DOCSLIB.ORG

Methods to Identify Tas2r Modulators Verfahren Zur Identifizierung Von Tas2r Modulatoren Procédé D’Identification De Modulateurs Tas2r

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

(19) TZZ _¥¥ _T (11) EP 2 137 322 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: C12Q 1/68 (2006.01) A23L 2/52 (2006.01) 27.02.2013 Bulletin 2013/09 A23G 4/00 (2006.01) C07C 53/134 (2006.01) (21) Application number: 08714784.9 (86) International application number: PCT/CH2008/000134 (22) Date of filing: 27.03.2008 (87) International publication number: WO 2008/119195 (09.10.2008 Gazette 2008/41) (54) METHODS TO IDENTIFY TAS2R MODULATORS VERFAHREN ZUR IDENTIFIZIERUNG VON TAS2R MODULATOREN PROCÉDÉ D’IDENTIFICATION DE MODULATEURS TAS2R (84) Designated Contracting States: • BEHRENS MAIK ET AL: "Members of RTP and AT BE BG CH CY CZ DE DK EE ES FI FR GB GR REEP gene families influence functional bitter HR HU IE IS IT LI LT LU LV MC MT NL NO PL PT taste receptor expression" JOURNAL OF RO SE SI SK TR BIOLOGICAL CHEMISTRY, vol. 281, no. 29, July 2006(2006-07), pages 20650-20659, XP002494217 (30) Priority: 30.03.2007 US 909143 P ISSN: 0021-9258 30.07.2007 US 962549 P • KUHN CHRISTINA ET AL: "Bitter taste receptors for saccharin and acesulfame K" JOURNAL OF (43) Date of publication of application: NEUROSCIENCE, vol. 24, no. 45, 10 November 30.12.2009 Bulletin 2009/53 2004 (2004-11-10), pages 10260-10265, XP002494218 ISSN: 0270-6474 (73) Proprietor: Givaudan SA • BUFE BERND ET AL: "The human TAS2R16 1214 Vernier (CH) receptor mediates bitter taste in response to beta- glucopyranosides" NATURE GENETICS, (72) Inventors: NATURE PUBLISHING GROUP, NEW YORK, US, • BRUNE, Nicole, Erna, Irene vol. 32, no. 3, 1 November 2002 (2002-11-01), San Diego, CA 92122 (US) pages 397-401, XP002269573 ISSN: 1061-4036 • SLACK, Jay, Patrick • DATABASE Geneseq [Online] 4 November 2004 Loveland, OH 45140 (US) (2004-11-04), "Taste receptor modulation- related • UNGUREANU, Ioana, Maria human T2R64 gene sequence SeqID182." Cincinnati, OH 45215 (US) XP002494220 retrieved from EBI accession no. • GRAY, Kimberley GSN:ADR29243 Database accession no. Loveland, OH 45140 (US) ADR29243 & WO 2004/069191 A (SENOMYX INC • SIMONS, Christopher, Todd [US]; SERVANT GUY [US]; OZECK MARK [US]; Wyoming, OH 45215 (US) BRUST PAUL [US];) 19 August 2004 (2004-08-19) • EVANS PENNIMPEDE, Jenny, Ellen • DATABASE EMBL [Online] 13 June 2003 Cincinnati, OH 45241 (US) (2003-06-13), "Sequence 36 from patent US 6558910." XP002494221 retrieved from EBI (74) Representative: Givaudan Patents accession no. EMBL:AR310322 Database Givaudan Schweiz AG accession no. AR310322 & US 2002/051997 A1 Ueberlandstrasse 138 (ZUKER CHARLES S [US] ET AL ZUKER 8600 Dübendorf (CH) CHARLES S [US] ET AL) 2 May 2002 (2002-05-02) (56) References cited: WO-A-2004/055048 US-A1- 2005 032 158 US-B2- 7 105 650 Note: Within nine months of the publication of the mention of the grant of the European patent in the European Patent Bulletin, any person may give notice to the European Patent Office of opposition to that patent, in accordance with the Implementing Regulations. Notice of opposition shall not be deemed to have been filed until the opposition fee has been paid. (Art. 99(1) European Patent Convention). EP 2 137 322 B1 Printed by Jouve, 75001 PARIS (FR) (Cont. next page) EP 2 137 322 B1 • DATABASE EMBL [Online] 13 June 2003 • DATABASE Geneseq [Online] 9 March 2006 (2003-06-13), "Sequence 36 from patent US (2006-03-09), "Taste receptor type 2 member 16 6558910." XP002494222 retrieved from EBI T2R16/TAS2R16 encoding DNA." XP002494227 accession no. EMBL:AR310322 Database retrieved from EBI accession no. GSN: AEF19624 accession no. AR310322 Database accession no. AEF19624 • DATABASE Geneseq [Online] 7 April 2005 • BEHRENS M ET AL: "Bitter taste receptors and (2005-04-07), "Human bitter taste receptor human bitter taste perception" CELLULAR AND haplotype protein T2R44 Seq 196." XP002494224 MOLECULAR LIFE SCIENCES, vol. 63, no. 13, retrievedfrom EBI accession no. GSP: ADW74584 July 2006 (2006-07), pages 1501-1509, Database accession no. ADW74584 & WO XP002494219 ISSN: 1420-682X 2005/007891A (US GOVERNMENT [US]; DRAYNA • KIM UNKYUNG ET AL: "Worldwide haplotype DENNIS [US]; KIM UN-KYUNG [US]) 27 January diversity and coding sequence variation at 2005 (2005-01-27) human bitter taste receptor loci" HUMAN • DATABASE EPO Proteins [Online] 28 April 2004 MUTATION, vol. 26, no. 3, September 2005 (2004-04-28), "Sequence 25 from Patent (2005-09), pages 199-204, XP008095937 ISSN: WO2004029087." XP002494225 retrieved from 1059-7794 EBI accession no. EPOP:CQ800021 Database • SHAMIL S ET AL: "PHYSICO-CHEMICAL AND accession no. CQ800021 & WO 2004/029087 A PSYCHOPHYSICAL STUDIES OF 4 1’ 6’ (DEUTSCHES INST FUER ERNAEHRUNG [DE]; TRICHLORO-4 1’ 6’- BUFE BERND [DE]; HOFMANN THOMAS [) 8 April TRIDEOXYGALACTOSUCROSE SUCRALOSE" 2004 (2004-04-08) LEBENSMITTEL WISSENSCHAFT UND • DATABASE Geneseq [Online] 7 April 2005 TECHNOLOGIE, ACADEMIC PRESS, LONDON, (2005-04-07), "Human bitter taste receptor GB, vol. 25, no. 2, 1 January 1992 (1992-01-01), haplotype protein T2R46 Seq 208." XP002494226 pages 192-196, XP008095932 ISSN: 0023-6438 retrievedfrom EBI accession no. GSP: ADW74596 Database accession no. ADW74596 2 EP 2 137 322 B1 Description [0001] Provided are methods to identify modulators of the bitter aftertaste associated with sucralose. [0002] Sucralose is a sweetener that provides a bitter off-note/aftertaste, and thereby limits the use of sucralose in 5 food. Therefore, methods that are able to identify compounds or ingredients that are able to modulate, and in particular to inhibit or mask, this bitter aftertaste are of interest. [0003] Bitter taste is perceived via taste receptors, and a family of 25 functional bitter taste receptors (TAS2R or T2R) is known. None of these receptors had previously been shown to be activated by sucralose. [0004] Applicant found that four of these receptors are activated by sucralose. 10 [0005] In particular, applicant identified sucralose as a specific agonist of taste receptor type 2 member 44 (TAS2R44), member 1 (TAS2R1), member 10 (TAS2R10), and member 46 (TAS2R46). These four receptors are referred to herein below as "sucralose activated bitter taste receptors" or "SABTR". This finding allows to provide methods that employ the identified SABTR and their agonist sucralose to identify ingredients that modulate the response of a SABTR to sucralose, for example, antagonists (blockers, inhibitors or masking agents) 15 of the sucralose- dependentSABTR activation. The methodstherefore allowto identifymodulators including bitter masking agents for sucralose, as was demonstrated for (E)- 4-(2,2,3-trimethylcyclopent-3-enyl)but-2-enoic acid, which was shown to inhibit the response of a SABTR to sucralose, and to significantly reduce the bitter aftertaste of sucralose in human sensory evaluations. 20 SUMMARY [0006] Provided is the following: (1) A method to identify an agent that modulates the taste of sucralose, the method comprising: 25 (i) contacting cells that express a TAS2R bitter taste receptor that is able to be activated by sucralose with sucralose in the presence of at least one agent; and (ii) determining whether the at least one agent affects binding to sucralose or a functional response thereto of said TAS2R bitter taste receptor, 30 with the proviso that the cells are not unmanipulated cells in their natural environment. (2) The method as described herein, including under (1), wherein the TAS2R bitter taste receptor comprises one or more sequences selected from 35 a TAS2R bitter taste receptor substantially homologous to a polypeptide sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO: 4, SEQ ID NO: 6, and SEQ ID NO: 8, with a sequence identity of at least 90%; a TAS2R bitter taste receptor which is encoded by a nucleotide sequence selected from the group consisting of 40 a nucleic acid substantially homologous to a nucleotide sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:3 and SEQ ID NO:5, SEQ ID NO:7, as determined by sequence identity, a nucleic acid substantially homologous to a nucleotide sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:3 and SEQ ID NO:5, SEQ ID NO:7, as determined by hybridisation, wherein the substantially homologous nucleic acid as determined by sequence identity has a sequence identity 45 of at least 90%; wherein the substantially homologous nucleic acid as determined by hybridisation hybridises under stringent hybridization conditions at a temperature of 42° C in a solution consisting of 50% formamide, 5 3SSC, and 1% SDS, and washing at 65° C in a solution consisting of 0.2 3SSC and 0.1 % SDS; wherein the nucleic acid optionally comprises SEQ ID NO:12 (HSV tag) at or near its end to form the C-terminus 50 in the corresponding protein, and optionally comprises a membrane export tag, optionally selected from rat somatostatin (RSS) and rhodopsin, optionally selected from SEQ ID NO: 11 (RSS tag), at or near its end to form the N terminus, and wherein the TAS2R bitter taste receptor polypeptide sequence optionally comprises SEQ ID NO:12 (HSV tag) at or near its end to form the C-terminus, and optionally comprises a membrane-export tag, optionally 55 selected from rat somatostatin (RSS) tag and rhodopsin tag, optionally selected from SEQ ID NO: 11 (RSS), at or near its end to form the N terminus. (3) The method as described herein including under (1) and (2) wherein the TAS2R bitter taste receptor comprises 3 EP 2 137 322 B1 a conservative functional variant able to be activated by sucralose. (4) The method as described herein including under (1), (2) or (3) wherein the cells also express a G-Protein, optionally a chimeric G-protein substantially homologous to Gaq-Gustducin, or substantially homologous to the 5 chimeric G-protein G alpha 16-gustducin 44.
Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Involvement of Taste Receptors in the Effectiveness of Sublingual Immunotherapy

    Involvement of Taste Receptors in the Effectiveness of Sublingual Immunotherapy

    Allergology International 67 (2018) 421e424 Contents lists available at ScienceDirect Allergology International journal homepage: http://www.elsevier.com/locate/alit Letter to the Editor Involvement of taste receptors in the effectiveness of sublingual immunotherapy Dear Editor, RNA or DNA was damaged, 25 samples each in the HR and NR groups underwent microarray analyses. We identified 56 genes, Japanese cedar pollinosis (JCP) is a specific seasonal allergic dis- differentially expressed between the HR and NR patients, based ease which affects ~30% of the Japanese population, between on the log2 ratio of their averages (Fig. 1). Among these, 5 genes February and April, every year.1 Apart from a series of symptom- encoded taste receptors, 4 of which tended to increase in the HR reliever medications, allergen-specific immunotherapy (AIT) is group but not in the NR group, after SLIT. Consistently, the expres- þ one of the most effective treatments for JCP. After several years of sion of TAS2R13, 43 and 50 in CD4 T cells could be retrieved by relying on the application of subcutaneous immunotherapy (SCIT) BioGPS (http://biogps.org/)(Supplementary Figs. 1e3). Among with standardized Japanese cedar pollen extract (since the them, we confirmed the cell surface expression of TAS2R43 on þ 1960s), the use of sublingual immunotherapy (SLIT) was approved CD4 T cells (Supplementary Fig. 4). SLIT-induced increasing ten- in 2014.2 In addition to the numerous clinical and scientific evi- dency was also observed for several small nuclear RNAs and micro- dences pertaining to its effectiveness and safety on JCP including RNAs especially in the HR group.
  • (12) United States Patent (10) Patent No.: US 9,347,934 B2 Shekdar Et Al

    (12) United States Patent (10) Patent No.: US 9,347,934 B2 Shekdar Et Al

    USOO9347934B2 (12) United States Patent (10) Patent No.: US 9,347,934 B2 Shekdar et al. (45) Date of Patent: May 24, 2016 (54) ASSAYS FOR IDENTIFYING COMPOUNDS 2008, OO38739 A1 2/2008 Li et al. THAT MODULATE BITTERTASTE 2008/0167286 A1* 7/2008 Gopalakrishnan et al. ........................ 514,21016 (71) Applicants: CHROMOCELL CORPORATION, 2010/01298.33 A1* 5/2010 Brune et al. ................. 435/721 North Brunswick, NJ (US); KRAFT FOODS GROUP BRANDS LLC, FOREIGN PATENT DOCUMENTS Northfield, IL (US) CN 1341632 A 3, 2002 CN 101583717 A 11, 2009 (72) Inventors: Kambiz Shekdar, New York, NY (US); CN 101828.111 A 9, 2010 Purvi Manoj Shah, Bridgewater, NJ WO WO-0038536 A2 7, 2000 WO WO-2004O29087 4/2004 (US); Joseph Gunnet, Flemington, NJ WO WO-2006053771 A2 5, 2006 (US); Jane V. Leland, Wilmette, IL WO WO-2007002026 A2 1/2007 (US); Peter H. Brown, Glenview, IL WO WO-2008057470 5, 2008 (US); Louise Slade, Morris Plains, NJ WO WO-2008119.195 A1 10, 2008 (US) WO WO-20081191.96 10, 2008 WO WO-20081191.97 10, 2008 (73) Assignees: Chromocell Corporation, North W WSi. A2 1929 Brunswick, NJ (US); Kraft Foods WO WO-2010O886.33 8, 2010 Group Brands LLC, Northfield, IL WO WO-2010O99983 A1 9, 2010 (US) WO WO-2013022947 2, 2013 (*) Notice: Subject to any disclaimer, the term of this OTHER PUBLICATIONS patent is extended or adjusted under 35 U.S.C. 154(b) by 0 days. Bachmanov et al., Taste Receptor Genes, 2007, 27:389-414.* Behrens et al., Structural Requirements for Bitter Taste Receptor (21) Appl.
  • G Protein-Coupled Receptors

    G Protein-Coupled Receptors

    S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2015/16: G protein-coupled receptors. British Journal of Pharmacology (2015) 172, 5744–5869 THE CONCISE GUIDE TO PHARMACOLOGY 2015/16: G protein-coupled receptors Stephen PH Alexander1, Anthony P Davenport2, Eamonn Kelly3, Neil Marrion3, John A Peters4, Helen E Benson5, Elena Faccenda5, Adam J Pawson5, Joanna L Sharman5, Christopher Southan5, Jamie A Davies5 and CGTP Collaborators 1School of Biomedical Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK, 2Clinical Pharmacology Unit, University of Cambridge, Cambridge, CB2 0QQ, UK, 3School of Physiology and Pharmacology, University of Bristol, Bristol, BS8 1TD, UK, 4Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK, 5Centre for Integrative Physiology, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2015/16 provides concise overviews of the key properties of over 1750 human drug targets with their pharmacology, plus links to an open access knowledgebase of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties. The full contents can be found at http://onlinelibrary.wiley.com/doi/ 10.1111/bph.13348/full. G protein-coupled receptors are one of the eight major pharmacological targets into which the Guide is divided, with the others being: ligand-gated ion channels, voltage-gated ion channels, other ion channels, nuclear hormone receptors, catalytic receptors, enzymes and transporters. These are presented with nomenclature guidance and summary information on the best available pharmacological tools, alongside key references and suggestions for further reading.
  • G Protein‐Coupled Receptors

    G Protein‐Coupled Receptors

    S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2019/20: G protein-coupled receptors. British Journal of Pharmacology (2019) 176, S21–S141 THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: G protein-coupled receptors Stephen PH Alexander1 , Arthur Christopoulos2 , Anthony P Davenport3 , Eamonn Kelly4, Alistair Mathie5 , John A Peters6 , Emma L Veale5 ,JaneFArmstrong7 , Elena Faccenda7 ,SimonDHarding7 ,AdamJPawson7 , Joanna L Sharman7 , Christopher Southan7 , Jamie A Davies7 and CGTP Collaborators 1School of Life Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK 2Monash Institute of Pharmaceutical Sciences and Department of Pharmacology, Monash University, Parkville, Victoria 3052, Australia 3Clinical Pharmacology Unit, University of Cambridge, Cambridge, CB2 0QQ, UK 4School of Physiology, Pharmacology and Neuroscience, University of Bristol, Bristol, BS8 1TD, UK 5Medway School of Pharmacy, The Universities of Greenwich and Kent at Medway, Anson Building, Central Avenue, Chatham Maritime, Chatham, Kent, ME4 4TB, UK 6Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK 7Centre for Discovery Brain Sciences, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2019/20 is the fourth in this series of biennial publications. The Concise Guide provides concise overviews of the key properties of nearly 1800 human drug targets with an emphasis on selective pharmacology (where available), plus links to the open access knowledgebase source of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties. Although the Concise Guide represents approximately 400 pages, the material presented is substantially reduced compared to information and links presented on the website.
  • TAS2R10 (NM 023921) Human Untagged Clone – SC305083

    TAS2R10 (NM 023921) Human Untagged Clone – SC305083

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC305083 TAS2R10 (NM_023921) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: TAS2R10 (NM_023921) Human Untagged Clone Tag: Tag Free Symbol: TAS2R10 Synonyms: T2R10; TRB2 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_023921, the custom clone sequence may differ by one or more nucleotides ATGCTACGTGTAGTGGAAGGCATCTTCATTTTTGTTGTAGTTAGTGAGTCAGTGTTTGGGGTTTTGGGGA ATGGATTTATTGGACTTGTAAACTGCATTGACTGTGCCAAGAATAAGTTATCTACGATTGGCTTTATTCT CACCGGCTTAGCTATTTCAAGAATTTTTCTGATATGGATAATAATTACAGATGGATTTATACAGATATTC TCTCCAAATATATATGCCTCCGGTAACCTAATTGAATATATTAGTTACTTTTGGGTAATTGGTAATCAAT CAAGTATGTGGTTTGCCACCAGCCTCAGCATCTTCTATTTCCTGAAGATAGCAAATTTTTCCAACTACAT ATTTCTCTGGTTGAAGAGCAGAACAAATATGGTTCTTCCCTTCATGATAGTATTCTTACTTATTTCATCG TTACTTAATTTTGCATACATTGCGAAGATTCTTAATGATTATAAAACGAAGAATGACACAGTCTGGGATC TCAACATGTATAAAAGTGAATACTTTATTAAACAGATTTTGCTAAATCTGGGAGTCATTTTCTTCTTTAC ACTATCCCTAATTACATGTATTTTTTTAATCATTTCCCTTTGGAGACACAACAGGCAGATGCAATCGAAT GTGACAGGATTGAGAGACTCCAACACAGAAGCTCATGTGAAGGCAATGAAAGTTTTGATATCTTTCATCA TCCTCTTTATCTTGTATTTTATAGGCATGGCCATAGAAATATCATGTTTTACTGTGCGAGAAAACAAACT GCTGCTTATGTTTGGAATGACAACCACAGCCATCTATCCCTGGGGTCACTCATTTATCTTAATTCTAGGA AACAGCAAGCTAAAGCAAGCCTCTTTGAGGGTACTGCAGCAATTGAAGTGCTGTGAGAAAAGGAAAAATC TCAGAGTCACATAG
  • Bivariate Genome-Wide Association Analysis Strengthens the Role of Bitter Receptor Clusters on Chromosomes 7 and 12 in Human Bitter Taste

    Bivariate Genome-Wide Association Analysis Strengthens the Role of Bitter Receptor Clusters on Chromosomes 7 and 12 in Human Bitter Taste

    bioRxiv preprint doi: https://doi.org/10.1101/296269; this version posted April 6, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Bivariate genome-wide association analysis strengthens the role of bitter receptor clusters on chromosomes 7 and 12 in human bitter taste Liang-Dar Hwang1,2,3,4, Puya Gharahkhani1, Paul A. S. Breslin5,6, Scott D. Gordon1, Gu Zhu1, Nicholas G. Martin1, Danielle R. Reed5, and Margaret J. Wright2,7 1 QIMR Berghofer Medical Research Institute, Herston, Queensland 4006, Australia 2 Queensland Brain Institute, University of Queensland, St Lucia, Queensland 4072, Australia 3 Faculty of Medicine, University of Queensland, Herston, Queensland 4006, Australia 4 University of Queensland Diamantina Institute, University of Queensland, Translational Research Institute, Woolloongabba, Queensland 4102, Australia 5 Monell Chemical Senses Center, Philadelphia, Pennsylvania 19104, USA 6 Department of Nutritional Sciences, School of Environmental and Biological Sciences, Rutgers University, New Brunswick NJ, 08901 USA 7 Centre for Advanced Imaging, University of Queensland, St Lucia, Queensland 4072, Australia Correspondence to be sent to: Liang-Dar Hwang University of Queensland Diamantina Institute Wolloongabba QLD 4102, Australia Email: [email protected] Telephone: +61 7 3443 7976 Fax: +61 7 3443 6966 1 bioRxiv preprint doi: https://doi.org/10.1101/296269; this version posted April 6, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
  • Human Pluripotent Stem Cell-Derived Ectomesenchymal Stromal Cells Promote More Robust Functional Recovery Than Umbilical Cord-De

    Human Pluripotent Stem Cell-Derived Ectomesenchymal Stromal Cells Promote More Robust Functional Recovery Than Umbilical Cord-De

    Human pluripotent stem cell-derived ectomesenchymal stromal cells promote more robust functional recovery than umbilical cord-derived mesenchymal stromal cells after hypoxic- ischaemic brain damage Jiawei Huang1,3*, Kin Pong U1,3*, Fuyuan Yang1, Zeyuan Ji1, Jiacheng Lin1,3, Zhihui Weng1, Lai Ling Tsang1,3, Tobias D Merson5, Ye Chun Ruan6, Chao Wan1,3, Gang Li2, Xiaohua Jiang1,3,4 1School of Biomedical Sciences, 2Department of Orthopaedics and Traumatology, Faculty of Medicine, The Chinese University of Hong Kong, Hong Kong SAR, PR China. 3School of Biomedical Sciences Core Laboratory, Shenzhen Research Institute, The Chinese University of Hong Kong, Shenzhen, PR China. 4Sichuan University – The Chinese University of Hong Kong Joint Laboratory for Reproductive Medicine, West China Second University Hospital, Sichuan University, Chengdu 610041, Sichuan, China. 5Australian Regenerative Medicine Institute, Monash University, Clayton, VIC, Australia. 6Department of Biomedical Engineering, Faculty of Engineering, The Hong Kong Polytechnic University, Hong Kong, China. Running Title: Human ectomesenchymal stromal cells promote functional recovery in a rat HIE model *Corresponding author: Prof. Xiaohua JIANG, Email: [email protected] Address: Room 409A, Lo Kwee Seong Integrated Biomedical Sciences Building, Area 39, The Chinese University of Hong Kong, Shatin. Keywords: HIE, ectomesenchymal stromal cells, brain damage, regeneration, paracrine, ERK Abstract: Aims: Hypoxic-ischaemic encephalopathy (HIE) is one of the most serious complications in neonates and infants. Mesenchymal stromal cell (MSC)-based therapy is emerging as a promising treatment avenue for HIE. However, despite its enormous potential, the clinical application of MSCs is limited by cell heterogeneity, low isolation efficiency and unpredictable effectiveness. In this study, we examined the therapeutic effects and underlying mechanisms of human pluripotent stem cell-derived ectomesenchymal stromal cells (hPSC-EMSCs) in a rat model of HIE.
  • Prostaglandin E2 As Mediator and Modulator of Airway Smooth Muscle Responses

    Prostaglandin E2 As Mediator and Modulator of Airway Smooth Muscle Responses

    Institute of Environmental Medicine Division of Physiology The Unit for Experimental Asthma and Allergy Research Karolinska Institutet, Stockholm, Sweden PROSTAGLANDIN E2 AS MEDIATOR AND MODULATOR OF AIRWAY SMOOTH MUSCLE RESPONSES Jesper Säfholm Stockholm 2013 All published papers were reproduced with permission from the publisher. Published by Karolinska Institutet. Printed by Repro Print AB © Jesper Säfholm, 2013 ISBN 978-91-7549-167-7 Printed by 2013 Gårdsvägen 4, 169 70 Solna To boldly go where a lot of people have gone before ABSTRACT Prostaglandin E2 (PGE2) is a lipid mediator produced by virtually every cell of the human body. Because common non-steroidal anti-inflammatory drugs (NSAIDs) inhibit its biosynthesis, PGE2 is usually considered to be a ‘pro-inflammatory’ mediator. The role of PGE2 in the lung and airways has however always been unclear. In particular, the airway responses caused by activation of its four different EP receptors have been debated. Research on the mechanisms involved in the actions of PGE2 has previously been limited by the low potency and selectivity of available pharmacological tools. Recently, a number of potent receptor antagonists and enzyme inhibitors have become available. The aim of this thesis was therefore to characterise airway responses to PGE2 in greater detail, focusing on the role of its receptors on baseline smooth muscle function and during antigen-induced contractions. Alongside investigating PGE2 responses, the newly discovered relaxant effects of bitter tasting substances acting at their respective receptors (TAS2Rs) were examined. The project mainly involved analysis of isometric contractions and relaxations in isolated airways from guinea pigs and humans in organ baths.
  • Alissa L. Allen1, John E. Mcgeary2, and John E. Hayes1

    Alissa L. Allen1, John E. Mcgeary2, and John E. Hayes1

    Bitterness of the non-nutritive sweetener Acesulfame Potassium varies with polymorphisms in TAS2R9, TAS2R31 and TAS2R38. Alissa L. Allen1, John E. McGeary2, and John E. Hayes1 1 Department of Food Science, College of Agricultural Sciences, The Pennsylvania State University, University Park, PA. 2 Providence Veterans Affairs Medical Center, Providence, RI Background Results Finding 4: Aggregate Genetic Bitterness Score predicts • Sweetness is innately liked by humans (reviewed by (Steiner, Glaser et al. Finding 1: Variation in the TAS2R9 Val187Ala allele the bitterness of AceK 2001)), even prior to birth (Snoo 1937). Many highly liked foods contain high predicts AceK bitterness endogenous amounts of natural sugars, or have sugars or other sweeteners added during processing. However, due to health risks such as cardiovascular disease, diabetes and obesity (Hill and Prentice 1995; Howard and Wylie- Rosett 2002), there has been a demand for reduced added-sugar in foods. To retain desired levels of sweetness while reducing calories, bulk carbohydrates are often replaced with non-nutritive sweeteners. • Acesulfame potassium (AceK) was approved by the US Food and Drug Administration for use in dry foods in 1994; approval as a general-purpose sweetener followed in 2002. However, in addition to eliciting sweet sensations, many non-nutritive sweeteners also have objectionable side tastes, such as bitterness, that are experienced by some individuals but not others. Thus, better understanding of the mechanisms underlying this variability may facilitate improved product formulation, with the potential to substantially impact health and wellness. Figure 4: Correlation between Perceived Bitterness of AceK and the Aggregate • Numerous studies have demonstrated that the perception of bitter taste in Figure 1: Effect of TAS2R9 polymorphisms on the bitterness and sweetness of AceK and bitterness of PROP.
  • (A) Up-Regulated Genes in HCC827-GR-High2 Compared to Parental HCC827

    (A) Up-Regulated Genes in HCC827-GR-High2 Compared to Parental HCC827

    Table S2. Results of expression profiling analysis (A) Up-regulated genes in HCC827-GR-high2 compared to parental HCC827 Fold Fold Fold Unique ID Symbol Unique ID Symbol Unique ID Symbol change* change* change* ILMN_1709348 ALDH1A1 577.587 ILMN_2310814 MAPT 13.003 ILMN_1741017 PIP4K2B 7.331 ILMN_1651354 SPP1 441.316 ILMN_1748650 MRPL45 12.988 ILMN_3237623 RNY1 7.297 ILMN_1701831 GSTA1 260.591 ILMN_1755897 UGT2B7 12.629 ILMN_1734897 SLC4A4 7.285 ILMN_1658835 CAV2 12.357 ILMN_1746359 RERG 7.280 ILMN_2094875 ABCB1 183.050 ILMN_1678939 VNN2 11.935 ILMN_1671337 SLC2A5 7.257 ILMN_3251540 GSTA2 145.982 ILMN_1729905 GAL3ST1 11.910 ILMN_1691606 LYG2 7.254 ILMN_2062468 IGFBP7 127.721 ILMN_1672536 FBLN1 11.716 ILMN_1785646 PMP22 7.246 ILMN_1795190 CLDN2 111.439 ILMN_1796339 PLEKHA2 11.631 ILMN_1737387 LOC728441 7.207 ILMN_1782937 LOC647169 98.612 ILMN_1676563 HTRA1 11.592 ILMN_1684401 FMO1 7.117 ILMN_1754247 SLC3A1 81.001 ILMN_3263423 LOC100129027 11.346 ILMN_1687035 ADAMTSL4 7.098 ILMN_1662795 CA2 79.581 ILMN_1694898 LOC653857 10.906 ILMN_2153572 MAGEA3 7.086 ILMN_2168747 GSTA2 66.250 ILMN_2404625 LAT 10.560 ILMN_1784283 USH1C 7.079 ILMN_1764228 DAB2 64.709 ILMN_1666546 DUSP14 10.375 ILMN_1731374 CPE 7.046 ILMN_1675797 EPDR1 63.605 ILMN_1764571 ARHGAP23 10.299 ILMN_1765446 EMP3 6.933 ILMN_1708341 PDZK1 59.714 ILMN_3200140 LOC645638 10.284 ILMN_1754002 IL1F8 6.863 ILMN_1713529 SEMA6A 52.575 ILMN_3244343 SNORA21 10.171 ILMN_1878007 FUT9 6.835 ILMN_1708391 NR1H4 43.218 ILMN_1671489 PC 10.075 ILMN_1699208 NAP1L1 6.763 ILMN_2412336 AKR1C2 42.826 ILMN_2404688
  • The Potential Druggability of Chemosensory G Protein-Coupled Receptors

    The Potential Druggability of Chemosensory G Protein-Coupled Receptors

    International Journal of Molecular Sciences Review Beyond the Flavour: The Potential Druggability of Chemosensory G Protein-Coupled Receptors Antonella Di Pizio * , Maik Behrens and Dietmar Krautwurst Leibniz-Institute for Food Systems Biology at the Technical University of Munich, Freising, 85354, Germany; [email protected] (M.B.); [email protected] (D.K.) * Correspondence: [email protected]; Tel.: +49-8161-71-2904; Fax: +49-8161-71-2970 Received: 13 February 2019; Accepted: 12 March 2019; Published: 20 March 2019 Abstract: G protein-coupled receptors (GPCRs) belong to the largest class of drug targets. Approximately half of the members of the human GPCR superfamily are chemosensory receptors, including odorant receptors (ORs), trace amine-associated receptors (TAARs), bitter taste receptors (TAS2Rs), sweet and umami taste receptors (TAS1Rs). Interestingly, these chemosensory GPCRs (csGPCRs) are expressed in several tissues of the body where they are supposed to play a role in biological functions other than chemosensation. Despite their abundance and physiological/pathological relevance, the druggability of csGPCRs has been suggested but not fully characterized. Here, we aim to explore the potential of targeting csGPCRs to treat diseases by reviewing the current knowledge of csGPCRs expressed throughout the body and by analysing the chemical space and the drug-likeness of flavour molecules. Keywords: smell; taste; flavour molecules; drugs; chemosensory receptors; ecnomotopic expression 1. Introduction Thirty-five percent of approved drugs act by modulating G protein-coupled receptors (GPCRs) [1,2]. GPCRs, also named 7-transmembrane (7TM) receptors, based on their canonical structure, are the largest family of membrane receptors in the human genome.