DOCSLIB.ORG

Supplementary Tables Supplemental Table S1: Comparison of the Coverage of Reference Panels Used for SNP Imputation. the Markers

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Tables Supplemental Table S1: Comparison of the Coverage of Reference Panels Used for SNP Imputation. the Markers Supplementary Tables Supplemental Table S1: Comparison of the coverage of reference panels used for SNP imputation. The markers on the Consortium on Asthma among African-ancestry Populations in the Americas (CAAPA) reference panel and Haplotype Reference Consortium (HRG) used to impute SNPs from our AA and CAU participants were compared to one thousand genomes (1kG) dataset. Loci information CAAPA vs 1kG HRC vs 1kG Total loci 45,639,158 90,558,388 Overlapping loci 24,880,301 49,826,569 Percent overlap 54.52% 55.02% 1kG-only loci 9,363,544 15,148,191 Ref-only loci 8,461,186 22,649,501 Supplemental Table S2: SNP imputation results. The total number of SNPs imputed for the AA and CAU participants either using the Michigan imputation server (Minimac) or Beagle. Targets prepared for: AA CAU Beagle 730,616 726,165 Minimac 698,343 660,733 Supplemental Table S3: Allele frequencies of TA2R38 SNPs by each ancestral group and time point. The rs number of each SNP, the location of SNP buy chromosome (CHR) and base pair position (POS) is provided along with the allele frequency (ALLELE:FREQ) for each SNP. Baseline 6-month Baseline 6-month AA (N = 297) AA (N = 234) CAU (N = 198) CAU (N = 151) SNP CHR POS ALLELE:FREQ ALLELE:FREQ ALLELE:FREQ ALLELE:FREQ rs10246939 7 141672604 T:0.49 C:0.51 T:0.50 C:0.50 T:0.54 C:0.46 T:0.54 C:0.46 rs1726866 7 141672705 G:0.68 A:0.32 G:0.68 A:0.32 G:0.46 A:0.54 G:0.46 A:0.54 rs713598 7 141673345 C:0.50 G:0.50 C:0.50 G:0.50 C:0.58 G:0.42 C:0.58 G:0.42 Supplemental Table S4: Linkage disequilibrium analysis of TAS2R38 SNPs at each time point of the intervention. Statistical analyses of linkage disequilibrium are represented by R- squared (R^2) and Dprime values of the pairwise comparisons of the indicated SNPs from the AA and CAU participants at either the baseline or 6-month time point are indicated. Baseline 6-month Baseline 6-month AA (N = 297) AA (N = 234) CAU (N = 198) CAU (N = 151) POS1 POS2 R^2 Dprime R^2 Dprime R^2 Dprime R^2 Dprime rs10246939 rs1726866 0.49 -1.00 0.47 -1.00 0.98 -0.99 0.97 -0.99 rs10246939 rs713598 0.95 0.99 0.96 0.98 0.84 1.00 0.84 1.00 rs1726866 rs713598 0.46 -0.98 0.44 -0.97 0.84 -1.00 0.84 -1.00 Supplemental Table 5: Haplotype distribution of TAS2R38 alleles at each time point of the intervention. The plus strand haplotype sequence (HAPLO), the count of each haplotype, and the resulting amino acid sequence of the allele are indicated from the AA and CAU participants at either the baseline or 6-month time point. AA Baseline (N = 297) Allele:frequency C:G:G:0.500 T:A:C:0.318 T:G:C:0.171 C:G:C:0.008 T:A:G:0.003 Haplotype PAV AVI AAI AAV PVI AA 6-month (N = 234) Allele:frequency C:G:G:0.500 T:A:C:0.314 T:G:C:0.180 C:G:C:0.006 T:A:G:0.003 Haplotype PAV AVI AAI AAV PVI CAU Baseline (N = 198) Allele:frequency C:G:G:0.422 T:A:C:0.533 T:G:C:0.003 C:G:C:0.040 C:A:C:0.003 Haplotype PAV AVI AAI AAV AVV CAU 6-month (N = 151) Allele:frequency C:G:G:0.417 T:A:C:0.536 T:G:C:0.003 C:G:C:0.040 C:A:C:0.003 Haplotype PAV AVI AAI AAV AVV Supplemental Table 6: T2R gene family member SNPs used in multivariate analysis. Tagged SNPs of T2R gene family members were used for principal components analyses. The associated gene and the location of the SNP are indicated by the chromosome number (CHR) and basepair position (POS). The type of SNP (Type) indicates whether the SNP is in a non- coding region otherwise, the type of coding-region SNP is indicated (synonymous, missense, or nonsense). SNP Gene CHR POS Type rs41467 TAS2R1 5 9628089 non-coding rs2234233 TAS2R1 5 9629529 missense R206W rs1357949 TAS2R16 7 122633264 non-coding rs6466849 TAS2R16 7 122633654 non-coding rs860170 TAS2R16 7 122635024 missense H222R rs978739 TAS2R16 7 122635900 non-coding rs11763979 TAS2R3 7 141462537 non-coding rs2233998 TAS2R4 7 141478308 missense F7S rs2234001 TAS2R4 7 141478574 missense V96L rs2227264 TAS2R5 7 141490238 missense S26I rs10246939 TAS2R38 7 141672604 missense I296V rs1726866 TAS2R38 7 141672705 missense V262A rs713598 TAS2R38 7 141673345 missense A49P rs4726600 TAS2R39 7 142881540 non-coding rs10260248 TAS2R40 7 142919731 missense S187Y rs534126 TAS2R40 7 142921234 non-coding rs4595035 TAS2R60 7 143141475 synonymous R310R rs1404635 TAS2R41 7 143175154 synonymous T63T rs10278721 TAS2R41 7 143175345 missense P127L rs2588350 TAS2R7 12 10953057 non-coding downstream rs619381 TAS2R7 12 10954258 missense M304I rs3741845 TAS2R9 12 10962115 missense V187A rs11610105 TAS2R14 12 11088981 non-coding rs3741843 TAS2R14 12 11091432 synonymous R125R rs3916060 TAS2R14 12 11093073 non-coding rs10772397 TAS2R50 12 11138680 synonymous P259P rs1376251 TAS2R50 12 11138852 missense C203Y rs6488334 TAS2R50 12 11140444 non-coding rs7135018 TAS2R20 12 11150240 missense K79E rs7301234 TAS2R20 12 11150884 non-coding rs10772408 TAS2R20 12 11151599 non-coding rs10772420 TAS2R19 12 11174276 missense R299C rs10845293 TAS2R31 12 11183255 missense A227V rs12370363 TAS2R31 12 11183512 synonymous A141A rs10845296 TAS2R31 12 11184140 non-coding rs2708381 TAS2R46 12 11214145 nonsense rs2708380 TAS2R46 12 11214212 missense L228M rs2599404 TAS2R30 12 11286088 missense F252L rs5020531 TAS2R42 12 11338957 missense F196S Supplemental Table 7: Factor loadings of the principal components analysis. The two principal components (PC) with the highest absolute correlation value of the adjusted predicted vegetable intake (used as a supplementary variable) for the AA and CAU groups are listed. For each SNP listed (loading > 0.3) the name of the gene and the factor loadings for the indicated component is provided. The light shaded rows indicate the TAS2R38 SNPs found in both analyses, the dark shaded rows are the other common SNPs found in the AA and CAU analyses, and † indicate SNPs with loading values higher than TAS2R38 SNPs. AA SNPs Gene PC4 PC5 rs1357949 TAS2R16 0.067991 0.308476 rs10246939 TAS2R38 -0.811926 0.202478 rs1726866 TAS2R38 0.773523 -0.02864 rs713598 TAS2R38 -0.811926 0.202478 rs4726600 TAS2R39 0.311989 0.106534 rs1404635 TAS2R41 0.434598 0.286556 rs10278721 TAS2R41 0.434598 0.286556 rs3916060 TAS2R14 0.121297 0.322448 rs1376251 TAS2R50 -0.136807 0.533771 rs7301234 TAS2R20 -0.175053 0.489455 rs10772408 TAS2R20 -0.051528 0.542298 Vegetables 0.11937 -0.12642 CAU SNPs Gene PC2 PC4 †rs11763979 TAS2R3 -0.779291 -0.017023 †rs2233998 TAS2R4 0.78411 0.023687 †rs2234001 TAS2R4 0.792898 0.045053 †rs2227264 TAS2R5 0.78411 0.023687 rs10246939 TAS2R38 0.657516 0.207052 rs1726866 TAS2R38 -0.650735 -0.197802 rs713598 TAS2R38 0.657516 0.207052 rs619381 TAS2R7 0.444284 -0.286315 rs3741843 TAS2R14 0.546394 -0.323296 rs1376251 TAS2R50 -0.039337 0.62516 rs6488334 TAS2R50 -0.177979 0.361978 rs7135018 TAS2R20 -0.206689 0.366842 rs7301234 TAS2R20 -0.024468 0.629872 rs10772408 TAS2R20 -0.212275 0.952096 rs10772420 TAS2R19 -0.346851 -0.360205 rs10845293 TAS2R31 -0.346851 -0.360205 rs12370363 TAS2R31 -0.205156 0.373125 rs10845296 TAS2R31 0.507478 -0.220709 rs2708381 TAS2R46 -0.205156 0.373125 rs2708380 TAS2R46 -0.355818 -0.356567 rs2599404 TAS2R30 -0.341294 -0.34939 Vegetables -0.12746 -0.13737 Supplemental Table 8: T2R gene family member SNPs used in multivariate analysis. Tagged SNPs of several T2R gene family members were included in the principal components analyses. The associated gene and the location of the SNP are indicated by the chromosome number (CHR) and basepair position (POS). The type of SNP (Type) indicates whether the SNP is in a non-coding region otherwise, the type of coding-region SNP is indicated (synonymous, missense, or nonsense). HHL cohort CAU cohort SNP Gene Chr Pos p (SNP) p (SNP:time) p (SNP) p (SNP:time) rs11763979 TAS2R3 7 141462537 0.7204 0.6573 0.9544 0.5056 rs2233998 TAS2R4 7 141478308 0.6953 0.5778 0.9424 0.5402 rs2234001 TAS2R4 7 141478574 0.9388 0.9855 0.9168 0.5965 rs2227264 TAS2R5 7 141490238 0.7204 0.6573 0.9544 0.5056 .
Load more

Recommended publications
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]
  • TAS2R20 Variants Confer Dietary Adaptation to High-Quercitrin Bamboo Leaves in Qinling Giant Pandas
    TAS2R20 variants confer dietary adaptation to high-quercitrin bamboo leaves in Qinling giant pandas Xiangxu Hu1, Guan Wang2, Lei Shan3, Shuyan Sun1, Yibo Hu1, and Fuwen Wei1 1Institute of Zoology Chinese Academy of Sciences 2Affiliation not available 3Nanjing Normal University College of Life Sciences May 5, 2020 Abstract Abstract: Sensitivity to bitter tastes provides animals with an important means of interacting with their environment and thus, influences their dietary preferences. Genetic variants encoding functionally distinct receptor types contribute to variation in bitter taste sensitivity. Our previous study showed that two nonsynonymous sites, A52V and Q296H, in the TAS2R20 gene are directionally selected in giant pandas from the Qinling Mountains, which are speculated to be the causative base-pair changes of Qinling pandas for the higher preference for bamboo leaves in comparison with other pandas. Here, we used functional expression in engineered cells to identify agonists of pTAS2R20 (i.e. giant panda's TAS2R20) and interrogated the differences in perception in the in vitro responses of pTAS2R20 variants to the agonists. Our results show that pTAS2R20 is specifically activated by quercitrin and that pTAS2R20 variants exhibit differences in the sensitivity of their response to the agonist. Compared to pTAS2R20 in pandas from other areas, the receptor variant with A52V and Q296H, which is most commonly found in Qinling pandas, confers a significantly decreased sensitivity to quercitrin. We subsequently quantified the quercitrin content of the leaves of bamboo distributed in the Qinling Mountains, which was found to be significantly higher than that of the leaves of bamboo from panda habitats in other areas.
    [Show full text]
  • LETTER Doi:10.1038/Nature09515
    LETTER doi:10.1038/nature09515 Distant metastasis occurs late during the genetic evolution of pancreatic cancer Shinichi Yachida1*, Siaˆn Jones2*, Ivana Bozic3, Tibor Antal3,4, Rebecca Leary2, Baojin Fu1, Mihoko Kamiyama1, Ralph H. Hruban1,5, James R. Eshleman1, Martin A. Nowak3, Victor E. Velculescu2, Kenneth W. Kinzler2, Bert Vogelstein2 & Christine A. Iacobuzio-Donahue1,5,6 Metastasis, the dissemination and growth of neoplastic cells in an were present in the primary pancreatic tumours from which the meta- organ distinct from that in which they originated1,2, is the most stases arose. A small number of these samples of interest were cell lines common cause of death in cancer patients. This is particularly true or xenografts, similar to the index lesions, whereas the majority were for pancreatic cancers, where most patients are diagnosed with fresh-frozen tissues that contained admixed neoplastic, stromal, metastatic disease and few show a sustained response to chemo- inflammatory, endothelial and normal epithelial cells (Fig. 1a). Each therapy or radiation therapy3. Whether the dismal prognosis of tissue sample was therefore microdissected to minimize contaminat- patients with pancreatic cancer compared to patients with other ing non-neoplastic elements before purifying DNA. types of cancer is a result of late diagnosis or early dissemination of Two categories of mutations were identified (Fig. 1b). The first and disease to distant organs is not known. Here we rely on data gen- largest category corresponded to those mutations present in all samples erated by sequencing the genomes of seven pancreatic cancer meta- from a given patient (‘founder’ mutations, mean of 64%, range 48–83% stases to evaluate the clonal relationships among primary and of all mutations per patient; Fig.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Reyna Alejandra Jiménez Flores
    TESIS DOCTORAL Actividad citotóxica del éter-lípido edelfosina en células de cáncer de hígado. Reyna Alejandra Jiménez Flores Director de tesis: Faustino Mollinedo García CENTRO DE INVESTIGACIÓN DEL CÁNCER UNIVERSIDAD DE SALAMANCA – CSIC SALAMANCA 2015 El Dr. Faustino Mollinedo García, Profesor de Investigación del Consejo Superior de Investigaciones Científicas (CSIC) y miembro del Instituto de Biología Molecular y Celular del Cáncer de la Universidad de Salamanca. CERTIFICA: Que la memoria de tesis titulada “Actividad citotoxica del éter‐lípido edelfosina en células de cáncer de hígado” presentado por Dña. Reyna Alejandra Jiménez Flores, ha sido realizada bajo su dirección en el Instituto de Biología Molecular y Celular del Cáncer y reúne, a su juicio, originalidad y contenidos suficientes para que sea presentada ante el tribunal correspondiente y optar al grado de Doctor por la Universidad de Salamanca. Y para que así conste, a efectos legales, expide el presente certificado en Salamanca, a 16 de noviembre de 2015. Dr. Faustino Mollinedo García Director de la tesis A mis padres y a mi hermana A Paula y a David FIDES No te resignes antes de perder definitiva, irrevocablemente La batalla que libras. Lucha erguido y sin contar las enemigas huestes. ¡Mientras veas resquicios de esperanza, no te rindas!. La suerte gusta de acumular los imposibles para vencerlos en conjunto, siempre, con el fatal y misterioso golpe de su masa de Hércules.... ¿Sabes tu si el instante en que, ya fatigado, desesperes, es justo aquel que a la definitiva realización de tu ideal precede?. Quien alienta una fe tenaz, al hado más torvo compromete en su favor.
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 9,347,934 B2 Shekdar Et Al
    USOO9347934B2 (12) United States Patent (10) Patent No.: US 9,347,934 B2 Shekdar et al. (45) Date of Patent: May 24, 2016 (54) ASSAYS FOR IDENTIFYING COMPOUNDS 2008, OO38739 A1 2/2008 Li et al. THAT MODULATE BITTERTASTE 2008/0167286 A1* 7/2008 Gopalakrishnan et al. ........................ 514,21016 (71) Applicants: CHROMOCELL CORPORATION, 2010/01298.33 A1* 5/2010 Brune et al. ................. 435/721 North Brunswick, NJ (US); KRAFT FOODS GROUP BRANDS LLC, FOREIGN PATENT DOCUMENTS Northfield, IL (US) CN 1341632 A 3, 2002 CN 101583717 A 11, 2009 (72) Inventors: Kambiz Shekdar, New York, NY (US); CN 101828.111 A 9, 2010 Purvi Manoj Shah, Bridgewater, NJ WO WO-0038536 A2 7, 2000 WO WO-2004O29087 4/2004 (US); Joseph Gunnet, Flemington, NJ WO WO-2006053771 A2 5, 2006 (US); Jane V. Leland, Wilmette, IL WO WO-2007002026 A2 1/2007 (US); Peter H. Brown, Glenview, IL WO WO-2008057470 5, 2008 (US); Louise Slade, Morris Plains, NJ WO WO-2008119.195 A1 10, 2008 (US) WO WO-20081191.96 10, 2008 WO WO-20081191.97 10, 2008 (73) Assignees: Chromocell Corporation, North W WSi. A2 1929 Brunswick, NJ (US); Kraft Foods WO WO-2010O886.33 8, 2010 Group Brands LLC, Northfield, IL WO WO-2010O99983 A1 9, 2010 (US) WO WO-2013022947 2, 2013 (*) Notice: Subject to any disclaimer, the term of this OTHER PUBLICATIONS patent is extended or adjusted under 35 U.S.C. 154(b) by 0 days. Bachmanov et al., Taste Receptor Genes, 2007, 27:389-414.* Behrens et al., Structural Requirements for Bitter Taste Receptor (21) Appl.
    [Show full text]
  • Modulation of Food Intake by Differential TAS2R Stimulation In
    nutrients Article Modulation of Food Intake by Differential TAS2R Stimulation in Rat Carme Grau-Bové 1, Alba Miguéns-Gómez 1 , Carlos González-Quilen 1 , José-Antonio Fernández-López 2,3 , Xavier Remesar 2,3 , Cristina Torres-Fuentes 4 , Javier Ávila-Román 4 , Esther Rodríguez-Gallego 1, Raúl Beltrán-Debón 1 , M Teresa Blay 1 , Ximena Terra 1 , Anna Ardévol 1,* and Montserrat Pinent 1 1 MoBioFood Research Group, Department of Biochemistry and Biotechnology, Universitat Rovira i Virgili, 43007 Tarragona, Spain; [email protected] (C.G.-B.); [email protected] (A.M.-G.); [email protected] (C.G.-Q.); [email protected] (E.R.-G.); [email protected] (R.B.-D.); [email protected] (M.T.B.); [email protected] (X.T.); [email protected] (M.P.) 2 Department of Biochemistry and Molecular Biomedicine, Faculty of Biology, University of Barcelona, Av. Diagonal 643, 08028 Barcelona, Spain; [email protected] (J.-A.F.-L.); [email protected] (X.R.) 3 CIBER Obesity and Nutrition, Institute of Health Carlos III, Av. Diagonal 643, 08028 Barcelona, Spain 4 Nutrigenomics Research Group, Department of Biochemistry and Biotechnology, Universitat Rovira i Virgili, 43007 Tarragona, Spain; [email protected] (C.T.-F.); [email protected] (J.Á.-R.) * Correspondence: [email protected]; Tel.: +34-977-559-566 Received: 31 October 2020; Accepted: 4 December 2020; Published: 10 December 2020 Abstract: Metabolic surgery modulates the enterohormone profile, which leads, among other effects, to changes in food intake. Bitter taste receptors (TAS2Rs) have been identified in the gastrointestinal tract and specific stimulation of these has been linked to the control of ghrelin secretion.
    [Show full text]
  • G Protein-Coupled Receptors
    S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2015/16: G protein-coupled receptors. British Journal of Pharmacology (2015) 172, 5744–5869 THE CONCISE GUIDE TO PHARMACOLOGY 2015/16: G protein-coupled receptors Stephen PH Alexander1, Anthony P Davenport2, Eamonn Kelly3, Neil Marrion3, John A Peters4, Helen E Benson5, Elena Faccenda5, Adam J Pawson5, Joanna L Sharman5, Christopher Southan5, Jamie A Davies5 and CGTP Collaborators 1School of Biomedical Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK, 2Clinical Pharmacology Unit, University of Cambridge, Cambridge, CB2 0QQ, UK, 3School of Physiology and Pharmacology, University of Bristol, Bristol, BS8 1TD, UK, 4Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK, 5Centre for Integrative Physiology, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2015/16 provides concise overviews of the key properties of over 1750 human drug targets with their pharmacology, plus links to an open access knowledgebase of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties. The full contents can be found at http://onlinelibrary.wiley.com/doi/ 10.1111/bph.13348/full. G protein-coupled receptors are one of the eight major pharmacological targets into which the Guide is divided, with the others being: ligand-gated ion channels, voltage-gated ion channels, other ion channels, nuclear hormone receptors, catalytic receptors, enzymes and transporters. These are presented with nomenclature guidance and summary information on the best available pharmacological tools, alongside key references and suggestions for further reading.
    [Show full text]
  • G Protein‐Coupled Receptors
    S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2019/20: G protein-coupled receptors. British Journal of Pharmacology (2019) 176, S21–S141 THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: G protein-coupled receptors Stephen PH Alexander1 , Arthur Christopoulos2 , Anthony P Davenport3 , Eamonn Kelly4, Alistair Mathie5 , John A Peters6 , Emma L Veale5 ,JaneFArmstrong7 , Elena Faccenda7 ,SimonDHarding7 ,AdamJPawson7 , Joanna L Sharman7 , Christopher Southan7 , Jamie A Davies7 and CGTP Collaborators 1School of Life Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK 2Monash Institute of Pharmaceutical Sciences and Department of Pharmacology, Monash University, Parkville, Victoria 3052, Australia 3Clinical Pharmacology Unit, University of Cambridge, Cambridge, CB2 0QQ, UK 4School of Physiology, Pharmacology and Neuroscience, University of Bristol, Bristol, BS8 1TD, UK 5Medway School of Pharmacy, The Universities of Greenwich and Kent at Medway, Anson Building, Central Avenue, Chatham Maritime, Chatham, Kent, ME4 4TB, UK 6Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK 7Centre for Discovery Brain Sciences, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2019/20 is the fourth in this series of biennial publications. The Concise Guide provides concise overviews of the key properties of nearly 1800 human drug targets with an emphasis on selective pharmacology (where available), plus links to the open access knowledgebase source of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties. Although the Concise Guide represents approximately 400 pages, the material presented is substantially reduced compared to information and links presented on the website.
    [Show full text]
  • Open ALA Thesis.Pdf
    The Pennsylvania State University The Graduate School Department of Food Science BITTER RECEPTOR POLYMORPHISMS INFLUENCE BITTERNESS OF NON- NUTRITIVE SWEETENERS AND ALCOHOLIC BEVERAGE LIKING A Thesis in Food Science by Alissa Allen © 2013 Alissa Allen Submitted in Partial Fulfillment of the Requirements for the Degree of Master of Science May 2013 The thesis of Alissa Allen was reviewed and approved* by the following: John E. Hayes Assistant Professor of Food Science Thesis Advisor Kathleen Keller Assistant Professor of Health and Nutritional Sciences and Food Science Joshua Lambert Assistant Professor of Food Science Robert Roberts Professor of Food Science Head of the Department of Food Science *Signatures are on file in the Graduate School iii ABSTRACT Bitterness is largely aversive and commonly associated with lower liking and intake. However, the ability to perceive bitterness differs across individuals due to genetic variation within bitter receptor genes (TAS2Rs). The goal of the present thesis is to investigate effects of bitter receptor polymorphisms on liking and perception, of reported bitterness and sweetness of non-nutritive and the remembered liking of different alcoholic beverages. The work presented here compares genotypes for putatively functional polymorphisms in bitter receptor genes in attempt to explain individual differences. Major experimental findings include: Study 1- Polymorphisms (SNPs) in bitter receptors TAS2R9 and TAS2R31 explains 13.4% of the variation in the perceived bitterness from Acesulfame K (AceK). Study 2 - The non-nutritive sweetener rebaudioside A (RebA) elicited greater perceived bitterness than rebaudioside D (RebD), with no difference in sweetness intensity. SNPs that were previously reported in Study 1 to explain AceK bitterness were not associated with perceived bitterness of RebA or RebD.
    [Show full text]
  • Bivariate Genome-Wide Association Analysis Strengthens the Role of Bitter Receptor Clusters on Chromosomes 7 and 12 in Human Bitter Taste
    bioRxiv preprint doi: https://doi.org/10.1101/296269; this version posted April 6, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Bivariate genome-wide association analysis strengthens the role of bitter receptor clusters on chromosomes 7 and 12 in human bitter taste Liang-Dar Hwang1,2,3,4, Puya Gharahkhani1, Paul A. S. Breslin5,6, Scott D. Gordon1, Gu Zhu1, Nicholas G. Martin1, Danielle R. Reed5, and Margaret J. Wright2,7 1 QIMR Berghofer Medical Research Institute, Herston, Queensland 4006, Australia 2 Queensland Brain Institute, University of Queensland, St Lucia, Queensland 4072, Australia 3 Faculty of Medicine, University of Queensland, Herston, Queensland 4006, Australia 4 University of Queensland Diamantina Institute, University of Queensland, Translational Research Institute, Woolloongabba, Queensland 4102, Australia 5 Monell Chemical Senses Center, Philadelphia, Pennsylvania 19104, USA 6 Department of Nutritional Sciences, School of Environmental and Biological Sciences, Rutgers University, New Brunswick NJ, 08901 USA 7 Centre for Advanced Imaging, University of Queensland, St Lucia, Queensland 4072, Australia Correspondence to be sent to: Liang-Dar Hwang University of Queensland Diamantina Institute Wolloongabba QLD 4102, Australia Email: [email protected] Telephone: +61 7 3443 7976 Fax: +61 7 3443 6966 1 bioRxiv preprint doi: https://doi.org/10.1101/296269; this version posted April 6, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
    Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013
    [Show full text]