DOCSLIB.ORG

The Potential Druggability of Chemosensory G Protein-Coupled Receptors

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Potential Druggability of Chemosensory G Protein-Coupled Receptors International Journal of Molecular Sciences Review Beyond the Flavour: The Potential Druggability of Chemosensory G Protein-Coupled Receptors Antonella Di Pizio * , Maik Behrens and Dietmar Krautwurst Leibniz-Institute for Food Systems Biology at the Technical University of Munich, Freising, 85354, Germany; [email protected] (M.B.); [email protected] (D.K.) * Correspondence: [email protected]; Tel.: +49-8161-71-2904; Fax: +49-8161-71-2970 Received: 13 February 2019; Accepted: 12 March 2019; Published: 20 March 2019 Abstract: G protein-coupled receptors (GPCRs) belong to the largest class of drug targets. Approximately half of the members of the human GPCR superfamily are chemosensory receptors, including odorant receptors (ORs), trace amine-associated receptors (TAARs), bitter taste receptors (TAS2Rs), sweet and umami taste receptors (TAS1Rs). Interestingly, these chemosensory GPCRs (csGPCRs) are expressed in several tissues of the body where they are supposed to play a role in biological functions other than chemosensation. Despite their abundance and physiological/pathological relevance, the druggability of csGPCRs has been suggested but not fully characterized. Here, we aim to explore the potential of targeting csGPCRs to treat diseases by reviewing the current knowledge of csGPCRs expressed throughout the body and by analysing the chemical space and the drug-likeness of flavour molecules. Keywords: smell; taste; flavour molecules; drugs; chemosensory receptors; ecnomotopic expression 1. Introduction Thirty-five percent of approved drugs act by modulating G protein-coupled receptors (GPCRs) [1,2]. GPCRs, also named 7-transmembrane (7TM) receptors, based on their canonical structure, are the largest family of membrane receptors in the human genome. The most commonly-used classification system divides GPCRs into six classes: class A (rhodopsin-like), consisting of over 80% of all GPCRs, class B (secretin-like), class C (metabotropic glutamate receptors), class D (pheromone receptors), class E (cAMP receptors) and class F (frizzled/smoothened family) [3–5]. The high GPCRs’ “druggability”, that is, the likelihood of modulating a target by small-molecule drugs [6], is due to a combination of numerous factors, including their physiological and pathological relevance, their expression in the plasma membrane, which facilitates molecular interactions in the extracellular milieu, and a very defined binding site [2,7–9]. The number of GPCRs targeted by drugs is currently 134, ~16% of the ~800 GPCRs in the human genome [1]. Remaining 84% of the GPCR repertoire include orphan GPCRs (~100 receptors) and sensory GPCRs (olfactory, taste and visual receptors). Chemosensory GPCRs (csGPCRs) constitute structurally and phylogenetically diverse subgroups within the superfamily of GPCRs (Figure1). Int. J. Mol. Sci. 2019, 20, 1402; doi:10.3390/ijms20061402 www.mdpi.com/journal/ijms Int. J. Mol. Sci. 2019, 20, x 1402 2 of 2122 Figure 1. Architecture of csGPCRs. (A) Chemosensory receptors classified as class A G protein-coupled receptorsFigure 1. (GPCRs),Architecture whose of orthostericcsGPCRs. ( bindingA) Chemosensory site is located receptors inside theclassified TM domain, as class i.e., A ORs, G protein TAARs- andcoupled TAS2Rs. receptors (B) Chemosensory (GPCRs), whose receptors orthosteric classified binding as class site Cis GPCRs,located inside whose the orthosteric TM domain, binding i.e., site ORs, is locatedTAARs inand the TAS2Rs. Venus flytrap (B) Chemosensory (VFT) domain, receptors i.e., TAS1R2/TAS1R3 classified as andclass TAS1R1/TAS1R3. C GPCRs, whose orthosteric binding site is located in the Venus flytrap (VFT) domain, i.e., TAS1R2/TAS1R3 and TAS1R1/TAS1R3. Odorant receptors (ORs) are class A GPCRs, encoded by ~400 genes in human and thus representOdorant the receptors largest GPCR (ORs) subgroup. are class A Additional GPCRs, encoded class A by csGPCRs ~400 genes in thein human nasal cavity and thus are represent the trace amine-associatedthe largest GPCR receptors subgroup. (TAARs). Additional Six functional class A csGPCRsTAAR genes in th havee nasal been cavity found are in human the trace and amine except- forassociated TAAR1, receptors all receptor (TAARs). subtypes Six arefunctional suggested TAAR to begenes targeted have bybeen odorants, found in particularly human and by except volatile for aminesTAAR1, [ 10all– 12receptor]. subtypes are suggested to be targeted by odorants, particularly by volatile aminesBitter [10– taste12]. signalling is initiated by 25 TAS2Rs [13–15], classified as class A GPCRs for their architectureBitter taste and signalling binding site is locationinitiated [16by]. 25 By TAS2Rs contrast, [13 there–15], are classified only three as class class CA GPCRs,GPCRs for TAS1R1, their TAS1R2architecture and and TAS1R3, binding which site form location functional [16]. By heterodimers contrast, there that are specifically only three recognize class C GPCRs, sweeteners TAS1R1, and aminoTAS1R2 acids: and TAS1R3, the TAS1R2/TAS1R3 which form functional combination heterodimers recognizes that natural specificall and artificialy recognize sweeteners sweeteners whereas and theamino TAS1R1/TAS1R3 acids: the TAS1R2/TAS1R3 is involved in combination umami taste recognizes [17–20]. GPCRs natural have and been artificial suggested sweeteners to mediate wherea alsos the orosensoryTAS1R1/TAS1R3 perception is involved of fat [ 21in– umami23] and taste kokumi [17– (i.e.,20]. GPCRs enhancement have been of mouthfulness suggested to and mediate thickness also ofthe food orosensory perception) perception substances of [24fat, 25[21]. –23] and kokumi (i.e., enhancement of mouthfulness and thicknessIt is of well-established food perception) that, substances by csGPCRs [24,25]. within our chemical senses smell and taste, we constantlyIt is well monitor-established our external that, by chemical csGPCRs environment within our tochemical detect and senses discriminate smell and especially taste, we constantly foodborne stimulimonitor [ 26our,27 external]. However, chemical canonical environment csGPCRs to detect are also and expressed discriminate in tissues especially not directlyfoodborne related stimuli to the[26,27] detection. However, of odorants canonical or csGPCRs tastants [are28– also31], whichexpressed strongly in tissues suggest not directly their role related in the to monitoring the detection of internalof odorant environments.s or tastants Indeed, [28–31] in, somewhich cases strongly their physiologicalsuggest their roles role and in theirthe monitoring involvement of in internal serious diseases,environments. like respiratory Indeed, in and some metabolic cases their diseases physiological and even cancer, roles haveand their been characterizedinvolvement in [32 serious]. diseases,The factlike thatrespiratory csGPCRs and have metabolic pharmacological diseases and relevance even cancer, and that have they been belong characterized to a highly druggable[32]. proteinThe family, fact that unequivocally csGPCRs pointshave pharmacological them out as new attractiverelevance drugand targets,that they increasing belong theto potentiala highly therapeuticdruggable protein GPCR family, target space unequivocally [33]. Since point previouss them analyses out as new on emergingattractive drugdrug designtargets, trendsincreasing and opportunitiesthe potential therapeutic have focused GPCR onthe target non-sensory space [33] GPCR-ome. Since previous [1,2,34 analyses,35], in thison emerging review we drug attempt design to describetrends and the opportunities state-of-the-art have ofcsGPCR focused researchon the non and-sensory explore GPCR the potential-ome [1,2,34,35] druggability, in this of csGPCRs.review we attempt to describe the state-of-the-art of csGPCR research and explore the potential druggability of 2.csGPCRs. “Ecnomotopic” csGPCRs and Their Modulation by Small Molecules OR gene expression has been established in a multitude of human tissues, that is, brain, blood 2. “Ecnomotopic” csGPCRs and Their Modulation by Small Molecules leukocytes, airway smooth muscle, skin, gut [36–45]. Similarly, TAS1Rs and TAS2Rs are located in tissuesOR other gene than expression the tongue has andbeen palate established epithelium; in a multitude including gastrointestinalof human tissues, tract, that heart, is, brain, leukocytes, blood Int. J. Mol. Sci. 2019, 20, x 3 of 21 vascularleukocytes, smooth airway muscle, smooth airway muscle, epithelium, skin, gut skin, [36– lung45]. Similarly, and brain TAS1Rs [39,46–55 and]. TAS2Rs are located in tissuesTheThe other expression than of ofthe extra-nasal extra-nasal tongue ORs and ORs and palate and extra-oral extra-oral epithelium TAS1Rs TAS1Rs and; including TAS2Rs and TAS2Rs isgastrointestinal frequently is frequently defined tract, as defined heart, as “ectopic”leukocytes,“ectopic” [etymology:[etymology: vascular smooth from Greek, muscle, ἐκ (out) airwayκ(out) + +τ epithelium,óτόποςπoσ(place),(place), skin, out-of-the-placeout-of-the-place lung and ]brain][ [32,56].32,56 [39,46]. Ectopic Ectopic–55] .is is a a medicalFormatted: Not Highlight medical term used for “a biological event or process occurring in an abnormal location or position within the body” [56,57]. However, csGPCRs outside their canonical places cannot be considered Formatted: Not Highlight abnormal and we prefer to use the term “ec-nomotopic” [etymology: from Greek, ἐκ(out) + νόμος(law, custom) + τόπος(place), out-of-the-usual(conventional)-place]. To the best of our knowledge, the
Load more

Recommended publications
  • G Protein Alpha 13 (GNA13) (NM 006572) Human Tagged ORF Clone Lentiviral Particle Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC207762L3V G protein alpha 13 (GNA13) (NM_006572) Human Tagged ORF Clone Lentiviral Particle Product data: Product Type: Lentiviral Particles Product Name: G protein alpha 13 (GNA13) (NM_006572) Human Tagged ORF Clone Lentiviral Particle Symbol: GNA13 Synonyms: G13 Vector: pLenti-C-Myc-DDK-P2A-Puro (PS100092) ACCN: NM_006572 ORF Size: 1131 bp ORF Nucleotide The ORF insert of this clone is exactly the same as(RC207762). Sequence: OTI Disclaimer: The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info OTI Annotation: This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. RefSeq: NM_006572.3 RefSeq Size: 4744 bp RefSeq ORF: 1134 bp Locus ID: 10672 UniProt ID: Q14344, A0A024R8M0 Domains: G-alpha Protein Families: Druggable Genome Protein Pathways: Long-term depression, Regulation of actin cytoskeleton, Vascular smooth muscle contraction MW: 44 kDa This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 G protein alpha 13 (GNA13) (NM_006572) Human Tagged ORF Clone Lentiviral Particle – RC207762L3V Gene Summary: Guanine nucleotide-binding proteins (G proteins) are involved as modulators or transducers in various transmembrane signaling systems (PubMed:15240885, PubMed:16787920, PubMed:16705036, PubMed:27084452).
    [Show full text]
  • Genetic Variation Across the Human Olfactory Receptor Repertoire Alters Odor Perception
    bioRxiv preprint doi: https://doi.org/10.1101/212431; this version posted November 1, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Genetic variation across the human olfactory receptor repertoire alters odor perception Casey Trimmer1,*, Andreas Keller2, Nicolle R. Murphy1, Lindsey L. Snyder1, Jason R. Willer3, Maira Nagai4,5, Nicholas Katsanis3, Leslie B. Vosshall2,6,7, Hiroaki Matsunami4,8, and Joel D. Mainland1,9 1Monell Chemical Senses Center, Philadelphia, Pennsylvania, USA 2Laboratory of Neurogenetics and Behavior, The Rockefeller University, New York, New York, USA 3Center for Human Disease Modeling, Duke University Medical Center, Durham, North Carolina, USA 4Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina, USA 5Department of Biochemistry, University of Sao Paulo, Sao Paulo, Brazil 6Howard Hughes Medical Institute, New York, New York, USA 7Kavli Neural Systems Institute, New York, New York, USA 8Department of Neurobiology and Duke Institute for Brain Sciences, Duke University Medical Center, Durham, North Carolina, USA 9Department of Neuroscience, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania, USA *[email protected] ABSTRACT The human olfactory receptor repertoire is characterized by an abundance of genetic variation that affects receptor response, but the perceptual effects of this variation are unclear. To address this issue, we sequenced the OR repertoire in 332 individuals and examined the relationship between genetic variation and 276 olfactory phenotypes, including the perceived intensity and pleasantness of 68 odorants at two concentrations, detection thresholds of three odorants, and general olfactory acuity.
    [Show full text]
  • Gastrointestinal Defense Mechanisms
    REVIEW CURRENT OPINION Gastrointestinal defense mechanisms Hyder Said a,b and Jonathan D. Kaunitzb,c Purpose of review To summarize and illuminate the recent findings regarding gastroduodenal mucosal defense mechanisms and the specific biomolecules involved in regulating this process, such as glucagon-like peptides (GLPs). Recent findings There has been a growing interest in luminal nutrient chemosensing and its physiological effects throughout the digestive system. From the ingestion of food in the oral cavity to the processing and absorption of nutrients in the intestines, nutrient chemosensing receptors signal the production and release of numerous bioactive peptides from enteroendocrine cells, such as the proglucagon-derived peptides. There has been a major emphasis on two proglucagon-derived peptides, namely GLP-1 and GLP-2, due to their apparent beneficial effect on gut structure, function, and on metabolic processes. As an incretin, GLP-1 not only enhances the effect and release of insulin on pancreatic bcells but also has been implicated in having trophic effects on the intestinal epithelium. In addition, GLP-2, the other major proglucagon-derived peptide, has potent intestinotrophic effects, such as increasing the rate of mucosal stem cell proliferation, mucosal blood flow, and fluid absorption, as well as augmenting the rate of duodenal bicarbonate secretion to improve gastric mucosal health and longevity. Summary Understanding the mechanisms underlying nutrient chemosensing and how it relates to GLP release can further elucidate how the gut functions in response to cellular changes and disturbances. Furthermore, a more in-depth comprehension of GLP release and its tissue-specific effects will help improve the utility of GLP-1 and GLP-2 receptor agonists in clinical settings.
    [Show full text]
  • TAS1R1 (NM 138697) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG219286 TAS1R1 (NM_138697) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: TAS1R1 (NM_138697) Human Tagged ORF Clone Tag: TurboGFP Symbol: TAS1R1 Synonyms: GM148; GPR70; T1R1; TR1 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 6 TAS1R1 (NM_138697) Human Tagged ORF Clone – RG219286 ORF Nucleotide >RG219286 representing NM_138697 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTGCTCTGCACGGCTCGCCTGGTCGGCCTGCAGCTTCTCATTTCCTGCTGCTGGGCCTTTGCCTGCC ATAGCACGGAGTCTTCTCCTGACTTCACCCTCCCCGGAGATTACCTCCTGGCAGGCCTGTTCCCTCTCCA TTCTGGCTGTCTGCAGGTGAGGCACAGACCCGAGGTGACCCTGTGTGACAGGTCTTGTAGCTTCAATGAG CATGGCTACCACCTCTTCCAGGCTATGCGGCTTGGGGTTGAGGAGATAAACAACTCCACGGCCCTGCTGC CCAACATCACCCTGGGGTACCAGCTGTATGATGTGTGTTCTGACTCTGCCAATGTGTATGCCACGCTGAG AGTGCTCTCCCTGCCAGGGCAACACCACATAGAGCTCCAAGGAGACCTTCTCCACTATTCCCCTACGGTG CTGGCAGTGATTGGGCCTGACAGCACCAACCGTGCTGCCACCACAGCCGCCCTGCTGAGCCCTTTCCTGG TGCCCATGATTAGCTATGCGGCCAGCAGCGAGACGCTCAGCGTGAAGCGGCAGTATCCCTCTTTCCTGCG CACCATCCCCAATGACAAGTACCAGGTGGAGACCATGGTGCTGCTGCTGCAGAAGTTCGGGTGGACCTGG
    [Show full text]
  • Mismatches Between Feeding Ecology and Taste Receptor Evolution
    satisfactory explanation exists (2). Furthermore, Tas1r2 is absent LETTER in all bird genomes sequenced thus far (2), irrespective of their diet. Mismatches between feeding ecology Jiang et al. (1) further contended that sea lions and dolphins and taste receptor evolution: An need not sense the umami taste because they swallow food whole. Although it is true that Tas1r1 is pseudogenized in these inconvenient truth two species, the authors ignore the previous finding that Tas1r1 is also pseudogenized or missing in all bats examined, regardless Comparative and evolutionary biology can not only verify labo- of their diet (fruits, insects, or blood) (3). Although the pseu- ratory findings of gene functions but also provide insights into dogenization of Tas1r1 in the giant panda (4) occurred at ap- their physiological roles in nature that are sometimes difficult to proximately the same time as it switched from being a meat-eater discern in the laboratory. Specifically, if our understanding of the to a plant-eater (5), and thus may be related to the feeding physiological function of a gene is complete and accurate, the ecology, herbivorous mammals, such as the horse and cow, still gene should be inactivated or pseudogenized in and only in carry an intact Tas1r1 (5). organisms in which the presumed function of the gene has be- Clearly, the presence/absence of intact Tas1r2 and Tas1r1 in come useless or harmful. On the basis of multiple independent mammals and other vertebrates is sometimes inconsistent with pseudogenizations of the sweet taste receptor gene Tas1r2 in the known functions of these genes and the involved tastes.
    [Show full text]
  • Functions of Olfactory Receptors Are Decoded from Their Sequence
    bioRxiv preprint doi: https://doi.org/10.1101/2020.01.06.895540; this version posted January 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Functions of olfactory receptors are decoded from their sequence Xiaojing Cong,1,†* Wenwen Ren,5,† Jody Pacalon1, Claire A. de March,6 Lun Xu,2 Hiroaki Matsunami,6 Yiqun Yu,2,3* Jérôme Golebiowski1,4* 1 Université Côte d’Azur, CNRS, Institut de Chimie de Nice UMR7272, Nice 06108, France 2 Department of Otolaryngology, Eye, Ear, Nose & Throat Hospital, Shanghai Key Clinical Disciplines of Otorhinolaryngology, Fudan University, Shanghai 200031, People's Republic of China 3 School of Life Sciences, Shanghai University, Shanghai 200444, People's Republic of China 4 Department of Brain and Cognitive Sciences, Daegu Gyeongbuk Institute of Science and Technology, Daegu 711-873, South Korea 5 Institutes of Biomedical Sciences, Fudan University, Shanghai 200031, People's Republic of China 6 Department of Molecular Genetics and Microbiology, and Department of Neurobiology, and Duke Institute for Brain Sciences, Duke University Medical Center, Research Drive, Durham, NC 27710, USA † These authors contributed equally. * Correspondence may be addressed to: [email protected], [email protected] or [email protected] Abstract G protein-coupled receptors (GPCRs) conserve common structural folds and activation mechanisms, yet their ligand spectra and functions are highly diversified. This work investigated how the functional variations in olfactory GPCRs (ORs)−the largest GPCR family−are encoded in the primary sequence.
    [Show full text]
  • Olfactory Receptor Proteins in Axonal Processes of Chemosensory Neurons
    7754 • The Journal of Neuroscience, September 1, 2004 • 24(35):7754–7761 Cellular/Molecular Olfactory Receptor Proteins in Axonal Processes of Chemosensory Neurons Joerg Strotmann, Olga Levai, Joerg Fleischer, Karin Schwarzenbacher, and Heinz Breer Institute of Physiology, University of Hohenheim, 70593 Stuttgart, Germany Olfactoryreceptorsaresupposedtoactnotonlyasmolecularsensorsforodorantsbutalsoascellrecognitionmoleculesguidingtheaxons of olfactory neurons to their appropriate glomerulus in the olfactory bulb. This concept implies that olfactory receptor proteins are located in sensory cilia and in the axons. To approach this critical issue, antibodies were generated against two peptides, one derived from olfactory receptor mOR256–17, one derived from the “mOR37” subfamily. By means of immunohistochemistry and double-labeling studies using transgenic mouse lines as well as Western blot analyses, it was demonstrated that the newly generated antibodies specifi- cally recognized the receptor proteins. To scrutinize the hypothesis that olfactory receptor proteins may also be present in the axonal processes and the nerve terminals, serial sections through the olfactory bulb were probed with the antibodies. Two glomeruli in each bulb were stained by anti-mOR256–17, one positioned in the medial, one in the lateral hemisphere. Fiber bundles approaching the glomeruli through the outer nerve layer also displayed intense immunofluorescence. A similar picture emerged for the antibody anti-mOR37, a small number of glomeruli in the ventral domain
    [Show full text]
  • Activation Mechanism of the G Protein-Coupled Sweet Receptor Heterodimer with Sweeteners and Allosteric Agonists
    Supporting Information Activation mechanism of the G protein-coupled sweet receptor heterodimer with sweeteners and allosteric agonists Soo-Kyung Kim, *† Yalu Chen, † Ravinder Abrol, †, ‡ William A. Goddard III,*† and Brian Guthrie§ †Materials and Process Simulation Center (MC 139-74), California Institute of Technology, 1200 E. California Blvd., Pasadena, CA 91125; ‡Current address, Departments of Chemistry and Biochemistry, California State University, Northridge, CA 91330; §Cargill Global Food Research, 2301 Crosby Road, Wayzata, MN 55391 * CORRESPONDING AUTHOR Prof. William A. Goddard III California Institute of Technology MC 139-74, 1200 E. California Blvd., Pasadena, CA 91125; phone: 1-626-395-2731, e-mail: [email protected] Dr. Soo-Kyung Kim phone: 1-626-395-2724, e-mail: [email protected] 1 RESULTS Structures for Allosteric ligand bound at the TMD of all three TAS1Rs As described in the METHODS section, the DarwinDock procedure (1) involves sampling ~50,000 poses for each of ~10 diverse ligand conformations from which, we select finally two energetically favorable binding poses based on two scoring methods: UCav E: unified cavity energy for which we consider that interactions of the best 100 poses with the union of all residues involve in their separate binding sites (providing a uniform comparison) BE: snap binding energy considering all interactions of ligand with protein As a first validation of the predicted structures for the 7 helix TMD, we used DarwinDock to predict the binding site for the allosteric ligands to each TAS1R TMD in Table S10. Here we find, S819 [1-((1H-pyrrol-2-yl)methyl)-3-(4-isopropoxyphenyl)thiourea] is a sweet compound that interacts with the TAS1R2 TMD.(2) and Lactisole is a competitive inhibitor of the sweet taste receptor that binds to TAS1R3 TMD.(3, 4) These structures were further relaxed through annealing.
    [Show full text]
  • G-Protein ␤␥-Complex Is Crucial for Efficient Signal Amplification in Vision
    The Journal of Neuroscience, June 1, 2011 • 31(22):8067–8077 • 8067 Cellular/Molecular G-Protein ␤␥-Complex Is Crucial for Efficient Signal Amplification in Vision Alexander V. Kolesnikov,1 Loryn Rikimaru,2 Anne K. Hennig,1 Peter D. Lukasiewicz,1 Steven J. Fliesler,4,5,6,7 Victor I. Govardovskii,8 Vladimir J. Kefalov,1 and Oleg G. Kisselev2,3 1Department of Ophthalmology and Visual Sciences, Washington University School of Medicine, St. Louis, Missouri 63110, Departments of 2Ophthalmology and 3Biochemistry and Molecular Biology, Saint Louis University School of Medicine, Saint Louis, Missouri 63104, 4Research Service, Veterans Administration Western New York Healthcare System, and Departments of 5Ophthalmology (Ross Eye Institute) and 6Biochemistry, University at Buffalo/The State University of New York (SUNY), and 7SUNY Eye Institute, Buffalo, New York 14215, and 8Sechenov Institute for Evolutionary Physiology and Biochemistry, Russian Academy of Sciences, Saint Petersburg 194223, Russia A fundamental question of cell signaling biology is how faint external signals produce robust physiological responses. One universal mechanism relies on signal amplification via intracellular cascades mediated by heterotrimeric G-proteins. This high amplification system allows retinal rod photoreceptors to detect single photons of light. Although much is now known about the role of the ␣-subunit of the rod-specific G-protein transducin in phototransduction, the physiological function of the auxiliary ␤␥-complex in this process remains a mystery. Here, we show that elimination of the transducin ␥-subunit drastically reduces signal amplification in intact mouse rods. The consequence is a striking decline in rod visual sensitivity and severe impairment of nocturnal vision. Our findings demonstrate that transducin ␤␥-complex controls signal amplification of the rod phototransduction cascade and is critical for the ability of rod photoreceptors to function in low light conditions.
    [Show full text]
  • Odorant Receptors: Regulation, Signaling, and Expression Michele Lynn Rankin Louisiana State University and Agricultural and Mechanical College, [email protected]
    Louisiana State University LSU Digital Commons LSU Doctoral Dissertations Graduate School 2002 Odorant receptors: regulation, signaling, and expression Michele Lynn Rankin Louisiana State University and Agricultural and Mechanical College, [email protected] Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_dissertations Recommended Citation Rankin, Michele Lynn, "Odorant receptors: regulation, signaling, and expression" (2002). LSU Doctoral Dissertations. 540. https://digitalcommons.lsu.edu/gradschool_dissertations/540 This Dissertation is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Doctoral Dissertations by an authorized graduate school editor of LSU Digital Commons. For more information, please [email protected]. ODORANT RECEPTORS: REGULATION, SIGNALING, AND EXPRESSION A Dissertation Submitted to the Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College in partial fulfillment of the requirements for the degree of Doctor of Philosophy In The Department of Biological Sciences By Michele L. Rankin B.S., Louisiana State University, 1990 M.S., Louisiana State University, 1997 August 2002 ACKNOWLEDGMENTS I would like to thank several people who participated in my successfully completing the requirements for the Ph.D. degree. I thank Dr. Richard Bruch for giving me the opportunity to work in his laboratory and guiding me along during the degree program. I am very thankful for the support and generosity of my advisory committee consisting of Dr. John Caprio, Dr. Evanna Gleason, and Dr. Jaqueline Stephens. At one time or another, I performed experiments in each of their laboratories and include that work in this dissertation.
    [Show full text]
  • Transducin ␤-Subunit Can Interact with Multiple G-Protein ␥-Subunits to Enable Light Detection by Rod Photoreceptors
    New Research Sensory and Motor Systems Transducin ␤-Subunit Can Interact with Multiple G-Protein ␥-Subunits to Enable Light Detection by Rod Photoreceptors Paige M. Dexter,1 Ekaterina S. Lobanova,2 Stella Finkelstein,2 William J. Spencer,1 Nikolai P. Skiba,2 and Vadim Y. Arshavsky1,2 DOI:http://dx.doi.org/10.1523/ENEURO.0144-18.2018 1Department of Pharmacology and Cancer Biology, Duke University School of Medicine, Durham, North Carolina 27710 and 2Albert Eye Research Institute, Duke University, Durham, North Carolina 27710 Visual Overview The heterotrimeric G-protein transducin mediates visual signaling in vertebrate photoreceptor cells. Many aspects of the function of transducin were learned from knock-out mice lacking its individual subunits. Of particular interest is ␥ ␥ the knockout of its rod-specific -subunit (G 1). Two stud- ies using independently generated mice documented that this knockout results in a considerable Ͼ60-fold reduction in the light sensitivity of affected rods, but provided dif- ␣ ␣ ferent interpretations of how the remaining -subunit (G t) ␤ ␥ mediates phototransduction without its cognate G 1 1- subunit partner. One study found that the light sensitivity ␣ reduction matched a corresponding reduction in G t con- tent in the light-sensing rod outer segments and proposed ␣ ␤ that G t activation is supported by remaining G 1 asso- ciating with other G␥ subunits naturally expressed in pho- toreceptors. In contrast, the second study reported the same light sensitivity loss but a much lower, only approx- ␣ imately sixfold, reduction of G t and proposed that the light responses of these rods do not require G␤␥ at all. To resolve this controversy and elucidate the mechanism ␥ driving visual signaling in G 1 knock-out rods, we analyzed both mouse lines side by side.
    [Show full text]
  • The Odorant Receptor OR2W3 on Airway Smooth Muscle Evokes Bronchodilation Via a Cooperative Chemosensory Tradeoff Between TMEM16A and CFTR
    The odorant receptor OR2W3 on airway smooth muscle evokes bronchodilation via a cooperative chemosensory tradeoff between TMEM16A and CFTR Jessie Huanga,1,2, Hong Lama,1, Cynthia Koziol-Whiteb,c, Nathachit Limjunyawongd, Donghwa Kime, Nicholas Kimb, Nikhil Karmacharyac, Premraj Rajkumarf, Danielle Firera, Nicholas M. Dalesiog, Joseph Judec, Richard C. Kurtenh, Jennifer L. Pluznickf, Deepak A. Deshpandei, Raymond B. Penni, Stephen B. Liggette,j, Reynold A. Panettieri Jrc, Xinzhong Dongd,k, and Steven S. Anb,c,2 aDepartment of Environmental Health and Engineering, The Johns Hopkins University Bloomberg School of Public Health, Baltimore, MD 21205; bDepartment of Pharmacology, Rutgers-Robert Wood Johnson Medical School, The State University of New Jersey, Piscataway, NJ 08854; cRutgers Institute for Translational Medicine and Science, New Brunswick, NJ 08901; dSolomon H. Snyder Department of Neuroscience, The Johns Hopkins University School of Medicine, Baltimore, MD 21205; eCenter for Personalized Medicine, Morsani College of Medicine, University of South Florida, Tampa, FL 33612; fDepartment of Physiology, The Johns Hopkins University School of Medicine, Baltimore, MD 21205; gDepartment of Anesthesiology and Critical Care Medicine, The Johns Hopkins University School of Medicine, Baltimore, MD 21205; hDepartment of Physiology and Biophysics, University of Arkansas for Medical Sciences, Little Rock, AR 72205; iDivision of Pulmonary and Critical Care Medicine, Department of Medicine, Center for Translational Medicine, Jane and Leonard Korman
    [Show full text]