Activation of Bitter Taste Receptors (Tas2rs) Relaxes Detrusor Smooth Muscle and Suppresses Overactive Bladder Symptoms

www.impactjournals.com/oncotarget/ Oncotarget, Vol. 7, No. 16

Activation of bitter taste receptors (tas2rs) relaxes detrusor smooth muscle and suppresses overactive bladder symptoms

Kui Zhai1,*, Zhiguang Yang1,*, Xiaofei Zhu2,*, Eric Nyirimigabo1, Yue Mi3, Yan Wang4, Qinghua Liu5, Libo Man2, Shiliang Wu3, Jie Jin3 and Guangju Ji1 1 National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing, China 2 Department of Urology, Beijing Jishuitan Hospital, Beijing, China 3 Department of Urology, National Research Center for Genitourinary Oncology, Peking University First Hospital and Institute of Urology, Beijing, China 4 Department of Gastroenterology, Peking University First Hospital, Beijing, China 5 Institute for Medical Biology, College of Life Sciences, South-Central University for Nationalities, Wuhan, China * Those authors have contributed equally to this work Correspondence to: Guangju Ji, email: [email protected] Correspondence to: Jie Jin, email: [email protected] Keywords: bitter taste receptors, chloroquine, detrusor smooth muscle, human, mouse, overactive bladder, Gerotarget Received: March 10, 2016 Accepted: March 20, 2016 Published: April 02, 2016 ABSTRACT Bitter taste receptors (TAS2Rs) are traditionally thought to be expressed exclusively on the taste buds of the tongue. However, accumulating evidence has indicated that this receptor family performs non-gustatory functions outside the mouth in addition to taste. Here, we examined the role of TAS2Rs in human and mouse detrusor smooth muscle (DSM). We showed that mRNA for various TAS2R subtypes was expressed in both human and mouse detrusor smooth muscle (DSM) at distinct levels. Chloroquine (CLQ), an agonist for TAS2Rs, concentration-dependently relaxed carbachol- and KCl-induced contractions of human DSM strips. Moreover, 100 µM of CLQ significantly inhibited spontaneous and electrical field stimulation (EFS)-induced contractions of human DSM strips. After a slight contraction, CLQ (1 mM) entirely relaxed carbachol-induced contraction of mouse DSM strips. Furthermore, denatonium and quinine concentration-dependently decreased carbachol-induced contractions of mouse DSM strips. Finally, we demonstrated that CLQ treatment significantly suppressed the overactive bladder (OAB) symptoms of mice with partial bladder outlet obstruction (PBOO). In conclusion, we for the first time provide evidence of the existence of TAS2Rs in the urinary DSM and demonstrate that TAS2Rs may represent a potential target for OAB. These findings open a new approach to develop drugs for OAB in the future.

INTRODUCTION reported that the overall prevalence of OAB syndrome was 11.8%; rates were similar between men and women [3]. The urinary bladder is the organ that collects urine The prevalence of OAB syndrome increased with age in excreted from kidneys before disposal by urination. a linear fashion [3-5]. As a result, in patients over the age Bladder dysfunction, such as overactive bladder (OAB), of 65 years the prevalence of OAB syndrome can increase has serious effects on quality of life [1]. OAB syndrome to 30.9% [4]. Anticholinergic drugs remain the first-line is a common condition characterized by the presence pharmacologic treatment for OAB syndrome [6] despite of urgency with or without incontinence, frequency, producing undesirable side effects such as dry mouth, and nocturia. The etiology of OAB syndrome is very constipation, and blurred vision [7]. It is estimated that complicated and includes increased afferent activity, by 2018, more than 500 million people worldwide will decreased inhibitory control, and increased sensitivity of be affected by OAB [3, 8]. Thus, it is of great urgency to the detrusor muscle to efferent stimulation [2]. It has been identify novel targets for this disorder. www.impactjournals.com/oncotarget 21156 Oncotarget Bitter taste receptors (TAS2Rs) belong to the obstruction (PBOO). superfamily of G-protein-coupled receptors (GPCRs) [9]. GPCRs, which convert extracellular stimuli RESULTS into intracellular signals through the activation of heterotrimeric G-proteins, are involved in many diseases and are also the target of approximately 40% of all modern Expression profile ofTas2rs in human DSM medicinal drugs [10]. However, these targeted GPCRs are only a small part of this receptor superfamily and over 30% GPCRs have no known endogenous ligand, Using quantitative reverse transcription PCR (RT- indicating that many potential targets remain to be qPCR), we screened the expression profile of all 25 discovered [11]. As TAS2Rs are traditionally thought to TAS2R genes in human DSM. As shown in Figure 1, we be expressed exclusively on the taste buds of the tongue, found that TAS2R7 and TAS2R8 were the most abundantly they have been generally neglected as drug targets. expressed genes, with levels similar to the reference However, accumulating evidence has indicated that this gene glyceraldehyde 3-phosphate dehydrogenase receptor family performs non-gustatory functions outside (GAPDH). The expression levels of TAS2R1, TAS2R5, the mouth in addition to taste. We and others have shown TAS2R9, TAS2R13, TAS2R20, and TAS2R31 were two that TAS2Rs are expressed in both human and mouse orders of magnitude lower than that of GAPDH with airway smooth muscle and mediate the tone of airway the following rank order: TAS2R13 > TAS2R1≈TAS2R9 smooth muscle [12-15]. Besides, it has been reported that > TAS2R5≈TAS2R20≈TAS2R31. TAS2R4, TAS2R10, this receptor family plays a critical role in the heart [16], TAS2R14, TAS2R30, TAS2R38, TAS2R39, TAS2R40, thyroid [17], and gastrointestinal muscle [18]. However, TAS2R45, and TAS2R50 were very slightly detected. Eight their role in the urinary bladder has never been determined. TAS2R genes (TAS2R3, TAS2R16, TAS2R19, TAS2R41, In this study, we examined the expression and TAS2R42, TAS2R43, TAS2R46, and TAS2R60) were not function of TAS2Rs in human and mouse urinary detrusor expressed. smooth muscle (DSM). We further determined their role in the urinary bladder of mice with partial bladder outlet

Figure 1: The genes of TAS2R are expressed in human DSM. RT-qPCR screen of TAS2R genes in human DSM. Data were presented as relative expression of TAS2R genes to the reference gene GAPDH (mean ± SEM of 5 independent DSM samples). Of all 25 human TAS2R gens, 17 TAS2Rs were expressed in human DSM with distinct levels, whereas 8 TAS2Rs were not detected. www.impactjournals.com/oncotarget 21157 Oncotarget Chloroquine (CLQ) relaxes human DSM strips on these contractions (Figure 2B and 2D). Moreover, we investigated the effects of CLQ on the nerve-evoked contractions induced by a wide range of electrical field Next, we determined the function of TAS2Rs in stimulation (EFS) frequencies as described from Petkov’s human DSM with chloroquine (CLQ). CLQ is an agonist work [25]. We first applied increasing EFS frequencies of TAS2Rs and has been shown to activate several (0.5-50 Hz) as a control protocol, followed by the addition TAS2Rs, including TAS2R3, TAS2R7, TAS2R10, and of 100 µM CLQ (Figure 3E). Five minutes after the TAS2R39 [19-21]. We showed that CLQ did not exhibit addition, a second EFS protocol was applied. As shown any effects on the base tone of human DSM strips. We in Figure 3F, CLQ (100 µM) significantly decreased the thus tested the effect of CLQ on carbachol- and KCl- amplitudes of EFS-induced contractions within a wide induced contractions of human DSM strips according range (0.5 Hz, 2 Hz, 3.5 Hz, 5 Hz, 7.5 Hz, 10 Hz, 12.5 to previous studies [22-24]. We showed that cumulative Hz, 15 Hz, 20 Hz, 30 Hz, 40 Hz, and 50 Hz) by 21 ± concentrations of CLQ (100 nM to 3 mM) induced 12%, 52 ± 15%, 26 ± 14%, 32 ± 10%, 31 ± 10%, 40 ± significant decreases of carbachol- and KCl-induced 5%, 50 ± 8%, 55 8%, 46 ± 10%, 48 ± 13%, and 57 ± 19%, contractions in a concentration-dependent manner (Figure respectively. Of all the strips (n = 26), only three exhibited 2A-2D). In contrast, the vehicle had no significant effects

Figure 2: Effect of chloroquine on stimulus-induced and spontaneous contractions of human DSM strips. A., B. Original trace and summary data showing the effects of vehicle (control, n = 4 strips) or chloroquine (CLQ: 100 nM to 3 mM; n = 5 strips) on carbachol-induced contractions. C., D. Original trace and summary data showing the effects of vehicle (control, n = 4 strips) or CLQ (100 nM to 3 mM; n = 5 strips) on KCl-induced contractions. E., F. Original trace and summary data showing the effects of CLQ (100 µM) on EFS-induced contractions (n= 4 strips). G. Original trace of spontaneous contractions in the absence and presence of 100 µM CLQ. Data are mean ± SEM of n independent DSM strips. *p < 0.05, **p < 0.01, and***p < 0.001 as indicated. www.impactjournals.com/oncotarget 21158 Oncotarget Figure 3: The genes of Tas2r are expressed in mouse DSM. RT-qPCR screen of Tas2r genes in mouse DSM. Data were presented as relative expression of Tas2r genes to the reference gene Gapdh (mean ± SEM of 3 independent DSM samples). Of all 35 mouse Tas2r genes, 19 Tas2rs were expressed in mouse DSM with distinct levels, whereas 16 Tas2rs were not detected.

Figure 4: Effect of bitter tastants on carbachol-induced contractions of mouse DSM strips. A.-C. Original traces and summary data showing the effects of vehicle (control, n = 5 strips) or chloroquine (CLQ: 1 mM; n = 6 strips) on carbachol-induced contractions in mouse DSM strips. D. Original trace showing the effects of denatonium (100 nM to 3 mM) on carbachol-induced contractions. E. Original trace showing the effects of quinine (100 nM to 3 mM) on carbachol-induced contractions. F. Summary data showing the effects of vehicle, denatonium (n = 5 strips), and quinine (n = 5 strips) on carbachol-induced contractions. Data are mean ± SEM of n independent mouse DSM strips. *p < 0.05, **p < 0.01, and ***p < 0.001 were control vs. CLQ or denatomium; #p < 0.05, ##p < 0.01, and ###p < 0.001 were control vs. quinine, respectively. www.impactjournals.com/oncotarget 21159 Oncotarget spontaneous phasic contractions. We found that CLQ Chloroquine treatment attenuates bladder (100 µM) completely inhibited these spontaneous phasic morphological alteration of PBOO mice contractions (Figure 2G). Taken together, these results suggested that TAS2R activation relaxes human DSM. It has been well accepted that detrusor over-activity Expression profile ofTas2rs in mouse DSM is one of the major causes of OAB syndrome [2]. Thus, relaxation of the urinary DSM has been recognized as an effective approach to treat OAB. Our in vitro results We further explored the expression profile ofTas2rs demonstrated that TAS2Rs activation can relax both in mouse DSM with RT-qPCR. Of 35 mouse Tas2r genes, human and mouse urinary DSM (Figure 2 and 4). We Tas2r114, Tas2r117, Tas2r130, Tas2r138, and Tas2r144 therefore hypothesized that TAS2Rs activation would were significantly expressed. Among them, onlyTas2r114 be effective for the treatment of OAB. To test this was expressed at a similar level to Gapdh. Fourteen Tas2r hypothesis, we induced a mouse model of OAB through genes were very lowly expressed, whereas 16 Tas2r genes partial obstruction of the urinary bladder outlet. The mean were not detected (Figure 3). bodyweights of the sham, PBOO-vehicle, and PBOO-CLQ mice were not significantly different (data not shown). As Effects of bitter tastants on carbachol-induced shown in Figure 5A, the bladder weights of PBOO-vehicle contractions in mouse DSM strips mice (N = 8; 0.031 ± 0.002 g) were significantly increased than that of sham mice (N = 8; 0.022 ± 0.002 g); CLQ treatment markedly suppressed this increase (PBOO-CLQ To determine the role of TAS2Rs in mouse DSM, mice: N = 8; 0.026 ± 0.001 g). Moreover, hematoxylin- three different bitter tastants, CLQ, denatonium, and eosin (HE) staining indicated that the bladder muscle quinine, were used. As shown in Figure 4A-4C, we found thicknesses of PBOO-vehicle mice (N = 5; 0.40 ± 0.03 that CLQ (1 mM) mediated a two-phasic response: it mm) were markedly thicker than that of sham mice (N = 5; first produced a slight contraction and then completely 0.28 ± 0.02 mm); while CLQ treatment largely prevented relaxed the carbachol-induced contractions. Moreover, PBOO-mediated muscle hypertrophy (PBOO-CLQ both denatonium and quinine concentration-dependently mice: N = 5; 0.32 ± 0.01 mm) (Figure 5B). In all groups, decreased carbachol-induced contractions of mouse DSM muscle fibers (stained red) and collagen fibers (stained strips (Figure 4D-4F). The vehicle had no significant blue) can be clearly observed in the bladder wall (Figure effects on these contractions (Figure 4F). 5C). Consistent with HE results, masson’s trichrome staining also indicated that the bladder walls were thicker in PBOO-vehicle and PBOO-CLQ mice in comparison with sham mice. Additionally, there was a transmural

Figure 5: Chloroquine treatment significantly attenuates the bladder morphological changes of PBOO mice.A. Bladder weights of the sham (N = 8), PBOO-Vehicle (N = 8), and PBOO-CLQ (N = 8) mice are shown. After anesthesia, the whole bladder was removed and imaged. The fat and connective tissues were cleaned under cold PBS. Then, the bladder was cut from the neck to the fundus along one side. After being quickly dried by drinking paper, the bladder was weighed. B. The representative HE stains of bladder specimens from the sham, PBOO-Vehicle, and PBOO-CLQ mice are shown. Summary data showing the average muscle thickness of bladders from the sham (N = 5), PBOO-Vehicle (N = 5), and PBOO-CLQ (N = 5) mice. C. The representative Masson’s trichrome staining of bladder from the sham, PBOO-Vehicle, and PBOO-CLQ mice were shown. Summary data showing the mean ratio of collagen to muscle from the sham (N = 5), PBOO-Vehicle (N = 5), and PBOO-CLQ (N = 5) mice. Scale bars = 250 µm. *p < 0.05 and **p < 0.01 as indicated. www.impactjournals.com/oncotarget 21160 Oncotarget increase in the amount of collagen in both PBOO-vehicle Chloroquine treatment improves bladder function and PBOO-CLQ mice. The collagen/muscle ratio in the of PBOO mice muscle layer of bladder wall was significantly increased in PBOO-vehicle mice (N = 5; 1.4 ± 0.04) compared to sham mice (N = 5; 0.84 ± 0.05); this increase was markedly We also explored the bladder function of PBOO suppressed by CLQ treatment (PBOO-CLQ mice: N = 5; mice after CLQ treatment. As shown in Figure 6A, 1.05 ± 0.05). compared to sham mice, PBOO-Vehicle mice exhibited aberrant urodynamic manifestations; while PBOO- CLQ mice had normal urodynamic features. In detail, maximum micturition pressure of PBOO-Vehicle mice was significantly higher than that of sham mice; CLQ

Figure 6: Chloroquine treatment improves the bladder function of PBOO mice. A. The representative traces of the cystometrogram recorded in the sham, PBOO-Vehicle, and PBOO-CLQ mice. B.-D. Summary data of micturition pressures, micturition intervals, and voiding frequency of the sham (N = 10), PBOO-Vehicle (N = 10), and PBOO-CLQ (N = 10) mice are shown. Data are mean ± SEM. *p < 0.05, **p < 0.01, and ***p < 0.001 as indicated. www.impactjournals.com/oncotarget 21161 Oncotarget treatment suppressed this increase (Figure 6B). PBOO interesting to test the role of TAS2Rs in the urothelium of significantly shortened the micturition interval; however, urinary bladder. these values were significantly prolonged and increased Another primary finding of this study is that CLQ by CLQ treatment (Figure 6C). The micturition frequency treatment suppresses OAB symptoms. We showed that of PBOO-Vehicle mice was largely increased compared once daily 30 mg/kg of CLQ for 6 weeks can attenuate to sham mice; this value was markedly decreased by CLQ PBOO-induced DSM hypertrophy and collagen deposition treatment (Figure 6D). (Figure 5) and improve bladder functions of PBOO mice (Figure 6). The dosage of CLQ used in this study was DISCUSSION based on previous observations. Sexton et al. showed that 25 and 50 mg/kg of CLQ are effective for the treatment In this study, we demonstrated for the first time of human malaria [29]. In a murine malaria model, a that TAS2Rs exist in human and mouse DSM based on single dose of 50 mg/kg of CLQ can protect mice from both molecular and pharmacological studies. With RT- experimental malaria [30]. It has been reported that qPCR, we determined the expression profile ofTAS2Rs in once daily 30 mg/kg of CLQ has no significant effects human and mouse DSM (Figure 1 and 3). We showed that on the behavior and appearance of the mice [31]. Moore TAS2R7 and TAS2R8 were the main subtypes expressed et al. found that the maximum plasma concentration of in human DSM (Figure 1). The murine homolog of CLQ can reach to 1 708 µg/liter (about 6 µM) after the TAS2R7, Tas2r130, was significantly detected in mouse treatment of a single dose of CLQ (50 mg/kg) in the mice DSM (Figure 3). Likewise, Tas2r144 was the major [32]. CLQ concentration can be accumulated more than subtype expressed in mouse DSM (Figure 3). Its human 10 times after the successive treatment of CLQ for 20 homolog, TAS2R40, was also observed in human DSM days in human [33]. As the pharmacokinetics of CLQ is (Figure 1). However, a large number of TAS2R subtypes similar between human and mouse [32], we calculated that expressed in human DSM were not detected in mouse the plasma concentration of CLQ should be maintained DSM. It is perhaps due to the fact that most of them from 10 to 100 µM during CLQ treatment. After PBOO are human specific TAS2Rs including TAS2R5, TAS2R8, surgery, the bladder underwent structural and functional TAS2R9, TAS2R30, TAS2R31, and TAS2R45. With a remodeling to adapt the excessive mechanical stress [34]. classical pharmacological method, we showed that One of the major functional alterations caused by PBOO is TAS2Rs activation induces a strong relaxation of both detrusor over-activity, which is characterized by increased human and mouse DSM strips. Of interest, a transient responses to stimuli and micturition dysfunction. The contraction before the relaxation was observed in mouse super-sensitivity of the detrusor to acetylcholine (Ach) has DSM strips (Figure 4). However, this phenomenon did been reported in the animal model [35] as well as in OAB not occurred in human DSM. These results suggested patients [36]. Thus, CLQ treatment suppresses detrusor that TAS2Rs and their downstream signaling pathways over-activity and leads to the improvement of the bladder might be varied among species. Like CLQ, the other two function of PBOO mice. Recently, Long et al. showed bitter tastants, quinine and denatonium, largely relaxed that CLQ can prevent the hypertrophy of right ventricular the carbachol-induced contractions of mouse DSM strips through the inhibition of autophagy pathways [37], in a concentration dependent manner (Figure 4D-4F), raising the possibility that there are the other mechanisms confirming the existence of TAS2Rs in mouse DSM. We responsible for the effects of CLQ treatment. also found that CLQ had no obvious effects on the base In this study, the OAB model was generated with tone but suppressed stimulus-induced contractions of female mice because of the ease of manipulation. It is DSM, implying that the underlying signaling pathways known that animal models always have several limitations, might be different between the resting and pre-contracted including the fact the prevalence of bladder obstruction is conditions. It has been shown that TAS2Rs activation higher in males than in females. Besides the obstruction mediates two opposing signaling pathways in the airway of bladder outlet, there are numerous causes of OAB smooth muscle [14]. in human. Thus, the effects of CLQ needs to be further In the airway epithelium, TAS2Rs expressed on the investigated with the other OAB models. ciliated epithelial cells [26] and solitary chemosensory There is an unmet need for additional therapeutic cells [27, 28], where they promote ciliary beat frequency options in the treatment of OAB. Here, we provide and sense chemical irritation, respectively. Here, we did evidence of the existence of TAS2Rs in both human and not focus the role of TAS2Rs in the urothelium of urinary mouse urinary DSM and further demonstrate that CLQ bladder. It is hard to obtain the human bladder tissues with can improve OAB symptoms of PBOO mice. Indeed, normal urothelium in our experimental conditions. In most many known synthetic agents and thousands of natural cases, only the DSM sections were delivered to the lab bitter tastants and their metabolites can activate TAS2Rs from the hospital. In order to keep consistent with findings and have favorable therapeutic profiles. Therefore, these in the human urinary DSM, we only investigated the role findings open a new approach to develop drugs for OAB of TAS2Rs in mouse DSM. However, it will be very in the future. www.impactjournals.com/oncotarget 21162 Oncotarget Table 1: Sequence information of RT-qPCR primers Gene symbol Accession number Forward sequence Reverse sequence Size (bp) TAS2R1 NM_019599.2 tgccattgcttatcttccttttt ggtgtgcctccccagaga 62 TAS2R3 NM_016943.2 caaaaaccaagatggctaagatga tgagtggccagcaggataaaa 65 TAS2R4 NM_016944.1 tttcctgaacttgtgactacgagaa taaagacaagatgccctcactgata 66 TAS2R5 NM_018980.2 cagcattcggtatccctttga tcctgaattgagctgaaatgca 61 TAS2R7 NM_023919.2 aacgctgctccccttttgt cgcagggagaggatcaagag 60 TAS2R8 NM_023918.1 aaaactctatgctaccggcagtaga agtcatagttttaatggctctcacatg 70 TAS2R9 NM_023917.2 tgcatgctacagggttcagaga tgcctttatggccctcatgt 59 TAS2R10 NM_023921.1 catttccctttggagacacaac atgagcttctgtgttggagtc 76 TAS2R13 NM_023920.2 aggagcagaaaaaggagaagg gtgaagatactcggcaggg 147 TAS2R14 NM_023922.1 cctcactgctttggcaatctc acacacaccagcttccgaatatt 65 TAS2R16 NM_016945.2 cattggttattcctttcatcctgtt cttggtcagtgatgccatgaga 65 TAS2R19 NM_176888.1 cgaaccatttcagcatgtgg ccccaacagtatcaccagaac 134 TAS2R20 NM_176889.2 agatggagtcttgccctgttgt ttgtggtgagccaagattgtg 62 TAS2R30 NM_001097643.1 atttcagcagctggcttgcta aaattggcaatcctgagcaaa 61 TAS2R31 NM_176885.2 cagcaccaaggtccacataaaa gtaaacggcacataacaagaggaa 67 TAS2R38 NM_176817.4 ctctgtgcccctactgattctgt cattatcccaacacaaaccatcac 64 TAS2R39 NM_176881.2 ccctgccagccactcaat ccgcttccaggctcttctc 64 TAS2R40 NM_176882.1 tgccggccactcagtacaa accgcttccaggctcttctc 62 TAS2R41 NM_176883.2 cggccgacagttcttcca aaaaccagaaggtggctgagttc 59 TAS2R42 NM_181429.1 actggtaaactgctctgaagg atgtgaagcaagtcccactag 139 TAS2R43 NM_176884.2 gcaccaaggtccacataaaagc aagtaaatggcacataacaagaggaa 67 TAS2R45 NM_176886.1 cctttgctgaccaaattgtcact taataataacacccagagcaaaccaa 68 TAS2R46 NM_176887.2 gctattgcattcagctatccttca agcttcttgtttccccaaatca 62 TAS2R50 NM_176890.2 gttgtcatggttagcaaggc gagttgagagtttcaggtcttttac 148 TAS2R60 NM_177437.1 caatgcccactgctgtctttt tgtgtcttcccagagatgtgatg 63 hGAPDH NM_002046.5 gccacatcgctcagacacc cccaatacgaccaaatccgt 64 Tas2r102 NM_199153.2 ggaagcttggtgttcttgcttgg agatcagctcggtccacattgc 127 Tas2r103 NM_053211.1 attagcactgggtttacactcacc ccacagggagaagatgagcagaag 75 Tas2r104 NM_207011.1 agcttcctttccgctagctgtg tggatcagccaggatgtgttgc 75 Tas2r105 NM_020501.1 ttccttctcatcggcttagca gtcaggtgattcacagtcatcc 152 Tas2r106 NM_207016.1 tgcctctgatgcccacattatag ggctggtggcaaaccatatacttg 80 Tas2r107 NM_199154.1 tccctgcggtcactcaatcatc cagtgccttcaaagaggcttgc 70 Tas2r108 NM_020502.1 agtgtttctcctgttgaaacggac tggtgagggctgaaatcagaag 83 Tas2r109 NM_207017.1 gtcaaattcaggtgttaggaagtcac cacagggagaagatgagcagga 94 Tas2r110 NM_199155.2 tggatagtgaataaccatttcagcg ctccactttaggtaaagaaacaaagagt 110 Tas2r113 NM_207018.1 tccgcactgctctggcaattag tgaacagacacccaccaatctagg 73 Tas2r114 NM_207019.1 tgctgagcacaatggaaggtgtc tgttccctacaatgcccagcac 72 Tas2r115 NM_207020.1 ctttggtgtatccttgatagctttcc gtactgcatcttccttacatgtttcat 73 Tas2r116 NM_053212.1 cttttgctgtgtcactggtca tctgatgtgggccttagtgct 119 Tas2r117 NM_207021.1 cttttcgttgtattttgtgaggttgt ctgtctcagcttcatgtctcctaca 90 Tas2r118 NM_207022.1 aagttgcacaacggttgcagtg tctccaccggtgacagtctttg 68 Tas2r119 NM_020503.2 ctcaaggaacccaagactcagtg acaggcttctgagcaggatgtc 82 Tas2r120 NM_207023.1 atggcaaaggatgtcaagatcag atgacctgctgggtagaagga 182 Tas2r121 NM_207024.1 ctggtcttattggagatgattgtgtt ggagaagattaacaggatgaaggaga 81 Tas2r122 NM_001039128.1 tcttctctttatggagccaccttag gtgcttctgtgcttatgtctttgg 75 Tas2r123 NM_207025.1 cattaaagccttgcaaactgtgttc ggaaaagtaagtatatggcatacagca 62 Tas2r124 NM_207026.1 agtctctggcttgctacagctc agcttcccagaagcatgtggac 127 Tas2r125 NM_207027.1 atcttctccctgtggagacacctg tggtgtcttcggagcctttagc 64 Tas2r126 NM_207028.1 gcagtgtgtgggattggtcaac tcccggagtactcaaccagatg 62 www.impactjournals.com/oncotarget 21163 Oncotarget Tas2r129 NM_207029.1 ttgcagatgcccacatcagagtc tggcacagagtaggacataggtg 60 Tas2r130 NM_199156.1 tccttcctggccctgtttg tgaatggcttgaaggatagattagag 132 Tas2r131 NM_207030.1 atcaacatggcttgccacctg agcacacctctcaatctccactta 105 Tas2r134 NM_199158.1 gcctgggaagtggtaacctaca gtgttgcttagtatcagaatggtgga 63 Tas2r135 NM_199159.1 tcagttctgccagcaacacacc tgaatcaccacctgccacatcc 64 Tas2r136 NM_181276.1 tctggaggaaccaatccacctg tgctctcacctgaaccattgcc 133 Tas2r137 NM_001025385.1 ctggctcaaatggagagcttcta ggtactgacacaggataagagcagtg 76 Tas2r138 NM_001001451.1 tgctattcagctcgcctgcttc tggcttggtagttgtggctcag 62 Tas2r139 NM_181275.1 tgacaatgttcgtcgcaacagc tcatgttcagggtgtgtctcctg 66 Tas2r140 NM_021562.1 catctgaagaacatgcaacacaatg gcagggccttaatatgggct 73 Tas2r143 NM_001001452.1 ttcccaggctgctggttgtatc agttcccggtggctgaaatgac 69 Tas2r144 NM_001001453.1 tggtttgctgcttggctcaatg tcagaaggaacagagggtgagc 73 mGapdh NM_008084.2 aaggtcggtgtgaacggatttg tcctggaagatggtgatgggct 224

MATERIALS AND METHODS RT-qPCR

This study was reviewed and approved by the local RNA and cDNA were prepared as previously Institutional Review Board of Peking University First reported [38]. In brief, total RNA was prepared from Hospital and the Institute of Biophysics Committee. For bladder DSM using the Trizol RNA purification experiments involving human subjects, the research was system (Invitrogen, Carlsbad, CA, USA). The cDNA conducted according to the principles expressed in the was generated from mRNA (2 µg) using the M-MLV Declaration of Helsinki. Animal protocols were performed reverse transcriptase (Promega Corp., Madison, WI, according to the Guide for the Care and Use of Laboratory USA). RT-qPCR was performed on a Corbett Rotor- Animals published by the US National Institutes of Health Gene 6600 QPCR system machine (Corbett Life (NIH Publication No. 85-23, revised 1996). Science) using TransScriptTM Green RT-qPCR SuperMix (TRANSGENE BIOTECH, Beijing, China) according to Obtainment of human urinary bladder tissues the manufacturer’s instructions. GAPDH was used as a reference gene. Detailed information regarding the primer Human urinary bladder tissues were obtained pairs used in this study was shown in Table 1. All the from 26 patients with bladder cancer (18 men and 8 PCR products were run on the gel or sequenced to test the women, mean age: 66 ± 7 yr) who had undergone radical specificity of each pair of primer. The -∆Ct2 method was cystectomy in Peking University First Hospital. The used to analyze the relative expression levels of TAS2Rs. patients with urinary retention, obvious lower urinary tract symptoms, or with medical conditions that could affect Isometric DSM tension recordings bladder function were excluded. In addition, the patients whose DSM layers were severely affected by cancer Organ bath experiments were performed as were also excluded. Bladder tissues were removed and previously reported [39, 40]. In brief, the mucosa-free confirmed to be cancer-free by an experienced urological DSM strips from human or mouse were dissected into pathologist. After the cleaning of fat tissue and peeling of strips 5-8 mm long and 2-3 mm wide. Strips were tied bladder serosa and mucosa, human DSM samples were up and mounted in the standard organ bath chambers collected. (BL-420F acquisition system, Chengdu TME Technology Adult C57BL/6J mice (8-week old, 18-22 g) were Co, Ltd, Sichuan, China) filled with KREBs solution purchased from Vital River Laboratories (Beijing, China), maintained at 37ºC and aerated with 95% O and 5% CO . housed with free access to food and water and maintained 2 2 DSM strips were passively stretched and equilibrated for on a 12 hour light/dark cycle. Mice were anesthetized by 1.5 hour. After equilibration, KCl (80 mM) or carbachol 5% chloral hydrate and the whole bladder was removed, (10 µM) were applied to pre-contract the DSM strips. placed into cold Tyrode solution composed of (mM): CLQ, denatonium, and quinine were prepared as 1, 000x 137 NaCl, 5.4 KCl, 1.8 CaCl , 1.0 MgCl , 10 glucose, 10 2 2 in MilliQ water just before use. The equal volume of HEPES, (pH 7.4). After the cleaning of the fat tissues, the MilliQ water was used as positive controls. When the bladder was cut into two longitudinal pieces by using a contraction responses were stable, cumulative CLQ (100 fine dissecting scissors along the axis from the neck to the nM to 3 mM) or the positive controls was added to the fundus. Then, the urothelium was carefully removed. The chambers. To analyze the effects of CLQ, denatonium, DSM tissues were collected for organ baths or RT-qPCR and quinine, the stable contractions induced by KCl experiments. (80 mM) or carbachol (10 µM) was taken as 100% and www.impactjournals.com/oncotarget 21164 Oncotarget the responses to subsequent bitter tastants or control Cystometry applications were normalized. For EFS experiments, DSM contractions were generated by applying increasing EFS As reported previously [42], the mice underwent a frequencies (0.5, 2, 3.5, 5, 7.5, 10, 12.5, 15, 20, 30, 40, surgical procedure for catheter (PE-10) insertion. The mice 50 Hz). EFS pulses were generated using the BL-420F were anesthetized with 5% chloral hydrate. The abdomen acquisition system (Chengdu TME Technology Co, Ltd) was opened and a PE-10 catheter was inserted into the and had the following parameters: pulse amplitude was 20 bladder and fixed with a surgeon’s knot. After closure the V, pulse width was 0.75 ms, stimulus duration was 3 s, and muscle, the catheter was tunneled subcutaneously and an polarity was reversed for alternating pulses according to a orifice made at the back of the animal. Three days after previous study [25]. Five minutes after the addition of 100 surgery, conscious mice were placed in cages without any µM CLQ, a second EFS stimulation with same frequencies restraints. The PE-10 tube was connected to a pressure was applied. To analyze the effects of CLQ on the EFS transducer (LABORIE, Canada) and an infusion pump generated contractions, the contraction amplitude at 0.5 (B. Braun Medical, Inc., Germany) through a 3-way Hz of the first EFS stimulation was taken as one and the tap. Saline solution (37ºC) was infused into the bladder other contraction amplitudes were normalized to it and at a rate of 1.2 ml/h. Urodynamic values were recorded shown as fold changes. continuously using data acquisition software (LABORIE, Canada). The following cystometric parameters were Partial bladder outlet obstruction recorded and analyzed in this study: maximal micturition pressure at the start of micturition, micturition frequency, The OAB mouse model was induced with female and inter-micturition interval. C57BL/6J mice (8-week old, 18-22g) as previously described [41]. In brief, mice were anesthetized with 5% Statistical analysis chloral hydrate, then abdomen was opened by a lower midline incision. The bladder and urethra were carefully Data were represented as mean ± SEM of n strips separated from the surrounding tissues. After placing a 0.5- in organ bath experiments and N mice in histological- mm metal rod alongside the proximal urethra, a 4-0 nylon examination/cystometry experiments. Significant ligature was tied both the rod and the urethra to make differences were determined by Student’s t-test. Only an infravesical obstruction. The rod was subsequently results with values of p < 0.05 were considered significant. removed, before closing the abdomen. Sham-operated animals served as controls. Two weeks after surgery, the PBOO mice were divided into two subgroups as follows: ACKNOWLEDGMENTS one group received once 30 mg/kg of CLQ for 6 weeks via oral gavage (as PBOO-CLQ mice), and the other group We thank the staff in the Department of Urology at received normal saline (as PBOO-Vehicle mice). The Peking University First Hospital for the help of collecting sham-operated mice received normal saline only. human bladder tissues. We thank Xudong Zhao and Su Liu for technical supports and the animal core facility for Histological examination efficient animal care. Authors’ contributions The urinary bladders were fixed with 4% paraformaldehyde, embedded in paraffin and sectioned (5 µm) onto glass slides. HE staining and Masson’s trichrome GJ, KZ, and JJ conceived and designed the staining were carried out by using standard protocols. experiments. KZ, ZY, XZ, EN, and YW performed the Images were acquired on a Leica SCN400 Scanner experiments. KZ and ZY analyzed the data. YM, QL, SW, microscope (Leica). To determine the bladder muscle and LM contributed to reagents/materials/analysis tools. thickness, images of HE staining were analyzed by Image KZ and GJ wrote the paper. All authors gave final approval J. Nine non-overlapping fields per mouse bladder were for publication. measured and the mean of the bladder muscle thickness was calculated. To measure the ratio of collagen/muscle CONFLICTS OF INTERESTS in the bladder muscle layer, images of masson’s trichrome staining were analyzed by using Image Pro Plus software. The authors declare no financial conflicts of interest. Through color recognition, this system automatically measures the area of each color. Nine fields per mouse FUNDING bladder were manually chose and analyzed. This analysis was carried out by a single person, who was completely This work was supported by grants from the blinded to the experimental data and all other variables. National Natural Science Foundation of China (31300956 www.impactjournals.com/oncotarget 21165 Oncotarget to ZK) and the National Basic Research Program of China Med. 2010; 16:1299-1304. (2011CB809104 to GJ). 13. Zhang CH, Chen C, Lifshitz LM, Fogarty KE, Zhu MS and ZhuGe R. Activation of BK channels may not be required REFERENCES for bitter tastant-induced bronchodilation. Nat Med. 2012; 18:648-650. 1. Abrams P, Kelleher CJ, Kerr LA and Rogers RG. 14. Zhang CH, Lifshitz LM, Uy KF, Ikebe M, Fogarty KE and Overactive bladder significantly affects quality of life. Am ZhuGe R. The cellular and molecular basis of bitter tastant- J Manag Care. 2000; 6:S580-S590. induced bronchodilation. PLoS Biol. 2013; 11:e1001501. 2. Wein AJ and Rackley RR. Overactive bladder: a better 15. Zhang T, Luo XJ, Sai WB, Yu MF, Li WE, Ma YF, Chen understanding of pathophysiology, diagnosis and W, Zhai K, Qin G, Guo D, Zheng YM, Wang YX, Shen JH, management. J Urol. 2006; 175:S5-10. et al. Non-selective cation channels mediate chloroquine- 3. Irwin DE, Milsom I, Hunskaar S, Reilly K, Kopp Z, induced relaxation in precontracted mouse airway smooth Herschorn S, Coyne K, Kelleher C, Hampel C, Artibani muscle. PLoS One. 2014; 9:e101578. W and Abrams P. Population-based survey of urinary 16. Foster SR, Blank K, See Hoe LE, Behrens M, Meyerhof incontinence, overactive bladder, and other lower urinary W, Peart JN and Thomas WG. Bitter taste receptor agonists tract symptoms in five countries: results of the EPIC study. elicit G-protein-dependent negative inotropy in the murine Eur Urol. 2006; 50:1306-1314. heart. FASEB J. 2014; 28:4497-4508. 4. Stewart WF, Van Rooyen JB, Cundiff GW, Abrams P, 17. Clark AA, Dotson CD, Elson AE, Voigt A, Boehm U, Herzog AR, Corey R, Hunt TL and Wein AJ. Prevalence Meyerhof W, Steinle NI and Munger SD. TAS2R bitter and burden of overactive bladder in the United States. taste receptors regulate thyroid function. FASEB J. 2015; World J Urol. 2003; 20:327-336. 29:164-172. 5. Wen JG, Li JS, Wang ZM, Huang CX, Shang XP, Su 18. Avau B, Rotondo A, Thijs T, Andrews CN, Janssen P, ZQ, Lu YT, Suo ZH, Wang Y, Qin GJ, Zhang WX and Tack J and Depoortere I. Targeting extra-oral bitter taste Heesakkers JP. The prevalence and risk factors of OAB in receptors modulates gastrointestinal motility with effects on middle-aged and old people in China. Neurourol Urodyn. satiation. Sci Rep. 2015; 5:15985. 2014; 33:387-391. 19. Meyerhof W, Batram C, Kuhn C, Brockhoff A, Chudoba 6. Athanasopoulos A, Chapple C, Fowler C, Gratzke C, Kaplan E, Bufe B, Appendino G and Behrens M. The molecular S, Stief C and Tubaro A. The role of antimuscarinics in the receptive ranges of human TAS2R bitter taste receptors. management of men with symptoms of overactive bladder Chem Senses. 2010; 35:157-170. associated with concomitant bladder outlet obstruction: an 20. Grassin-Delyle S, Abrial C, Fayad-Kobeissi S, Brollo update. Eur Urol. 2011; 60:94-105. M, Faisy C, Alvarez JC, Naline E and Devillier P. The 7. Buser N, Ivic S, Kessler TM, Kessels AGH and Bachmann expression and relaxant effect of bitter taste receptors in LM. Efficacy and Adverse Events of Antimuscarinics for human bronchi. Resp Res. 2013; 14. Treating Overactive Bladder: Network Meta-analyses. Eur 21. Bassoli A, Borgonovo G, Caremoli F and Mancuso G. The Urol. 2012; 62:1040-1060. taste of D- and L-amino acids: In vitro binding assays 8. Irwin DE, Kopp ZS, Agatep B, Milsom I and Abrams P. with cloned human bitter (TAS2Rs) and sweet (TAS1R2/ Worldwide prevalence estimates of lower urinary tract TAS1R3) receptors. Food Chem. 2014; 150:27-33. symptoms, overactive bladder, urinary incontinence and 22. Mills IW, Greenland JE, McMurray G, McCoy R, Ho KM, bladder outlet obstruction. BJU Int. 2011; 108:1132-1138. Noble JG and Brading AF. Studies of the pathophysiology 9. Behrens M and Meyerhof W. Bitter taste receptors and of idiopathic detrusor instability: the physiological human bitter taste perception. Cell Mol Life Sci. 2006; properties of the detrusor smooth muscle and its pattern of 63:1501-1509. innervation. J Urol. 2000; 163:646-651. 10. Overington JP, Al-Lazikani B and Hopkins AL. How many 23. Hristov KL, Parajuli SP, Soder RP, Cheng Q, Rovner ES drug targets are there? Nat Rev Drug Discov. 2006; 5:993- and Petkov GV. Suppression of human detrusor smooth 996. muscle excitability and contractility via pharmacological 11. Insel PA, Snead A, Murray F, Zhang L, Yokouchi H, activation of large conductance Ca2+-activated K+ Katakia T, Kwon O, Dimucci D and Wilderman A. GPCR channels. Am J Physiol Cell Physiol. 2012; 302:C1632- expression in tissues and cells: are the optimal receptors 1641. being used as drug targets? Br J Pharmacol. 2012; 24. Yamanishi T, Kaga K, Fuse M, Shibata C, Kamai T and 165:1613-1616. Uchiyama T. The role of muscarinic receptor subtypes on 12. Deshpande DA, Wang WC, McIlmoyle EL, Robinett KS, carbachol-induced contraction of normal human detrusor Schillinger RM, An SS, Sham JS and Liggett SB. Bitter and overactive detrusor associated with benign prostatic taste receptors on airway smooth muscle bronchodilate by hyperplasia. J Pharmacol Sci. 2015; 128:65-70. localized calcium signaling and reverse obstruction. Nat 25. Afeli SA, Rovner ES and Petkov GV. SK but not IK www.impactjournals.com/oncotarget 21166 Oncotarget channels regulate human detrusor smooth muscle 35. Sibley GN. The physiological response of the detrusor spontaneous and nerve-evoked contractions. Am J Physiol muscle to experimental bladder outflow obstruction in the Renal Physiol. 2012; 303:F559-568. pig. British journal of urology. 1987; 60:332-336. 26. Shah AS, Ben-Shahar Y, Moninger TO, Kline JN and 36. Harrison SC, Hunnam GR, Farman P, Ferguson DR and Welsh MJ. Motile cilia of human airway epithelia are Doyle PT. Bladder instability and denervation in patients chemosensory. Science. 2009; 325:1131-1134. with bladder outflow obstruction. Br J Urol. 1987; 60:519- 27. Tizzano M, Gulbransen BD, Vandenbeuch A, Clapp 522. TR, Herman JP, Sibhatu HM, Churchill ME, Silver WL, 37. Long L, Yang X, Southwood M, Lu J, Marciniak SJ, Kinnamon SC and Finger TE. Nasal chemosensory cells use Dunmore BJ and Morrell NW. Chloroquine prevents bitter taste signaling to detect irritants and bacterial signals. progression of experimental pulmonary hypertension via Proc Natl Acad Sci U S A. 2010; 107:3210-3215. inhibition of autophagy and lysosomal bone morphogenetic 28. Tizzano M, Cristofoletti M, Sbarbati A and Finger TE. protein type II receptor degradation. Circ Res. 2013; Expression of taste receptors in solitary chemosensory cells 112:1159-1170. of rodent airways. BMC Pulm Med. 2011; 11:3. 38. Zhai K, Hubert F, Nicolas V, Ji G, Fischmeister R 29. Sexton JD, Deloron P, Bugilimfura L, Ntilivamunda A and and Leblais V. beta-Adrenergic cAMP signals are Neill M. Parasitologic and clinical efficacy of 25 and 50 mg/ predominantly regulated by phosphodiesterase type 4 in kg of chloroquine for treatment of Plasmodium falciparum cultured adult rat aortic smooth muscle cells. PLoS One. malaria in Rwandan children. Am J Trop Med Hyg. 1988; 2012; 7:e47826. 38:237-243. 39. Zhai K, Chang Y, Wei B, Liu Q, Leblais V, Fischmeister 30. Zhu X, Pan Y, Li Y, Jiang Y, Shang H, Gowda DC, Cui L R and Ji G. Phosphodiesterase types 3 and 4 regulate the and Cao Y. Targeting Toll-like receptors by chloroquine phasic contraction of neonatal rat bladder smooth myocytes protects mice from experimental cerebral malaria. Int via distinct mechanisms. Cell Signal. 2014; 26:1001-1010. Immunopharmacol. 2012; 13:392-397. 40. Hubert F, Belacel-Ouari M, Manoury B, Zhai K, Domergue- 31. Ramadan A, Wheatcroft MD, Quan A, Singh KK, Lovren F, Dupont V, Mateo P, Joubert F, Fischmeister R and Leblais Dhingra N, Teoh H, Al-Omran M, Leong-Poi H and Verma V. Alteration of vascular reactivity in heart failure: Role S. Effects of long-term chloroquine administration on the of phosphodiesterases type 3 and 4. Br J Pharmacol. natural history of aortic aneurysms in mice. Can J Physiol 2014;171:5361-5375. Pharmacol. 2015; 93:641-648. 41. Pandita RK, Fujiwara M, Alm P and Andersson KE. 32. Moore BR, Page-Sharp M, Stoney JR, Ilett KF, Jago JD Cystometric evaluation of bladder function in non- and Batty KT. Pharmacokinetics, pharmacodynamics, anesthetized mice with and without bladder outlet and allometric scaling of chloroquine in a murine malaria obstruction. J Urol. 2000; 164:1385-1389. model. Antimicrob Agents Chemother. 2011; 55:3899- 42. Uvin P, Everaerts W, Pinto S, Alpizar YA, Boudes M, 3907. Gevaert T, Voets T, Nilius B, Talavera K and De Ridder 33. Wetsteyn JC, De Vries PJ, Oosterhuis B and Van Boxtel D. The Use of Cystometry in Small Rodents: A Study of CJ. The pharmacokinetics of three multiple dose regimens Bladder Chemosensation. J Vis Exp. 2012; (66): e3869. of chloroquine: implications for malaria chemoprophylaxis. Br J Clin Pharmacol. 1995; 39:696-699. 34. Mirone V, Imbimbo C, Longo N and Fusco F. The detrusor muscle: an innocent victim of bladder outlet obstruction. Eur Urol. 2007; 51:57-66.