Genetic Diversity of Bitter Taste Receptor Gene Family in Sichuan Domestic and Tibetan Chicken Populations

c Indian Academy of Sciences

RESEARCH ARTICLE

Genetic diversity of bitter taste receptor gene family in Sichuan domestic and Tibetan chicken populations

YUAN SU, DIYAN LI, UMA GAUR, YAN WANG, NAN WU, BINLONG CHEN, ZHONGXIAN XU, HUADONG YIN, YAODONG HU and QING ZHU∗

Farm Animal Genetic Resources Exploration and Innovation Key Laboratory of Sichuan Province, Sichuan Agricultural University, Chengdu 611130, People’s Republic of China

Abstract The sense of bitter taste plays a critical role in animals as it can help them to avoid intake of toxic and harmful substances. Previous research had revealed that chicken has only three bitter taste receptor genes (Tas2r1, Tas2r2 and Tas2r7). To better understand the genetic polymorphisms and importance of bitter taste receptor genes (Tas2rs) in chicken, here, we sequenced Tas2rs of 30 Sichuan domestic chickens and 30 Tibetan chickens. Thirteen single-nucleotide polymorphisms (SNPs) including three nonsynonymous mutations (m.359G>C, m.503C>A and m.583A>G) were detected in Tas2r1 (m. is the abbreviation for mutation); three SNPs were detected in Tas2r2, but none of them were missense mutation; eight SNPs were detected in Tas2r7 including six nonsynonymous substitutions (m.178G>A, m.421A>C, m.787C>T, m.832G>T, m.907A>Tand m.943G>A). Tajima’s D neutral test indicates that there is no population expansion in both populations, and the size of the population is relatively stable. All the three networks indicate that red jungle fowls share haplotypes with domestic chickens. In addition, we found that haplotypes H1 and HE1 were positively associated with high-altitude adaptation, whereas haplotypes H4 and HE4 showed a negative correlation with high-altitude adaptation in Tas2rs. Although, chicken has only three Tas2rs, our results showed that both Sichuan domestic chickens and Tibetan chickens have abundant haplotypes in Tas2rs, especially in Tas2r7, which might help chickens to recognize a wide variety of bitter-tasting compounds.

[Su Y., Li D., Gaur U., Wang Y., Wu N., Chen B., Xu Z., Yin H., Hu Y. and Zhu Q. 2016 Genetic diversity of bitter taste receptor gene family in Sichuan domestic and Tibetan chicken populations. J. Genet. 95, 675–681]

Introduction be affected by the important roles of Tas2rs in avoiding generally bitter, toxic and harmful substances (Go et al. 2005). Mammals can distinguish five basic tastes: sour, sweet, Most of the previous bitter taste receptor studies focussed umami, bitter and salty (Kinnamon and Cummings 1992; on mammals, such as humans (Hayes et al. 2011; Campa Lindemann 1996). Of them, bitter taste is a critical nat- et al. 2012; Behrens and Meyerhof 2013), western chim- ural defense preventing the ingestion of toxic or harmful panzees (Sugawara et al. 2011), bats (Hong and Zhao 2014) substances, which are typically bitter in nature (Garcia and and whales (Feng et al. 2014). Birds are believed to be poor Hankins 1975; Glendinning 1994). It provides extremely tasters, previous study found only three Tas2rs in chicken, important sensory information for animals, and can help in comparison to 10–69 in mammals. Molecular evidence identify toxic substances and maintain nutritional balance. showed that three basic tastes (sweet, umami and bitter) are While compared with mammals, there are only four kinds dispensable in penguins (especially in adelie and emperor of taste receptor genes (bitter, umami, sour and salty) in penguins) (Zhao et al. 2015). A recent study showed that her- chickens (Roura et al. 2013). Previous studies showed that bivorous and insectivorous birds may need more functional bitter tastants bind to bitter taste receptor (Tas2rs) and trig- Tas2rs than carnivorous birds feeding on noninsect animals ger the bitter taste signal transduction pathway (Mueller et al. (Wang and Zhao 2015). Until now, no significant progress 2005; Chandrashekar et al. 2006; Behrens et al. 2007). The has been made in the research of genetic polymorphisms of behaviour of animals, especially the feeding behaviour, could Tas2rs in chickens. Tibetan chicken (TC) (Gallus gallus), as a specific and ∗ For correspondence. E-mail: [email protected]. native breed, mainly distributed in Qinghai, Tibet Plateau, at Yuan Su and Diyan Li contributed equally to this work. an altitudes between 2200 and 4100 meters (Liu 2004), and

Keywords. polymorphisms; bitter taste receptor; Sichuan domestic chicken; Tibetan chicken.

Journal of Genetics, DOI 10.1007/s12041-016-0684-4, Vol. 95, No. 3, September 2016 675 Yuan Su et al. has adapted to hypoxia and low air pressure in harsh environ- Table 1. The primers information used in the study. ment (Li and Zhao 2009). Compared to domestic chickens, they have unique physiological and genetic adaptations, such Product Gene Primer sequences (5→3) T (◦C) length as remarkable adaptability to the speciﬁc natural environ- m ment of frigid temperature, decreased air pressure and rare Tas2r1 TCATGCGATGGGAACATCTA 59.0 1080 oxygen, strong disease resistance, excellent meat taste with TGGATCTCAACTGGAAAGAGC high nutritional value and high medicinal value of its eggs Tas2r2 AAACAGGCAGAAGTGACCAGA 63.3 1043 (Wideman et al. 2002). However, the size of the TC popu- GGTGAAACAAGAAGTGCATGA lation is decreasing drastically, and is under increasing pres- Tas2r7 AGCCCGACAGAGTTTCACA 59.0 1413 CAGCAGGTGGCAGAATCAC sure from the introgression of modern, commercial breeds because of its poor laying performance and high frequency of broodiness (Xu et al. 2005). Therefore, investigations on cochin-Chinese red jungle fowl (G. g. gallus,GenBank the genetic variability of the TC populations are becoming accession numbers: AB249766.1, AB249767.1, AB249768.1) increasingly important. Here, to explore the genetic polymor- was used as the reference sequence for determining the vari- phisms and importance of Tas2rs in chicken, we sequenced able sites of chicken Tas2r1, Tas2r2 and Tas2r7 sequences, Tas2rs in 30 Sichuan domestic chickens (DC) and 30 TC. respectively. The haplotypes were generated using DnaSP V5 software (Librado and Rozas 2009). A median-joining network analysis was performed by using the program Net- Materials and methods work 4 (http://www.ﬂuxus-engineering.com/sharenet.htm).

Sampling and DNA extraction Statistical analysis Sixty chickens were used in this study. Fifteen male and 15 female DC (Sichuan Jiuyuan black-chicken strain) from the We considered DC as one population (without high-altitude chicken breeding farm of Sichuan Agricultural University at adaptation) and TC as another population (with high-altitude low attitude areas (≈600 m) were sampled; and 15 male and adaptation). The haplotype diversity and nucleotide diversity 15 female TC were sampled from the domestic conservation were analysed using DnaSP V5 software (Librado and Rozas farms in Xiangcheng, Batang Counties of Ganzi, Sichuan 2009). Statistical difference in the allele frequencies and hap- Province, China (≈3100 m). Blood samples were collected lotype frequencies of Tas2r1, Tas2r2 and Tas2r7 in DC and ◦ from wing vein and stored at −20 C until DNA extraction. TC populations were analysed using Pearson chi-square test, The whole genomic DNA was extracted by salt-extraction P < 0.05 was regarded as statistical signiﬁcance. method (Miller et al. 1988). No chicken was injured or slaughtered accidentally in the process of sampling. Results

DNA amplification and sequencing Haplotype and nucleotide diversities of Tas2rs in DC and TC Primer pairs used in this study are shown in table 1. The populations primer pairs flanking the gene sequences were designed Number of haplotypes, haplotype diversity (Hd), average using Primer 3 software (ver. 0.4.0). A total of 50 μLof number of differences (K), nucleotide diversity (Pi) and reaction volume was amplified, including 100–150 ng DNA Tajima’s D values of Tas2r1, Tas2r2 and Tas2r7 are summa- template, 5 μL10× buffer, 25 mM MgCl2,2.5mMdNTP rized in table 2. For Tas2r7, TC has greater genetic diversity mixture, 2 mM of each primer, 1.25 U Taq polymerase than DC. In Tas2r1, Tas2r2 and Tas2r7, Tajima’s D values (Takara, Dalian, China) using the standard PCR programme. had no significant difference (P > 0.10) between DC and The PCR amplification programme is as follows: initial TC populations. The result indicates that these two popula- ◦ denaturation at 95 Cfor4min,followedby34cyclesof tions are in accordance with neutral mutation. There is no ◦ ◦ ◦ 94 C for 40 s, annealing at 59.0–63.3 C for 40 s, 72 Cfor population expansion in both populations, and the size of the ◦ 90 s, and a final extension at 72 C for 10 min. PCR prod- population is relatively stable. ucts were checked on 1.5% agarose gel and the purified PCR products were directly sequenced in both directions. Sequence variations in Tas2rs The Tas2r1 sequences were trimmed to 891 bp for all 60 Analysis of sequences samples; no insertions/deletions were detected. A total of The raw sequences were edited and aligned using DNAstar 13 SNPs were identified in Tas2r1. The observed allele (DNAstar Inc., Madison, USA). Sequence variations includ- frequencies of Tas2r1 in each polymorphic site between DC ing variable sites and conserved sites were identified using and TC populations are shown in table 3. Three nonsynony- MEGA 5.0 (Tamura et al. 2011). The genome sequence of mous mutations (m.359G>C, m.503C>A and m.583A>G)

676 Journal of Genetics, Vol. 95, No. 3, September 2016 Genetic diversity of chicken Tas2r2

Table 2. Genetic diversity parameters of Tas2r1, Tas2r2 and Tas2r7 in DC and TC populations.

Tas2r1 Tas2r2 Tas2r7 Population DC TC DC TC DC TC

Number of variable sites 10 13 2 3 7 6 Number of haplotypes 11 14 3 5 8 11 Haplotype diversity (Hd) 1.000 0.908 0.333 0.434 0.540 0.870 Average number of differences (K) 3.564 4.710 0.344 0.462 1.148 1.889 Nucleotide diversity (Pi) 0.3564 0.0053 0.0004 0.0005 0.0014 0.0023 Tajima’s D 0.1864 1.4671 −0.6342 −1.3699 −1.0868 0.6536

DC, Sichuan domestic chicken; TC, Tibetan chicken.

Table 3. Distribution of SNPs in Tas2r1, Tas2r2 and Tas2r7 in DC and TC populations.

Tas2r1 Tas2r2 Tas2r7 Allele Allele Allele Allele Allele Allele SNP frequency frequency SNP frequency frequency SNP frequency frequency position Allele in DC (%) in TC (%) position Allele in DC (%) in TC (%) position Allele in DC (%) in TC (%)

9 T 100.0 96.7 585 A 100.0 96.7 178 G 96.3 100.0 C 0.0 3.3 G 0.0 3.3 A 3.7 0.0 201* C 100.0 73.3 885* C 86.7 100 195 C 96.3 100.0 T 0.0 26.7 G 13.3 0.0 T 3.7 0.0 285* T 16.7 53.3 887 G 96.7 83.3 399 A 100 88.9 C 83.3 46.7 C 3.3 16.7 C 0.0 11.1 300* T 96.7 66.7 421* A 81.5 48.1 A 3.3 33.3 C 18.5 51.9 321 T 30.0 43.3 787 C 100 96.3 C 70.0 56.7 T 0.0 3.7 359 G 6.7 10.0 832 G 100.0 92.6 C 93.3 90.0 T 0.0 7.4 465 A 100 93.3 907* A 85.2 48.1 T 0.0 6.7 T 14.8 51.9 474* C 86.7 63.3 943* G 81.5 22.2 T 13.3 36.7 A 18.5 77.8 503* C 26.7 56.7 A 73.3 43.3 582* A 96.7 80.0 G 3.3 20.0 583* A 96.7 80.0 G 3.3 20.0 720* C 33.3 80.0 T 66.7 20.0 843* T 86.7 63.3 C 13.3 36.7

The significance of the allele frequency was tested with Pearson chi-square test. *Significant difference (P < 0.05) between DC and TC populations. DC, Sichuan domestic chicken; TC, Tibetan chicken. and 10 synonymous substitutions (m.9T>C, m.201C>T, both the populations. Distribution of eight SNPs (m.285T> m.285T>C, m.300T>A, m.321T>C, m.465A>T, m.474C> C, m.300T>A, m.474C>T, m.503C>A, m.582A>G, T, m.582A>G, m.720C>T and m.843T>C) were found in m.583A>G, m.720C>T and m.843T>C) were significantly Tas2r1 (m. is the abbreviation for mutation). Three SNPs different (P < 0.05) between both the populations. (m.9T>C, m.201C>T and m.465A>T) were detected Sixty Tas2r2 sequences were truncated into 903 bp; no uniquely in TC population with allele frequencies of 3.3, insertions/deletions were detected. In total, three SNPs were 26.7 and 6.7%, respectively. The other 10 SNPs (m.285T>C, found in Tas2r2. Table 3 shows the observed allele frequen- m.300T>A, m.321T>C, m.359G>C, m.474C>T, m.503C> cies of Tas2r2 in each polymorphic site between DC and TC A, m.582A>G, m.583A>G, m.720C>T and m.843T>C) populations. There were only three synonymous mutations were observed in both the populations. Pearson chi-square (m.585A>G, m.885G>C and m.887G>C) found in Tas2r2. test results showed that distribution of SNP (m.201C>T) In TC population, distribution of one SNP (m.585A>G) only in TC was significantly different (P < 0.05) between was detected uniquely with the allele frequency of 3.3%. In

Journal of Genetics, Vol. 95, No. 3, September 2016 677 Yuan Su et al.

DC population, distribution of one SNP (m.885G>C) was networks indicate that red jungle fowls share haplotypes with detected uniquely with the allele frequency of 13.3%. One domestic chickens. SNP (m.887G>C) was shared in both the populations. Pear- son chi-square test result showed that the distribution of Haplotype analysis in Tas2rs SNP (m.885G>C) only in DC was significantly different There were 19 (H1–H19), five (HA1–HA5) and 13 (HE1– (P < 0.05) between two populations. The other two SNPs HE13) haplotypes detected in Tas2r1, Tas2r2 and Tas2r7, distribution (m.585A>G and m.887G>C) showed no signif- respectively (table 4). All 37 haplotypes (H1–H37) were icant difference (P > 0.05). submitted to GenBank (accession numbers: KT377134– The whole length of Tas2r7 sequences were truncated into KT377170). 816 bp; no insertions/deletions were detected. In Tas2r7, a total of eight SNPs were discovered. Table 3 shows the observed allele frequencies of Tas2r7 in each polymor- Association between haplotype distribution and high-altitude phic site between DC and TC populations. There were two adaptation synonymous mutations (m.195C>T and m.399C>A) and After examining the level of significance by Pearson chi- six nonsynonymous substitutions (m.178G>A, m.421A>C, square test, we found that haplotypes H1 and H4 were signif- m.787C>T, m.832G>T, m.907A>T and m.943G>A) icantly associated with high-altitude adaptation in Tas2r1 at detected in Tas2r7. Two SNPs (m.178G>A and m.195C>T) 0.05 level (table 4). Specially, haplotype H1 was positively distributed uniquely in DC population with the allele fre- associated with high-altitude adaptation (P value, 6.81 × quency of 3.7%. In TC population, three SNPs (m.399C>A, 10−5; OR, 4.750; 95% CI, 2.587–8.721), whereas haplotype m.787C>T and m.832G>T) distributed uniquely with the H4 showed a negative correlation with high-altitude adap- allele frequency of 11.1, 3.7 and 7.4%, respectively. The tation (P value, 0.0443; OR, 0.167; 95% CI, 0.056–0.516); distribution of other three SNPs (m.421A>C, m.907A>T In Tas2r2, we found that there is no haplotype significantly and m.943G>A) were shared in both the populations. Only associated with high-altitude adaptation at the 0.05 level distribution of three SNPs (m.421A>C, m.907A>Tand (table 4). In Tas2r7, we found that haplotypes HE1 and HE4 m.943G>A) was significantly different (P < 0.05) between were significantly associated with high-altitude adaptation both the populations. at 0.05 level (table 4). Haplotype HE1 was positively associated with high-altitude adaptation (P value, 9.37 × 10−6; OR, 6.333; 95% CI, 3.213–12.465), whereas haplotype HE4 showed a negative correlation with high-altitude adaptation Median-joining network of haplotypes (P value, 0.0495; OR, 0.333; 95% CI, 0.101–1.077). The median-joining network of bitter taste receptor genes were constructed using the 19, 5 and 13 haplotypes of Tas2r1, Discussion Tas2r2 and Tas2r7, respectively (figure 1). For Tas2r1,haplotypes H2, H3, H9, H11, H12, H16, H18 and H19 were Bitter taste receptors (Tas2rs) are G-protein-coupled receptors unique to TC and haplotypes H6, H10, H14, H15 and H17 (GPCR), which are characterized by their seven conserved were unique to DC. For Tas2r2, haplotypes HA1 and HA4 transmembrane regions (Striem et al. 1989), and they are were shared by both TC and DC populations. All three coded by the Tas2rs that are intronless genes (Adler et al. 2000;

Figure 1. Median-joining network of bitter taste receptor genes haplotypes (a–c represent Tas2r1, Tas2r2 and Tas2r7, respectively). Red jungle fowl (G. g. gallus), TC and DC were represented with black, grey and white, respectively. Circle sizes are proportional to haplotype frequencies. Black nodes indicate inferred steps not found in the sampled populations. The link lines between nodes are proportional to the mutation steps.

678 Journal of Genetics, Vol. 95, No. 3, September 2016 Genetic diversity of chicken Tas2r2 1, > 0.05) on 95% CIs (conﬁdence < P 1, haplotype is not associated with high-altitude adaptation; OR = value is calculated using Pearson chi-square test, *Signiﬁcant difference ( P haplotypes on high-altitude adaptation. Tas2r1 Tas2r2 Tas2r7 1 means a haplotype may be negatively associated with high-altitude adaptation; OR < Tas2rs Distribution Distribution Distribution Distribution Distribution Distribution Effect of Table 4. H1*H2*H3H4*H5 63.33H6 0.00H7 0.00H8 13.33 3.33H9 20.00 4.750 3.33H10 2.587–8.721 6.67H11 6.67 20.00 3.33H12 – HA1 3.33H13 0.167 3.33 0.00 0.056–0.516H14 – 0.00 3.33H15 83.33 1.000 3.33 0.00 – HA4 0.238–4.211 10.00H16 0.00H17 – 1.000 3.33 3.33 – HA5 0.333 0.238–4.211 0.00H18 76.67 0.101–1.077 3.33 3.33 3.33H19 HA2 3.33 1.087 3.33 – 0.00 – – 0.775–1.534 0.00 3.33 HA3* 3.33 – 0.00 16.67 HE1* 0.00 – 0.00 1.000 0.00 0.238–4.211 0.00 – 13.33 0.200 3.33 – 3.33 0.065-1.623 – 70.37 0.00 – – 3.33 3.33 – HE4* – – 3.33 0.00 – 11.11 – – – 11.11 – – 6.333 – – 3.213–12.465 – – 33.33 – – – – 0.333 HE5 0.101–1.077 HE2 HE3 3.70 3.70 0.00 11.11 HE7 0.333 HE8 0.00 0.101–1.077 3.70 – 0.00 3.70 – HE6 HE13 7.41 – 0.00 HE9 3.70 – HE10 0.00 HE11 – – HE12 0.00 11.11 0.00 3.70 3.70 0.333 0.00 – – 0.101–1.077 3.70 7.41 – 3.70 3.70 – – 1.000 – 0.238–4.211 – – – – intervals) between DC and TC populations. Frequency in DC (%), frequency of haplotypes in DC. Frequency in TC (%), frequency of haplotypes in TC. Haplotype in DC (%) in TC (%) OR 95% CIs Haplotype in DC (%) in TC (%) OR 95% CIs Haplotype in DC (%) in TC (%) OR 95% CIs haplotype may be positively associated with high-altitude adaptation. The OR, odds ratio; OR

Journal of Genetics, Vol. 95, No. 3, September 2016 679 Yuan Su et al.

Chandrashekar et al. 2000; Matsunami et al. 2000). Bitter of China (NSFC31160432) and Sichuan Provincial Department of generally means that it is poisonous in nature (Garcia and Science and Technology Programme (2015JQO023). Hankins 1975; Glendinning 1994). The bitter taste recogni- tion as a defense mechanism can effectively help animals References to avoid intake of toxic substances. In addition, it plays a very important role in the process of evolution. These Adler E., Hoon M. A., Mueller K. L., Chandrashekar J., Ryba gustatory senses are closely concerned with an animal’s N. J. P. and Zuker C. S. 2000 A novel family of mammalian taste diet and external environments (Glendinning et al. 1999; receptors. Cell 100, 693–702. Chandrashekar et al. 2000). The genetic variation in taste Behrens M., Foerster S., Staehler F., Raguse J.-D. and Meyerhof receptors may account for differences in food choices and W. 2007 Gustatory expression pattern of the human TAS2R bitter receptor gene family reveals a heterogenous popula- dietary habits (Garcia-Bailo et al. 2009). The genetics of tion of bitter responsive taste receptor cells. J. Neurosci. 27, taste sensitivity appears as an innovative field of research to 12630–12640. enlarge current knowledge on the subject and it has not been Behrens M. and Meyerhof W. 2013 Bitter taste receptor research studied so far in chickens, although relation between saliva comes of age: from characterization to modulation of TAS2Rs. proteome and taste sensitivity have already been pointed out Semin. Cell Dev. Biol. 24, 215–221. (Fan and Yao 2011). Through using Ca2+ imaging, Kudo Campa D., De Rango F., Carrai M., Crocco P., Montesanto A., Canzian F. et al. 2012 Bitter taste receptor polymorphisms and et al. 2014 observed that the taste buds’ response to 2 human aging. PLoS One 7, e45232. mmol/L quinine hydrochloride (a bitter substance). It turned Chandrashekar J., Mueller K. L., Hoon M. A., Adler E., Feng L., out that the isolated taste buds were intact and functional Guo W. et al. 2000 T2Rs function as bitter taste receptors. Cell approaches for examining the taste senses of the chicken, 100, 703–711. and Ca2+ imaging technology can be informative in detect- Chandrashekar J., Hoon M. A., Ryba N. J. and Zuker C. S. 2006 The receptors and cells for mammalian taste. Nature 444, 288–294. ing responses of taste buds (Kudo et al. 2014). Hirose et al. Espaillat J. E. and Mason J. R. 1990 Differences in taste preference (2015) reported a new agonist (dextromethorphan hydrochlo- between red-winged blackbirds and European starlings. Wilson ride) of Tas2r1, they found that the activities of Tas2r1 ago- Bull. 102, 292–299. nists were linked to aversive behaviour in chickens by using Fan L. and Yao Y. G. 2011 MitoTool: a web server for the analysis the biosensor detection. These studies suggested important and retrieval of human mitochondrial DNA sequence variations. Mitochondrion 11, 351–356. roles for Tas2rs of chicken in recognizing bitter compounds. Feng P., Zheng J., Rossiter S. J., Wang D. and Zhao H. 2014 Mas- Here, we investigated the SNPs and haplotypes of sive losses of taste receptor genes in toothed and baleen whales. Tas2r1, Tas2r2 and Tas2r7, and discussed the haplotype and Genome Biol. Evol. 6, 1254–1265. nucleotide diversities of bitter taste receptor genes in DC Garcia-Bailo B., Toguri C., Eny K. M. and El-Sohemy A. 2009 and TC populations. Thirteen, three and eight SNPs were Genetic variation in taste and its influence on food selection. OMICS 13, 69–80. detected in Tas2r1, Tas2r2 and Tas2r7, respectively. All three Garcia J. and Hankins W. G. 1975 The evolution of bitter and networks indicate that red jungle fowls share haplotypes with the acquisition of toxiphobia. In Olfaction and taste (ed. D. A. domestic chickens. In addition, we discovered that haplo- Denton and J. P. Coghlan), vol 5, pp. 39–45. Academic Press, types H1 and HE1 were positively associated with high- New York, USA. altitude adaptation, whereas haplotypes H4 and HE4 showed Glendinning J. 1994 Is the bitter rejection response always adap- tive? Physiol. Behav. 56, 1217–1227. a negative correlation with high-altitude adaptation in Tas2rs. Glendinning J. I., Tarre M. and Asaoka K. 1999 Contribution of The results will provide a theoretical basis for the hypoxia different bitter-sensitive taste cells to feeding inhibition in a adaptability in the TC and may contribute to the ongoing caterpillar (Manduca sexta). Behav. Neurosci. 113, 840–854. studies on the adaptation to hypoxia in Tas2rs. Go Y., Satta Y., Takenaka O. and Takahata N. 2005 Lineage-specific Previous research had revealed that compared with loss of function of bitter taste receptor genes in humans and nonhuman primates. Genetics 170, 313–326. humans, domestic chickens only have three bitter taste recep- Hayes J. E., Wallace M. R., Knopik V. S., Herbstman D. M., tor genes (Tas2rs), including Tas2r1, Tas2r2, Tas2r7 (Hillier Bartoshuk L. M. and Duffy V. B. 2011 Allelic variation in TAS2R et al. 2004; Li and Zhang 2014). In addition, compared with bitter receptor genes associates with variation in sensations from mammals, chickens have relatively less taste bud cells and and ingestive behaviors toward common bitter beverages in poor saliva secretion. However, this kind of defect did not adults. Chem. Senses 36, 311–319. Hillier L. D., Miller W., Birney E., Warren W., Hardison R. C., affect the ability of chickens to feel the bitterness effectively Ponting C. P. et al. 2004 Sequence and comparative analysis of (Espaillat and Mason 1990). Our results found that both DC the chicken genome provide unique perspectives on vertebrate and TC populations have abundant haplotypes in Tas2rs, evolution. Nature 432, 695–716. especially in Tas2r7 and this haplotype and nucleotide diver- Hirose N., Kawabata Y., Kawabata F., Nishimura S. and Tabata sities might help chickens to recognize a wide variety of S. 2015 Bitter taste receptor T2R1 activities were compatible with behavioral sensitivity to bitterness in chickens. Biochem. bitter-tasting compounds. Biophys. Res. 460, 464–468. Hong W. and Zhao H. 2014 Vampire bats exhibit evolutionary Acknowledgements reduction of bitter taste receptor genes common to other bats. P. R. Soc. London, B. Biol. 281, 20141079. This study was supported by the programme from Sichuan Agricul- Kinnamon S. C. and Cummings T. A. 1992 Chemosensory trans- tural University (02920400); National Natural Science Foundation duction mechanisms in taste. Annu. Rev. Physiol. 54, 715–731.

680 Journal of Genetics, Vol. 95, No. 3, September 2016 Genetic diversity of chicken Tas2r2

Kudo K., Kawabata F., Nomura T., Aridome A., Nishimura S. and Roura E., Baldwin M. W. and Klasing K. C. 2013 The avian taste Tabata S. 2014 Isolation of chicken taste buds for real-time Ca2+ system: potential implications in poultry nutrition. Anim. Feed imaging. Anim. Sci. J. 85, 904–909. Sci. Tech. 180, 1–9. Li D. and Zhang J. 2014 Diet shapes the evolution of the verte- Striem B., Pace U., Zehavi U., Naim M. and Lancet D. 1989 Sweet brate bitter taste receptor gene repertoire. Mol. Biol. Evol. 31, tastants stimulate adenylate cyclase coupled to GTP-binding 303–309. protein in rat tongue membranes. Biochem. J. 260, 121–126. Li M. and Zhao C. 2009 Study on Tibetan chicken embryonic Sugawara T., Go Y., Udono T., Morimura N., Tomonaga M., Hirai adaptability to chronic hypoxia by revealing differential gene H. et al. 2011 Diversiﬁcation of bitter taste receptor gene family expression in heart tissue. Sci. China Ser. C. Life Sci. 52, in western chimpanzees. Mol. Biol. Evol. 28, 921–931. 284–295. Tamura K., Peterson D., Peterson N., Stecher G., Nei M. and Kumar Librado P. and Rozas J. 2009 DnaSP v5: a software for compre- S. 2011 MEGA5: molecular evolutionary genetics analysis using hensive analysis of DNA polymorphism data. Bioinformatics 25, maximum likelihood, evolutionary distance, and maximum par- 1451–1452. simony methods. Mol. Biol. Evol. 28, 2731–2739. Lindemann B. 1996 Taste reception. Physiol. Rev. 76, 719–766. Wang K. and Zhao H. 2015 Birds generally carry a small repertoire Liu B. 2004 Thinking about the use of Tibetan chicken. China of bitter taste receptor genes. Genome Biol. Evol. 7, 2705–2715. Poultry 26, 49–51. Wideman R., Erf G., Chapman M., Wang W., Anthony N. B. Matsunami H., Montmayeur J. P. and Buck L. B. 2000 A family and Xiaofang L. 2002 Intravenous micro-particle injections of candidate taste receptors in human and mouse. Nature 404, and pulmonary hypertension in broiler chickens: acute post- 601–604. injection mortality and ascites susceptibility. Poultry Sci. 81, Miller S., Dykes D. and Polesky H. 1988 A simple salting out pro- 1203–1217. cedure for extracting DNA from human nucleated cells. Nucleic Xu R. F., Li K., Chen G. H., Qiangba Y., Zhang Y. B., Lin L. et al. acids Res. 16, 1215. 2005 Genetic variation within exon 2 of the MHC B-LB // gene Mueller K. L., Hoon M. A., Erlenbach I., Chandrashekar J., Zuker in Tibetan chicken. Acta Genet. Sin. 32, 1136–1146. C. S. and Ryba N. J. P. 2005 The receptors and coding logic for Zhao H., Li J. and Zhang J. 2015 Molecular evidence for the loss of bitter taste. Nature 434, 225–229. three basic tastes in penguins. Curr. Biol. 25, R141–R142.

Received 20 October 2015, in revised form 28 December 2015; accepted 21 January 2016 Unedited version published online: 27 January 2016 Final version published online: 23 August 2016

Journal of Genetics, Vol. 95, No. 3, September 2016 681