology 79: 205-208.

Seol E, Jung Y, Lee J, Cho C, Kim T, Rhee Y, Lee S. 2008. In planta transformation of Notocactus scopa cv. Soonjung by Agrobacterium tumefaciens. Plant Cell Reports 27: 1197-1206.

Schubert T. 2012. Downy mildew of Impatiens walleriana caused by Plasmopara obducens [online], available: https://www.freshfromflorida.com/content/download/9766/134864/downy-mildew- of-impatiens.pdf [accessed 25 Sep 2016].

Shah D. 1997. Genetic engineering for fungal and bacterial diseases. Current Opinion in Biotechnology 8: 208-214.

Sharma K, Ortiz R. 2000. Program for the application of genetic transformation for crop improvement in the semi-arid tropics. In Vitro Cellular & Developmental Biology- Plant 36: 83-92.

Stebbins GL. 1971. Chromosomal evolution in higher plants. Edward Arnold LTD, London 87-89

100

Silva K, Brunings A, Peres N, Mou Z, Folta K. 2015. The Arabidopsis NPR1 gene confers broad-spectrum disease resistance in strawberry. Transgenic Research 24: 693-704.

Singh R, Das Chaurasiya S, Lal P, Misra L, Uniyal G, Tuli R, Sangwan N. 2007. Withanolide A biogeneration in in vitro shoot cultures of Ashwagandha (Withania somnifera Dunal), a main medicinal plant in Ayurveda. Chemical & Pharmaceutical Bulletin 55: 1371-1375.

Sticher L, MauchMani B, Metraux J. 1997. Systemic acquired resistance. Annual Review of Phytopathology 35: 235-270.

Stuiver M, Custers J. 2001. Engineering disease resistance in plants. Nature 411: 865- 868.

Stupar R, Bhaskar P, Yandell B, Rensink W, Hart A, Ouyang S, Veilleux R, Busse J, Erhardt R, Buell C, Jiang J. 2007. Phenotypic and transcriptomic changes associated with potato autopolyploidization. Genetics 176: 2055-2067.

Takamura T, Miyajima I. 1996. Colchicine induced tetraploids in yellow-flowered cyclamens and their characteristics. Scientia Horticulturae 65: 305-312.

Thao N, Ureshino K, Miyajima I, Ozaki Y, Okubo H. 2003. Induction of tetraploids in ornamental Alocasia through colchicine and oryzalin treatments. Plant Cell Tissue and Organ Culture 72: 19-25.

Toppe B, Brurberg M, Stensvand A, Herrero M. 2010. First report of Plasmopara obducens (downy mildew) on Impatiens walleriana in Norway. Plant Pathology 59: 800-800.

Torney F, Moeller L, Scarpa A, Wang K. 2007. Genetic engineering approaches to improve bioethanol production from maize. Current Opinion in Biotechnology 18: 193-199.

Uchneat MS. 2007. ‘Impatiens’, in N.O. Anderson., Flower breeding and genetics: Issues, challenges and opportunities for the 21st century. Springer, London.

Udall J, Wendel J. 2006. Polyploidy and crop improvement. Crop Science 46: S3-S14.

Udayakumar R, Kasthurirengan S, Mariashibu T, Rayan J, Ganapathi A, Kim S, Kim J, Choi C. 2014. Agrobacterium-mediated genetic transformation of Withania somnifera using nodal explants. Acta Physiologiae Plantarum 36: 1969- 1980.

United States Department of Agriculture/ National Agricultural Statistics Service (USDA/NASS). 2011. Floriculture crops 2010 summary [online], available: http://usda.mannlib.cornell.edu/usda/nass/FlorCrop//2010s/2011/FlorCrop-04-21- 2011_new_format.pdf [accessed 25 Sep 2016].

101

Vaeck M, Reynaerts A, Hofte H, Jansens S, Debeuckeleer M, Dean C, Zabeau M, Vanmontagu M, Leemans J. 1987. Transgenic plants protected from insect attack. Nature 328: 33-37.

Vajna L. 2011. First report of Plasmopara obducens on impatiens (Impatiens walleriana) in Hungary. New Disease Reports 24: 13.

Vale FXRD, Parlevliet JE, Zambolim L. 2001. Concepts in plant disease resistance. Fitopatologia Brasileira 26: 577-589.

Vélez H. 2005. Alternaria alternata mannitol metabolism in plant-pathogen interactions. Doctor of Philosophy.

Voglmayr H, Piatek M, Mossebo D. 2009. Pseudoperonospora cubensis causing downy mildew disease on Impatiens irvingii in Cameroon: a new host for the pathogen. Plant Pathology 58: 394-394.

Wang H, Clarke J. 1993. Genotypic, intraplant, and environmental variation in stomatal frequency and size in wheat. Canadian Journal of Plant Science 73: 671-678.

Ward NA, Dixon E, Amsden B. 2013. First report of impatiens downy mildew caused by Plasmopara obducens in Kentucky. Plant Disease 97: 428–428.

Warfield CY. 2011. Downy mildew of impatiens [online], available: http://ballpublishing.com/GrowerTalks/ViewArticle.aspx?articleid=18921 [accessed 25 Sep 2016].

Welter L, Gokturk-Baydar N, Akkurt M, Maul E, Eibach R, Topfer R, Zyprian E. 2007. Genetic mapping and localization of quantitative trait loci affecting fungal disease resistance and leaf morphology in grapevine (Vitis vinifera L). Molecular Breeding 20: 359-374.

Wu J, Ferguson A, Murray B, Jia Y, Datson P, Zhang J. 2012. Induced polyploidy dramatically increases the size and alters the shape of fruit in Actinidia chinensis. Annals of Botany 109: 169-179.

Wegulo SN, Koike ST, Vilchez M, Santos P. 2004. First report of downy mildew caused by Plasmopara obducens on impatiens in California. Plant Disease 88: 909–909.

Xie D, Hong Y. 2002. Agrobacterium-mediated genetic transformation of Acacia mangium. Plant Cell Reports 20: 917-922.

Xu C, Huang Z, Liao T, Li Y, Kang X. 2016. In vitro tetraploid plants regeneration from leaf explants of multiple genotypes in Populus. Plant Cell Tissue and Organ Culture 125: 1-9.

102

Yang X, Cao Z, An L, Wang Y, Fang X. 2006. In vitro tetraploid induction via colchicine treatment from diploid somatic embryos in grapevine (Vitis vinifera L.). Euphytica 152: 217-224.

Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden T. 2012. Primer- BLAST: A tool to design target-specific primers for polymerase chain reaction. Bmc Bioinformatics 13.

Zhang X, Francis M, Dawson W, Graham J, Orbovic V, Triplett E, Mou Z. 2010. Over-expression of the Arabidopsis NPR1 gene in citrus increases resistance to citrus canker. European Journal of Plant Pathology 128: 91-100.

Zhang X, Henriques R, Lin S, Niu Q, Chua N. 2006. Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method. Nature Protocols 1: 641-646.

Zhang Y, Fan W, Kinkema M, Li X, Dong X. 1999. Interaction of NPR1 with basic leucine zipper protein transcription factors that bind sequences required for salicylic acid induction of the PR-1 gene. Proceedings of the National Academy of Sciences of the United States of America 96: 6523-6528.

103

BIOGRAPHICAL SKETCH

Weining Wang was born in Hebei, China. He received his bachelor’s degree in landscape gardening from Beijing Forestry University in 2013. He began his graduate study in the U.S. in January 2014 under the supervision of Dr. Zhanao Deng and focused his research on improving impatiens resistance to downy mildew. He received his Master of Science degree from University of Florida in the fall of 2016.

104