DOCSLIB.ORG

(A) Up-Regulated Genes in HCC827-GR-High2 Compared to Parental HCC827

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Table S2. Results of expression profiling analysis (A) Up-regulated genes in HCC827-GR-high2 compared to parental HCC827 Fold Fold Fold Unique ID Symbol Unique ID Symbol Unique ID Symbol change* change* change* ILMN_1709348 ALDH1A1 577.587 ILMN_2310814 MAPT 13.003 ILMN_1741017 PIP4K2B 7.331 ILMN_1651354 SPP1 441.316 ILMN_1748650 MRPL45 12.988 ILMN_3237623 RNY1 7.297 ILMN_1701831 GSTA1 260.591 ILMN_1755897 UGT2B7 12.629 ILMN_1734897 SLC4A4 7.285 ILMN_1658835 CAV2 12.357 ILMN_1746359 RERG 7.280 ILMN_2094875 ABCB1 183.050 ILMN_1678939 VNN2 11.935 ILMN_1671337 SLC2A5 7.257 ILMN_3251540 GSTA2 145.982 ILMN_1729905 GAL3ST1 11.910 ILMN_1691606 LYG2 7.254 ILMN_2062468 IGFBP7 127.721 ILMN_1672536 FBLN1 11.716 ILMN_1785646 PMP22 7.246 ILMN_1795190 CLDN2 111.439 ILMN_1796339 PLEKHA2 11.631 ILMN_1737387 LOC728441 7.207 ILMN_1782937 LOC647169 98.612 ILMN_1676563 HTRA1 11.592 ILMN_1684401 FMO1 7.117 ILMN_1754247 SLC3A1 81.001 ILMN_3263423 LOC100129027 11.346 ILMN_1687035 ADAMTSL4 7.098 ILMN_1662795 CA2 79.581 ILMN_1694898 LOC653857 10.906 ILMN_2153572 MAGEA3 7.086 ILMN_2168747 GSTA2 66.250 ILMN_2404625 LAT 10.560 ILMN_1784283 USH1C 7.079 ILMN_1764228 DAB2 64.709 ILMN_1666546 DUSP14 10.375 ILMN_1731374 CPE 7.046 ILMN_1675797 EPDR1 63.605 ILMN_1764571 ARHGAP23 10.299 ILMN_1765446 EMP3 6.933 ILMN_1708341 PDZK1 59.714 ILMN_3200140 LOC645638 10.284 ILMN_1754002 IL1F8 6.863 ILMN_1713529 SEMA6A 52.575 ILMN_3244343 SNORA21 10.171 ILMN_1878007 FUT9 6.835 ILMN_1708391 NR1H4 43.218 ILMN_1671489 PC 10.075 ILMN_1699208 NAP1L1 6.763 ILMN_2412336 AKR1C2 42.826 ILMN_2404688 NUPR1 10.044 ILMN_2403237 CHN2 6.749 ILMN_3272081 LOC100130221 39.774 ILMN_1772824 WNT5B 10.037 ILMN_1687757 AKR1C4 6.720 ILMN_3243598 PDZK1P1 39.514 ILMN_1741356 PRICKLE1 9.893 ILMN_1810560 P8 6.594 ILMN_1754076 CACNA2D3 39.414 ILMN_1758146 SIRPA 9.804 ILMN_1892403 SNORD13 6.570 ILMN_1808157 RUNDC3B 38.375 ILMN_1801090 KRT222 9.757 ILMN_2332553 MSRB3 6.534 ILMN_1704617 EFHB 37.932 ILMN_1731941 APOM 9.724 ILMN_1720771 STX11 6.527 ILMN_1760412 SHISA2 36.244 ILMN_1709153 PRR16 9.707 ILMN_2400219 SRI 6.526 ILMN_2336094 ODZ3 33.505 ILMN_1804357 GNG4 9.638 ILMN_1798210 E2F7 6.505 ILMN_1657373 LEPREL1 29.033 ILMN_1706664 FAM80A 9.622 ILMN_1782419 GNG11 6.499 ILMN_1715508 NNMT 27.320 ILMN_1669393 GGT1 9.572 ILMN_2188521 PVRL3 6.475 ILMN_2141482 SERPINF1 27.052 ILMN_1810797 WASF3 9.553 ILMN_2225135 GCNT1 6.458 ILMN_2315044 FGG 26.902 ILMN_1808238 RBPMS2 9.526 ILMN_1691662 LOC100101266 6.425 ILMN_1811303 NR5A2 26.868 ILMN_1680682 TADA2A 9.525 ILMN_1751453 ABCC9 6.422 ILMN_1788122 GSTA5 26.123 ILMN_2363988 GSG1 9.385 ILMN_1681260 LOC643272 6.384 ILMN_2289593 FXYD2 25.330 ILMN_1729216 CRYAB 9.348 ILMN_2105919 FGF2 6.365 ILMN_1789502 GPC4 23.773 ILMN_1678353 FARP1 9.338 ILMN_1672591 SCN9A 6.326 ILMN_1785732 TNFAIP6 23.401 ILMN_1677200 CYFIP2 9.312 ILMN_2135321 CHDH 6.297 ILMN_1694840 MATN2 22.663 ILMN_1728734 PSG5 9.180 ILMN_2234956 LEPR 6.265 ILMN_3243831 CAPN6 21.834 ILMN_2366790 DDX52 9.083 ILMN_3238435 SNORA12 6.255 ILMN_1809859 PCGF2 21.378 ILMN_1774261 DOK4 8.954 ILMN_1701032 TFPI 6.168 ILMN_1806754 GLDC 21.314 ILMN_3216979 LOC646949 8.937 ILMN_2376263 SMARCA1 6.079 ILMN_2368530 IL32 19.690 ILMN_1676088 MSRB3 8.929 ILMN_2151281 GABARAPL1 6.071 ILMN_1678842 THBS2 19.454 ILMN_1771652 BAIAP2L2 8.831 ILMN_1800512 HMOX1 6.037 ILMN_3235709 HNF1B 19.325 ILMN_2170949 SNX10 8.471 ILMN_1762155 FBXO40 6.024 ILMN_1687306 LGALS2 18.691 ILMN_2149766 APPBP2 8.445 ILMN_1740443 LOC728811 6.016 ILMN_1703301 LOC653479 18.372 ILMN_1691702 ZNF775 8.443 ILMN_1737255 C22orf36 6.006 ILMN_2058251 VIM 18.289 ILMN_1727091 ACMSD 8.384 ILMN_1712545 S100A3 5.890 ILMN_1697548 LPHN2 18.020 ILMN_1812461 WISP2 8.326 ILMN_1705346 NBEA 5.886 ILMN_1678049 FGB 18.003 ILMN_1656368 ALDH4A1 8.208 ILMN_1759785 LOC644111 5.839 ILMN_1730454 FOLR3 17.458 ILMN_1690223 CNTNAP2 8.093 ILMN_1804419 LRMP 5.780 ILMN_1808301 MRPL45 16.535 ILMN_1805826 BIVM 7.972 ILMN_2337923 TPD52L1 5.770 ILMN_2367172 AMACR 16.517 ILMN_1789599 NBL1 7.911 ILMN_1711408 ANXA4 5.769 ILMN_1800787 RFTN1 15.849 ILMN_2415467 AP1GBP1 7.889 ILMN_3187623 SYCE1L 5.759 ILMN_1778337 TCF2 15.128 ILMN_1720233 CCDC49 7.822 ILMN_1698020 DLC1 5.736 ILMN_2081087 HSPA12A 15.058 ILMN_2102257 FBXO48 7.776 ILMN_1724061 PAX3 5.714 ILMN_2315789 PTPRD 14.388 ILMN_1708098 LIX1L 7.705 ILMN_1721770 PAPPA 5.709 ILMN_2307903 VCAM1 13.721 ILMN_3248094 ANO2 7.688 ILMN_1717327 KCNJ14 5.686 ILMN_2401344 PPP2R2C 13.709 ILMN_1718734 MLLT6 7.586 ILMN_2384745 PSG4 5.668 ILMN_1766675 CDH6 13.679 ILMN_1678170 MME 7.582 ILMN_1765304 psiTPTE22 5.649 ILMN_1746013 SPOCK1 13.672 ILMN_3247139 C17orf96 7.522 ILMN_1776850 ITGB1BP3 5.609 ILMN_1745976 TRAF4 13.505 ILMN_1782429 TMEM56 7.496 ILMN_2171295 PFTK1 5.607 ILMN_1750062 PPARGC1A 13.359 ILMN_1783276 NEXN 7.414 ILMN_1737406 KLF6 5.598 ILMN_1691410 BAMBI 13.170 ILMN_1758825 ABLIM2 7.406 ILMN_1805543 ADAMTS9 5.571 ILMN_2399463 VAV3 13.164 Fold Fold Fold Unique ID Symbol Unique ID Symbol Unique ID Symbol change* change* change* ILMN_1742044 GNAI1 5.546 ILMN_1710001 RPL41 4.698 ILMN_1738849 SLC9A2 4.147 ILMN_1664170 CUGBP2 5.514 ILMN_3195372 LOC100128056 4.698 ILMN_2195482 CACNB3 4.146 ILMN_3253901 HAVCR1 5.506 ILMN_1670875 PPM1D 4.695 ILMN_3249501 ZNF697 4.145 ILMN_1690979 SLC17A3 5.493 ILMN_1668531 LOC440386 4.689 ILMN_1675062 MYL9 4.123 ILMN_1743394 HNF4G 5.448 ILMN_1700887 TDRD5 4.677 ILMN_2361862 VLDLR 4.108 ILMN_1693912 SLC47A2 5.399 ILMN_1692398 CNTNAP1 4.676 ILMN_1736863 TMEM140 4.102 ILMN_2302118 CCDC50 5.391 ILMN_1680521 AV PR1 B 4.670 ILMN_1677684 BTBD16 4.093 ILMN_1767934 PCSK5 5.390 ILMN_3238898 LOC100192378 4.658 ILMN_1693738 CTSE 4.093 ILMN_1656378 NMT2 5.358 ILMN_1721657 RSU1 4.657 ILMN_1654112 PARD6A 4.089 ILMN_1699226 UBR4 5.348 ILMN_2246956 BCL2 4.654 ILMN_2282081 QRICH1 4.088 ILMN_1749962 NCAM2 5.324 ILMN_1690644 LOC652605 4.621 ILMN_1712159 AV PR1 A 4.085 ILMN_2197365 RGS2 5.319 ILMN_2275126 RHBDF2 4.614 ILMN_2186137 RRAD 4.082 ILMN_1799600 STARD8 5.291 ILMN_1768804 LOC644014 4.610 ILMN_1722953 USP47 4.055 ILMN_1652631 GLIPR2 5.288 ILMN_1723978 LGALS1 4.599 ILMN_3245684 C12orf27 4.047 ILMN_2360710 TPM1 5.275 ILMN_1719543 MAF 4.598 ILMN_1742069 ZSWIM5 4.041 ILMN_2174481 TEX9 5.248 ILMN_1662846 GPR160 4.574 ILMN_1806603 MESP1 4.039 ILMN_1667018 ACE2 5.227 ILMN_2194009 ABCC4 4.556 ILMN_1754969 LMCD1 4.037 ILMN_2094360 NR2F2 5.224 ILMN_1810684 TINAG 4.549 ILMN_3240365 MNX1 4.034 ILMN_3251737 EEF1A1 5.212 ILMN_1655595 SERPINE2 4.545 ILMN_2374244 DYRK2 4.033 ILMN_1804629 TPK1 5.179 ILMN_3235853 S1PR1 4.544 ILMN_2284222 PCTK3 4.032 ILMN_1796349 SMPDL3A 5.178 ILMN_1696339 ZIC2 4.525 ILMN_3235185 SNRNP200 4.026 ILMN_1767657 MAT1A 5.141 ILMN_2405602 OSBPL1A 4.519 ILMN_1738657 SATB2 4.007 ILMN_1669631 GLRB 5.140 ILMN_1737025 PLCL2 4.517 ILMN_1736104 LOC645218 4.000 ILMN_1668374 ITGB5 5.139 ILMN_1692865 VPS37D 4.515 ILMN_1794959 SLC35F3 3.993 ILMN_1662839 PLEKHA1 5.113 ILMN_1794598 SCHIP1 4.506 ILMN_3276119 LOC645251 3.984 ILMN_1686116 THBS1 5.093 ILMN_1746888 PCOLCE2 4.499 ILMN_1802519 VPS36 3.983 ILMN_1687301 VCAN 5.079 ILMN_1767900 LGI2 4.489 ILMN_1712419 DCDC2 3.971 ILMN_1803676 ENOSF1 5.078 ILMN_1732127 RBKS 4.469 ILMN_3194217 LOC100129424 3.956 ILMN_1680874 TUBB2B 5.045 ILMN_1716957 C1QL1 4.457 ILMN_1691237 CAP2 3.950 ILMN_2410929 PAPSS2 5.044 ILMN_2403896 GGTLC2 4.433 ILMN_1729453 TSPAN9 3.942 ILMN_1796229 FGFR1 5.038 ILMN_1752299 RAB6B 4.422 ILMN_2059535 PPM1F 3.919 ILMN_1811238 ALPK2 5.026 ILMN_1767523 IL17RB 4.408 ILMN_2388070 TMEM44 3.910 ILMN_3248282 LOC100134539 5.023 ILMN_2201678 FSTL1 4.392 ILMN_2381899 OPTN 3.908 ILMN_1775508 CYLD 5.006 ILMN_1763196 WDR72 4.384 ILMN_1813685 RAB7L1 3.908 ILMN_1655563 KIAA0427 5.004 ILMN_3310421 MIR1292 4.381 ILMN_1655796 37681 3.907 ILMN_1778333 MMP24 4.990 ILMN_1779228 CDH2 4.380 ILMN_2364384 PPARG 3.906 ILMN_3241021 RNY4 4.989 ILMN_1782243 LOC643248 4.375 ILMN_1782349 LOC648066 3.903 ILMN_3237439 SNORD61 4.981 ILMN_2075643 ANKRD29 4.374 ILMN_1755822 SYDE1 3.903 ILMN_1777397 MSX1 4.978 ILMN_1758523 ABCA3 4.374 ILMN_1699489 TUBB6 3.902 ILMN_1707727 ANGPTL4 4.966 ILMN_1781691 TRAK2 4.373 ILMN_3248599 LOC100134825 3.901 ILMN_1685275 MCAM 4.963 ILMN_1774387 ZHX3 4.366 ILMN_1697959 SLC35B4 3.892 ILMN_1810233 UGT2B11 4.928 ILMN_1752914 CDGAP 4.354 ILMN_1717393 PTCHD1 3.891 ILMN_1719792 PHLDB2 4.927 ILMN_1803862 LCN15 4.354 ILMN_1801776 PSG9 3.890 ILMN_1723969 PLCB1 4.923 ILMN_1662038 LARGE 4.321 ILMN_2381064 TPD52 3.887 ILMN_1712913 UNC5A 4.913 ILMN_1758392 ANKS1B 4.320 ILMN_1788931 DOCK8 3.884 ILMN_1706498 DSE 4.913 ILMN_1680037 FAM65A 4.320 ILMN_1787324 C16orf48 3.883 ILMN_1729455 EML1 4.895 ILMN_1810941 COMT 4.299 ILMN_1806930 LOC651040 3.872 ILMN_2346339 FOLR1 4.869 ILMN_2193706 HRK 4.286 ILMN_1688935 DLK2 3.870 ILMN_2143250 FAR1 4.860 ILMN_2068991 TBC1D3G 4.285 ILMN_1673941 RBM24 3.869 ILMN_1731714 CREB5 4.859 ILMN_1658498 SLC44A3 4.272 ILMN_1761281 LOC441019 3.867 ILMN_1724686 CLDN1 4.835 ILMN_1708709 KIAA1211 4.268 ILMN_1759660 LOC648153 3.854 ILMN_1722845 RAB3B 4.815 ILMN_1724480 AXIN2 4.257 ILMN_1706660 HYI 3.848 ILMN_1805448 EPB41L2 4.814 ILMN_1665909 LASP1 4.253 ILMN_1727805 SYNGR1 3.844 ILMN_3269395 GGT2 4.805 ILMN_1719570 BICC1 4.231 ILMN_1781400 SLC7A2 3.841 ILMN_1748281 MAPK10 4.792 ILMN_3251472 TOMM20 4.229 ILMN_1809490 NCKAP5 3.841 ILMN_1674193 EMX1 4.787 ILMN_1664922 FLNB 4.217 ILMN_1716264 ANKRD1 3.838 ILMN_1742866 F2R 4.781 ILMN_1755115 RPL23 4.212 ILMN_1732584 FLJ45455 3.835 ILMN_1705869 LOC440297 4.780 ILMN_1709683 RASSF2 4.187 ILMN_2131523 SACS 3.833 ILMN_1661940 CAMTA1 4.765 ILMN_1768391 ARL4C 4.184 ILMN_2298588 TAOK2 3.815 ILMN_2348788 CD44 4.760 ILMN_1727813 BRP44 4.172 ILMN_2140990
Recommended publications
  • Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis

    Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis

    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Screening and identification of key biomarkers in clear cell renal cell carcinoma based on bioinformatics analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Clear cell renal cell carcinoma (ccRCC) is one of the most common types of malignancy of the urinary system. The pathogenesis and effective diagnosis of ccRCC have become popular topics for research in the previous decade. In the current study, an integrated bioinformatics analysis was performed to identify core genes associated in ccRCC. An expression dataset (GSE105261) was downloaded from the Gene Expression Omnibus database, and included 26 ccRCC and 9 normal kideny samples. Assessment of the microarray dataset led to the recognition of differentially expressed genes (DEGs), which was subsequently used for pathway and gene ontology (GO) enrichment analysis.
  • BLOC-1 and BLOC-3 Regulate VAMP7 Cycling to and From

    BLOC-1 and BLOC-3 Regulate VAMP7 Cycling to and From

    BLOC-1 and BLOC-3 regulate VAMP7 cycling to and from melanosomes via distinct tubular transport carriers Megan K. Dennis1,2, Cédric Delevoye3,4, Amanda Acosta-Ruiz1,2, Ilse Hurbain3,4, Maryse Romao3,4, Geoffrey G. Hesketh5, Philip S. Goff6, Elena V. Sviderskaya6, Dorothy C. Bennett6, J. Paul Luzio5, Thierry Galli7, David J. Owen5, Graça Raposo3,4 and Michael S. Marks1,2,8 1Dept. of Pathology and Laboratory Medicine, Children's Hospital of Philadelphia Research Institute, and 2Dept. of Pathology and Laboratory Medicine and Dept of Physiology, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA, USA; 3Institut Curie, PSL Research University, CNRS, UMR144, Structure and Membrane Compartments, F-75005, Paris, France; 4 Institut Curie, PSL Research University, CNRS, UMR144, Cell and Tissue Imaging Facility (PICT-IBiSA), F-75005, Paris, France; 5Cambridge Institute for Medical Research, University of Cambridge, Cambridge, UK; 6Cell Biology & Genetics Research Centre, St. George’s , University of London, London, UK; 7Sorbonne Paris-Cité, Univ. Paris-Diderot, Institut Jacques Monod, CNRS UMR7592, INSERM ERL U950, Membrane Traffic in Health & Disease, Paris, France. 8To whom correspondence should be addressed: Michael S. Marks, Ph.D. Dept. of Pathology & Laboratory Medicine Children's Hospital of Philadelphia Research Institute 816G Abramson Research Center 3615 Civic Center Blvd. Philadelphia, PA 19104 Tel: 215-590-3664 Email: [email protected] Running title: VAMP7 into and out of melanosomes Keywords: SNARE, lysosome-related organelle, melanogenesis, Hermansky-Pudlak syndrome, recycling, endosome, 2 ABSTRACT Endomembrane organelle maturation requires cargo delivery via fusion with membrane transport intermediates and recycling of fusion factors to their sites of origin.
  • Diagnosing Platelet Secretion Disorders: Examples Cases

    Diagnosing Platelet Secretion Disorders: Examples Cases

    Diagnosing platelet secretion disorders: examples cases Martina Daly Department of Infection, Immunity and Cardiovascular Disease, University of Sheffield Disclosures for Martina Daly In compliance with COI policy, ISTH requires the following disclosures to the session audience: Research Support/P.I. No relevant conflicts of interest to declare Employee No relevant conflicts of interest to declare Consultant No relevant conflicts of interest to declare Major Stockholder No relevant conflicts of interest to declare Speakers Bureau No relevant conflicts of interest to declare Honoraria No relevant conflicts of interest to declare Scientific Advisory No relevant conflicts of interest to declare Board Platelet granule release Agonists (FIIa, Collagen, ADP) Signals Activation Shape change Membrane fusion Release of granule contents Platelet storage organelles lysosomes a granules Enzymes including cathepsins Adhesive proteins acid hydrolases Clotting factors and their inhibitors Fibrinolytic factors and their inhibitors Proteases and antiproteases Growth and mitogenic factors Chemokines, cytokines Anti-microbial proteins Membrane glycoproteins dense (d) granules ADP/ATP Serotonin histamine inorganic polyphosphate Platelet a-granule contents Type Prominent components Membrane glycoproteins GPIb, aIIbb3, GPVI Clotting factors VWF, FV, FXI, FII, Fibrinogen, HMWK, FXIII? Clotting inhibitors TFPI, protein S, protease nexin-2 Fibrinolysis components PAI-1, TAFI, a2-antiplasmin, plasminogen, uPA Other protease inhibitors a1-antitrypsin, a2-macroglobulin
  • Primepcr™Assay Validation Report

    Primepcr™Assay Validation Report

    PrimePCR™Assay Validation Report Gene Information Gene Name olfactory receptor, family 5, subfamily J, member 2 Gene Symbol OR5J2 Organism Human Gene Summary Olfactory receptors interact with odorant molecules in the nose to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. Gene Aliases OR11-266 RefSeq Accession No. NC_000011.9, NT_167190.1 UniGene ID Hs.537145 Ensembl Gene ID ENSG00000174957 Entrez Gene ID 282775 Assay Information Unique Assay ID qHsaCED0019003 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000312298 Amplicon Context Sequence CCTTGTTGAGGAATCTGGGCATGATCCTCTTAATCCAAATCACCTCCAAACTCCA CACACCCATGTACTTTTTACTCAGCTGTCTTTCATTTGTGGATGCCTGCTATTCAT CTGCAATT Amplicon Length (bp) 89 Chromosome Location 11:55944206-55944324 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 104 R2 0.9987 cDNA Cq 29.8 Page 1/5 PrimePCR™Assay Validation Report cDNA Tm (Celsius) 79.5 gDNA Cq 23.17 Specificity (%) 100 Information to assist with data interpretation is provided
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • A Network of Bhlhzip Transcription Factors in Melanoma: Interactions of MITF, TFEB and TFE3

    A Network of Bhlhzip Transcription Factors in Melanoma: Interactions of MITF, TFEB and TFE3

    A network of bHLHZip transcription factors in melanoma: Interactions of MITF, TFEB and TFE3 Josué A. Ballesteros Álvarez Thesis for the degree of Philosophiae Doctor January 2019 Net bHLHZip umritunarþátta í sortuæxlum: Samstarf milli MITF, TFEB og TFE3 Josué A. Ballesteros Álvarez Ritgerð til doktorsgráðu Leiðbeinandi/leiðbeinendur: Eiríkur Steingrímsson Doktorsnefnd: Margrét H. Ögmundsdóttir Þórarinn Guðjónsson Jórunn E. Eyfjörð Lars Rönnstrand Janúar 2019 Thesis for a doctoral degree at tHe University of Iceland. All rigHts reserved. No Part of tHis Publication may be reProduced in any form witHout tHe Prior permission of the copyright holder. © Josue A. Ballesteros Álvarez. 2019 ISBN 978-9935-9421-4-2 Printing by HáskólaPrent Reykjavik, Iceland 2019 Ágrip StjórnPróteinin MITF , TFEB, TFE3 og TFEC (stundum nefnd MiT-TFE þættirnir) tilheyra bHLHZip fjölskyldu umritunarþátta sem bindast DNA og stjórna tjáningu gena. MITF er mikilvægt fyrir myndun og starfsemi litfruma en ættingjar þess, TFEB og TFE3, stjórna myndun og starfsemi lysósóma og sjálfsáti. Sjálfsát er líffræðilegt ferli sem gegnir mikilvægu hlutverki í starfsemi fruma en getur einnig haft áHrif á myndun og meðHöndlun sjúkdóma. Í verkefni þessu var samstarf MITF, TFE3 og TFEB Próteinanna skoðað í sortuæxlisfrumum og hvaða áhrif þau Hafa á tjáningu hvers annars. Eins og MITF eru TFEB og TFE3 genin tjáð í sortuæxlisfrumum og sortuæxlum; TFEC er ekki tjáð í þessum frumum og var því ekki skoðað í þessu verkefni. Með notkun sérvirkra hindra var sýnt að boðleiðir hafa áhrif á staðsetningu próteinanna þriggja í sortuæxlisfrumum. Umritunarþættir þessir geta bundist skyldum DNA-bindisetum og haft áhrif á tjáningu gena sem eru nauðsynleg fyrir myndun bæði lýsósóma og melanósóma.
  • Supplementary Tables

    Supplementary Tables

    Supplementary Tables Supplementary Table S1: Preselected miRNAs used in feature selection Univariate Cox proportional hazards regression analysis of the endpoint freedom from recurrence in the training set (DKTK-ROG sample) allowed the pre-selection of 524 miRNAs (P< 0.5), which were used in the feature selection. P-value was derived from log-rank test. miRNA p-value miRNA p-value miRNA p-value miRNA p-value hsa-let-7g-3p 0.0001520 hsa-miR-1304-3p 0.0490161 hsa-miR-7108-5p 0.1263245 hsa-miR-6865-5p 0.2073121 hsa-miR-6825-3p 0.0004257 hsa-miR-4298 0.0506194 hsa-miR-4453 0.1270967 hsa-miR-6893-5p 0.2120664 hsa-miR-668-3p 0.0005188 hsa-miR-484 0.0518625 hsa-miR-200a-5p 0.1276345 hsa-miR-25-3p 0.2123829 hsa-miR-3622b-3p 0.0005885 hsa-miR-6851-3p 0.0531446 hsa-miR-6090 0.1278692 hsa-miR-3189-5p 0.2136060 hsa-miR-6885-3p 0.0006452 hsa-miR-1276 0.0557418 hsa-miR-148b-3p 0.1279811 hsa-miR-6073 0.2139702 hsa-miR-6875-3p 0.0008188 hsa-miR-3173-3p 0.0559962 hsa-miR-4425 0.1288330 hsa-miR-765 0.2141536 hsa-miR-487b-5p 0.0011381 hsa-miR-650 0.0564616 hsa-miR-6798-3p 0.1293342 hsa-miR-338-5p 0.2153079 hsa-miR-210-5p 0.0012316 hsa-miR-6133 0.0571407 hsa-miR-4472 0.1300006 hsa-miR-6806-5p 0.2173515 hsa-miR-1470 0.0012822 hsa-miR-4701-5p 0.0571720 hsa-miR-4465 0.1304841 hsa-miR-98-5p 0.2184947 hsa-miR-6890-3p 0.0016539 hsa-miR-202-3p 0.0575741 hsa-miR-514b-5p 0.1308790 hsa-miR-500a-3p 0.2185577 hsa-miR-6511b-3p 0.0017165 hsa-miR-4733-5p 0.0616138 hsa-miR-378c 0.1317442 hsa-miR-4515 0.2187539 hsa-miR-7109-3p 0.0021381 hsa-miR-595 0.0629350 hsa-miR-3121-3p
  • DULIP: a Dual Luminescence-Based Co-Immunoprecipitation Assay for Interactome Mapping in Mammalian Cells

    DULIP: a Dual Luminescence-Based Co-Immunoprecipitation Assay for Interactome Mapping in Mammalian Cells

    Repository of the Max Delbrück Center for Molecular Medicine (MDC) in the Helmholtz Association http://edoc.mdc-berlin.de/14998 DULIP: A dual luminescence-based co-immunoprecipitation assay for interactome mapping in mammalian cells Trepte, P., Buntru, A., Klockmeier, K., Willmore, L., Arumughan, A., Secker, C., Zenkner, M., Brusendorf, L., Rau, K., Redel, A., Wanker, E.E. NOTICE: this is the author’s version of a work that was accepted for publication in the Journal of Molecular Biology. Changes resulting from the publishing process, such as peer review, editing, corrections, structural formatting, and other quality control mechanisms may not be reflected in this document. Changes may have been made to this work since it was submitted for publication. A definitive version was subsequently published in: Journal of Molecular Biology 2015 MMM DD ; 427(21): 3375-3388 doi: 10.1016/j.jmb.2015.08.003 Publisher: Elsevier © 2015, Elsevier. This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-nd/4.0/ or send a letter to Creative Commons, PO Box 1866, Mountain View, CA 94042, USA. DULIP: A DUAL LUMINESCENCE-BASED CO-IMMUNOPRECIPITATION ASSAY FOR INTERACTOME MAPPING IN MAMMALIAN CELLS Philipp Treptea, Alexander Buntrua#, Konrad Klockmeiera#, Lindsay Willmorea, Anup Arumughana, Christopher Seckera, Martina Zenknera, Lydia Brusendorfa, Kirstin Raua, Alexandra Redela and Erich E Wankera* a Neuroproteomics, Max Delbrueck Center for Molecular Medicine, Robert-Roessle- Straße 10, 13125 Berlin, Germany # Contributed equally * Corresponding author, E-mail address: [email protected], Telephone: +49- 30-9406-2157, Fax: +49-30-9406-2552 ABSTRACT Mapping of protein-protein interactions (PPIs) is critical for understanding protein function and complex biological processes.
  • Supplementary Figure S4

    Supplementary Figure S4

    18DCIS 18IDC Supplementary FigureS4 22DCIS 22IDC C D B A E (0.77) (0.78) 16DCIS 14DCIS 28DCIS 16IDC 28IDC (0.43) (0.49) 0 ADAMTS12 (p.E1469K) 14IDC ERBB2, LASP1,CDK12( CCNE1 ( NUTM2B SDHC,FCGR2B,PBX1,TPR( CD1D, B4GALT3, BCL9, FLG,NUP21OL,TPM3,TDRD10,RIT1,LMNA,PRCC,NTRK1 0 ADAMTS16 (p.E67K) (0.67) (0.89) (0.54) 0 ARHGEF38 (p.P179Hfs*29) 0 ATG9B (p.P823S) (0.68) (1.0) ARID5B, CCDC6 CCNE1, TSHZ3,CEP89 CREB3L2,TRIM24 BRAF, EGFR (7p11); 0 ABRACL (p.R35H) 0 CATSPER1 (p.P152H) 0 ADAMTS18 (p.Y799C) 19q12 0 CCDC88C (p.X1371_splice) (0) 0 ADRA1A (p.P327L) (10q22.3) 0 CCNF (p.D637N) −4 −2 −4 −2 0 AKAP4 (p.G454A) 0 CDYL (p.Y353Lfs*5) −4 −2 Log2 Ratio Log2 Ratio −4 −2 Log2 Ratio Log2 Ratio 0 2 4 0 2 4 0 ARID2 (p.R1068H) 0 COL27A1 (p.G646E) 0 2 4 0 2 4 2 EDRF1 (p.E521K) 0 ARPP21 (p.P791L) ) 0 DDX11 (p.E78K) 2 GPR101, p.A174V 0 ARPP21 (p.P791T) 0 DMGDH (p.W606C) 5 ANP32B, p.G237S 16IDC (Ploidy:2.01) 16DCIS (Ploidy:2.02) 14IDC (Ploidy:2.01) 14DCIS (Ploidy:2.9) -3 -2 -1 -3 -2 -1 -3 -2 -1 -3 -2 -1 -3 -2 -1 -3 -2 -1 Log Ratio Log Ratio Log Ratio Log Ratio 12DCIS 0 ASPM (p.S222T) Log Ratio Log Ratio 0 FMN2 (p.G941A) 20 1 2 3 2 0 1 2 3 2 ERBB3 (p.D297Y) 2 0 1 2 3 20 1 2 3 0 ATRX (p.L1276I) 20 1 2 3 2 0 1 2 3 0 GALNT18 (p.F92L) 2 MAPK4, p.H147Y 0 GALNTL6 (p.E236K) 5 C11orf1, p.Y53C (10q21.2); 0 ATRX (p.R1401W) PIK3CA, p.H1047R 28IDC (Ploidy:2.0) 28DCIS (Ploidy:2.0) 22IDC (Ploidy:3.7) 22DCIS (Ploidy:4.1) 18IDC (Ploidy:3.9) 18DCIS (Ploidy:2.3) 17q12 0 HCFC1 (p.S2025C) 2 LCMT1 (p.S34A) 0 ATXN7L2 (p.X453_splice) SPEN, p.P677Lfs*13 CBFB 1 2 3 4 5 6 7 8 9 10 11
  • Aberrant Sialylation in Cancer: Biomarker and Potential Target for Therapeutic Intervention?

    Aberrant Sialylation in Cancer: Biomarker and Potential Target for Therapeutic Intervention?

    cancers Review Aberrant Sialylation in Cancer: Biomarker and Potential Target for Therapeutic Intervention? Silvia Pietrobono * and Barbara Stecca * Tumor Cell Biology Unit, Core Research Laboratory, Institute for Cancer Research and Prevention (ISPRO), Viale Pieraccini 6, 50139 Florence, Italy * Correspondence: [email protected] (S.P.); [email protected] (B.S.); Tel.: +39-055-7944568 (S.P.); +39-055-7944567 (B.S.) Simple Summary: Sialylation is a post-translational modification that consists in the addition of sialic acid to growing glycan chains on glycoproteins and glycolipids. Aberrant sialylation is an established hallmark of several types of cancer, including breast, ovarian, pancreatic, prostate, colorectal and lung cancers, melanoma and hepatocellular carcinoma. Hypersialylation can be the effect of increased activity of sialyltransferases and results in an excess of negatively charged sialic acid on the surface of cancer cells. Sialic acid accumulation contributes to tumor progression by several paths, including stimulation of tumor invasion and migration, and enhancing immune evasion and tumor cell survival. In this review we explore the mechanisms by which sialyltransferases promote cancer progression. In addition, we provide insights into the possible use of sialyltransferases as biomarkers for cancer and summarize findings on the development of sialyltransferase inhibitors as potential anti-cancer treatments. Abstract: Sialylation is an integral part of cellular function, governing many biological processes Citation: Pietrobono, S.; Stecca, B. including cellular recognition, adhesion, molecular trafficking, signal transduction and endocytosis. Aberrant Sialylation in Cancer: Sialylation is controlled by the levels and the activities of sialyltransferases on glycoproteins and Biomarker and Potential Target for lipids. Altered gene expression of these enzymes in cancer yields to cancer-specific alterations of Therapeutic Intervention? Cancers glycoprotein sialylation.
  • LETTER Doi:10.1038/Nature09515

    LETTER Doi:10.1038/Nature09515

    LETTER doi:10.1038/nature09515 Distant metastasis occurs late during the genetic evolution of pancreatic cancer Shinichi Yachida1*, Siaˆn Jones2*, Ivana Bozic3, Tibor Antal3,4, Rebecca Leary2, Baojin Fu1, Mihoko Kamiyama1, Ralph H. Hruban1,5, James R. Eshleman1, Martin A. Nowak3, Victor E. Velculescu2, Kenneth W. Kinzler2, Bert Vogelstein2 & Christine A. Iacobuzio-Donahue1,5,6 Metastasis, the dissemination and growth of neoplastic cells in an were present in the primary pancreatic tumours from which the meta- organ distinct from that in which they originated1,2, is the most stases arose. A small number of these samples of interest were cell lines common cause of death in cancer patients. This is particularly true or xenografts, similar to the index lesions, whereas the majority were for pancreatic cancers, where most patients are diagnosed with fresh-frozen tissues that contained admixed neoplastic, stromal, metastatic disease and few show a sustained response to chemo- inflammatory, endothelial and normal epithelial cells (Fig. 1a). Each therapy or radiation therapy3. Whether the dismal prognosis of tissue sample was therefore microdissected to minimize contaminat- patients with pancreatic cancer compared to patients with other ing non-neoplastic elements before purifying DNA. types of cancer is a result of late diagnosis or early dissemination of Two categories of mutations were identified (Fig. 1b). The first and disease to distant organs is not known. Here we rely on data gen- largest category corresponded to those mutations present in all samples erated by sequencing the genomes of seven pancreatic cancer meta- from a given patient (‘founder’ mutations, mean of 64%, range 48–83% stases to evaluate the clonal relationships among primary and of all mutations per patient; Fig.
  • Supplementary Materials

    Supplementary Materials

    Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine