Genetic Diversity of Bitter Taste Receptor Gene Family in Sichuan Domestic and Tibetan Chicken Populations

c Indian Academy of Sciences RESEARCH ARTICLE Genetic diversity of bitter taste receptor gene family in Sichuan domestic and Tibetan chicken populations YUAN SU, DIYAN LI, UMA GAUR, YAN WANG, NAN WU, BINLONG CHEN, ZHONGXIAN XU, HUADONG YIN, YAODONG HU and QING ZHU∗ Farm Animal Genetic Resources Exploration and Innovation Key Laboratory of Sichuan Province, Sichuan Agricultural University, Chengdu 611130, People’s Republic of China Abstract The sense of bitter taste plays a critical role in animals as it can help them to avoid intake of toxic and harmful substances. Previous research had revealed that chicken has only three bitter taste receptor genes (Tas2r1, Tas2r2 and Tas2r7). To better understand the genetic polymorphisms and importance of bitter taste receptor genes (Tas2rs) in chicken, here, we sequenced Tas2rs of 30 Sichuan domestic chickens and 30 Tibetan chickens. Thirteen single-nucleotide polymorphisms (SNPs) including three nonsynonymous mutations (m.359G>C, m.503C>A and m.583A>G) were detected in Tas2r1 (m. is the abbreviation for mutation); three SNPs were detected in Tas2r2, but none of them were missense mutation; eight SNPs were detected in Tas2r7 including six nonsynonymous substitutions (m.178G>A, m.421A>C, m.787C>T, m.832G>T, m.907A>Tand m.943G>A). Tajima’s D neutral test indicates that there is no population expansion in both populations, and the size of the population is relatively stable. All the three networks indicate that red jungle fowls share haplotypes with domestic chickens. In addition, we found that haplotypes H1 and HE1 were positively associated with high-altitude adaptation, whereas haplotypes H4 and HE4 showed a negative correlation with high-altitude adaptation in Tas2rs. Although, chicken has only three Tas2rs, our results showed that both Sichuan domestic chickens and Tibetan chickens have abundant haplotypes in Tas2rs, especially in Tas2r7, which might help chickens to recognize a wide variety of bitter-tasting compounds. [Su Y., Li D., Gaur U., Wang Y., Wu N., Chen B., Xu Z., Yin H., Hu Y. and Zhu Q. 2016 Genetic diversity of bitter taste receptor gene family in Sichuan domestic and Tibetan chicken populations. J. Genet. 95, 675–681] Introduction be affected by the important roles of Tas2rs in avoiding gen- erally bitter, toxic and harmful substances (Go et al. 2005). Mammals can distinguish five basic tastes: sour, sweet, Most of the previous bitter taste receptor studies focussed umami, bitter and salty (Kinnamon and Cummings 1992; on mammals, such as humans (Hayes et al. 2011; Campa Lindemann 1996). Of them, bitter taste is a critical nat- et al. 2012; Behrens and Meyerhof 2013), western chim- ural defense preventing the ingestion of toxic or harmful panzees (Sugawara et al. 2011), bats (Hong and Zhao 2014) substances, which are typically bitter in nature (Garcia and and whales (Feng et al. 2014). Birds are believed to be poor Hankins 1975; Glendinning 1994). It provides extremely tasters, previous study found only three Tas2rs in chicken, important sensory information for animals, and can help in comparison to 10–69 in mammals. Molecular evidence identify toxic substances and maintain nutritional balance. showed that three basic tastes (sweet, umami and bitter) are While compared with mammals, there are only four kinds dispensable in penguins (especially in adelie and emperor of taste receptor genes (bitter, umami, sour and salty) in penguins) (Zhao et al. 2015). A recent study showed that her- chickens (Roura et al. 2013). Previous studies showed that bivorous and insectivorous birds may need more functional bitter tastants bind to bitter taste receptor (Tas2rs) and trig- Tas2rs than carnivorous birds feeding on noninsect animals ger the bitter taste signal transduction pathway (Mueller et al. (Wang and Zhao 2015). Until now, no significant progress 2005; Chandrashekar et al. 2006; Behrens et al. 2007). The has been made in the research of genetic polymorphisms of behaviour of animals, especially the feeding behaviour, could Tas2rs in chickens. Tibetan chicken (TC) (Gallus gallus), as a specific and ∗ For correspondence. E-mail: [email protected]. native breed, mainly distributed in Qinghai, Tibet Plateau, at Yuan Su and Diyan Li contributed equally to this work. an altitudes between 2200 and 4100 meters (Liu 2004), and Keywords. polymorphisms; bitter taste receptor; Sichuan domestic chicken; Tibetan chicken. Journal of Genetics, DOI 10.1007/s12041-016-0684-4, Vol. 95, No. 3, September 2016 675 Yuan Su et al. has adapted to hypoxia and low air pressure in harsh environ- Table 1. The primers information used in the study. ment (Li and Zhao 2009). Compared to domestic chickens, they have unique physiological and genetic adaptations, such Product Gene Primer sequences (5→3) T (◦C) length as remarkable adaptability to the specific natural environ- m ment of frigid temperature, decreased air pressure and rare Tas2r1 TCATGCGATGGGAACATCTA 59.0 1080 oxygen, strong disease resistance, excellent meat taste with TGGATCTCAACTGGAAAGAGC high nutritional value and high medicinal value of its eggs Tas2r2 AAACAGGCAGAAGTGACCAGA 63.3 1043 (Wideman et al. 2002). However, the size of the TC popu- GGTGAAACAAGAAGTGCATGA lation is decreasing drastically, and is under increasing pres- Tas2r7 AGCCCGACAGAGTTTCACA 59.0 1413 CAGCAGGTGGCAGAATCAC sure from the introgression of modern, commercial breeds because of its poor laying performance and high frequency of broodiness (Xu et al. 2005). Therefore, investigations on cochin-Chinese red jungle fowl (G. g. gallus,GenBank the genetic variability of the TC populations are becoming accession numbers: AB249766.1, AB249767.1, AB249768.1) increasingly important. Here, to explore the genetic polymor- was used as the reference sequence for determining the vari- phisms and importance of Tas2rs in chicken, we sequenced able sites of chicken Tas2r1, Tas2r2 and Tas2r7 sequences, Tas2rs in 30 Sichuan domestic chickens (DC) and 30 TC. respectively. The haplotypes were generated using DnaSP V5 software (Librado and Rozas 2009). A median-joining network analysis was performed by using the program Net- Materials and methods work 4 (http://www.fluxus-engineering.com/sharenet.htm). Sampling and DNA extraction Statistical analysis Sixty chickens were used in this study. Fifteen male and 15 female DC (Sichuan Jiuyuan black-chicken strain) from the We considered DC as one population (without high-altitude chicken breeding farm of Sichuan Agricultural University at adaptation) and TC as another population (with high-altitude low attitude areas (≈600 m) were sampled; and 15 male and adaptation). The haplotype diversity and nucleotide diversity 15 female TC were sampled from the domestic conservation were analysed using DnaSP V5 software (Librado and Rozas farms in Xiangcheng, Batang Counties of Ganzi, Sichuan 2009). Statistical difference in the allele frequencies and hap- Province, China (≈3100 m). Blood samples were collected lotype frequencies of Tas2r1, Tas2r2 and Tas2r7 in DC and ◦ from wing vein and stored at −20 C until DNA extraction. TC populations were analysed using Pearson chi-square test, The whole genomic DNA was extracted by salt-extraction P < 0.05 was regarded as statistical significance. method (Miller et al. 1988). No chicken was injured or slaughtered accidentally in the process of sampling. Results DNA amplification and sequencing Haplotype and nucleotide diversities of Tas2rs in DC and TC Primer pairs used in this study are shown in table 1. The populations primer pairs flanking the gene sequences were designed Number of haplotypes, haplotype diversity (Hd), average using Primer 3 software (ver. 0.4.0). A total of 50 μLof number of differences (K), nucleotide diversity (Pi) and reaction volume was amplified, including 100–150 ng DNA Tajima’s D values of Tas2r1, Tas2r2 and Tas2r7 are summa- template, 5 μL10× buffer, 25 mM MgCl2,2.5mMdNTP rized in table 2. For Tas2r7, TC has greater genetic diversity mixture, 2 mM of each primer, 1.25 U Taq polymerase than DC. In Tas2r1, Tas2r2 and Tas2r7, Tajima’s D values (Takara, Dalian, China) using the standard PCR programme. had no significant difference (P > 0.10) between DC and The PCR amplification programme is as follows: initial TC populations. The result indicates that these two popula- ◦ denaturation at 95 Cfor4min,followedby34cyclesof tions are in accordance with neutral mutation. There is no ◦ ◦ ◦ 94 C for 40 s, annealing at 59.0–63.3 C for 40 s, 72 Cfor population expansion in both populations, and the size of the ◦ 90 s, and a final extension at 72 C for 10 min. PCR prod- population is relatively stable. ucts were checked on 1.5% agarose gel and the purified PCR products were directly sequenced in both directions. Sequence variations in Tas2rs The Tas2r1 sequences were trimmed to 891 bp for all 60 Analysis of sequences samples; no insertions/deletions were detected. A total of The raw sequences were edited and aligned using DNAstar 13 SNPs were identified in Tas2r1. The observed allele (DNAstar Inc., Madison, USA). Sequence variations includ- frequencies of Tas2r1 in each polymorphic site between DC ing variable sites and conserved sites were identified using and TC populations are shown in table 3. Three nonsynony- MEGA 5.0 (Tamura et al. 2011). The genome sequence of mous mutations (m.359G>C, m.503C>A and m.583A>G) 676 Journal of Genetics, Vol. 95, No. 3, September 2016 Genetic diversity of chicken Tas2r2 Table 2. Genetic diversity parameters of Tas2r1, Tas2r2 and Tas2r7 in DC and TC populations. Tas2r1 Tas2r2 Tas2r7 Population DC TC DC TC DC TC Number of variable sites 10 13 2 3 7 6 Number of haplotypes 11 14 3 5 8 11 Haplotype diversity (Hd) 1.000 0.908 0.333 0.434 0.540 0.870 Average number of differences (K) 3.564 4.710 0.344 0.462 1.148 1.889 Nucleotide diversity (Pi) 0.3564 0.0053 0.0004 0.0005 0.0014 0.0023 Tajima’s D 0.1864 1.4671 −0.6342 −1.3699 −1.0868 0.6536 DC, Sichuan domestic chicken; TC, Tibetan chicken.

Load more