DOCSLIB.ORG

The Association of Bovine T1R Family of Receptors Polymorphisms with Cattle Growth Traits ⇑ C.L

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Association of Bovine T1R Family of Receptors Polymorphisms with Cattle Growth Traits ⇑ C.L Research in Veterinary Science xxx (2012) xxx–xxx Contents lists available at SciVerse ScienceDirect Research in Veterinary Science journal homepage: www.elsevier.com/locate/rvsc The association of bovine T1R family of receptors polymorphisms with cattle growth traits ⇑ C.L. Zhang a, J. Yuan a, Q. Wang a, Y.H. Wang a, X.T. Fang a, C.Z. Lei b, D.Y. Yang c, H. Chen a, a Institute of Cellular and Molecular Biology, Xuzhou Normal University, Xuzhou, Jiangsu, PR China b College of Animal Science and Technology, Northwest Agriculture and Forestry University, Shaanxi Key Laboratory of Molecular Biology for Agriculture, Yangling, Shaanxi, PR China c College of Life Science, Dezhou University, Dezhou, Shandong 253023, PR China article info abstract Article history: The three members of the T1R class of taste-specific G protein-coupled receptors have been proven to Received 12 August 2011 function in combination with heterodimeric sweet and umami taste receptors in many mammals that Accepted 20 January 2012 affect food intake. This may in turn affect growth traits of livestock. We performed a comprehensive eval- Available online xxxx uation of single-nucleotide polymorphisms (SNPs) in the bovine TAS1R gene family, which encodes receptors for umami and sweet tastes. Complete DNA sequences of TAS1R1-, TAS1R2-, and TAS1R3-cod- Keywords: ing regions, obtained from 436 unrelated female cattle, representing three breeds (Qinchuan, Jiaxian Red, Taste receptors Luxi), revealed substantial coding and noncoding diversity. A total of nine SNPs in the TAS1R1 gene were SNP identified, among which seven SNPs were in the coding region, and two SNPs were in the introns. All five Cattle Body height SNPs in the TAS1R2 gene and all three SNPs in the TAS1R3 gene were identified in the coding region. Four SNPs (TAS1R1 g.5081C > T, TAS1R1 g.5110C > A, TAS1R2 g.288A > G, TAS1R2 g.2552T > C) were signifi- cantly associated with body height of Qinchuan cattle (P < 0.05). The heterozygous genotypes of the four SNPs showed a molecular heterosis on cattle heights at hip cross and sacra. The individuals with different genotypic combinations of the four SNPs had significant association with heights at hip cross and sacra (P < 0.05). Ó 2012 Published by Elsevier Ltd. 1. Introduction may promote selection and ingestion of a diet containing an ade- quate level of protein (Gietzen et al., 2007). The sensory capabili- The T1R family of Class C G protein-coupled receptors is respon- ties of normal individuals with normal weight appear to be sible for the generation of the signals that are ultimately inter- higher than that of overweight subjects (Simchen et al., 2006). preted as ‘‘sweetness’’ and those leading to the so called The extent of variation in human TAS1R genes has been well ‘‘umami’’ taste associated with some L-amino acids, especially L- characterized, 17 SNPs in TAS1R1 (including three synonymous glutamate. There are three proteins in the family, T1R1, T1R2, and 14 nonsynonymous variants) and 12 SNPs in TAS1R3 (six and T1R3, encoded by their respective genes, Tas1r1, Tas1r2, and nonsynonymous and six synonymous SNPs) were detected Tas1r3. T1R2 and T1R3 form a heterodimer that can bind sugars (Kim et al., 2006). The frequencies of two nsSNPs, C329T in and other sweeteners (Li et al., 2002; Zhao et al., 2003; Nie et al., TAS1R1 and C2269T in TAS1R3, were significantly higher in 2005). T1R3 also combines with T1R1 to form a heterodimer that nontasters than expected, whereas G1114A in TAS1R1 was more binds with L-amino acids (Nelson et al., 2002; Damak et al., frequent in tasters (Raliou et al., 2009). The TAS1R1-372T creates 2003; Taylor-Burds et al., 2004; Scott, 2004). a more sensitive umami receptor than -372A, while TAS1R3- The ability to detect orexigenic tastes had significant affect on 757C creates a less sensitive one than -757R for MSG and MSG dietary behavior and growth of humans and other mammals plus IMP, and showed a strong correlation between the recogni- (Golding et al., 2009). The bone resorption ability was significantly tion thresholds and in vitro dose response relationships (Shigem- higher in the high sugar preference group compared with the low ura et al., 2009). The amino acid substitutions (A110V and preference group (Coldwell et al., 2009). It was reported that the R507Q) in the N-terminal ligand-binding domain of T1R1, and absorption of sugars, peptides and amino acids is coordinated by the two amino acid substitutions (F749S and R757C), located signaling of sweet and amino acid taste receptors to target a in the transmembrane domain of T1R3, severely impaired common enterocytic pool of PKCbII (Mace et al., 2009). Taste in vitro T1R1/T1R3 response to MSG (Raliou et al., 2011). A ge- netic variation in TAS1R2 (Ile191Val) affected the habitual con- ⇑ Corresponding author. sumption of sugars, and it may have contributed to difference E-mail address: [email protected] (H. Chen). of human body weight (Eny et al., 2010). This suggested that 0034-5288/$ - see front matter Ó 2012 Published by Elsevier Ltd. doi:10.1016/j.rvsc.2012.01.014 Please cite this article in press as: Zhang, C.L., et al. The association of bovine T1R family of receptors polymorphisms with cattle growth traits. Res. Vet. Sci. (2012), doi:10.1016/j.rvsc.2012.01.014 2 C.L. Zhang et al. / Research in Veterinary Science xxx (2012) xxx–xxx the variation of TAS1R genes might affect their function. For live- three samples containing identical genotypes confirmed that they stock, this may in turn affect tissue accretion and growth. In an displayed strictly identical sequences. effort to obtain thorough understanding of genetic and func- tional variation in bovine taste perception, we performed a sur- 2.5. Statistical analysis vey of polymorphisms in the three taste receptor genes. Gene frequencies were determined for each breed by direct counting. Statistical analysis of associations between genotypes 2. Materials and methods and growth traits of Qinchuan heifers was performed, using SPSS (version 13.0). The model applied was: 2.1. Sampling and DNA extraction Yijk = l + Ai + Bj + Gk + eijkl, where Yijk was the trait measured on each of the th animal, was the overall population mean, A was In this study, 436 unrelated female cattle, representing Qinch- ijk l i fixed effect due to the th age, B was fixed effect due to the breed, uan (228), Jiaxian Red (143), and Luxi (65) were included. Qinch- i j G was the fixed effect associated with th genotype and e was uan, Jiaxian Red, Luxi are important breeds for beef production k k ijkl the random error (animal as a random effect with pedigree rela- in China. The animals of each breed were selected to be unre- tionships between animals). The least square means estimates lated for at least three generations for the purpose of having di- with standard errors for genotypes and growth traits were used. verse lineages within each breed. Blood samples were obtained from the jugular veins of cattle. Blood genomic DNA was ex- tracted by standard methods. 3. Results The 228 cows of Qinchuan breed used for the association study came from a common ancestor, and pedigrees of core breeding In the present study, a total of nine SNPs of TAS1R1 gene were population animals were traced back three generations. Calves identified, among which seven were in the coding region, and two were weaned at the average age of 6 months and raised from were in the introns. Five SNPs of TAS1R2 gene and three SNPs of weaning to slaughter on a corn–corn silage diet, according to nutri- TAS1R3 gene were detected in the coding region (Fig. 1). The nat- ent requirements of growing heifers (NRC, 2000). Heifers have free ure and the distribution of mutations in the three genes are shown access to the same diet and fresh water. All heifers were tethered in Table 1. individually in stalls and housed in a large barn. They were daily We investigated whether TAS1R genes variations associated released to sport field for three hours to ensure their health if with the growth traits of cattle. Results of the association analysis weather permitted. Heights at hip cross and sacra, chest circumfer- are summarized in Table 2. Four SNPs have an effect on body ence and body lengh, which were key parameters of growth traits, height (P < 0.05, Table 2), but they have no effect on chest circum- were recorded at 24 months. ference and body lengh of Qinchuan cattle. Cattle with the TAS1R1 g.5081CT genotype had lower heights at hip cross and sacra than the TAS1R1 g.5081CC animals, and cattle with the TAS1R1 2.2. Primer design and PCR amplification g.5110CA genotype had lower heights at hip cross and sacra mean than the TAS1R1 g.5110CC and g.5110AA animals (P < 0.05) (Table Thirty-one pairs of PCR primers (Supplementary Table 1) were 2). Cattle with the TAS1R2 g.2552TC genotype had higher heights designed to amplify the coding and flanking region of bovine at hip cross and sacra than the TAS1R2 g.2552TT and TAS1R2 TAS1R1 (NW_001493427), TAS1R2 (NC_007300) and TAS1R3 g.2552CC animals, but cattle with the TAS1R2 g.12375CG genotype (NW_001493430) by using Primer V5.0 software. The 20 ll PCR had lower heights at hip cross and sacra than the TAS1R2 reaction volume contained 50 ng DNA template, 0.20 mM dNTP, g.12375CC and TAS1R2 g.12375GG animals (P < 0.05, Table 2). 2.5 mM MgCl2 and 0.5 U Taq DNA polymerase (TaKaRa, Dalian, The four SNPs that associated with growth traits produced China). The PCR protocol was performed using the following pro- seven types of genotypic combinations (Table 3).
Load more

Recommended publications
  • Cellular Mechanisms in Taste Buds
    Bull Tokyo Dent Coll (2007) 48(4): 151–161 151 Review Article Cellular Mechanisms in Taste Buds Takashi Suzuki Professor (retired), Department of Physiology, Tokyo Dental College, 1-2-2 Masago, Mihama-ku, Chiba 261-8502, Japan Received 23 May, 2007/Accepted for publication 10 October, 2007 Abstract In the soft palate, tongue, pharynx and larynx surrounding the oral region, taste buds are present, allowing the sensation of taste. On the tongue surface, 3 kinds of papillae are present: fungiform, foliate, and circumvallate. Approximately 5,000 taste buds cover the surface of the human tongue, with about 30% fungiform, 30% foliate and 40% circumvallate papillae. Each taste bud comprises 4 kinds of cells, namely high dark (type I), low light (type II), and intermediate (type III) cells in electron density and Merkel-like taste basal cells (type IV) located at a distance from taste pores. Type II cells sense taste stimuli and type III cells transmit taste signals to sensory afferent nerve fibers. However, type I and type IV cells are not considered to possess obvious taste functions. Synaptic interactions that mediate communication in taste cells provide signal outputs to primary afferent fibers. In the study of taste bud cells, molecular functional techniques using single cells have recently been applied. Serotonin (5-HT) plays a role in cell-to-cell transmission of taste signals. ATP fills the criterion of a neurotransmitter that activates receptors of taste nerve fibers. Findings on 5-HT and ATP suggest that various different transmitters and receptors are present in taste buds. However, no firm evidence for taste- evoked release from type III cells has been identified, except for 5-HT and ATP.
    [Show full text]
  • Food, Food Chemistry and Gustatory Sense
    Food, Food Chemistry and Gustatory Sense COOH N H María González Esguevillas MacMillan Group Meeting May 12th, 2020 Food and Food Chemistry Introduction Concepts Food any nourishing substance eaten or drunk to sustain life, provide energy and promote growth any substance containing nutrients that can be ingested by a living organism and metabolized into energy and body tissue country social act culture age pleasure election It is fundamental for our life Food and Food Chemistry Introduction Concepts Food any nourishing substance eaten or drunk to sustain life, provide energy and promote growth any substance containing nutrients that can be ingested by a living organism and metabolized into energy and body tissue OH O HO O O HO OH O O O limonin OH O O orange taste HO O O O 5-caffeoylquinic acid Coffee taste OH H iPr N O Me O O 2-decanal Capsaicinoids Coriander taste Chilli burning sensation Astray, G. EJEAFChe. 2007, 6, 1742-1763 Food and Food Chemistry Introduction Concepts Food Chemistry the study of chemical processes and interactions of all biological and non-biological components of foods biological substances areas food processing techniques de Man, J. M. Principles of Food Chemistry 1999, Springer Science Fennema, O. R. Food Chemistry. 1985, 2nd edition New York: Marcel Dekker, Inc Food and Food Chemistry Introduction Concepts Food Chemistry the study of chemical processes and interactions of all biological and non-biological components of foods biological substances areas food processing techniques carbo- hydrates water minerals lipids flavors vitamins protein food enzymes colors additive Fennema, O. R. Food Chemistry.
    [Show full text]
  • Gastrointestinal Defense Mechanisms
    REVIEW CURRENT OPINION Gastrointestinal defense mechanisms Hyder Said a,b and Jonathan D. Kaunitzb,c Purpose of review To summarize and illuminate the recent findings regarding gastroduodenal mucosal defense mechanisms and the specific biomolecules involved in regulating this process, such as glucagon-like peptides (GLPs). Recent findings There has been a growing interest in luminal nutrient chemosensing and its physiological effects throughout the digestive system. From the ingestion of food in the oral cavity to the processing and absorption of nutrients in the intestines, nutrient chemosensing receptors signal the production and release of numerous bioactive peptides from enteroendocrine cells, such as the proglucagon-derived peptides. There has been a major emphasis on two proglucagon-derived peptides, namely GLP-1 and GLP-2, due to their apparent beneficial effect on gut structure, function, and on metabolic processes. As an incretin, GLP-1 not only enhances the effect and release of insulin on pancreatic bcells but also has been implicated in having trophic effects on the intestinal epithelium. In addition, GLP-2, the other major proglucagon-derived peptide, has potent intestinotrophic effects, such as increasing the rate of mucosal stem cell proliferation, mucosal blood flow, and fluid absorption, as well as augmenting the rate of duodenal bicarbonate secretion to improve gastric mucosal health and longevity. Summary Understanding the mechanisms underlying nutrient chemosensing and how it relates to GLP release can further elucidate how the gut functions in response to cellular changes and disturbances. Furthermore, a more in-depth comprehension of GLP release and its tissue-specific effects will help improve the utility of GLP-1 and GLP-2 receptor agonists in clinical settings.
    [Show full text]
  • TAS1R1 (NM 138697) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG219286 TAS1R1 (NM_138697) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: TAS1R1 (NM_138697) Human Tagged ORF Clone Tag: TurboGFP Symbol: TAS1R1 Synonyms: GM148; GPR70; T1R1; TR1 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 6 TAS1R1 (NM_138697) Human Tagged ORF Clone – RG219286 ORF Nucleotide >RG219286 representing NM_138697 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTGCTCTGCACGGCTCGCCTGGTCGGCCTGCAGCTTCTCATTTCCTGCTGCTGGGCCTTTGCCTGCC ATAGCACGGAGTCTTCTCCTGACTTCACCCTCCCCGGAGATTACCTCCTGGCAGGCCTGTTCCCTCTCCA TTCTGGCTGTCTGCAGGTGAGGCACAGACCCGAGGTGACCCTGTGTGACAGGTCTTGTAGCTTCAATGAG CATGGCTACCACCTCTTCCAGGCTATGCGGCTTGGGGTTGAGGAGATAAACAACTCCACGGCCCTGCTGC CCAACATCACCCTGGGGTACCAGCTGTATGATGTGTGTTCTGACTCTGCCAATGTGTATGCCACGCTGAG AGTGCTCTCCCTGCCAGGGCAACACCACATAGAGCTCCAAGGAGACCTTCTCCACTATTCCCCTACGGTG CTGGCAGTGATTGGGCCTGACAGCACCAACCGTGCTGCCACCACAGCCGCCCTGCTGAGCCCTTTCCTGG TGCCCATGATTAGCTATGCGGCCAGCAGCGAGACGCTCAGCGTGAAGCGGCAGTATCCCTCTTTCCTGCG CACCATCCCCAATGACAAGTACCAGGTGGAGACCATGGTGCTGCTGCTGCAGAAGTTCGGGTGGACCTGG
    [Show full text]
  • Mismatches Between Feeding Ecology and Taste Receptor Evolution
    satisfactory explanation exists (2). Furthermore, Tas1r2 is absent LETTER in all bird genomes sequenced thus far (2), irrespective of their diet. Mismatches between feeding ecology Jiang et al. (1) further contended that sea lions and dolphins and taste receptor evolution: An need not sense the umami taste because they swallow food whole. Although it is true that Tas1r1 is pseudogenized in these inconvenient truth two species, the authors ignore the previous finding that Tas1r1 is also pseudogenized or missing in all bats examined, regardless Comparative and evolutionary biology can not only verify labo- of their diet (fruits, insects, or blood) (3). Although the pseu- ratory findings of gene functions but also provide insights into dogenization of Tas1r1 in the giant panda (4) occurred at ap- their physiological roles in nature that are sometimes difficult to proximately the same time as it switched from being a meat-eater discern in the laboratory. Specifically, if our understanding of the to a plant-eater (5), and thus may be related to the feeding physiological function of a gene is complete and accurate, the ecology, herbivorous mammals, such as the horse and cow, still gene should be inactivated or pseudogenized in and only in carry an intact Tas1r1 (5). organisms in which the presumed function of the gene has be- Clearly, the presence/absence of intact Tas1r2 and Tas1r1 in come useless or harmful. On the basis of multiple independent mammals and other vertebrates is sometimes inconsistent with pseudogenizations of the sweet taste receptor gene Tas1r2 in the known functions of these genes and the involved tastes.
    [Show full text]
  • Activation Mechanism of the G Protein-Coupled Sweet Receptor Heterodimer with Sweeteners and Allosteric Agonists
    Supporting Information Activation mechanism of the G protein-coupled sweet receptor heterodimer with sweeteners and allosteric agonists Soo-Kyung Kim, *† Yalu Chen, † Ravinder Abrol, †, ‡ William A. Goddard III,*† and Brian Guthrie§ †Materials and Process Simulation Center (MC 139-74), California Institute of Technology, 1200 E. California Blvd., Pasadena, CA 91125; ‡Current address, Departments of Chemistry and Biochemistry, California State University, Northridge, CA 91330; §Cargill Global Food Research, 2301 Crosby Road, Wayzata, MN 55391 * CORRESPONDING AUTHOR Prof. William A. Goddard III California Institute of Technology MC 139-74, 1200 E. California Blvd., Pasadena, CA 91125; phone: 1-626-395-2731, e-mail: [email protected] Dr. Soo-Kyung Kim phone: 1-626-395-2724, e-mail: [email protected] 1 RESULTS Structures for Allosteric ligand bound at the TMD of all three TAS1Rs As described in the METHODS section, the DarwinDock procedure (1) involves sampling ~50,000 poses for each of ~10 diverse ligand conformations from which, we select finally two energetically favorable binding poses based on two scoring methods: UCav E: unified cavity energy for which we consider that interactions of the best 100 poses with the union of all residues involve in their separate binding sites (providing a uniform comparison) BE: snap binding energy considering all interactions of ligand with protein As a first validation of the predicted structures for the 7 helix TMD, we used DarwinDock to predict the binding site for the allosteric ligands to each TAS1R TMD in Table S10. Here we find, S819 [1-((1H-pyrrol-2-yl)methyl)-3-(4-isopropoxyphenyl)thiourea] is a sweet compound that interacts with the TAS1R2 TMD.(2) and Lactisole is a competitive inhibitor of the sweet taste receptor that binds to TAS1R3 TMD.(3, 4) These structures were further relaxed through annealing.
    [Show full text]
  • Dimers of Serotonin Receptors: Impact on Ligand Affinity and Signaling
    Dimers of serotonin receptors: impact on ligand affinity and signaling Luc Maroteaux, Catherine Béchade, Anne Roumier To cite this version: Luc Maroteaux, Catherine Béchade, Anne Roumier. Dimers of serotonin receptors: impact on ligand affinity and signaling. Biochimie, Elsevier, 2019, 161, pp.23-33. 10.1016/j.biochi.2019.01.009. hal- 01996206 HAL Id: hal-01996206 https://hal.archives-ouvertes.fr/hal-01996206 Submitted on 28 Jan 2019 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Maroteaux et al., 1 Dimers of serotonin receptors: impact on ligand affinity and signaling. Luc Maroteaux1,2,3, Catherine Béchade1,2,3, and Anne Roumier1,2,3 Affiliations: 1: INSERM UMR-S839, S1270, Paris, 75005, France; 2Sorbonne Université, Paris, 75005, France; 3Institut du Fer à Moulin, Paris, 75005, France. Running title: Dimers of serotonin receptors Correspondence should be addressed to: Luc Maroteaux INSERM UMR-S839, S1270, 17 rue du Fer a Moulin Paris, 75005, France; E-mail : [email protected] Abstract Membrane receptors often form complexes with other membrane proteins that directly interact with different effectors of the signal transduction machinery. G-protein-coupled receptors (GPCRs) were for long time considered as single pharmacological entities.
    [Show full text]
  • (Rs12033832) and Sweet Taste Perception Amongst Malay Obese and Non- Obese Subjects Ahmad Riduan Bahauddin1, Nazamid Shaari2, Zalilah Mohd Shariff3, Roselina Karim2
    Malaysian Journal of Medicine and Health Sciences (eISSN 2636-9346) ORIGINAL ARTICLE Association Between TAS1R2 Gene Polymorphism (rs12033832) and Sweet Taste Perception Amongst Malay Obese and Non- obese Subjects Ahmad Riduan Bahauddin1, Nazamid Shaari2, Zalilah Mohd Shariff3, Roselina Karim2 1 Faculty of Food Science and Nutrition, Universiti Malaysia Sabah, Jln. UMS, 88400 Kota Kinabalu, Sabah, Malaysia 2 Department of Food Technology, Faculty of Food Science and Technology, Universiti Putra Malaysia, 43000, Serdang, Selangor, Malaysia 3 Department of Nutrition and Dietetics, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, 43000 Serdang, Selangor, Malaysia ABSTRACT Introduction: A growing evidence supported that variation of sweet taste perception, mediated by TAS1Rs gene variants could lead to excess sweetened food and beverages intake and also obesity. However, obesity development may also alter individuals' taste sensitivity and perception. Thus, it is best to further investigate whether or not the individuals' sweet taste sensitivity and acceptance are associated with variation in TAS1R2 gene and Body Mass Index (BMI) status. Methods: This comparison cross sectional study comprised of 88 obese and 92 non-obese subjects aged 20-45. All the subjects were genotyped for TAS1R2 gene variant at rs12033832 using polymerase chain reaction – restriction fragment length polymorphism (PCR-RFLP). Suprathreshold sensitivity for sweet taste was assessed using general Labeled Magnitude Scales. Intensity rating and hedonic test were carried out on 2 food samples (tea drink and rose flavoured agar) to examine subject's intensity rating and liking at different sugar contents. Results: Our re- sults showed that rs12033832 of TAS1R2 gene is associated with sweet taste perception among obese and non-obese subjects.
    [Show full text]
  • G Protein-Coupled Receptors
    S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2015/16: G protein-coupled receptors. British Journal of Pharmacology (2015) 172, 5744–5869 THE CONCISE GUIDE TO PHARMACOLOGY 2015/16: G protein-coupled receptors Stephen PH Alexander1, Anthony P Davenport2, Eamonn Kelly3, Neil Marrion3, John A Peters4, Helen E Benson5, Elena Faccenda5, Adam J Pawson5, Joanna L Sharman5, Christopher Southan5, Jamie A Davies5 and CGTP Collaborators 1School of Biomedical Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK, 2Clinical Pharmacology Unit, University of Cambridge, Cambridge, CB2 0QQ, UK, 3School of Physiology and Pharmacology, University of Bristol, Bristol, BS8 1TD, UK, 4Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK, 5Centre for Integrative Physiology, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2015/16 provides concise overviews of the key properties of over 1750 human drug targets with their pharmacology, plus links to an open access knowledgebase of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties. The full contents can be found at http://onlinelibrary.wiley.com/doi/ 10.1111/bph.13348/full. G protein-coupled receptors are one of the eight major pharmacological targets into which the Guide is divided, with the others being: ligand-gated ion channels, voltage-gated ion channels, other ion channels, nuclear hormone receptors, catalytic receptors, enzymes and transporters. These are presented with nomenclature guidance and summary information on the best available pharmacological tools, alongside key references and suggestions for further reading.
    [Show full text]
  • Characterization of Gonadotropin Receptors Fshr And
    General and Comparative Endocrinology 285 (2020) 113276 Contents lists available at ScienceDirect General and Comparative Endocrinology journal homepage: www.elsevier.com/locate/ygcen Characterization of gonadotropin receptors Fshr and Lhr in Japanese T medaka, Oryzias latipes Susann Burowa, Naama Mizrahib,1, Gersende Maugarsa,1, Kristine von Krogha, Rasoul Nourizadeh-Lillabadia, Lian Hollander-Cohenb, Michal Shpilmanb, Ishwar Atreb, ⁎ ⁎ Finn-Arne Weltziena, , Berta Levavi-Sivanb, a Department of Basic Sciences and Aquatic Medicine, Faculty of Veterinary Medicine, Norwegian University of Life Sciences, 0454 Oslo, Norway b Department of Animal Sciences, Faculty of Agriculture, Food and Environment, The Hebrew University, Rehovot 76100, Israel ARTICLE INFO ABSTRACT Keywords: Reproduction in vertebrates is controlled by the brain-pituitary-gonad axis, where the two gonadotropins fol- Follicle-stimulating hormone licle-stimulating hormone (Fsh) and luteinizing hormone (Lh) play vital parts by activating their cognate re- Follicle-stimulating hormone receptor ceptors in the gonads. The main purpose of this work was to study intra- and interspecies ligand promiscuity of Luteinizing hormone teleost gonadotropin receptors, since teleost receptor specificity is unclear, in contrast to mammalian receptors. Luteinizing hormone receptor Receptor activation was investigated by transfecting COS-7 cells with either Fsh receptor (mdFshr, tiFshr) or Lh Protein structure receptor (mdLhr, tiLhr), and tested for activation by recombinant homologous and heterologous ligands Receptor-ligand interaction Transactivation assay (mdFshβα, mdLhβα, tiFshβα, tiLhβα) from two representative fish orders, Japanese medaka (Oryzias latipes, Beloniformes) and Nile tilapia (Oreochromis niloticus, Cichliformes). Results showed that each gonadotropin preferentially activates its own cognate receptor. Cross-reactivity was detected to some extent as mdFshβα was able to activate the mdLhr, and mdLhβα the mdFshr.
    [Show full text]
  • Human Taste Thresholds Are Modulated by Serotonin and Noradrenaline
    12664 • The Journal of Neuroscience, December 6, 2006 • 26(49):12664–12671 Behavioral/Systems/Cognitive Human Taste Thresholds Are Modulated by Serotonin and Noradrenaline Tom P. Heath,1 Jan K. Melichar,2 David J. Nutt,2 and Lucy F. Donaldson1 1Department of Physiology and 2Psychopharmacology Unit, University of Bristol, Bristol BS8 1TD, United Kingdom Circumstances in which serotonin (5-HT) and noradrenaline (NA) are altered, such as in anxiety or depression, are associated with taste disturbances, indicating the importance of these transmitters in the determination of taste thresholds in health and disease. In this study, we show for the first time that human taste thresholds are plastic and are lowered by modulation of systemic monoamines. Measurement of taste function in healthy humans before and after a 5-HT reuptake inhibitor, NA reuptake inhibitor, or placebo showed that enhancing 5-HT significantly reduced the sucrose taste threshold by 27% and the quinine taste threshold by 53%. In contrast, enhancing NA significantly reduced bitter taste threshold by 39% and sour threshold by 22%. In addition, the anxiety level was positively correlated with bitter and salt taste thresholds. We show that 5-HT and NA participate in setting taste thresholds, that human taste in normal healthy subjects is plastic, and that modulation of these neurotransmitters has distinct effects on different taste modalities. We present a model to explain these findings. In addition, we show that the general anxiety level is directly related to taste perception, suggesting that altered taste and appetite seen in affective disorders may reflect an actual change in the gustatory system.
    [Show full text]
  • Multi-Functionality of Proteins Involved in GPCR and G Protein Signaling: Making Sense of Structure–Function Continuum with In
    Cellular and Molecular Life Sciences (2019) 76:4461–4492 https://doi.org/10.1007/s00018-019-03276-1 Cellular andMolecular Life Sciences REVIEW Multi‑functionality of proteins involved in GPCR and G protein signaling: making sense of structure–function continuum with intrinsic disorder‑based proteoforms Alexander V. Fonin1 · April L. Darling2 · Irina M. Kuznetsova1 · Konstantin K. Turoverov1,3 · Vladimir N. Uversky2,4 Received: 5 August 2019 / Revised: 5 August 2019 / Accepted: 12 August 2019 / Published online: 19 August 2019 © Springer Nature Switzerland AG 2019 Abstract GPCR–G protein signaling system recognizes a multitude of extracellular ligands and triggers a variety of intracellular signal- ing cascades in response. In humans, this system includes more than 800 various GPCRs and a large set of heterotrimeric G proteins. Complexity of this system goes far beyond a multitude of pair-wise ligand–GPCR and GPCR–G protein interactions. In fact, one GPCR can recognize more than one extracellular signal and interact with more than one G protein. Furthermore, one ligand can activate more than one GPCR, and multiple GPCRs can couple to the same G protein. This defnes an intricate multifunctionality of this important signaling system. Here, we show that the multifunctionality of GPCR–G protein system represents an illustrative example of the protein structure–function continuum, where structures of the involved proteins represent a complex mosaic of diferently folded regions (foldons, non-foldons, unfoldons, semi-foldons, and inducible foldons). The functionality of resulting highly dynamic conformational ensembles is fne-tuned by various post-translational modifcations and alternative splicing, and such ensembles can undergo dramatic changes at interaction with their specifc partners.
    [Show full text]