DOCSLIB.ORG

TAS2R10 (NM 023921) Human Untagged Clone – SC305083

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
TAS2R10 (NM 023921) Human Untagged Clone – SC305083 OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC305083 TAS2R10 (NM_023921) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: TAS2R10 (NM_023921) Human Untagged Clone Tag: Tag Free Symbol: TAS2R10 Synonyms: T2R10; TRB2 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_023921, the custom clone sequence may differ by one or more nucleotides ATGCTACGTGTAGTGGAAGGCATCTTCATTTTTGTTGTAGTTAGTGAGTCAGTGTTTGGGGTTTTGGGGA ATGGATTTATTGGACTTGTAAACTGCATTGACTGTGCCAAGAATAAGTTATCTACGATTGGCTTTATTCT CACCGGCTTAGCTATTTCAAGAATTTTTCTGATATGGATAATAATTACAGATGGATTTATACAGATATTC TCTCCAAATATATATGCCTCCGGTAACCTAATTGAATATATTAGTTACTTTTGGGTAATTGGTAATCAAT CAAGTATGTGGTTTGCCACCAGCCTCAGCATCTTCTATTTCCTGAAGATAGCAAATTTTTCCAACTACAT ATTTCTCTGGTTGAAGAGCAGAACAAATATGGTTCTTCCCTTCATGATAGTATTCTTACTTATTTCATCG TTACTTAATTTTGCATACATTGCGAAGATTCTTAATGATTATAAAACGAAGAATGACACAGTCTGGGATC TCAACATGTATAAAAGTGAATACTTTATTAAACAGATTTTGCTAAATCTGGGAGTCATTTTCTTCTTTAC ACTATCCCTAATTACATGTATTTTTTTAATCATTTCCCTTTGGAGACACAACAGGCAGATGCAATCGAAT GTGACAGGATTGAGAGACTCCAACACAGAAGCTCATGTGAAGGCAATGAAAGTTTTGATATCTTTCATCA TCCTCTTTATCTTGTATTTTATAGGCATGGCCATAGAAATATCATGTTTTACTGTGCGAGAAAACAAACT GCTGCTTATGTTTGGAATGACAACCACAGCCATCTATCCCTGGGGTCACTCATTTATCTTAATTCTAGGA AACAGCAAGCTAAAGCAAGCCTCTTTGAGGGTACTGCAGCAATTGAAGTGCTGTGAGAAAAGGAAAAATC TCAGAGTCACATAG Restriction Sites: SgfI-MluI ACCN: NM_023921 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 TAS2R10 (NM_023921) Human Untagged Clone – SC305083 OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at [email protected] or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. RefSeq: NM_023921.1, NP_076410.1 RefSeq Size: 924 bp RefSeq ORF: 924 bp Locus ID: 50839 UniProt ID: Q9NYW0 Protein Families: Transmembrane Protein Pathways: Taste transduction Gene Summary: This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008] This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 2.
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • G Protein-Coupled Receptors
    S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2015/16: G protein-coupled receptors. British Journal of Pharmacology (2015) 172, 5744–5869 THE CONCISE GUIDE TO PHARMACOLOGY 2015/16: G protein-coupled receptors Stephen PH Alexander1, Anthony P Davenport2, Eamonn Kelly3, Neil Marrion3, John A Peters4, Helen E Benson5, Elena Faccenda5, Adam J Pawson5, Joanna L Sharman5, Christopher Southan5, Jamie A Davies5 and CGTP Collaborators 1School of Biomedical Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK, 2Clinical Pharmacology Unit, University of Cambridge, Cambridge, CB2 0QQ, UK, 3School of Physiology and Pharmacology, University of Bristol, Bristol, BS8 1TD, UK, 4Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK, 5Centre for Integrative Physiology, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2015/16 provides concise overviews of the key properties of over 1750 human drug targets with their pharmacology, plus links to an open access knowledgebase of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties. The full contents can be found at http://onlinelibrary.wiley.com/doi/ 10.1111/bph.13348/full. G protein-coupled receptors are one of the eight major pharmacological targets into which the Guide is divided, with the others being: ligand-gated ion channels, voltage-gated ion channels, other ion channels, nuclear hormone receptors, catalytic receptors, enzymes and transporters. These are presented with nomenclature guidance and summary information on the best available pharmacological tools, alongside key references and suggestions for further reading.
    [Show full text]
  • G Protein‐Coupled Receptors
    S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2019/20: G protein-coupled receptors. British Journal of Pharmacology (2019) 176, S21–S141 THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: G protein-coupled receptors Stephen PH Alexander1 , Arthur Christopoulos2 , Anthony P Davenport3 , Eamonn Kelly4, Alistair Mathie5 , John A Peters6 , Emma L Veale5 ,JaneFArmstrong7 , Elena Faccenda7 ,SimonDHarding7 ,AdamJPawson7 , Joanna L Sharman7 , Christopher Southan7 , Jamie A Davies7 and CGTP Collaborators 1School of Life Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK 2Monash Institute of Pharmaceutical Sciences and Department of Pharmacology, Monash University, Parkville, Victoria 3052, Australia 3Clinical Pharmacology Unit, University of Cambridge, Cambridge, CB2 0QQ, UK 4School of Physiology, Pharmacology and Neuroscience, University of Bristol, Bristol, BS8 1TD, UK 5Medway School of Pharmacy, The Universities of Greenwich and Kent at Medway, Anson Building, Central Avenue, Chatham Maritime, Chatham, Kent, ME4 4TB, UK 6Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK 7Centre for Discovery Brain Sciences, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2019/20 is the fourth in this series of biennial publications. The Concise Guide provides concise overviews of the key properties of nearly 1800 human drug targets with an emphasis on selective pharmacology (where available), plus links to the open access knowledgebase source of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties. Although the Concise Guide represents approximately 400 pages, the material presented is substantially reduced compared to information and links presented on the website.
    [Show full text]
  • Methods to Identify Tas2r Modulators Verfahren Zur Identifizierung Von Tas2r Modulatoren Procédé D’Identification De Modulateurs Tas2r
    (19) TZZ _¥¥ _T (11) EP 2 137 322 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: C12Q 1/68 (2006.01) A23L 2/52 (2006.01) 27.02.2013 Bulletin 2013/09 A23G 4/00 (2006.01) C07C 53/134 (2006.01) (21) Application number: 08714784.9 (86) International application number: PCT/CH2008/000134 (22) Date of filing: 27.03.2008 (87) International publication number: WO 2008/119195 (09.10.2008 Gazette 2008/41) (54) METHODS TO IDENTIFY TAS2R MODULATORS VERFAHREN ZUR IDENTIFIZIERUNG VON TAS2R MODULATOREN PROCÉDÉ D’IDENTIFICATION DE MODULATEURS TAS2R (84) Designated Contracting States: • BEHRENS MAIK ET AL: "Members of RTP and AT BE BG CH CY CZ DE DK EE ES FI FR GB GR REEP gene families influence functional bitter HR HU IE IS IT LI LT LU LV MC MT NL NO PL PT taste receptor expression" JOURNAL OF RO SE SI SK TR BIOLOGICAL CHEMISTRY, vol. 281, no. 29, July 2006(2006-07), pages 20650-20659, XP002494217 (30) Priority: 30.03.2007 US 909143 P ISSN: 0021-9258 30.07.2007 US 962549 P • KUHN CHRISTINA ET AL: "Bitter taste receptors for saccharin and acesulfame K" JOURNAL OF (43) Date of publication of application: NEUROSCIENCE, vol. 24, no. 45, 10 November 30.12.2009 Bulletin 2009/53 2004 (2004-11-10), pages 10260-10265, XP002494218 ISSN: 0270-6474 (73) Proprietor: Givaudan SA • BUFE BERND ET AL: "The human TAS2R16 1214 Vernier (CH) receptor mediates bitter taste in response to beta- glucopyranosides" NATURE GENETICS, (72) Inventors: NATURE PUBLISHING GROUP, NEW YORK, US, • BRUNE, Nicole, Erna, Irene vol.
    [Show full text]
  • Bivariate Genome-Wide Association Analysis Strengthens the Role of Bitter Receptor Clusters on Chromosomes 7 and 12 in Human Bitter Taste
    bioRxiv preprint doi: https://doi.org/10.1101/296269; this version posted April 6, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Bivariate genome-wide association analysis strengthens the role of bitter receptor clusters on chromosomes 7 and 12 in human bitter taste Liang-Dar Hwang1,2,3,4, Puya Gharahkhani1, Paul A. S. Breslin5,6, Scott D. Gordon1, Gu Zhu1, Nicholas G. Martin1, Danielle R. Reed5, and Margaret J. Wright2,7 1 QIMR Berghofer Medical Research Institute, Herston, Queensland 4006, Australia 2 Queensland Brain Institute, University of Queensland, St Lucia, Queensland 4072, Australia 3 Faculty of Medicine, University of Queensland, Herston, Queensland 4006, Australia 4 University of Queensland Diamantina Institute, University of Queensland, Translational Research Institute, Woolloongabba, Queensland 4102, Australia 5 Monell Chemical Senses Center, Philadelphia, Pennsylvania 19104, USA 6 Department of Nutritional Sciences, School of Environmental and Biological Sciences, Rutgers University, New Brunswick NJ, 08901 USA 7 Centre for Advanced Imaging, University of Queensland, St Lucia, Queensland 4072, Australia Correspondence to be sent to: Liang-Dar Hwang University of Queensland Diamantina Institute Wolloongabba QLD 4102, Australia Email: [email protected] Telephone: +61 7 3443 7976 Fax: +61 7 3443 6966 1 bioRxiv preprint doi: https://doi.org/10.1101/296269; this version posted April 6, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Prostaglandin E2 As Mediator and Modulator of Airway Smooth Muscle Responses
    Institute of Environmental Medicine Division of Physiology The Unit for Experimental Asthma and Allergy Research Karolinska Institutet, Stockholm, Sweden PROSTAGLANDIN E2 AS MEDIATOR AND MODULATOR OF AIRWAY SMOOTH MUSCLE RESPONSES Jesper Säfholm Stockholm 2013 All published papers were reproduced with permission from the publisher. Published by Karolinska Institutet. Printed by Repro Print AB © Jesper Säfholm, 2013 ISBN 978-91-7549-167-7 Printed by 2013 Gårdsvägen 4, 169 70 Solna To boldly go where a lot of people have gone before ABSTRACT Prostaglandin E2 (PGE2) is a lipid mediator produced by virtually every cell of the human body. Because common non-steroidal anti-inflammatory drugs (NSAIDs) inhibit its biosynthesis, PGE2 is usually considered to be a ‘pro-inflammatory’ mediator. The role of PGE2 in the lung and airways has however always been unclear. In particular, the airway responses caused by activation of its four different EP receptors have been debated. Research on the mechanisms involved in the actions of PGE2 has previously been limited by the low potency and selectivity of available pharmacological tools. Recently, a number of potent receptor antagonists and enzyme inhibitors have become available. The aim of this thesis was therefore to characterise airway responses to PGE2 in greater detail, focusing on the role of its receptors on baseline smooth muscle function and during antigen-induced contractions. Alongside investigating PGE2 responses, the newly discovered relaxant effects of bitter tasting substances acting at their respective receptors (TAS2Rs) were examined. The project mainly involved analysis of isometric contractions and relaxations in isolated airways from guinea pigs and humans in organ baths.
    [Show full text]
  • The Bitter Taste Receptor Tas2r14 Is Expressed in Ovarian Cancer and Mediates Apoptotic Signalling
    THE BITTER TASTE RECEPTOR TAS2R14 IS EXPRESSED IN OVARIAN CANCER AND MEDIATES APOPTOTIC SIGNALLING by Louis T. P. Martin Submitted in partial fulfilment of the requirements for the degree of Master of Science at Dalhousie University Halifax, Nova Scotia June 2017 © Copyright by Louis T. P. Martin, 2017 DEDICATION PAGE To my grandparents, Christina, Frank, Brenda and Bernie, and my parents, Angela and Tom – for teaching me the value of hard work. ii TABLE OF CONTENTS LIST OF TABLES ............................................................................................................. vi LIST OF FIGURES .......................................................................................................... vii ABSTRACT ....................................................................................................................... ix LIST OF ABBREVIATIONS AND SYMBOLS USED .................................................... x ACKNOWLEDGEMENTS .............................................................................................. xii CHAPTER 1 INTRODUCTION ........................................................................................ 1 1.1 G-PROTEIN COUPLED RECEPTORS ................................................................ 1 1.2 GPCR CLASSES .................................................................................................... 4 1.3 GPCR SIGNALING THROUGH G PROTEINS ................................................... 6 1.4 BITTER TASTE RECEPTORS (TAS2RS) ...........................................................
    [Show full text]
  • G Protein-Coupled Receptors
    Alexander, S. P. H., Christopoulos, A., Davenport, A. P., Kelly, E., Marrion, N. V., Peters, J. A., Faccenda, E., Harding, S. D., Pawson, A. J., Sharman, J. L., Southan, C., Davies, J. A. (2017). THE CONCISE GUIDE TO PHARMACOLOGY 2017/18: G protein-coupled receptors. British Journal of Pharmacology, 174, S17-S129. https://doi.org/10.1111/bph.13878 Publisher's PDF, also known as Version of record License (if available): CC BY Link to published version (if available): 10.1111/bph.13878 Link to publication record in Explore Bristol Research PDF-document This is the final published version of the article (version of record). It first appeared online via Wiley at https://doi.org/10.1111/bph.13878 . Please refer to any applicable terms of use of the publisher. University of Bristol - Explore Bristol Research General rights This document is made available in accordance with publisher policies. Please cite only the published version using the reference above. Full terms of use are available: http://www.bristol.ac.uk/red/research-policy/pure/user-guides/ebr-terms/ S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2017/18: G protein-coupled receptors. British Journal of Pharmacology (2017) 174, S17–S129 THE CONCISE GUIDE TO PHARMACOLOGY 2017/18: G protein-coupled receptors Stephen PH Alexander1, Arthur Christopoulos2, Anthony P Davenport3, Eamonn Kelly4, Neil V Marrion4, John A Peters5, Elena Faccenda6, Simon D Harding6,AdamJPawson6, Joanna L Sharman6, Christopher Southan6, Jamie A Davies6 and CGTP Collaborators 1 School of Life Sciences,
    [Show full text]
  • SARS-Cov-2 Infected Pediatric Cerebral Cortical Neurons: Transcriptomic Analysis and Potential Role of Toll-Like Receptors in Pathogenesis
    International Journal of Molecular Sciences Article SARS-CoV-2 Infected Pediatric Cerebral Cortical Neurons: Transcriptomic Analysis and Potential Role of Toll-like Receptors in Pathogenesis Agnese Gugliandolo 1 , Luigi Chiricosta 1 , Valeria Calcaterra 2,3,† , Mara Biasin 4 , Gioia Cappelletti 4 , Stephana Carelli 5 , Gianvincenzo Zuccotti 2,4, Maria Antonietta Avanzini 6 , Placido Bramanti 1, Gloria Pelizzo 4,7 and Emanuela Mazzon 1,*,† 1 IRCCS Centro Neurolesi “Bonino-Pulejo”, Via Provinciale Palermo, Contrada Casazza, 98124 Messina, Italy; [email protected] (A.G.); [email protected] (L.C.); [email protected] (P.B.) 2 Department of Pediatrics, Ospedale dei Bambini “Vittore Buzzi”, 20154 Milano, Italy; [email protected] (V.C.); [email protected] (G.Z.) 3 Pediatrics and Adolescentology Unit, Department of Internal Medicine, University of Pavia, 27100 Pavia, Italy 4 Department of Biomedical and Clinical Sciences–L. Sacco, University of Milan, 20157 Milan, Italy; [email protected] (M.B.); [email protected] (G.C.); [email protected] (G.P.) 5 Pediatric Clinical Research Center Fondazione Romeo ed Enrica Invernizzi, University of Milan, 20157 Milan, Italy; [email protected] 6 Cell Factory, Pediatric Hematology Oncology Unit, Fondazione IRCCS Policlinico San Matteo, 27100 Pavia, Italy; [email protected] 7 Pediatric Surgery Unit, Ospedale dei Bambini “Vittore Buzzi”, 20154 Milano, Italy Citation: Gugliandolo, A.; Chiricosta, * Correspondence: [email protected] L.; Calcaterra, V.; Biasin, M.; † These authors contribute equally to the paper as senior author. Cappelletti, G.; Carelli, S.; Zuccotti, G.; Avanzini, M.A.; Bramanti, P.; Abstract: Different mechanisms were proposed as responsible for COVID-19 neurological symptoms Pelizzo, G.; et al.
    [Show full text]
  • Activation of Bitter Taste Receptors (Tas2rs) Relaxes Detrusor Smooth Muscle and Suppresses Overactive Bladder Symptoms
    www.impactjournals.com/oncotarget/ Oncotarget, Vol. 7, No. 16 Activation of bitter taste receptors (tas2rs) relaxes detrusor smooth muscle and suppresses overactive bladder symptoms Kui Zhai1,*, Zhiguang Yang1,*, Xiaofei Zhu2,*, Eric Nyirimigabo1, Yue Mi3, Yan Wang4, Qinghua Liu5, Libo Man2, Shiliang Wu3, Jie Jin3 and Guangju Ji1 1 National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing, China 2 Department of Urology, Beijing Jishuitan Hospital, Beijing, China 3 Department of Urology, National Research Center for Genitourinary Oncology, Peking University First Hospital and Institute of Urology, Beijing, China 4 Department of Gastroenterology, Peking University First Hospital, Beijing, China 5 Institute for Medical Biology, College of Life Sciences, South-Central University for Nationalities, Wuhan, China * Those authors have contributed equally to this work Correspondence to: Guangju Ji, email: [email protected] Correspondence to: Jie Jin, email: [email protected] Keywords: bitter taste receptors, chloroquine, detrusor smooth muscle, human, mouse, overactive bladder, Gerotarget Received: March 10, 2016 Accepted: March 20, 2016 Published: April 02, 2016 ABSTRACT Bitter taste receptors (TAS2Rs) are traditionally thought to be expressed exclusively on the taste buds of the tongue. However, accumulating evidence has indicated that this receptor family performs non-gustatory functions outside the mouth in addition to taste. Here, we examined the role of TAS2Rs in human and mouse detrusor smooth muscle (DSM). We showed that mRNA for various TAS2R subtypes was expressed in both human and mouse detrusor smooth muscle (DSM) at distinct levels. Chloroquine (CLQ), an agonist for TAS2Rs, concentration-dependently relaxed carbachol- and KCl-induced contractions of human DSM strips.
    [Show full text]
  • Oxygenated Fatty Acids Enhance Hematopoiesis Via the Receptor GPR132
    Oxygenated Fatty Acids Enhance Hematopoiesis via the Receptor GPR132 The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Lahvic, Jamie L. 2017. Oxygenated Fatty Acids Enhance Hematopoiesis via the Receptor GPR132. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:42061504 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Oxygenated Fatty Acids Enhance Hematopoiesis via the Receptor GPR132 A dissertation presented by Jamie L. Lahvic to The Division of Medical Sciences in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Developmental and Regenerative Biology Harvard University Cambridge, Massachusetts May 2017 © 2017 Jamie L. Lahvic All rights reserved. Dissertation Advisor: Leonard I. Zon Jamie L. Lahvic Oxygenated Fatty Acids Enhance Hematopoiesis via the Receptor GPR132 Abstract After their specification in early development, hematopoietic stem cells (HSCs) maintain the entire blood system throughout adulthood as well as upon transplantation. The processes of HSC specification, renewal, and homing to the niche are regulated by protein, as well as lipid signaling molecules. A screen for chemical enhancers of marrow transplant in the zebrafish identified the endogenous lipid signaling molecule 11,12-epoxyeicosatrienoic acid (11,12-EET). EET has vasodilatory properties, but had no previously described function on HSCs.
    [Show full text]
  • Supplemental Data
    Supplemental Figure 1. F2R S1PR1 GPR160 ELTD1 CD97 Supplemental Figure 2. A B brain heart lung liver kidney spleen testis skm Expression in mouse ssues glom rok Gprc5a Gapdh Human Protein Atlas RNAseq database Supplemental Figure 3. A Gprc5a Pdgfrb Merged CL CL Gprc5a CD31 Merged CL CL B C 1.4 * 1.2 mc 1 matrix 0.8 0.6 0.4 matrix 0.2 0 pod end 1 2 mes3 D Vector Gprc5a E 40 kD - - Gprc5a - acn Supplemental Figure 4. Control 12 month-old KO 12 month-old A B C D E F 1 2 0.8 * 1.5 score 0.6 m µ 1 0.4 0.2 Slits/ 0.5 Mesangial 0 0 Ctrl KO Ctrl KO Supplemental Figure 5. A B 1.2 Vector Gprc5a 1 * 0.8 0.6 * 0.4 * Normalized Density 0.2 0 pEGFR/tEGR pSmad/tSmad TGF-β1 C 1.8 siCON 1.6 siGprc5a * 1.4 * * 1.2 1 0.8 0.6 NormalizedDensity 0.4 0.2 0 pEGFR/tEGR pSmad/tSmad TGF-β1 Supplemental table 1. List of glomerulus-expressed GPCRs as detected by qPCR. Data shown as mean ± standard deviation (Glom=glomerulus, Rok=rest of kidney). GPCR Glom Rok Glom/Rok LPAR6 41892,11 ± 38478,89 1040,06 ± 1370,12 39,28 ELTD1 30275,64 ± 14085,26 33,23 ± 46,99 910,13 GPR116 24020,06 ± 7789,84 55,1 ± 47,75 434,96 PTH1R 15402,81 ± 17644,32 7521,01 ± 3264,57 1,05 CALCRL 14096,09 ± 3854,84 199,06 ± 222,52 69,81 HPRT1 13342,04 ± 10677,69 1824,77 ± 1767,23 6,31 S1PR5 9474,7 ± 10124,3 110,84 ± 29,54 84,48 LPHN2 8645,89 ± 914,74 256,04 ± 293,87 32,77 FZD1 8176,2 ± 4947,45 1321,97 ± 1311,91 5,18 CXCR4 7097,31 ± 4388,91 535,98 ± 640,28 12,24 GPR160 6446,59 ± 1550,07 4816,3 ± 5918,99 0,34 NPY1R 6177,74 ± 6282,76 209,64 ± 296,48 28,47 PTGER4 5323,66 ± 3789,51 179,13 ± 210 28,72 RXFP1
    [Show full text]